le métabolisme des acides gras et des ... · potentiellement impliquées dans la biosynthèse des...

LE MÉTABOLISME DES ACIDES GRAS ET DES

GLYCÉROPHOSPHOLIPIDES CHEZ LES

LYMPHOCYTES T HUMAINS

Thèse

Philippe-Pierre Robichaud

Doctorat en Microbiologie-Immunologie

Philosophiae Doctor (Ph.D.)

Québec, Canada

© Philippe-Pierre Robichaud, 2018

LE MÉTABOLISME DES ACIDES GRAS ET DES

GLYCÉROPHOSPHOLIPIDES CHEZ LES

LYMPHOCYTES T HUMAINS

Thèse

Philippe-Pierre Robichaud

Sous la direction de :

Eric Boilard, directeur de recherche

Marc E. Surette, codirecteur de recherche

iii

Résumé

Les acides gras (AG) polyinsaturés, tels que l’acide arachidonique (AA), sont précurseurs de

médiateurs lipidiques impliqués dans nombreux processus biologiques, mais aussi dans la

progression de certaines maladies inflammatoires et cancers. La biodisponibilité de ces AG

dépend des mécanismes de remodelage qui contrôlent leur incorporation et redistribution

dans les glycérophospholipides (GPL) ainsi que leur libération. L’inhibition de la

transacylase CoA-indépendante (CoA-IT) a démontré le potentiel du remodelage de l’AA

comme cible thérapeutique contre les maladies inflammatoires et prolifératives. Boilard et

Surette ont démontré que l’activité de la CoA-IT est induite chez les lymphocytes T humains

en prolifération et que son inhibition induit l’apoptose chez ces cellules, mais pas chez celles

au repos. Par contre, peu était connu sur les changements dans la composition en AG des

GPL suite à l’induction de la prolifération des lymphocytes T et encore moins sur l’identité

des enzymes impliquées.

Lors de cette thèse, nous avons premièrement mesuré la composition en AG des GPL chez

les lymphocytes T primaires humains au repos et en prolifération, ainsi que chez la lignée

lymphocytaire Jurkat. La prolifération des lymphocytes T induit des modifications majeures

dans la distribution des AG contenus dans les GPL et les Jurkat ressemble beaucoup plus aux

lymphocytes T en prolifération que ceux au repos. Au niveau du contenu en AG des GPL, la

plupart des AG ont subi une augmentation significative suite à l’induction de la prolifération,

mais ce sont les AG mono-insaturés qui ont subi l’augmentation la plus significative.

Contrairement aux autres AG, la masse de l’AA dans les GPL n’a pas été affectée suite à

l’induction de la prolifération, mais l’AA a subi une importante redistribution dans les

différents GPL. Cette redistribution est non seulement associée à l’induction de l’activité

CoA-IT, mais aussi à une importante induction de l’incorporation de l’AA. Nous avons aussi

démontré que les cellules T en prolifération et les cellules Jurkat ont une grande capacité

d’élongation et de désaturation des AG polyinsaturés de 18 et 20 carbones comparativement

aux cellules T au repos.

Afin d’expliquer ces changements, nous avons mesuré l’expression de plusieurs enzymes

potentiellement impliquées dans la biosynthèse des AG ainsi que dans le remodelage des AG

iv

polyinsaturés dans les GPL chez les cellules T au repos et en prolifération. Nous avons

démontré une induction de l’expression de l’acide gras synthase (FASN), de la stéaroyl-CoA

desaturase-1 (SCD1), des désaturases 1 et 2 (FADS1 et FADS2), de l’élongase 5 (ELOVL5)

ainsi que plusieurs acyl-CoA-synthétases (ACS), lysophospholipid acyltransférases

(LPLAT) et phospholipases A2 (PLA2) chez les cellules T en prolifération comparativement

au cellules T au repos. Il est connu que la SCD1 est nécessaire pour la prolifération de

plusieurs carcinomes. L’atténuation de la SCD1 chez la lignée Jurkat affecte la désaturation

de l’acide palmitique (16:0 vers 16:1 n-7), mais ne semble pas affecter la désaturation de

l’acide stéarique (18:0 vers 18:1 n-9) ni la prolifération cellulaire. La stéaroyl-CoA

désaturase-5 (SCD5) pourrait être un élément compensateur responsable du maintien de

l’acide oléique (18:1n-9) cellulaire et de la prolifération. Nous avons aussi démontré que

l’atténuation de l’ELOVL5 chez les cellules T en prolifération et les cellules Jurkat modifie

significativement le profil des AG mono-insaturés et polyinsaturés, et bloque efficacement

l’élongation des AG polyinsaturés de 18 et 20 carbones, mais n’a eu aucun effet sur la survie

et la prolifération. Pour ce qui est des enzymes potentiellement impliquées dans le

remodelage de l’AA, leur implication reste à être élucidée et l’identité de la CoA-IT n’est pas

encore connue.

Nous avons aussi démontré que l’utilisation d’un analogue de l’AA, l’AA-alcyne, comme

outil pour étudier le remodelage de l’AA et la production de médiateurs lipidiques nécessite

la prise de certaines précautions, car les enzymes cellulaires ne l’utilisent pas exactement

comme l’AA. Nous avons aussi publié une revue discutant des études récentes sur le contrôle

de la biodisponibilité des AG polyinsaturés pour la production de médiateurs lipidiques ainsi

que les aspects de ce métabolisme qui sont encore inconnus. Une meilleure compréhension

du contrôle de la distribution des AG polyinsaturés dans les GPL et de leurs biodisponibilités

pourrait mener à la découverte de nouvelles cibles thérapeutiques contre les maladies

inflammatoires et prolifératives.

v

Abstract Polyunsaturated fatty acids (PUFA), such as arachidonic acid (AA), are precursors of

bioactive lipid mediators involved in several biological processes, but also in the progression

of certain inflammatory diseases and cancers. The availability of these fatty acids (FA)

depends on the remodeling mechanisms that control their incorporation and redistribution in

glycerophospholipids (GPL) as well as their release. Inhibition of CoA-independent

transacylase activity (CoA-IT) has demonstrated the potential for the remodeling of AA as a

therapeutic target against inflammatory and proliferative diseases. Boilard and Surette

demonstrated that CoA-IT activity is induced in proliferating human T lymphocytes and that

its inhibition only induces apoptosis in proliferating T cells and not in resting cells. On the

other hand, little was known about the changes in the FA composition of the GPL following

the induction of the proliferation of the T lymphocytes and still less on the identity of the

enzymes involved.

In this thesis, we first measured GPL FA composition in resting and proliferating human

primary T lymphocytes as well as in the Jurkat lymphocyte cell line. The activation of the T

cells proliferation induces major changes in the FA profile contained in the GPL and the

Jurkat line resembles much more proliferating T lymphocytes than resting T cells. At the

level of the FA content of the GPL, the mass of most FA has increased significantly following

the induction of proliferation, but the monounsaturated FA has the most significant increase.

Unlike other FA, the total mass of AA in cellular GPL was not affected by T-cell proliferation

induction, but the AA was significantly redistributed in the different classes and subclasses

of GPL. This redistribution is not only associated with the induction of CoA-IT activity, but

also a significant induction of the incorporation of AA in GPL. We have also demonstrated

that proliferating T cells and Jurkat cells have a very high capacity for elongation and

desaturation of PUFA omega-3 and omega-6 of 18 and 20 carbons compared to resting cells.

To explain these observations, we measured the expression of several enzymes potentially

involved in the biosynthesis of FA and in the GPL remodeling in resting and proliferating T

cells. We have demonstrated an induction of the fatty acid synthase (FASN), the stearoyl-

CoA desaturase-1 (SCD1), the fatty acid desaturases 1 and 2 (FADS1 and FADS2), the fatty

vi

acid elongase 5 (ELOVL5) as well as several acyl-CoA synthetases (ACS), lysophospholipid

acyltransferases (LPLAT) and phospholipases A2 (PLA2) expression in proliferating T cells

compared to resting T cells. Many carcinoma cells require the stearoyl-CoA desaturase-1

(SCD1) to proliferate. The knockdown of SCD1 in Jurkat cell line affects the desaturation of

palmitic acid (16:0 to 16:1 n-7), but does not appear to affect the desaturation of stearic acid

(18:0 to 18:1 n-9) and cell proliferation. The stearoyl-CoA desaturase-5 (SCD5) could be a

compensating element responsible for maintaining cellular oleic acid (18:1 n-9) and

proliferation capacity. We also demonstrated that the ELVOL5 knockdown in proliferating

T cells and Jurkat cells significantly altered the profile of monounsaturated and

polyunsaturated FA and effectively blocks the elongation of 18 and 20 carbon PUFA, but

had no effect on survival and proliferation. For the enzymes potentially involved in the

remodeling of AA, their involvement remains to be elucidated and the identity of the CoA-

IT is not yet known.

We have also demonstrated that the use of an AA analogue, AA-alkyne, as a research tools

to study the remodeling of AA and the production of lipid mediators requires certain

precautions because it is not used by cellular enzymes exactly like AA. We also published a

review discussing recent studies on the control of the availability of PUFA to produce lipid

mediators in inflammatory cells as well as aspects that remain unknown. A better

understanding of the control of the distribution of PUFA in GPL and their availabilities could

lead to the discovery of new therapeutic targets for the treatment of inflammatory and

proliferative diseases.

vii

Table des matières Pages

Résumé ................................................................................................................................. iii Abstract .................................................................................................................................. v Liste des Tableaux ............................................................................................................... ix Liste des Figures .................................................................................................................... x Liste des abréviations ....................................................................................................... xiii Dédicace .............................................................................................................................. xiv Remerciements .................................................................................................................... xv Avant-propos ...................................................................................................................... xvi 1. CHAPITRE I: Introduction .......................................................................................... 1

1.1. Introduction générale ............................................................................................... 1 1.2. Les acides gras et leurs biosynthèses ....................................................................... 1 1.3. Les médiateurs lipidiques bioactifs et l’inflammation ........................................... 4 1.4. Les glycérophospholipides membranaires et leur métabolisme ........................... 7

1.4.1. Les glycérophospholipides membranaires ............................................................. 7 1.4.2. La biosynthèse et le remodelage CoA-dépendent des glycérophospholipides ....... 8 1.4.3. Le remodelage CoA-indépendant des glycérophospholipides ............................. 10 1.4.4. L’inhibition de la transacylase CoA-indépendante .............................................. 11 1.4.5. Les enzymes potentiellement impliquées dans le remodelage des

glycérophospholipides .......................................................................................... 13 1.5. La synthèse des acides gras, le remodelage des glycérophospholipides et la

prolifération cellulaire ............................................................................................ 18 1.6. La synthèse des acides gras et le remodelage des glycérophospholipides

chez les lymphocytes T ............................................................................................ 18 2. CHAPITRE II: Hypothèses et objectifs de recherche .............................................. 21 3. CHAPITRE III: Fatty acid remodeling in cellular glycerophospholipids

following the activation of human T cells .................................................................. 22 3.1. Résumé ..................................................................................................................... 23 3.2. Abstract .................................................................................................................... 24 3.3. Introduction ............................................................................................................. 25 3.4. Experimental procedures ....................................................................................... 27 3.5. Results ...................................................................................................................... 32 3.6. Discussion ................................................................................................................. 50 3.7. Supplemental data ................................................................................................... 55 3.8. Abbreviations .......................................................................................................... 58 3.9. Acknowledgements .................................................................................................. 59 3.10. References ................................................................................................................ 59

4. CHAPITRE IV: The role of Stearoyl-CoA desaturase in proliferation maintenance of human leukemic Jurkat T cells ........................................................ 65

4.1. Résumé ..................................................................................................................... 66 4.2. Abstract .................................................................................................................... 67 4.3. Introduction ............................................................................................................. 68 4.4. Materials and methods ........................................................................................... 69 4.5. Results ...................................................................................................................... 71 4.6. Discussion ................................................................................................................. 75

viii

4.7. Abbreviations .......................................................................................................... 77 4.8. Aknowledgements ................................................................................................... 77 4.9. References ................................................................................................................ 78

5. CHAPITRE V: Polyunsaturated fatty acid elongation and desaturation following activation of human T cells: ELOVL5 is responsible for fatty acid elongation ..... 81

5.1. Résumé ..................................................................................................................... 82 5.2. Abstract .................................................................................................................... 83 5.3. Introduction ............................................................................................................. 84 5.4. Materials and methods ........................................................................................... 86 5.5. Results ...................................................................................................................... 90 5.6. Discussion ............................................................................................................... 105 5.7. Supplemental data ................................................................................................. 110 5.8. Aknowledgements ................................................................................................. 113 5.9. References .............................................................................................................. 114

6. CHAPITRE VI: On the cellular metabolism of the click chemistry probe 19-alkyne arachidonic acid ............................................................................................. 117

6.1. Résumé ................................................................................................................... 118 6.2. Abstract .................................................................................................................. 119 6.3. Introduction ........................................................................................................... 120 6.4. Materials and methods ......................................................................................... 123 6.5. Results .................................................................................................................... 127 6.6. Discussion ............................................................................................................... 135 6.7. Supplemental data ................................................................................................. 141 6.8. Abbreviations ........................................................................................................ 148 6.9. Acknowledgements ................................................................................................ 148 6.10. References .............................................................................................................. 148

7. CHAPITRE VII: Polyunsaturated fatty acid–phospholipid remodeling and inflammation .............................................................................................................. 153

7.1. Résumé ................................................................................................................... 154 7.2. Abstract .................................................................................................................. 155 7.3. Introduction ........................................................................................................... 156 7.4. Turnover of polyunsatured fatty acids ................................................................ 157 7.5. Acyl-CoA synthetases ........................................................................................... 160 7.6. Lysophospholipid acyltransferases ...................................................................... 162 7.7. Phospholipases A2 ................................................................................................. 164 7.8. Conclusion .............................................................................................................. 165 7.9. Key Points .............................................................................................................. 165 7.10. Abbreviations ........................................................................................................ 166 7.11. Acknowledgements ................................................................................................ 166 7.12. Financial support and sponsorship ..................................................................... 166 7.13. Conflicts of interest ............................................................................................... 166 7.14. References .............................................................................................................. 166

8. CHAPITRE VIII: Discussion ................................................................................... 169 9. CHAPITRE IX: Conclusion et perspectives ........................................................... 179 10. Références. .................................................................................................................. 181

ix

Liste des Tableaux Page

Table 1.1. Les phospholipases A2 et leur dépendance en calcium ............................ 14 Table 1.2. La diversité des lysophospholipides acyltransférases .............................. 16 Table 3.1. List of primer sequences used in qPCR experiments for each

transcript ..................................................................................................... 31 Table 3.2. Gene expression of selected enzymes in resting and proliferating

T cells ............................................................................................................ 34 Table 3.3. Supplemental Table SI. Fatty acid composition glycerophospholipid

sub-classes of resting and proliferating T cells ......................................... 58 Table 4.1. Fatty acid composition of Jurkat cells with induced SCD1

knockdown ................................................................................................... 73 Table 5.1. List of primer sequences used in qPCR experiments and product

size in base pairs (bp) for each of the indicated transcripts .................... 87 Table 5.2. Gene expression of selected enzymes in resting and proliferating

T cells ............................................................................................................ 95

x

Liste des Figures Pages

Figure 1.1. Les voies métaboliques de la biosynthèse des acides gras saturés et mono-insaturés .............................................................................................. 2

Figure 1.2. Les voies métaboliques de la biosynthèse des acides gras polyinsaturés .................................................................................................. 3

Figure 1.3. Structures moléculaires de l’acide arachidonique (AA), l’acide éicosapentaénoïque (EPA) et de l’acide docosahexaénoïque (DHA) ........ 4

Figure 1.4. Les phases de l’inflammation et les voies métaboliques de la biosynthèse des médiateurs lipidiques impliqués dans l’inflammation. ... 5

Figure 1.5. La structure générale des glycérophospholipides ...................................... 7 Figure 1.6. Les voies métaboliques de la biosynthèse des glycérophospholipides ...... 8 Figure 1.7. Schéma illustrant la biosynthèse et le remodelage CoA-dépendant des

glycérophospholipides ................................................................................... 9 Figure 1.8. Schéma illustrant la biosynthèse et les remodelages CoA-dépendant

et CoA-indépendant des glycérophospholipides ....................................... 10 Figure 3.1. Schematic representation of fatty acid (FA) and glycerophospholipid

(GPL) biosynthesis and remodeling. .......................................................... 26 Figure 3.2. The mass content of fatty acids (A) and the fatty acid distribution (B)

in total glycerophospholipid from resting and proliferating T cells. ...... 33 Figure 3.3. Fatty acid synthase (FASN) and stearoyl-CoA desaturase 1 (SCD1)

expression in resting and proliferating T cells. ......................................... 35 Figure 3.4. Total fatty acid content (A) and the fatty acid distribution (B) of

glycerophospholipid (GPL) classes from different cell populations. ...... 36 Figure 3.5. The distribution of fatty acids within glycerophospholipid (GPL)

classes from different cell populations. ..................................................... 38 Figure 3.6. The mass content of fatty acids within glycerophospholipid (GPL)

classes of resting and proliferating T cells. ............................................... 40 Figure 3.7. The distribution of fatty acids between glycerophospholipid (GPL)

classes of resting and proliferating T cells. ............................................... 42 Figure 3.8. Arachidonic acid mass content in glycerophospholipid (GPL) classes

from different cell populations. .................................................................. 43 Figure 3.9. Arachidonic acid composition of glycerophospholipid (GPL)

sub-classes from resting and proliferating T cells. ................................... 44 Figure 3.10. Arachidonate-phospholipid remodeling in resting and proliferating

T cells. ........................................................................................................... 46 Figure 3.11. Arachidonoyl-CoA synthetase (A), lysophosphatidylcholine

acyltransferase (B), lysophosphatidylinositol acyltransferase (C) and lysophosphatidylethanolamine (D) activities in resting and proliferating human T cells. ....................................................................... 48

Figure 3.12. Lysophospatidylcholine acyltransferase 3 (LPCAT3), lysophospatidylinositol acyltransferase 1 (LPIAT1) and phospholipase A2 IVC (PLA2) expression in resting and proliferating T cells. .................................................................................... 49

Figure 3.13. Supplemental Figure SI. Cell cycle analysis of proliferating and quiescent (S-NS) T cells. .............................................................................. 55

xi

Figure 3.14. Supplemental Figure SII. Lipid phosphorus composition (A) and lipid phosphorus distribution (B) of glycerophospholipid (GPL) classes from resting and proliferating T cells. .......................................... 56

Figure 3.15. Supplemental Figure SIII. Arachidonic acid distribution between glycerophospholipid (GPL) classes for resting, proliferating and S-NS T cells and for Jurkat cells. ............................................................... 57

Figure 4.1. Activation of knockdown in Jurkat cell clones induces diminution in SCD1 protein expression. ........................................................................... 72

Figure 4.2. SCD1 knockdown and cell proliferation in Jurkat cell clones. ............... 74 Figure 5.1. The metabolic pathway of the n-6 and n-3 families of PUFA. ................ 85 Figure 5.2. The percent distribution of n-6 and n-3 fatty acids in resting T cells,

proliferating T cells and Jurkat cells following supplementation with different PUFA. ........................................................................................... 91

Figure 5.3. Protein expression of indicated enzymes. ................................................. 96 Figure 5.4. Jurkat cell fatty acid distribution following ELOVL5 knockdown

and supplementations with or without different PUFA. ......................... 97 Figure 5.5. Primary proliferating T cell fatty acid distribution following

ELOVL5 knockdown with and without supplementation with different PUFA. ........................................................................................... 99

Figure 5.6. HepG2 cell fatty acid distribution following ELOVL5 knockdown with and without supplementation with different PUFA. ..................... 101

Figure 5.7. The elongation of AA-d8 and EPA-d5 following ELOVL5 knockdown in Jurkat cells, proliferating primary T cells and HepG2 cells. ............ 103

Figure 5.8. Supplemental Figure SI. The mass content of n-6 and n-3 fatty acids in resting T cells, proliferating T cells and Jurkat cells following supplementation with different n-6 PUFA. ............................................. 110

Figure 5.9. Supplemental Figure SII. Proliferation of Jurkat cells measured by the CellTrace™ CFSE flow cytometry cell proliferation assay following ELOVL5 knockdown. .............................................................. 111

Figure 5.10. Supplemental Figure SIII. Proliferation of Jurkat cells measured by the Click-iT® EdU Alexa Fluor® 488 and FxCycle flow cytometry cell proliferation assay following ELOVL5 knockdown. .... 112

Figure 5.11. Supplemental Figure SIV. Annexin V / propidium iodide (PI) flow cytometry apoptosis assay. ....................................................................... 113

Figure 6.1. The structures of arachidonic acid and its clickable analogue 19-alkyne arachidonic acid. ...................................................................... 120

Figure 6.2. Schematic representation of cellular arachidonic acid incorporation and metabolism. ................................................................ 121

Figure 6.3. The incorporation and elongation of exogenous AA and AA-alk into Jurkat cells. ........................................................................................ 128

Figure 6.4. Arachidonate-phospholipid remodeling in Jurkat cells. ....................... 129 Figure 6.5. Eicosanoid biosynthesis by human platelets, neutrophils and

5-LO-transfected HEK293 cells stimulated in the presence of exogenous AA or AA-alk. ......................................................................... 131

Figure 6.6. (A) Autocrine stimulation of neutrophils with exogenous AA and AA-alk and (B) neutrophil chemoattractant activity of LTB4 and LTB4 alk. .................................................................................................... 134

xii

Figure 6.7. Supplemental Figure SI. Gas chromatograms of FAMEs prepared from Jurkat cells incubated for 2 hours in the absence (A) or presence (B) of 20 µM AA-alk. ................................................................. 141

Figure 6.8. Supplemental Figure SII. HPLC chromatograms of eicosanoids from human platelets stimulated with calcium ionophore A23187 in the presence of 10 µM AA (A) 10 µM AA-alk (B). ............................. 142

Figure 6.9. Supplemental Figure SIII. LC-MS/MS analysis of product identified as 12-HETE-alk. ....................................................................... 143

Figure 6.10. Supplemental Figure SIV. HPLC chromatograms of eicosanoids from human neutrophils stimulated with calcium ionophore A23187 in the presence of 10 µM AA (A and C) or 10 µM AA-alk (B and D). . 144

Figure 6.11. Supplemental Figure SV. MS/MS analysis of authentic LTB4. ............. 145 Figure 6.12. Supplemental Figure SVI. LC-MS/MS analysis of product

identified as LTB4-alk. .............................................................................. 146 Figure 6.13. Supplemental Figure SVII. LC-MS/MS analysis of product

identified as 5-HETE-alk. ......................................................................... 147 Figure 7.1. Schematic representation of glycerophospholipid (PL) biosynthesis,

fatty acid remodeling and lipid mediator production. ........................... 158

xiii

Liste des abréviations GPL Glycérophospholipides sn- Numérotation stéréospécifique (Stereospecific Numbering) AG Acide gras ACC Acétyl-CoA carboxylase FAS / FASN Acide gras synthase (“Fatty Acid Synthase”) SCD1 Stéaroyl-CoA desaturase 1 (Delta-9-désaturase) SCD5 Stéaroyl-CoA desaturase 5 (Delta-9-désaturase) FADS1 Delta-5-désaturase FADS2 Delta-6-désaturase ELOVL5 Élongase 5 (“Elongation of very long chain fatty acid protein 5”) ELOVL2 Élongase 2 (“Elongation of very long chain fatty acid protein 2”) 16:0 Acide palmitique 18:0 Acide stéarique 16:1 n-7 Acide palmitoléique 18:1 n-9 Acide oléique 18:1 n-7 Acide vaccénique 18:2 n-6 Acide linoléique 18:3 n-3 Acide alpha-linolénique 20:3 n-6 Acide dihomo-gamma-linolénique 20:4 n-3 Acide éicosatétraénoïque AA Acide arachidonique; acide éicosatétraénoïque; (20:4 n-6) EPA Acide éicosapentaénoïque (20:5 n-3) DHA Acide docosahexaénoïque (22:6 n-3) 5-LO 5-Lipoxygénase COX-1 Cyclooxygénase-1 COX-2 Cyclooxygénase-2 LTB4 Leucotriène B4 GPC / PC Phosphatidylcholine GPE / PE Phosphatidyléthanolamine GPI / PI Phosphatidylinositol GPS / PS Phosphatidylsérine Lyso-GPL Lyso-glycérophospholipides PAF Facteurs activant les plaquettes (Platelet-activating factor, PAF) GPAT 1-glycérol-3-phosphate acyltransférase LPAAT Acide lysophosphatidique acytransférase LPLAT Lysophospholipide acyltransférase LPLAT Lysophospholipides acyltransférase LPCAT Lysophosphatidylcholine acyltransférase LPEAT Lysophosphatidyléthanolamine acyltransférase LPIAT Lysophosphatidylinositol acyltransférase LPSAT Lysophosphatidylsérine acyltransférase ACS Acyl-CoA synthétase CoA-IT Coenzyme A-indépendante transacylase PLA2 Phospholipase A2 cPLA2 Phospholipase A2 calcium-dépendante du groupe IV iPLA2 Phospholipase A2 calcium-indépendante du groupe VI

xiv

À la mémoire de mon père, Jean-Pierre

Dédicace

xv

Remerciements

La présente thèse est le résultat de plusieurs années consacrées à cette recherche. Bien qu’il

y ait eu des défis à relever tout au long de ces années, le sujet de cette recherche m’a passionné

dès le début et m’a motivé à mettre tous les efforts et le temps nécessaires pour accomplir ce

projet.

La réalisation de cette thèse fut possible grâce à l’apport de plusieurs personnes à qui je

voudrais témoigner ma reconnaissance. Dans un premier temps, je tiens particulièrement à

remercier mon directeur de thèse, Dr. Éric Boilard et mon co-directeur de thèse, Dr. Marc

Surette, pour leur disponibilité, leur engagement, leurs judicieux conseils et leur passion qui

m’ont permis d’avancer dans ma recherche et de perfectionner mon travail.

Mes remerciements vont également au comité d’évaluation, l’évaluateur externe Dr. Richard

Bazinet ainsi que les évaluateurs interne Dr. Sylvain G Bourgoin et Dr. Nicolas Flamand

pour avoir accepté d’évaluer cette thèse.

Je désire aussi remercier les assistants de recherche du Dr. Surette, Nathalie Lévesque et

Jérémie Doiron, pour leur soutien technique au laboratoire. Je voudrais exprimer ma

reconnaissance à mes collègues, co-auteurs et amis, Katherine Boulay, Luc Boudreau,

Samuel Poirier, Anissa Belkaid, Eric Allain, Jean-Luc Jougleux, Jean Éric Munganyiki,

Maroua Mbarik, Natalie Lefort et Yasmina Néchadi pour leur soutien et leur contribution

essentielle à ce projet. Aussi, j’exprime ma reconnaissance envers tous ceux et celles qui ont

participé de près ou de loin à l’élaboration de cette recherche.

Enfin, je tiens à témoigner toute ma gratitude à ma conjointe, Mylène, ainsi qu’aux membres

de ma famille et à tous mes amis pour leur amour, leur compréhension et leur appui

inestimable. Je tiens aussi à saluer mon garçon, Charles-Émile, qui été une importante source

de motivation lors de l’écriture de cette thèse.

xvi

Avant-propos

CHAPITRE III: Fatty acid remodeling in cellular glycerophospholipids following the

activation of human T cells

Philippe Pierre Robichaud, Katherine Boulay, Jean Éric Munganyiki and Marc E Surette

• Cet article fut publié dans le journal J Lipid Res. 2013 Oct;54(10):2665-77.

• Les modifications apportées sont l’insertion des figures et des légendes directement

dans le texte des résultats et quelques modifications au niveau du formatage.

• Contribution des auteurs : P.P.R., K.B., et J.E.M. ont contribués aux travaux

expérimentaux. P.P.R., K.B., et M.E.S. ont contribués au développement du plan

expérimental. P.P.R. et M.E.S. ont écrit le manuscrit.

CHAPITRE IV: The role of Stearoyl-CoA desaturase in proliferation maintenance of

human leukemic Jurkat T cells

*Yasmina Néchadi, *Philippe Pierre Robichaud, Eric Boilard and Marc E Surette

* Co-premiers auteurs

• Cet article est en préparation et sera soumis sous peu.



• Contribution des auteurs : P.P.R. et Y.N. ont contribués aux travaux expérimentaux.

P.P.R., Y.N., E.B. et M.E.S. ont contribués au développement du plan expérimental et ont

écrit le manuscrit.

CHAPITRE V: Polyunsaturated fatty acid elongation and desaturation following

activation of human T cells: ELOVL5 is responsible for fatty acid elongation

*Philippe Pierre Robichaud, *Jean Éric Munganyiki, Eric Boilard and Marc E Surette

*Co-premiers auteurs

• Cet article a été soumis chez BBA Molecular and Cell Biology of Lipids le 26 Mai

2017, Manuscript Number : BBALIP-17-143.



xvii

• Contribution des auteurs : P.P.R. et J.E.M. ont contribués aux travaux expérimentaux.

P.P.R., J.E.M., E.B. et M.E.S. ont contribués au développement du plan expérimental et ont

écrit le manuscrit.

CHAPITRE VI: On the cellular metabolism of the click chemistry probe 19-alkyne

arachidonic acid

Philippe Pierre Robichaud, Samuel J Poirier, Luc H Boudreau, Jeremie A Doiron, David A

Barnett, Eric Boilard and Marc E Surette

• Cet article fut publié dans le journal J Lipid Res. 2016 Oct;57(10):1821-1830.



• Contribution des auteurs : P.P.R., S.J.P., L.H.B., J.A.D., D.A.B. ont contribués aux

travaux expérimentaux. P.P.R., E.B. et M.E.S. ont contribués au développement du plan

expérimental et ont écrit le manuscrit.

CHAPITRE VII: Polyunsaturated fatty acid–phospholipid remodeling and

inflammation

Philippe Pierre Robichaud and Marc E Surette

• Cet article fut publié dans le journal Current Opinion in Endocrinology, Diabetes &

Obesity. 22(2):112-118, April 2015.

• Les modifications apportées sont l’insertion de la figure et de sa légende directement

dans le texte et quelques modifications au niveau du formatage.

• Contribution des auteurs : P.P.R. et M.E.S. ont écrit la revue de littérature.

1

1. CHAPITRE I: Introduction 1.1. Introduction générale La prolifération cellulaire nécessite la biosynthèse de glycérophospholipides (GPL), qui sont

des composantes majeures des membranes et une importante réserve d’acides gras (AG)

polyinsaturés. Les AG polyinsaturés sont précurseurs de médiateurs lipidiques bioactifs

impliqués dans plusieurs processus biologiques, mais leurs implications dans l’inflammation

ne cessent d’être élucidés. L’inflammation est une importante réponse du système

immunitaire contre les pathogènes et pour la réparation des tissus endommagés lors de

blessures et d’infections. La progression de l’inflammation est grandement contrôlée par les

médiateurs lipidiques bioactifs produits à partir d’AG polyinsaturés, car certains sont de

puissantes molécules pro-inflammatoires tandis que d’autres sont anti-inflammatoires [1-6].

Cependant, l’inflammation cause une sensation de chaleur et de douleur qui est associée avec

une rougeur et un gonflement de la région atteinte qui peut même aboutir à la destruction et

à la perte de fonctions des tissus atteints lors d’inflammation excessive ou chronique. De

plus, les médiateurs lipidiques pro-inflammatoires sont généralement impliqués dans la

progression de certains cancers, réactions allergiques et maladies inflammatoires chroniques

comme l’asthme, l’arthrite rhumatoïde et l’athérosclérose [4-9]. C’est pourquoi vient

l’importance d’étudier comment les cellules régulent la biodisponibilité des AG

polyinsaturés pour ainsi contrôler la production de médiateurs lipidiques bioactifs. Certaines

enzymes qui contrôlent l’incorporation, le stockage et la libération des AG polyinsaturés

semblent aussi être des cibles intéressantes contre les maladies prolifératives.

1.2. Les acides gras et leurs biosynthèses Les AG sont des acides carboxyliques à chaine aliphatique qui diffèrent par leur nombre de

carbones et d’insaturations ainsi que par la position de ces dernières. Basé sur le nombre

d’insaturation, les AG peuvent être classés en trois grandes familles; les AG saturés qui ne

contiennent aucune insaturation, les AG mono-insaturés qui contiennent une seule

insaturation et les AG polyinsaturés qui contiennent plusieurs insaturations [10]. La

biosynthèse de novo des AG saturés débute par la synthèse de l’acide palmitique (16:0) qui

est catalysé par l’acétyl-CoA carboxylase (ACC) et l’acide gras synthase (FAS, Fatty Acid

2

Synthase) tandis que l’acide stéarique (18:0) est produit par l’élongation de 2 carbones à

l’acide palmitique (16:0) catalysée par une élongase (Figure 1.1.) [11, 12].

Figure 1.1. Les voies métaboliques de la biosynthèse des acides gras saturés et

mono-insaturés.

Les AG mono-insaturés, tels que l’acide palmitoléique (16:1 n-7) et l’acide oléique (18:1 n-

9), sont produits par la désaturation de l’acide palmitique (16:0) et de l’acide stéarique (18:0),

respectivement, tandis que l’acide vaccénique (18:1 n-7) est produit par l’élongation de

l’acide palmitoléique (16:1 n-7) [11-13] (Figure 1.1). Ces AG saturés et mono-insaturés

représentent les AG majoritairement retrouvés chez les cellules animales, mais ces AG

peuvent encore subir des élongations. Chez l’humain, on connait maintenant sept élongases

(ELOVL1-7) et deux delta-9-désaturases, la stéaroyl-CoA désaturase 1 (SCD1) et la stéaroyl-

CoA désaturase 5 (SCD5), qui sont responsables de la synthèse des AG saturés et mono-

insaturés à partir de l’acide palmitique [11, 14-16]. Plusieurs études ont démontré que les

élongases et les delta-9-désaturases ont des préférences envers les différents AG, mais la

plupart des études ayant vérifié la spécificité enzymatique de ces enzymes ont procédé à leur

surexpression dans des cellules d’origines non humaines.

Contrairement aux AG saturés et mono-insaturés, certains AG polyinsaturés sont essentiels

car ils ne peuvent pas être entièrement synthétisés par l’organisme et doivent être obtenus

par l’alimentation. La majorité des AG polyinsaturés peuvent être divisée en deux familles,

les omega-3 et les omega-6, selon la position de leur première liaison double à partir du bout

méthyle [10]. Par contre, il est important de noter que l’organisme peut quand même faire

certaines conversions en procédant à l’élongation, à la désaturation et à la béta-oxydation des

AG polyinsaturés omega-3 et omega-6 [17] (Figure 1.2).

3

Figure 1.2. Les voies métaboliques de la biosynthèse des acides gras polyinsaturés.

Les gènes de la delta-5-désaturase qui catalyse de désaturation de l’acide linoléique (18:2 n-

6) et de l’acide alpha-linolénique (18:3 n-3) et de la delta-6-désaturase qui catalyse de

désaturation de l’acide dihomo-gamma-linolénique (20:3 n-6) et de l’acide

éicosatétraénoïque (20:4 n-3) (Figure 1.2.), FADS1 et FADS2 respectivement, sont les seules

enzymes connues pour catalyser ces activités enzymatiques [16, 17]. Pour ce qui est des

élongases impliquées dans la synthèse des AG polyinsaturés, plusieurs études ont démontré

que l’élongase 5 (ELOVL5) est impliquée dans l’élongation des AG polyinsaturés oméga-3

et oméga-6 de 18 et 20 carbones tandis que l’élongase 2 (ELOVL2) est plutôt impliquée dans

l’élongation des AG polyinsaturés oméga 3 et oméga-6 de 20 et 22 carbones [11, 16-21].

Cependant, encore une fois, les études qui ont vérifié la spécificité enzymatique des élongases

ont procédé à leur surexpression chez différents types cellulaires d’origine non humaines.

4

Les AG polyinsaturés les plus étudiés sont l’acide arachidonique (AA, 20:4 n-6), l’acide

éicosapentaénoïque (EPA, 20:5 n-3) et l’acide docosahexaénoïque (DHA, 22:6 n-3) (Figure

1.3), car ils sont d’importants précurseurs de médiateurs lipidiques bioactifs.

Figure 1.3. Structures moléculaires de l’acide arachidonique (AA), l’acide

éicosapentaénoïque (EPA) et de l’acide docosahexaénoïque (DHA).

L’AA est un AG polyinsaturé oméga-6 composé de vingt carbones et de quatre liaisons

doubles tandis que l’EPA et le DHA sont des AG polyinsaturés oméga-3 composés de vingt

et vingt-deux carbones et de cinq et six liaisons doubles, respectivement (Figure 1.3). Les

liaisons doubles de ces AG sont sujettes à l’oxydation enzymatique et non-enzymatique

pouvant ainsi produire des centaines de molécules lipidiques différentes. Certaines de ces

molécules sont très bien connues due aux diverses réponses biologiques qu’elles engendrent,

car ces molécules agissent généralement comme molécules de signalisation cellulaire.

1.3. Les médiateurs lipidiques bioactifs et l’inflammation Le processus d’une réaction inflammatoire aïgue normale est caractérisé par la succession de

trois phases qui mènent à une guérison spontanée en nécessitant aucun traitement. La phase

d’initiation et la phase aigüe de l’inflammation, qui sont caractérisées par la formation d’un

œdème et par le recrutement et l’activation de neutrophiles afin de tuer les pathogènes, est

suivie par une phase de résolution où d’autres types de cellules immunitaires, telles que les

monocytes et les macrophages, sont recrutés et activés afin d’éliminer les débris par

phagocytose et de réparer les tissus endommagés [1, 2, 22] (Figure 1.4).

5

Figure 1.4. Les phases de l’inflammation et les voies métaboliques de la

biosynthèse des médiateurs lipidiques impliqués dans l’inflammation.

(Tirée de Serhan et al 2014 [3]).

Les médiateurs lipidiques produits à partir de l’AA, à l’exception des lipoxines et de certaines

prostaglandines, sont généralement pro-inflammatoires, tandis que ceux produits à partir des

AG polyinsaturés oméga-3 sont généralement anti-inflammatoires et plutôt impliqués dans

la résolution de l’inflammation (Figure 1.4.). Les effets bénéfiques sur la santé et la

progression de maladies inflammatoires chroniques associés à la consommation de poissons

ou d’huiles de poisson riches en AG polyinsaturés oméga-3 semblent dues à un ratio d’AG

omega-3 par rapport aux AG oméga-6 qui pousse la production de médiateurs lipidiques vers

des médiateurs anti-inflammatoires [23, 24].

En général, l’AA et le EPA sont précurseurs d’éicosanoïdes, un groupe de molécules

lipidiques bioactives produites par l’oxygénation d’AG polyinsaturés de 20 carbones. Plus

précisément, l’AA (20:4 n-6) peut être converti en leucotriènes, prostaglandines,

6

thromboxanes et lipoxines tandis que l’EPA (20:5 n-3) peut être converti en médiateurs tel

que les résolvines de la série E. Pour sa part, le DHA (22:6 n-3) est le précurseur de

docosanoïdes incluant les résolvines de la série D, les protectines et les marésines (Figure

1.4.). Ces médiateurs lipidiques bioactifs ont des récepteurs présents à la surface de différents

types cellulaires et induisent diverses réponses physiologiques grandement impliquées dans

l’inflammation telles que la migration cellulaire (chimiotactisme), la vasodilatation, la

bronchoconstriction, la perméabilisation vasculaire, la phagocytose et bien d’autres [1, 3-5,

25, 26].

Plusieurs voies métaboliques complexes sont impliquées dans la production de médiateurs

lipidiques à partir des AG polyinsaturés et ces modifications moléculaires sont catalysées par

de nombreuses enzymes notamment des lipoxygénases, des cyclooxygénases, des hydrolases

et des synthétases [4, 25, 27-29]. Les voies les plus connues sont celles de la 5-lipoxygénase

(5-LO) et des cyclooxygénases (COX-1 et 2) qui catalysent la bioconversion de l’AA en

leucotriènes et en prostaglandines, respectivement. Puisque ces médiateurs lipidiques sont

impliqués dans la douleur et dans plusieurs maladies inflammatoires, de nombreux groupes

de recherche ciblent ces voies métaboliques depuis plusieurs années et quelques

médicaments contre la douleur et les maladies inflammatoires telles que l’arthrite rhumatoïde

et l’asthme ont été développés. Par exemple, l’Aspirine® (acide acétylsalicylique), le

Celebrex® (célécoxib) et le Vioxx® (rofécoxib) sont des inhibiteurs des cyclooxygenases

utilisés contre la douleur et l’arthrite rhumatoïde [30]. Le Zyflo® (zileuton) est un inhibiteur

de la 5-lipoxygénase tandis que l’Accolate® (zafirlukast) et le Singulair® (montelukast) sont

des antagonistes du récepteur de peptidoleucotriènes (Cyst-LTR1) utilisés contre les allergies

et l’asthme [8]. Les plus récentes découvertes ont démontré l’importance des lipoxines, des

résolvines, des protectines et des marésines, qui sont aussi produites par les lipoxygénases et

la cyclooxygénase-2 (COX-2) acétylée, dans la résolution de l’inflammation pour un retour

éventuel de l’homéostasie [1-3, 26].

La biosynthèse des médiateurs lipidiques dérivés d’AG polyinsaturés est grandement

contrôlée par l’expression et l’activation des lipoxygénases et cyclooxygénases suite à une

stimulation cellulaire adéquate, mais aussi par la biodisponibilité des différents AG

7

polyinsaturés [25, 27-29, 31, 32]. Au niveau cellulaire, les AG polyinsaturés sont

généralement entreposés dans les GPL membranaires et doivent être libérés avant d’être

converti en médiateurs lipidiques, ce qui contrôle grandement leur biodisponibilité cellulaire.

Lorsque certaines cellules immunitaires sont stimulées adéquatement, les AG polyinsaturés

sont libérés des GPL pour ensuite être convertis en différents médiateurs lipidiques

dépendamment des enzymes qui sont exprimées dans ces cellules [25, 27, 31]. Par exemple,

lorsque les neutrophiles sont activés et que le calcium intracellulaire augmente, une

phospholipase A2 (PLA2) et la 5-LO sont activés et transloquent du cytosol vers les

membranes péri-nucléaires afin de libérer et convertir l’AA en leucotriène B4 (LTB4) et

autres dérivés de l’AA. Le LTB4 est un chimio-attractant puissant causant le recrutement

supplémentaire de neutrophiles et d’autres types de cellules au site inflammatoire [31, 33].

En fait, la biodisponibilité des AG polyinsaturés dépend de l’équilibre entre l’activité de

l’incorporation et de la libération des AG polyinsaturés des GPL qui est régulée par plusieurs

enzymes impliquées dans le métabolisme des GPL. Cependant, on connait encore très peu

sur les mécanismes qui permettent le changement des classes de médiateurs lipidiques lors

de la résolution de l’inflammation.

1.4. Les glycérophospholipides membranaires et leur métabolisme 1.4.1. Les glycérophospholipides membranaires

Les GPL sont des composantes majeures de la bicouche lipidique des membranes cellulaires,

mais aussi une importante réserve de molécules lipidiques bioactives. La structure générale

des GPL est constituée d’une molécule centrale de glycérol liée à deux AG en position sn-1

et sn-2 et à un groupement phosphate lié à une tête polaire en position sn-3 (Figure 1.5) [34].

Figure 1.5. La structure générale des glycérophospholipides.

8

On retrouve généralement une grande diversité de GPL au niveau des membranes cellulaires,

incluant des classes et des sous-classes selon la nature moléculaire de la tête polaire présente

en sn-3 et du type de liaison entre l’AG et le glycérol en position sn-1, respectivement. Les

quatre principales classes de GPL contenant des AG polyinsaturés sont les

phosphatidyléthanolamines (PE), les phosphatidylcholines (PC), les phosphatidylinositols

(PI) et les phosphatidylsérines (PS) ayant respectivement des molécules d’éthanolamine, de

choline, d’inositol et de sérine comme têtes polaires. La présence d’une liaison ester en sn-1

correspond à la sous-classe des diacyl-GPL (1-acyl-2-acyl-GPL), la présence d’une liaison

éther correspond aux alkyl-GPL (1-alkyl-2-acyl-GPL) et la présence d’une liaison vinyl éther

correspond aux alk-enyl-GPL (1-alk-1-enyl-2-acyl-GPL) qui sont couramment appelés les

plasmalogènes [34]. De plus, l’identité des AG présents en position sn-1 et sn-2 augmente

encore plus la diversité des espèces moléculaires de GPL présents dans les membranes

biologiques, car on retrouve une vingtaine d’AG associés aux GPL membranaires.

1.4.2. La biosynthèse et le remodelage CoA-dépendent des glycérophospholipides

Les GPL sont tous synthétisés de novo à partir de l’acide phosphatidique, un GPL ayant un

atome d’hydrogène comme tête polaire, mais les différentes classes et sous-classes de GPL

n’ont pas la même composition en AG. L’acide phosphatidique est synthétisé à partir du

glycérol-3-phosphate par la voie de Kennedy. (Figure 1.6).

Figure 1.6. Les voies métaboliques de la biosynthèse des glycérophospholipides.

Les enzymes responsables de l’acylation du glycérol-3-phosphate (GPAT, glycerol-3-

phosphate acyltransferase) et les enzymes responsables de l’acylation des acides

lysophosphatidiques (LPAAT, lysophosphatidic acid acyltransferase) incorporent

majoritairement des AG saturés et mono-insaturés. Cependant, il est très bien connu que les

GPL représentent une importante réserve d’AG polyinsaturés contrairement à l’acide

phosphatidique. En fait, les GPL synthétisés de novo à partir de l’acide phosphatidique

9

subissent une maturation (un remodelage) par l’action de plusieurs enzymes telles que des

phospholipases, des acyltransférases et des transacylases afin d’atteindre un certain équilibre

et une certaine diversité moléculaire [35, 36]. Depuis la fin des années 1950, Lands a publié

une série d’articles sur la caractérisation du remodelage CoA-dépendant des AG en position

sn-2 des GPL. Cette voie consiste premièrement à l’hydrolyse d’un GPL par une

phospholipase A2 produisant ainsi un 2-lyso-GPL et un AG libre. Ensuite, un autre AG libre,

préalablement activé par une acyl-CoA synthétase (ACS), peut être transféré à ce lyso-GPL

par une CoA-dépendante 2-lyso-GPL acyltransférase (LPLAT) (Figure 1.7).

Figure 1.7. Schéma illustrant la biosynthèse et le remodelage CoA-dépendant des

glycérophospholipides.

Ce mécanisme, couramment appelé le cycle de Lands, est responsable de l’incorporation

d’AG polyinsaturés à longues chaines en position sn-2 des GPL et donc, de l’asymétrie des

AG en position sn-1 par rapport à la position sn-2 des GPL [35, 37-42]. Plusieurs PLA2, ACS

et LPLAT ayant différentes caractéristiques et spécificités enzymatiques sont maintenant

connues, mais d’autres activités enzymatiques sont responsables du contrôle de la

distribution des AG dans les différentes classes et sous-classes de GPL.

10

1.4.3. Le remodelage CoA-indépendant des glycérophospholipides

Plusieurs études ont démontré la spécificité de l’incorporation et du remodelage de l’AA dans

les différentes classes et sous-classes de GPL chez plusieurs types cellulaires humains et

animales. Kramer et Deykin ont été les premiers à caractériser le remodelage de l’AA en

étudiant l’incorporation et la redistribution (remodelage) de l’AA marqué ([3H]AA) chez des

plaquettes humaines en 1983 [43]. Il était connu qu’une grande proportion de l’AA cellulaire

était associée avec la sous-classe des plasmalogènes (1-alk-1-enyl-GPE), mais que l’[3H]AA

était initialement majoritairement incorporé dans le GPC et très peu dans la sous-classe des

plasmalogènes chez ces cellules. En effet, ils ont démontré que des préparations

membranaires de plaquettes, préalablement marquées à l’[3H]AA, étaient capable de

transférer l’[3H]AA à des lyso-plasmalogènes exogènes en absence de CoA, d’ATP, de Ca2+

et de Mg2+ et que le 1-acyl-2-lyso-GPE et le 1-alky-2-lyso-GPC pouvaient aussi être utilisés

comme substrats accepteurs contrairement aux lyso-GPS, lyso-GPI [43, 44]. (Figure 1.8)

Figure 1.8. Schéma illustrant la biosynthèse et les remodelages CoA-dépendant et

CoA-indépendant des glycérophospholipides.

11

Il fut ensuite démontré que lorsque des macrophages alvéolaires de lapin sont marqués à

l’[3H]AA, l’AA est rapidement incorporé dans la classe des GPC suivit d’un transfert vers la

classe des GPE jusqu'à l’obtention d’un certain équilibre. Suite à la séparation et l’analyse

de la radioactivité associée aux différentes sous-classes des GPC et des GPE, ils ont démontré

que l’incorporation de l’AA est spécifique aux diacyl-GPC et le remodelage est caractérisée

par le transfert spécifique de l’AA vers les sous-classes 1-acyl-GPE, 1-alk-1-enyl-GPE et 1-

alkyl-GPC. Ces expériences ont aussi été réalisées avec l’acide linoléique (18:2, n-6), mais

aucun remodelage ne fut décelé [45]. De plus, des préparations microsomales de

macrophages alvéolaires de lapin sont capables de transférer le 20:5 n-3, le 20:3 n-6, le 22:4

n-6 et le 22:6 n-3 à partir de diacyl-GPC vers les 1-alkyl-GPC de façon CoA-indépendante

contrairement à l’acide palmitique (16:0), l’acide stéarique (18:0) et l’acide oléique (18:1n-

9) [46, 47].

Ces études ont mené à la description d’une voie de remodelage des AG polyinsaturés

caractérisée par la présence d’une transacylase CoA-indépendante (CoA-IT) (Figure 1.6). Il

a été proposé que le remodelage de l’AA pourrait être impliqué dans le contrôle de la

biodisponibilité de l’AA et de lyso-PAF (1-alkyl-2-lyso-GPC) lorsque certaines cellules

inflammatoires sont stimulées [47-51]. Par contre, la CoA-IT n’a jamais été isolée et

identifiée due à une très grande sensibilité aux détergents, mais des inhibiteurs ont été

développés afin d’évaluer l’implication du remodelage de l’AA sur la distribution de l’AA

et la synthèse de médiateurs lipidiques comme les leucotriènes, les prostaglandines et de

facteurs activant les plaquettes (Platelet-activating factor, PAF).

1.4.4. L’inhibition de la transacylase CoA-indépendante

Depuis les années 1990, plusieurs études ont porté sur l’inhibition de l’activité CoA-IT.

Premièrement, deux inhibiteurs, le SK&F98625 et le SK&F45905, qui agissent selon un

mécanisme de compétition de substrat sans inhiber l’incorporation initiale de l’AA, ont été

développés et testés avec succès chez des neutrophiles humains [52]. Ensuite, un composé

préalablement utilisé comme agent antinéoplasique, l’édelfosine (ET-18-O-CH3), qui est

structuralement très similaire aux 1-alkyl-2-lyso-PC ayant un groupement o-méthyl non-

hydrolysable en position sn-2, inhibe l’activité CoA-IT chez la lignée leucocytaire HL-60 par

12

compétition de substrats [53]. En analysant l’effet de ces trois inhibiteurs sur la distribution

de la masse de l’AA dans les GPL des cellules HL-60 par GC/MS, il a été démontré que

l’inhibition de la CoA-IT est non seulement associée à un ralentissement du remodelage de

l’AA marqué ([3H]AA), mais cause aussi une redistribution de la masse de l’AA dans les

classes et sous-classes de GPL. Cette redistribution de masse semble être spécifique à l’AA,

car la distribution de l’acide linoléique (18:2 n-6) et la distribution relative des classes de

GPL n’ont pas été altérées par l’inhibition de la CoA-IT [54]. L’aspect le plus intéressant est

que l’inhibition de la CoA-IT diminue la capacité de production d’éicosanoïdes et de PAF

suite à la stimulation de certaines cellules inflammatoires [55]. Par contre, l’incubation

prolongée de lignées cellulaires avec ces trois inhibiteurs, contrairement à des analogues

inactifs, causent une diminution de la prolifération et de la survie cellulaire due à l’induction

de l’apoptose [53] [54] [56] [57].

Il a été proposé que la perturbation du contrôle de la distribution cellulaire de l’AA soit à

l’origine de l’influence qu’a l’inhibition de la CoA-IT sur la prolifération et la mort cellulaire

induite par l’apoptose. Cette hypothèse fut apportée car l’inhibition de la CoA-IT est associée

avec une augmentation de la quantité d’AA libre dans le milieu extracellulaire et la sensibilité

à l’induction de l’apoptose par l’inhibition de la CoA-IT est significativement diminuée

lorsque les cellules HL-60 sont déplétées en AA [56]. De plus, lors de l’incubation de ces

cellules en présence de différents AG libres, seulement les AG de 20 carbones ont induit une

diminution significative de la prolifération de façon dose dépendante (10-100 µM). Cette

induction de l’apoptose ne semble pas être causée par le métabolisme de l’AA en

éicosanoïdes car l’inhibition de la 5-lipoxygénase et des cyclooxygénases fut sans effet sur

la diminution de la prolifération induite par l’AA et les inhibiteurs de la CoA-IT. Cette

induction de l’apoptose fut plutôt associée à la synthèse de céramides qui sont connus pour

induire l’apoptose [56].

Une diminution du remodelage de l’AA a été démontré lorsque l’apoptose de cellules BMMC

“Bone Marrow-Derived Mast Cells” de souris est induite par la déplétion de cytokines (“stem

cell factor” (SCF) et IL-3). La quantité d’AA libre, contrairement aux autres AG, corrèle

avec le pourcentage de cellules apoptotiques et pourtant les activités arachidonoyl-CoA

13

synthétases et LPLAT n’étaient pas altérées. Cependant, l’induction de l’apoptose chez ces

cellules fut associée avec une diminution de l’activité CoA-IT résultant en une diminution de

la quantité d’AA dans les GPE et une augmentation de la quantité d’AA dans les GPC, dans

les lipides neutres et libres [58].

Il fut ensuite proposé que le mécanisme d’action la CoA-IT pouvait être similaire à celui de

la lécithine-cholestérol acyltransférase, ce mécanisme consisterait à la formation d’un

intermédiaire CoA-IT et AA par la formation d’une liaison covalente entre l’AA et la CoA-

IT et d’une libération d’un lyso-GPL. Ensuite, l’AA lié de façon covalente à la CoA-IT

pourrait être transféré à un GPL accepteur [59]. En se basant sur ce mécanisme, deux

inhibiteurs irréversibles de la CoA-IT, le ß-Lactam SB 212047 et SB 216754, ont été

développés. En plus d’inhiber la production d’éicosanoïdes et de PAF suite à des stimulations

cellulaires in vitro, ces inhibiteurs bloquent aussi des phénomènes inflammatoires comme

l’œdème et l’infiltration cellulaire in vivo [59].

1.4.5. Les enzymes potentiellement impliquées dans le remodelage des

glycérophospholipides

L’incorporation des AG polyinsaturés dans les GPL ainsi que leur remodelage, qui

nécessitent les activités PLA2, ACS, LPLAT et CoA-IT (Figure 1.8.), contrôlent grandement

la biodisponibilité des AG polyinsaturés pour la production de médiateurs lipidiques

bioactifs. Les expériences d’inhibition de la CoA-IT ont démontré que le remodelage des AG

polyinsaturés est une cible thérapeutique potentiellement intéressante contre les maladies

inflammatoires et prolifératives. Cependant la CoA-IT n’a jamais été isolée ni identifiée étant

donné sa sensibilité aux détergents, mais plusieurs PLA2, ACS et LPLAT ayant différentes

spécificités enzymatiques et caractéristiques sont maintenant connues. Certaines PLA2

membranaires ont des caractéristiques et des spécificités enzymatiques intéressantes qui nous

laissent penser que la CoA-IT pourrait bien être une PLA2 [60].

Les phospholipases A2

L’activité PLA2, qui catalyse l’hydrolyse des AG en position sn-2 des GPL, est nécessaire à

la production des 1-acyl-2-lyso-GPC et 1-acyl-2-lyso-GPI qui sont requis pour

14

l’incorporation des AG polyinsaturés dans les GPL. De plus, l’activité PLA2 est aussi

nécessaire pour la production des 1-alkyl-2-lyso-GPC, 1-acyl-2-lyso-GPE et des 1-alkenyl-

2-lyso-GPE qui sont les accepteurs des AG polyinsaturés lors de la transacylation CoA-

indépendante, ainsi que pour la libération des AG polyinsaturés pour la production de

médiateurs lipidiques bioactifs (Figure 1.3) [31, 61, 62]. Les gènes de près d’une trentaine

de PLA2, ayant différentes caractéristiques et spécificités enzymatiques, sont maintenant

connus et ces enzymes peuvent être classifiées selon l’homologie de leurs séquences

(groupes), leurs localisations cellulaires, leur poids moléculaire et leurs dépendances pour le

calcium [63]. Les PLA2 les plus connues sont les PLA2 sécrétées, qui sont caractérisées par

leur faible poids moléculaire, leur sécrétion dans le milieu extracellulaire et leur dépendance

envers le calcium qui est de l’ordre des mM, et les PLA2 intracellulaires qui sont soit calcium-

dépendantes dans l’ordre du µM ou calcium-indépendantes [64] [63, 65, 66]. (Tableau 1)

Table 1.1. Les phospholipases A2 et leur dépendance en calcium Phospholipases A2 Groupes Synonymes Dépendance en calcium

Sécrétées IB, IIA, IIC-F, III, V, X XII

sPLA2 mM

Cytosoliques IVA IVB IVC

IVD-F

cPLA2 α cPLA2 β cPLA2 γ

cPLA2 δ, ε et ζ

µM µM

- µM

Calcium-indépendantes VIA VIB

iPLA2 β, PNPLA9 iPLA2 γ, PNPLA8

- -

Les PLA2 cytosoliques (groupe IV) contiennent six membres, mais la cPLA2α (IVA) est la

plus étudiée due à sa grande spécificité envers les GPL contenant l’AA et par son implication

dans la libération de l’AA pour la production de médiateurs lipidiques bioactifs [31, 33, 67].

La PLA2 IVA, ainsi que les PLA2 IVB, IVD, IVE et IVF qui sont moins connues, contiennent

un domaine C2 permettant leur translocation du cytosol vers les membranes lors de

stimulation cellulaire adéquate qui augmente la concentration du calcium intracellulaire [68-

70]. Les PLA2 IVB, IVD, IVE et IVF ont beaucoup moins d’activité lysophospholipase et

phospholipase A2 et elles n’ont pas de spécificité envers les GPL contenant l’AA [68-70]. La

cPLA2γ (IVC) est classée dans la catégorie des PLA2 cytosoliques par rapport à l’homologie

de sa séquence avec celle de la PLA2 IVA, mais elle est membranaire et calcium-

indépendante. La cPLA2 IVC catalyse plusieurs activités différentes, car en plus de catalyser

15

la libération de l’AA des GPL, elle catalyse aussi les activités lysophospholipase,

lysophospholipide dismutase (LPLase/transacylase) et une faible activité CoA-IT [71, 72].

Les PLA2 calcium-indépendantes (iPLA2β VIA et iPLA2γ VIB) font partie de la famille des

‘Patatin-like phospholipase domain-containing protein’ (PNPLA) composée de neuf gènes

[73]. La PLA2 VIA contient des séquences ankyrines qui sont généralement impliquées dans

l’interaction protéine-protéine et cette enzyme semble être active sous forme de tétramère.

Plusieurs isoformes produits par l’épissage alternatif de la PLA2 VIA ont été découverts et

les isoformes ankyrines non-actifs semblent être responsables d’une modulation négative de

l’activité de la iPLA2 VIA en formant des tétramères avec les formes actives [74, 75]. Pour

ce qui est de la iPLA2 VIB, elle est calcium-indépendante, elle contient une séquence de

localisation peroxysomale en C-terminal et elle est généralement associée aux membranes

des peroxysomes [76]. Ces enzymes ne semblent pas avoir de spécificité de substrat envers

les GPL contenant l’AA et semble surtout responsable du remodelage général des GPL. De

plus, l’inhibition de la PLA2 VIA par le bromoenol lactone (BEL) diminue l’incorporation

de l’AA dans les GPL en inhibant probablement la production des lyso-GPL accepteurs de

l’AA [61, 77, 78].

Cependant, les autres membres de la famille des PNPLA, qui ne semblent pas avoir d’activité

phospholipase A2, ont des activités transacylases en utilisant différents substrats donneurs et

accepteurs que ceux utilisés par la CoA-IT [79]. De plus, plusieurs autres PLA2 beaucoup

moins connues, incluant quatre acétylhydrolases de facteurs activateurs de plaquettes (PAF-

AH VIIA, VIIB, VIIIA et VIIIB), une PLA2 lysosomale (LPLA2 XV), une famille de

PLA/AT (PLA2 XVI) et la peroxyredoxin-6 (PRDX6) pourraient bien être impliquées, mais

la caractérisation de leur activité enzymatique est beaucoup moins complète [60, 65, 66, 80].

Plusieurs études ont démontré l’implication des PLA2 dans la progression des maladies

inflammatoires et prolifératives [31, 33, 62, 81-85]

Les acyl-CoA synthétases

L’activité acyl-CoA synthétase (ACS), qui catalyse la formation d’une liaison thioester entre

une molécule de Coenzyme A et le groupement carboxylique des AG, est indispensable pour

l’incorporation des AG dans les GPL ainsi qu’aux réactions d’élongation et de désaturation

16

des AG qui sont catalysées sur des acyl-CoA. Environ 26 ACS, ayant différentes spécificités

enzymatiques, distributions tissulaires et localisations subcellulaires, sont maintenant

connues [86]. Cependant, ce sont les ACSL (long-chain acyl-CoA synthases) qui sont

connues pour agir sur les AG d’intérêts pour cette étude (12-22 carbones). Il y a cinq ACSL

(ACSL1, 3, 4, 5, 6) qui sont exprimées chez les humains, mais l’ACSL4 est l’ACS la plus

étudiée et semble être la seule ACS à avoir une très grande préférence pour l’AA [87].

Plusieurs études récentes démontrent que l’ACSL4 est impliquée dans le contrôle de la

biodisponibilité de l’AA pour la production de médiateurs lipidiques bioactifs et que son

expression est importante pour la prolifération et la survie de plusieurs types de cellules

cancéreuses [86-96]. Très peu est connu sur l’implication des autres ACS sur l’incorporation

de l’AA, la biodisponibilité de l’AA et la prolifération cellulaire. Sauf qu’il fut démontré que

l’ACSL1 est induite lorsque les monocytes humains sont différentiés en macrophages de type

inflammatoire (M1) et joue un rôle important dans la disponibilité de l’AA pour la synthèse

de médiateurs lipidiques bioactifs produit à partir de l’AA [97]. Dans cette étude, ils ont aussi

démontré que la suppression sélective myéloïde de l'ACSL1 chez les souris diabétiques de

type 1 atténue le phénotype inflammatoire des monocytes et des macrophages diabétiques et

prévient l'athérosclérose accélérée par le diabète [97].

Les lysophospholipides acyltransférases

Les lysophospholipides acyltransférases (LPLAT) sont les enzymes qui incorporent les acyl-

CoA en position sn-2 des 2-lyso-GPL en catalysant la formation d’une liaison ester. Deux

familles de LPLAT, ayant différentes spécificités enzymatiques envers les AG et les lyso-

GPL, sont maintenant connues (Tableau 2) [98, 99].

Table 1.2. La diversité des lysophospholipides acyltransférases

Lysophospholipides acyltransférases Familles et synonymes LPCAT1 AGPAT9 / AYTL2 LPCAT2 LysoPAF-AT / AYTL1 LPCAT3 MBOAT5 LPCAT4 MBOAT2 / LPEAT2 LPEAT1 MBOAT1 LPEAT2 AGPAT7 / AYTL3 LPIAT1 MBOAT7

17

La famille des 1-acylglycérol-3-phosphate acyltransférase (AGPAT) comprend trois

membres ayant une activité LPLAT (LPCAT1/AGPAT9, LPCAT2/ LysoPAFAT/AYTL1 et

LPEAT2/AGPAT7). La LPCAT1 est une enzyme calcium-indépendante qui préfère le 18:2-

CoA et le 18:3-CoA comme AG et les lyso-GPC comme GPL accepteur, mais elle a aussi

une activité lyso-PAF acétyltransférase pour produire le PAF. Cette enzyme semble être

majoritairement impliquée dans la production des GPL contenus dans le surfactant

pulmonaire [100]. La LPCAT2 préfère l’AA-CoA et les 1-alkyl-2-lyso-GPC et elle a aussi

une activité lyso-PAF acétyltransférase chez certaines cellules inflammatoires.

Contrairement à la LPCAT1, son activité est calcium-dépendante et elle peut être induite par

les lipopolysaccharides (LPS) chez les macrophages [101]. La LPEAT2 est majoritairement

exprimée au niveau du cerveau et elle a été démontrée pour avoir des activités LPEAT,

LPCAT et LPSAT en utilisant préférentiellement le 16:0-CoA, le 18:0-CoA et le 18:1-CoA,

mais elle peut aussi utiliser l’AA-CoA. L’atténuation de l’expression de la LPEAT2 par des

ARN interférents chez les cellules HEK293T a diminué l’activité d’acylation des 1-acyl-GPE

et 1-alk-1-enyl-GPE [102].

La famille des “membrane-bound O-acyltransferases” (MBOAT) comprend quatre membres

ayant une activité LPLAT (LPEAT1/MBOAT1, LPCAT3/MBOAT5, LPCAT4/MBOAT2 et

LPIAT1/MBOAT7). La LPCAT3 a une activité LPCAT, LPEAT et LPSAT et utilise

préférentiellement des AG polyinsaturés comme l’AA-CoA et le 18:2-CoA [103]. Des

expériences d’ARN interférents chez la lignée de cellules mélanomes B16 ont démontré une

diminution de l’activité endogène LPCAT, LPEAT et LPSAT avec l’AA-CoA et une

diminution de la masse de l’AA en position sn-2 des GPC, GPE et GPS [104]. La LPEAT1

et la LPCAT4 ont une activité LPEAT, LPCAT et LPSAT avec une très grande préférence

pour le 18:1-CoA [98, 99, 103]. La LPIAT1 est pour sa part la seule enzyme ayant une très

grande spécificité envers les lyso-GPI et l’AA-CoA [103].

Cependant, l’implication des différentes LPLAT dans le contrôle de la biodisponibilité de

l’AA et des autres AG polyinsaturés pour la production de médiateurs lipidiques ainsi que

l’effet de l’atténuation de ces gènes sur la prolifération et la survie cellulaire sont encore très

peu connus.

18

1.5. La synthèse des acides gras, le remodelage des glycérophospholipides

et la prolifération cellulaire La prolifération cellulaire est un processus de base, mais la prolifération non contrôlée ou

non voulue est impliquée dans les cancers et dans plusieurs maladies auto-immunes et

inflammatoires chroniques. Il est très bien connu que la biosynthèse de novo des AG saturés

et mono-insaturés est induite chez les cellules cancéreuses pour supporter la biosynthèse

accrue de GPL membranaires et de nouvelles membranes [105-111]. L’acétyl-CoA

carboxylase (ACC), l’acide gras synthase (FAS), la stéaroyl-CoA désaturase 1 (SCD1) et la

stéaroyl-CoA désaturase 5 (SCD5) semblent tous être des cibles thérapeutiques intéressantes,

car l’inhibition de ces enzymes affectent la prolifération cellulaire et induisent l’apoptose

chez plusieurs types de cancers [107, 108, 110-121]. Au niveau de l’intégrité membranaire,

les propriétés physiques des AG insaturés influence grandement la fluidité, ce qui affecte

l’organisation moléculaire des membranes et les fonctions membranaires [122-125]. Le

remodelage des GPL, qui est responsable de l’incorporation et de la redistribution des AG

polyinsaturés dans les GPL, contribue aussi au maintien de l’intégrité et de l’homéostasie des

membranes [123-125]. Plusieurs PLA2 ont été démontrées être impliquées dans la

progression de différents types de cancers et maladies inflammatoires [126-128], mais très

peu est connu sur l’expression et l’implication des ACS, LPLAT, FADS et ELOVL dans la

prolifération cellulaire et encore moins dans la production de médiateurs lipidiques.

1.6. La synthèse des acides gras et le remodelage des

glycérophospholipides chez les lymphocytes T Les lymphocytes T sont responsables de la reconnaissance spécifique des antigènes et

coordonnent la réponse immunitaire cellulaire adaptative par des interactions intercellulaires

et la libération de cytokines. En fait, il y a deux types majeurs de lymphocytes T, les

lymphocytes T auxiliaires (CD4) et les lymphocytes T cytotoxiques (CD8), qui jouent des

rôles très différents. Les lymphocytes T auxiliaires CD4 (Th1 et Th2) ont des récepteurs qui

reconnaissent des antigènes présentés par des cellules présentatrice d’antigènes, telles que

les cellules dendritiques et macrophages, qui ont ingéré des pathogènes. Une fois activées,

les lymphocytes T auxiliaires Th1 aident les phagocytes à détruire les pathogènes, les

lymphocytes T auxiliaires Th2 induisent la production d’anticorps par les lymphocytes B et

19

les lymphocytes T cytotoxiques activées tuent des cellules infectées par des virus [129]. Par

contre, les lymphocytes T sont aussi impliqués dans la progression de certaines maladies

inflammatoires, auto-immunes et prolifératives comme le lupus, l’arthrite rhumatoïde,

certaines leucémies et certains lymphomes [130-134].

Les lymphocytes T primaires sont un modèle cellulaire intéressant pour étudier la

prolifération cellulaire, car ces cellules peuvent être facilement obtenues à partir de sang

périphérique et leur prolifération peut facilement être induite. L’ajout seul d’un agent

mitogène comme la Concanavaline A (ConA) et la phytohémagglutinine (PHA) ou

l’activation du récepteur spécifique aux lymphocytes T (T-Cell Receptor, TCR) par

l’anticorps monoclonal OKT3 (anti-CD3) en présence de monocytes et d’interleukine-2 (IL-

2) permettent l’induction d’une prolifération accrue. La prolifération de lymphocytes T

purifiés par sélection négative peut aussi être induite par des billes anti-CD3/anti-CD28 en

présence d’IL-2. L’activation du récepteur TCR induit le passage des cellules du stade G0

(repos) vers la phase G1 du cycle cellulaire et l’ajout d’un facteur de croissance comme l’IL-

2 induit la progression du cycle cellulaire par l’induction de la synthèse de l’ADN [135-137].

Il est bien connu que la transition du stade G0 vers la phase G1 du cycle cellulaire est associée

avec une induction de nombreux de gènes associés à la biosynthèse des GPL et que cette

biosynthèse est très active lors de la progression des autres phases du cycle cellulaire jusqu’à

la phase de la mitose caractérisée par la division cellulaire. [138].

Quelques études précédentes ont porté sur le métabolisme des AG et des GPL chez les

lymphocytes T humains au repos et en prolifération. Une augmentation significative de la

proportion de l’acide palmitique (16:0) et des AG mono-insaturés ainsi qu’une diminution

de la proportion de l’AA furent démontrées par rapport aux autres AG au niveau des AG

totaux et dans les différentes classes de GPL suite à une activation des lymphocytes T

primaires humains par le PHA de 48-72h [139, 140]. La stimulation des lymphocytes T

humains avec le PHA pendant 48-72h fut aussi démontrée d’induire l’élongation des AG

18:2 n-6, 18 :3 n-3 et l’AA et d’induire les activités delta-5, delta-6 et delta-9 désaturases

[141].

20

Boilard et Surette ont démontré une très grande accélération du remodelage de l’AA entre

les classes de GPL quand la prolifération des lymphocytes T primaires humains était induite

par l’agent mitogène ConA seul ou par la combinaison de l’OKT3 (anti-CD3) et IL-2,

comparativement aux lymphocytes au repos. De plus, l’activité enzymatique de la CoA-IT

dans des préparations membranaires de lymphocytes T en prolifération fut significativement

induite comparativement aux préparations membranaires de lymphocytes T au repos par la

mesure de l’acylation CoA-indépendante d’un 1-alkyl-2-lyso-GPC marqué. Le résultat le

plus intéressant fut que l’inhibition de la CoA-IT avec le SK&F 98625 et le SK&F 45905

chez les lymphocytes T au repos et en prolifération a induit seulement l’apoptose chez les

lymphocytes T en prolifération [137]. Donc, le remodelage CoA-indépendant de l’AA est

très accéléré lors de la prolifération cellulaire et pourrait être une cible thérapeutique contre

les maladies de nature prolifératives.

Cependant, les changements dans la composition molaire en AG des différentes classes et

sous-classes des GPL qui ont lieu suite à l’induction de la prolifération cellulaire des

lymphocytes primaires humains ne sont pas encore bien caractérisés. De plus, l’identité des

enzymes impliquées dans ces modifications ne sont pas encore bien identifiées autant au

niveau de la biosynthèse des AG qu’au niveau de l’incorporation et du remodelage des AG

polyinsaturés dans les GPL. L’identification des enzymes impliquées pourrait mener à la

découverte de cibles contre les maladies inflammatoires et prolifératives. L’étude de ces

phénomènes et l’identification des enzymes impliquées font parties des buts de cette thèse.

21

2. CHAPITRE II: Hypothèses et objectifs de recherche Les hypothèses de cette recherche sont que l’induction de la prolifération des lymphocytes T

humains est associée à une biosynthèse des GPL et à une induction du remodelage des AG

polyinsaturés qui résulte en une modification de la composition et la distribution des AG dans

les classes et sous-classes de GPL. Ces changements lipidiques sont associés à une

modification de l’expression de certains gènes associés au métabolisme des AG et des GPL.

L’expression de certains gènes ciblés est indispensable à la prolifération et la survie cellulaire

des lymphocytes T en prolifération et chez la lignée lymphocytaire Jurkat.

Le premier objectif de cette recherche est de mesurer l’effet de l’induction de la prolifération

des lymphocytes T primaires sur la distribution et la composition des AG dans chaque classe

et sous-classe de GPL. Le deuxième objectif est de mesurer l’expression génique et

protéinique de plusieurs enzymes, qui sont potentiellement impliquées dans les changements

observés, chez les cellules T au repos et en prolifération. Le troisième objectif est d’évaluer

l’effet de l’atténuation de l’expression de certains gènes, qui sont potentiellement impliqués

dans la synthèse des AG ainsi que dans l’incorporation et le remodelage des AG polyinsaturés

dans les GPL, sur la distribution et la composition en AG des GPL ainsi que sur le rythme de

prolifération et la survie cellulaire.

22

3. CHAPITRE III: Fatty acid remodeling in cellular

glycerophospholipids following the activation of human T cells

Philippe Pierre Robichaud, Katherine Boulay, Jean Éric Munganyiki and Marc E Surette

The Journal of Lipid Research. 2013 Oct;54(10):2665-77.

Contribution des auteurs

P.P.R., K.B., et J.E.M. ont contribués aux travaux expérimentaux. P.P.R., K.B., et M.E.S. ont

contribués au développement du plan expérimental. P.P.R. et M.E.S. ont écrit le manuscrit.

23

3.1. Résumé Lors de cette première publication, nous avons évalué le métabolisme des acides gras (AG)

et des glycérophospholipides (GPL) chez les lymphocytes T primaires humains au repos et

en prolifération. Des changements significatifs ont été mesurés dans la composition et la

distribution des AG dans les GPL suite à la stimulation de la prolifération des lymphocytes

T humains. La distribution des AG dans les GPL des lymphocytes T en prolifération est très

similaire à celle observé chez la lignée cellulaire lymphocytaire T Jurkat et lorsque

lymphocytes T en prolifération ont été incubés en absence de stimulus et ont arrêté de

proliférer, la distribution des AG dans les GPL est redevenue très similaire aux lymphocyte

T au repos. Le contenu cellulaire en AG saturés et mono-insaturés fut aussi significativement

augmenté chez les lymphocytes T en prolifération comparativement aux cellules T au repos,

ce qui est associé avec une induction de l’expression de l’acide gras synthase (FASN) et la

stéaroyl-CoA désaturase 1 (SCD1). De plus, la redistribution de l’AA cellulaire dans les GPL

est très différente des autres AG et fut étroitement associée avec une induction des

remodelages CoA-dépendant et CoA-indépendant. En ce sens, une induction de l’expression

de plusieurs acyl-CoA synthétases, lysophospholipides acyltransférases et phospholipases A2

a été mesurée suite à l’induction de la prolifération des lymphocytes T humains. Des

augmentations significatives des activités arachidonoyl-CoA synthétase,

lysophosphatidylcholine acyltransférase et lysophosphatidylinositol acyltransférase ont aussi

été mesurées. Ces résultats suggèrent que ces voies métaboliques, qui sont activées chez les

lymphocytes T humains en prolifération, semblent être des changements fondamentaux

associés avec la prolifération cellulaire.

24

3.2. Abstract Changes in fatty acid and glycerophospholipid metabolism associated with cell cycle entry

are not fully understood. In this study, fatty acid-glycerophospholipid remodeling was

investigated in resting and proliferating primary human T cells. Significant changes were

measured in the composition and distribution of fatty acids in glycerophospholipids

following receptor activation of human T cells. The fatty acid distribution of proliferating T

cells was very similar to that of the human Jurkat T cell line and when the stimulus was

removed from proliferating T cells, they stopped proliferating and the fatty acid distribution

largely reverted back to that of resting T cells. The cellular content of saturated and

monounsaturated fatty acids was significantly increased in proliferating cells which was

associated with an induction of fatty acid synthase and stearoyl-CoA desaturase-1 gene

expression. Additionally, cellular arachidonate was redistributed in glycerophospholipids in

a distinct pattern that was unlike any other fatty acid. This redistribution was associated with

an induction of CoA-dependent and CoA-independent remodeling. Accordingly, significant

changes in the expression of several acyl-CoA synthetases, lysophospholipid acyltransferases

and phospholipases A2 were measured. Overall, these results suggest that metabolic

pathways are activated in proliferating T cells that may represent fundamental changes

associated with human cell proliferation.

25

3.3. Introduction Cellular proliferation is an essential process for the regeneration of tissues and for certain

cellular responses such as host defense. However, uncontrolled or unwanted cell proliferation

is implicated in the progression of cancers and inflammatory and autoimmune diseases. In a

proliferative state, cells need to synthesize many cellular constituents, including membranes,

before cell division can occur. Glycerophospholipids (GPL) are the major structural lipid

component of cellular membranes, but they are present as a very large diverse group of

molecular species. Membrane GPL are divided into major classes based on the nature of the

polar head group linked to the sn-3 position of the glycerol moiety, and are further divided

into three sub-classes based on the nature of the link between the glycerol and the fatty acid

(FA) in the sn-1 position. Finally, the large numbers of combinations of different FA present

in positions sn-1 and sn-2 of GPL greatly increases the molecular diversity of membranes

GPL. The degree of unsaturation of FA associated with GPL is known to affect membrane

fluidity and many biological processes, however the distribution of these FA is not

homogeneous nor static (1-3).

During membrane biogenesis associated with cell proliferation, FA biosynthesis is enhanced

and the FA incorporated into positions sn-1 and sn-2 of phosphatidic acid during de novo

biosynthesis of GPL (Kennedy Pathway) are generally saturated (SFA) and monounsaturated

(MUFA) (2). However, cellular GPL usually have PUFA acylated to the sn-2 position and

this incorporation of PUFA in GPL only occurs after de novo GPL biosynthesis. This

remodeling of GPL species, termed the Lands Cycle, is characterized by the hydrolysis of

SFA or MUFA from the sn-2 position of GPL by a phospholipase A2 (PLA2) followed by a

reacylation with PUFA by a reaction catalyzed by a lysophospholipid acyl-CoA transferase

(LPLAT) (2, 4) (see Figure 3.1). Free FA are activated by an acyl-CoA synthetase (ACSL)

to produce the required acyl-CoA. Several PLA2, LPLAT and ACSL having different

characteristics and substrate specificities have been recently discovered and their differential

expression is likely responsible for the diversity of GPL molecular species in different tissues

(5-11).

26

The FA distribution in GPL may also be modulated by a CoA-independent transacylase

(CoA-IT) (2). This transacylation is specific for highly unsaturated long chain PUFA like

arachidonic acid (AA, 20:4n-6) and is characterized by their direct transfer from diacyl-

phosphatidylcholine (PC) species to 1-acyl-phosphatidylethanolamine (PE), 1-alk-enyl-PE

and 1-alkyl-PC species without requirements of co-factors, Mg2+ or Ca2+ (2, 12-18). The

protein responsible for the CoA-independent remodeling has not been identified; however

compounds that inhibit its activity have been described (19-23). Figure 3.1 summarizes the

main paths by which cellular PUFA are incorporated into and remodeled within membrane

GPL.

Figure 3.1. Schematic representation of fatty acid (FA) and glycerophospholipid

(GPL) biosynthesis and remodeling.

During de novo biosynthesis of GPL by the Kennedy pathway, saturated and mono-

unsaturated fatty acids are mainly incorporated in position sn-1 and sn-2 of the newly

synthetized GPL. These FA are biosynthetized by fatty acid synthase (FASN) and

stearoyl-CoA desaturase-1 (SCD-1). PUFA are incorporated into GPL by Lands Cycle

remodeling which is characterized by the hydrolysis of SFA or MUFA from the sn-2

position of GPL by a phospholipase A2 (PLA2) followed by a reacylation with PUFA

The Lands cycle (CoA-dependent Remodeling)

1-radyl-2-acyl-GPL

Free FA

AA

•  1-acyl-2-AA-GPC 1-acyl-2-AA-GPE 1-alkenyl-2-AA-GPE 1-alkyl-2-AA-GPC

2-lyso-GPL Acyl-CoA

PUFA (AA)

1-acyl-2-lyso-GPE 1-alkenyl-2-lyso-GPE 1-alkyl-2-lyso-GPC

•  1-acyl-2-AA-GPI

LPLAT

Membrane Glycerophospholipids

Glycerophospholipids biosynthesis (Kennedy pathway)

Fatty acids biosynthesis (FASN and SCD-1)

1-radyl-2-PUFA-GPL

PLA2

ACSL

PLA2

1-acyl-2-lyso-GPC

(CoA-independent Remodeling)

CoA-IT

27

by a lysophospholipid acyl-CoA transferase (LPLAT). Free FA must be activated by

an acyl-CoA synthetase (ACSL) to produce the acyl-CoA required for its incorporation

in the 2-lyso-glycerophospholipid (2-lyso-GPL) previously produced by the PLA2.

Highly unsaturated long chain PUFA, like arachidonic acid (AA, 20:4n-6), which are

mainly incorporated into 1-acyl-glycerophosphatidylcholine (GPC) in the Lands cycle,

are directly transferred to other specific GPL species (1-acyl-

glycerophosphatidylethanolamine (GPE), 1-alk-enyl-GPE and 1-alkyl-GPC) by the

CoA-independent transacylase (CoA-IT). This CoA-independent remodeling is

involved in the maturation of GPL and the distribution of the AA in GPL.

There are still many unanswered questions regarding PUFA metabolism when cells enter the

cell cycle, including the nature of changes in the composition of GPL and which of the several

newly-discovery ACSL, LPLAT and PLA2 isoforms may be implicated. In this study, the

composition and remodeling of FA in GPL classes and sub-classes and the expression of

some key enzymes believed to be associated with PUFA metabolism were measured in

primary human T-lymphocytes, a model in which resting non-proliferating cells can be

induced to enter the cell cycle.

3.4. Experimental procedures Reagents. Lymphocyte Separation Medium was purchased from Wisent (St-Bruno, Qc.).

Human recombinant IL-2, boron trifluoride (14% in methanol), phospholipase C from

Bacillus cereus, 2,3,4,5,6-pentafluorobenzyl bromide (PFB-Br) and N,N-

diisopropylethylamine (DIPA) were from Sigma-Aldrich (Oakville, ON). The

[3H]arachidonic acid and [14C]arachidonoyl-CoA were purchased from American

Radiolabeled Chemicals Inc. (St. Louis, MO). The 1-stearoyl-2-hydroxy-sn-glycero-3-

phosphocholine and 1-stearoyl-2-hydroxy-sn-glycero-3-phosphoethanolamine were from

Avanti Polar Lipids (Alabaster, AL). The L-α-lysophosphatidylinositol was from EMD

Millipore (Billerica, MA). The 1,2, diheptadecanoyl-PC was from Biolynx (Brockville, ON).

The Silica gel G TLC plates (20 x 20 cm, 250 microns) were from Analtech (Newark, DE).

The acetylation kit (acetic anhydride/pyridine) was from Alltech (Deerfield, IL). The anti-

CD3 was purified from the OKT3 hybridoma clone (ATCC) culture medium using HiTrap

28

Protein G HP columns from GE Healthcare Bio-Sciences (Uppsala, Sweden). Fatty acid

methyl esters (FAME) and free FA were from Nu-check Prep (Elysian, MN) and

octadeuterated arachidonic acid (5, 8, 11, 14-eicosatetraenoic-5, 6, 8, 9, 11, 12, 14, 15-d8

acid, 2H8-AA) was from Cayman Chemical (Ann Arbor, MI). FITC-labelled anti-CD3 was

from Beckman Coulter (Mississauga, ON). The human CD3 positive and human T cell

negative selection kits were from STEMCELL Technologies Inc. (Vancouver, BC). The anti-

FASN (ab96863), anti-SCD1 (ab19862) and anti-LPCAT2 (ab88871) were from Abcam

(Toronto, ON). The anti-LPCAT3 (PAG531Hu01) was from USCN (Wuhan Hubei, China)

and the anti-LPIAT1 (NBP1-69610) was from Novus (Oakville, ON). The anti-PLA2 IVC

(C15308) was from Assay Biotechnology Company (Sunnyvale, CA) and the horseradish

peroxidase-conjugated anti-β-actin (A3854) was from Sigma-Aldrich (Oakville, ON).

Lymphocyte isolation and culture. Human peripheral blood mononuclear cells (PBMC) were

obtained from the buffy coat following centrifugation of heparinized blood from healthy

donors on lymphocyte separation medium as previously described (24). PBMC were

incubated in RPMI 1640 with 10% FBS (1x106 cells/ml) with or without 1 µg/ml anti-CD3

for 3 days at 37°C in a 5% CO2 atmosphere. IL-2 (20 U/ml) was added to anti-CD3-treated

cells at 24h post-incubation to induce the T-cell proliferation (25). In some experiments, the

IL-2 and anti-CD3 were removed from proliferating cells on day 4 (S-NS) and cells were

incubated for another 3 days without stimulation. After incubations primary T cells were then

purified with the EasySep® Human CD3 Positive Selection Kit.

Flow cytometry analysis. The purity of T cells (>99%) was determined by flow cytometry

(CytomicsTM FC 500, Beckman Coulter, Mississauga, ON) using FITC-labelled anti-CD3.

Cell cycle analysis was performed by flow cytometry as previously described (26).

Pulse-labeling of cells with [3H] arachidonic acid (remodeling). After 3 days of incubation

with or without stimulation, cells were pulse labeled by incubating in 1 ml of culture medium

containing (1µCi [3H]AA/107cells) for 30 min at 37ºC. Cells were then washed twice with

culture medium and resuspended in their original incubation medium. T cells were then

purified at 0, 4 or 24 hours, the lipids were extracted, the GPL classes and sub-classes were

29

separated as described below and the radioactivity was measured by liquid scintillation

counting (Beckman Instruments LS 5000 CE) (25).

Lipid extraction and fractionation. Cellular lipids were extracted (27), GPL classes were

separated by HPLC (28) and fractions containing PE, PC and

phosphatidylinositol/phosphatidylserine (PI/PS) were collected using elution times

determined with GPL standards. The GPL subclasss were processed and separated as

previously described (18) and the FA mass was measured in each fraction by GC-MS as

described below.

Fatty acid analysis. For measurement of FA mass in GPL classes, diheptadecanoyl-PC was

added to each HPLC fraction as an internal standard. The different fractions were saponified

with 0.5M KOH in methanol (100oC - 15 min) and fatty acid methyl esters (FAME) were

prepared by adding 14% BF3 in methanol (100oC-10 min). FAME were extracted in hexane

and quantified by GC-FID using a 30-m trace-FAME column on a Thermo Trace gas

chromatograph (Thermo Electron Corporation, Mississauga, ON) (29). Authentic FAME

standards were used for the identification of FA peak retention times and for standard curve

quantification.

To have more sensitivity for the measurement of unsaturated FA mass in PC and PE sub-

classes, penta-fluorobenzyl esters of FA were prepared and measured by negative ion

chemical ionization gas chromatography mass spectrometry (GC/MS) (18) using a Polaris Q

mass spectrometer (Thermo) using the internal standard 2H8-AA. The negative chemical

ionization ion trap scan was 200-400 uma, 1 ml/min of methane (220°C) was used as carrier

and 0.3 ml/min of helium as damping gas. Authentic free FA standards were also derivatized

and used as standard curve for quantification.

Lipid phosphorus assay. Lipid phosphorus in the different GPL fractions was measured as

previously described (30). GPL fractions were collected using sodium acetate buffer 25 mM

(pH 7.4) in HPLC solvents to avoid phosphate in these experiments.

30

Enzyme activity assays. Resting and proliferating T cells at day 3 were sonicated (3 x 10s at

40% of amplitude) in sonication buffer (250 mM sucrose, 50 mM tris-HCl (pH 7.4), 1 mM

EDTA and 20% glycerol) and centrifuged at 1500 xg 10 min to pellet unbroken cells. Proteins

were quantified by the modified Lowry assay (31). Acyl-CoA synthetase activity was

measured as previously described (32) with minor modifications. Briefly, 50 µg of cell lysate

protein in 100µl of a solution containing 100 mM Tris-HCl (pH 8), 20 mM MgCl2, 10 mM

ATP, 1 mM CoA, 1 mM 2-ME and 10 µM of [3H]AA (0.5 µCi) was incubated at 37°C for

10 min. The reactions were stopped by adding 2.25 ml 2-propanol/heptane/2M sulfuric acid

(40:10:1, v/v/v). Phase separation was obtained after addition of 1.5 ml heptane and 1 ml

water. The aqueous phases were collected and extracted twice with heptane containing 4

mg/ml linoleic acid, and the radioactivity in the aqueous phase and in the dried heptane

fractions were measured by liquid scintillation counting. Lysophospholipid acyltransferase

activity was measured as previously described (33, 34) with minor modifications. Briefly, 2-

4 µg of cell lysate protein in 100 µl of buffer containing 10 mM Tris-HCl (pH 7.4), 150 mM

NaCl, 1mM EDTA and 12.5 µM BSA, 18 µM [14C]AA-CoA (0.1 µCi) and 0-50 µM of 1-

18:0-2-lyso-PC, 1-18:0-2-lyso-PE or 2-lyso-PI was incubated at 37°C for 5 min. The

reactions were stopped by adding chloroform/methanol (1:2, v/v), lipids were extracted (27)

and GPL classes were separated by TLC using chloroform/methanol/acetic acid/water

(50:25:8:4, v/v/v/v) as mobile phase. Lipids were then visualized with iodine, the GPL spots

identified using GPL standards were scraped and measured by liquid scintillation counting.

Gene expression analysis. Cellular mRNA was extracted with Trizol from (Invitrogen),

purified with the RNeasy Mini Kit (QIAGEN). mRNA integrity was evaluated by

electrophoretic migration on a 1% agarose gel. cDNA was obtained using the Quantitect

Reverse Transcription Kit (QIAGEN) with 1 µg of RNA. Gene expression was measured by

qPCR (ABI 7500, Applied Biosystems) with SsofastTM Evagreen Supermix Low ROX (Bio-

Rad) and with Prime time assay (Integrated DNA Technologies) with PerfeCTa qPCR

SuperMix Low ROX (Quanta Biosciences). The efficiency of all primer pairs (Table 3.1)

was evaluated using a standard curve and the stability of the RN18S1 reference gene

expression between treatments was evaluated before analysis. All ∆∆Ct experiments were

performed with 10 ng of RNA reversed transcribed into cDNA. In these experiments, primary

31

T cells were negatively selected with the EasySep® Human T cells enrichment Kit to avoid

cellular activation and gene induction in resting cells.

Table 3.1. List of primer sequences used in qPCR experiments for each

transcript

Transcript (Accession) Primers Sequences

Products

(bp) Evagreen

LPEAT2 NM_153613

FWD REV

GTAGGGAGCTTACCTGTGATTGT CCACATAGCCAGCGGACA 112

LPIAT1 NM_024298

FWD REV

ACCATCCGCAACATCG CGCTCCGCAGGACATA 145

PLA2 IVA NM_024420

FWD REV

TGAGTGACTTTGCCACACAGGACT AATGTGAGCCCACTGTCCACTACA 142

PLA2 IVB NM_001114633

FWD REV

TGGGAACTGTCATCACGC AAGTGCTCCAACTACTCAACGT 202

PLA2 IVC NM_003706

FWD REV

CTGGTGGATGCTGGTTTAG GCGGCAGTAGTCAGTGGTA 141

PLA2 VIA NM_003560

FWD REV

GAGAGCACGGCAACAC GGAGGCTAGGAATGTA 134

RN18S1 NR_003286

FWD REV

GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG 151

Prime Time

FASN NM_004104

FWD Probe REV

AGAACTTGCAGGAGTTCTGGGACA 56-FAM/TGTGGACAT/ZEN/GGTCACGGACGATGA/3IABkFQ

TCCGAAGAAGGAGGCATCAAACCT 149

SCD-1 NM_005063

FWD Probe REV

AGTTCTACACCTGGCTTTGG 56-FAM/CTCCACAGA/ZEN/CGATGAGCTCCTGC/3IABkFQ

GTTGGCAATGATCAGAAAGAGC 137

FATP4 NM_005094

FWD Probe REV

TGACCCGCCTCATCTGTTCATTCA 56-FAM/TAAGCTGAG/ZEN/GGTGTAGCAGGTAAGATGC/3IABkFQ

AGCCCACACTGTTAAACACCTTGC 139

ACSL3 NM_004457

FWD Probe REV

ATTGTGCATACCATGGCTGCAGTG 56-FAM/ACACAAGTG/ZEN/GATCCACAGGACTTCCA/3IABkFQ

TCTGGAATCCTTTCTGCCATCCCA 197

ACSL4 NM_004458

FWD Probe REV

TGGGCATTCCTCCAAGTAGACCAA 56-FAM/ACTAGTGGT/ZEN/TCTACTGGCCGACCTAA/3IABkFQ

ACTGGCCTGTCATTCCAGCTATCA 129

ACSL5 NM_016234

FWD Probe REV

TCAGTCATGACATTCTTCCGGGCA 56-FAM/TGGTCAAAC/ZEN/AGAATGCACAGGTGGCT/3IABkFQ

CCAGCTTCACGTAATTGCAAGCCA 154

ACSL6 NM_015256

FWD Probe REV

AGCTGGCCTGCTACACATATTCCA 56-FAM/AGCACCGTG/ZEN/ATTGTGGACAAACCTCA/3IABkFQ

TCCACATGCTCTAGCAGAAGCACA 151

LPCAT2 NM_017839

FWD Probe REV

AGTATGTGATTGGCCTGGCTGTCT 56-FAM/TGCAACCCT/ZEN/TCCAACACAGAGGAGAT/3IABkFQ

TCCAAGGGAAGCCTGTAGAATGGT 143

LPCAT3 NM_005768

FWD Probe REV

AACAGACCATCCACTGGCTCTTCA 56-FAM/TGCCTCTTC/ZEN/ACGTGGGACAAATGGCTTA/3IABkFQ

TCAGGAAGAAGATGTGGCCAAGGA 120

PLA2 VIB NM_015723

FWD Probe REV

TCATCTGCTGCTCCAGGCTACTTT 56-FAM/CCCTTCGGC/ZEN/ATTAGCTATGCATGAGT/3IABkFQ

CGGCACATCTGGCCAAAGACATTT 132

RN18S1 NR_003286

FWD Probe REV

GAGACTCTGGCATGCTAACTAG 56-FAM/TGCTCAATC/ZEN/TCGGGTGGCTGAA/3IABkFQ

GGACATCTAAGGGCATCACAG 129

32

Western blot analysis. Resting and proliferating primary T cells were washed with PBS and

lysis buffer (150 mM NaCl, 1% Nonidet P-40, 2mM EDTA, 50 mM Tris-HCL, pH 7.6)

supplemented with protease inhibitor cocktail (Roche) was added to the pellets. Following a

quick vortex, 5x Laemmli sample buffer (300 mM Tris-HCL pH6.8, 10% SDS, 50% glycerol,

25% β-mercaptoethanol, 0.05% bromophenol blue) was added and samples were boiled for

10 min. Proteins were quantified by EZQ Protein Quantitation kit (Molecular probe) and 20

µg of cellular proteins were separated on Criterion 4-15% polyacrylamide gels (Bio Rad).

Proteins were transferred onto a PVDF membrane and Western blotting was performed using

indicated primary antibodies and horseradish peroxidase-conjugated secondary antibodies.

Membranes were washed and developed using Amersham ECL prime (GE Healthcare) and

images were captured using an Alpha Innotech Fluorchem imager (San Leandro. CA. USA).

Statistics. Statistical analyses were performed using JMP software (Cary, NC) as described

in the figure legends.

Ethics. This study was approved by the Université de Moncton institutional review

committee for the research involving human subjects, and all subjects provided informed

consent prior to their participation in the study.

3.5. Results Primary T cell culture and proliferation. The proliferation of primary human T cells was

induced by incubation of fresh PBMCs with anti-CD3 and IL-2. After three days of

incubation, the stimulated T cells grew in clusters and cellular counts were increased by 2.6

± 0.1 fold (p ≤ 0.0001, student’s t test, n=16) compared to resting cells, in accord with

previous reports (25). In experiments where the IL-2 and anti-CD3 stimuli were removed

from proliferating cells on day 4 (S-NS), cells ceased to proliferate and cell numbers became

stable by day 6 to 7. This is consistent with the previously-reported return of T cells to the

Go phase within 72 hours after removal of stimuli without induction of cell death (35). The

increase in the proportion of cells showing diploid (2n) DNA content (Go/G1) by flow

cytometry analysis is consistent with this return to a non-proliferating quiescent phenotype

(Figure 3.13. (Supplemental Figure SI)).

33

Cellular fatty acid composition. The FA composition and distribution in GPL of resting and

stimulated T cells is shown in Figure 3.2. Cell proliferation was associated with a significant

increase in mass of nearly all cellular FA (Figure 3.2A) which is consistent with the increase

in cell size during blast transformation of T cells (36, 37).

Figure 3.2. The mass content of fatty acids (A) and the fatty acid distribution (B)

in total glycerophospholipid from resting and proliferating T cells.

Lipids were extracted from resting T cells incubated without stimulation for 3 days

and proliferating T cells that were incubated with 1 µg/ml anti-CD3 and 20 U/ml IL-2

for 3 days. The fatty acids were hydrolyzed and transmethylated, and individual fatty

34

acids were measured by GC-FID. The results are the mean ± SEM of 9-10 independent

experiments. *Different from resting cells (p<0.05) as determined by student’s t-test.

The most prominent increases in mass associated with cell proliferation were in the SFA and

MUFA content. When the percent FA distribution of the two cell populations is presented, it

becomes evident that only MUFA had become enriched in stimulated T cells (Figure 3.2B).

Overall, these results suggest that de novo FA biosynthesis is increased in proliferating T

cells, and that the cells preferentially shunt the newly synthesized SFA toward desaturation.

This is supported by a significant increase in fatty acid synthase and stearoyl CoA-desaturase-

1 (SCD-1) gene and protein expression in stimulated T cells (Table 3.2A and Figure 3.3).

Table 3.2. Gene expression of selected enzymes in resting and proliferating T

cells.

RNA from resting T cells incubated without stimulation and proliferating T cells

incubated with 1 µg/ml anti-CD3 and 20 U/ml of IL-2 for 3 days was extracted and

reversed transcribed into cDNA. Relative qPCR was performed using RN18S1 as

reference gene. Values represent the mean ± SEM of fold increase of RNA expression

in proliferating T cells compared to resting T cells for 3 to 6 independent experiments.

*Different from resting cells (p<0.05) as determined by student’s t-test.

Coded Enzyme Fold Increase A FASN 9.7 ± 2.1 * SCD1 169 ± 42 *

B FATP4 1.8 ± 0.6 ACSL3 3.5 ± 0.4 * ACSL4 4.4 ± 0.5 * ACSL5 2.1 ± 0.4 * ACSL6 13.1 ± 3.9 *

C LPCAT2 0.5 ± 0.2 * LPCAT3 1.5 ± 0.1 * LPEAT2 / LPCAT4 1.6 ± 0.1 * LPIAT1 2.2 ± 0.3 *

D PLA2 IVA 25.0 ± 8.3 * PLA2 IVB 0.1 ± 0.0 * PLA2 IVC 39.9 ± 3.8 * PLA2 VIA 0.8 ± 0.1 * PLA2 VIB 1.8 ± 0.3 *

35

Figure 3.3. Fatty acid synthase (FASN) and stearoyl-CoA desaturase 1 (SCD1)

expression in resting and proliferating T cells.

Proteins (20 µg) from resting T cells and proliferating T cells were separated by SDS-

PAGE and transferred on PVDF membrane as described in the experimental

procedures section. Western blotting was performed using anti-FASN (1:1000) and

anti-SCD1 (1:1000) antibodies, and anti-β-actin (1:10000) as loading control. These

images are representative of 3 independent experiments using different donors.

It is noteworthy that in contrast to all other FA, the total cellular AA mass did not change

with T cell stimulation (Figure 3.2A), and as a result its percent content decreased

substantially with cell stimulation (Figure 3.2B).

Data 1

0 50 100 1500

50

100

150FASN

SCD1

β-Actin

36

Cellular glycerophospholipids. The total fatty acyl content of each GPL class was measured

in the different T cell populations (Figure 3.4A).

Figure 3.4. Total fatty acid content (A) and the fatty acid distribution (B) of

glycerophospholipid (GPL) classes from different cell populations.

Lipids were extracted from resting T cells incubated without stimulation for 3 days,

proliferating T cells incubated with 1 µg/ml anti-CD3 and 20 U/ml IL-2 for 3 days,

proliferating T cells incubated for an additional 4 days without stimulation (S-NS) and

Resting Proliferating S-NS Jurkat0

500

1000

1500

2000

2500

aa a

a b

b b

bc

b

bac

b

bbc

c

cPCPEPI/PSTotal

Cells

A

Fatty

aci

ds(n

mol

/ 108 c

ells

)


20

40

60

80

100 PCPEPI/PS

a

a a b

aa

b

a aab

ca

B

Cells

Fatty

aci

ds(%

mol

)

37

Jurkat cells. GPL classes were separated by HPLC and phosphatidylcholine (PC),

phosphatidylethanolamine (PE), phosphatidylinositiol + phosphatidylserine (PI/PS)

were collected separately. The fatty acids from each fraction were hydrolyzed,

transmethylated and total fatty acids associated with each class measured by GC-FID.

These results are the mean ± SEM of 9-10 independent experiments for resting and

proliferating T cells and 3 independent experiments for the Jurkat and S-NS cells.

Values within each GPL class that do not have a common superscript are significantly

different p<0.05 as determined by oneway ANOVA.

The total cellular FA associated with GPL increased over 2-fold in proliferating T cells

compared to resting cells. This increased total cellular GPL content was maintained following

removal of the stimulus (S-NS) and was similar to that measured in the human Jurkat T cell

line. Although the amount of total FA associated with each class of GPL increased with T

cell stimulation, the relative distribution of total FA between the different GPL classes was

comparable amongst the different cell populations (Figure 3.4B). Similar results were

obtained when lipid phosphorous associated with the different GPL classes was measured in

resting and proliferating T cells (Figure 3.14. (Supplemental Figure SII)).

Fatty acid distribution in GPL classes. Although no significant changes in the proportions of

the cellular GPL classes were measured, several significant changes in the FA distribution

within each GPL class were measured in the different cell populations (Figure 3.5).

38

Figure 3.5. The distribution of fatty acids within glycerophospholipid (GPL)

classes from different cell populations.


proliferating T cells incubated with 1 µg/ml anti-CD3 and 20 U/ml IL-2 for 3 days,

0

10

20

30

40

50 RestingProliferatingS-NSJurkat

PC

aa

a

b

a

a

a

b b

a

a

c aaa

b

aa

a

b

b

a a c

bb

bbab

ab b

a

b b a b baab

ab aa a b

Fatty

aci

ds(%

mol

)

0

10

20

30

40

50PE

a

a

ab b

c

a

c

a

b

aa

bc

ab

a

b

bb

ab

ab

ab aca

bd

bc c

b

ab a a

Fatty

aci

ds(%

mol

)

16:0

16:1

n-7 18:0

18:1

n-9

18:1

n-7

18:2

n-6

20:3

n-6

20:4

n-6

22:4

n-6

22:5

n-3

22:6

n-30

10

20

30

40

50PI/PS

a

a

ab b

a

a

c

b

a

acb a

b

ab

b

ab b

aab

ab

aa c

bc

c

a ab c

c c

ab

ab

bc

Fatty acids

Fatty

aci

ds(%

mol

)

39




were collected separately. The fatty acids from each fraction were hydrolyzed and

transmethylated, and individual fatty acids were measured by GC-FID. The results are

the mean ± SEM of 9-10 independent experiments for resting and proliferating T cells

and 3 independent experiments for the Jurkat and S-NS cells. Values within each fatty

acid that do not have a common superscript are significantly different p<0.05 as

determined by oneway ANOVA.

Firstly, the composition of MUFA and SFA in the PC fraction followed a strong distinct

pattern that was associated with cell proliferation or with cell quiescence, where the MUFA

were significantly lower and stearic acid (18:0) was significantly increased in the PC from

quiescent cell populations (Resting and S-NS). Secondly, the PC fraction from both

populations of non-proliferating cells (Resting and S-NS) was strikingly more enriched in

arachidonate than that from proliferating cells (Proliferating T cells and Jurkat). Similar

patterns were also measured in the PE and in the PI/PS fractions. A smaller decrease in AA

as a percent of total FA was previously reported in mitogen-stimulated T cells (36).

To better characterize the changes occurring in the FA composition of GPL when resting

primary T cells are stimulated to proliferate, the molar FA content within the different GPL

classes was measured (Figure 3.6).

40

Figure 3.6. The mass content of fatty acids within glycerophospholipid (GPL)

classes of resting and proliferating T cells.

Lipids were extracted from resting T cells incubated without stimulation for 3 days or

proliferating T cells incubated with 1 µg/ml anti-CD3 and 20 U/ml IL-2 for 3 days.

050

100150200250300350 Resting

Proliferating*

*

*

*****

PCFa

tty a

cids

(nm

ol / 1

08 cel

ls)

050

100150200250300350

**

*

**

***

***

PE

Fatty

aci

ds (n

mol

/ 108 c

ells

)

16:0

16:1

n-7 18:0

18:1

n-9

18:1

n-7

18:2

n-6

20:3

n-6

20:4

n-6

22:4

n-6

22:5

n-3

22:6

n-30

50100150200250300350

*

*

*****

***

PI/PS

Fatty acids

Fatty

aci

ds (n

mol

/ 108 c

ells

)

41

GPL classes were separated by HPLC and phosphatidylcholine (PC),



transmethylated, and individual fatty acids were measured by GC-FID. The results are

the mean ± SEM of 9-10 independent experiments. *Different from resting cells

(p<0.05) as determined by student’s t-test.

The molar content of most FA was significantly increased in all GPL fractions of

proliferating T cells with the most prominent increases in mass in the SFA and MUFA in all

GPL classes. It is noteworthy that a different picture emerges when the molar content is

portrayed than when percent FA are presented as in Figure 3.5; important information is

gathered by both representations since, for example, although 16:0 is similarly enriched in

the GPL fractions from resting and proliferating cells on a percent basis (Figure 3.5), the

stimulated cells contain much more 16:0 mass (Figure 3.6).

AA is the only FA whose molar content followed a distinct redistribution pattern in the

different GPL classes following the induction of T cell proliferation. Its molar content in both

PE and PI/PS increased in proliferating T cells while the quantity associated with PC

significantly decreased compared to resting T cells (Figure 3.6). This suggests that a

mechanism is in place to handle cellular AA content that does not apply to other FA. Indeed,

when the distribution of each FA between the different cellular GPL classes is measured, the

change in the distribution pattern of AA following the induction of T cell proliferation is

unique (Figure 3.7).

42

Figure 3.7. The distribution of fatty acids between glycerophospholipid (GPL)

classes of resting and proliferating T cells.

Lipids were extracted from resting T cells incubated without stimulation for 3 days or

proliferating T cells incubated with 1 µg/ml anti-CD3 and 20 U/ml IL-2 for 3 days.

GPL classes were separated by HPLC and phosphatidylcholine (PC),


0

20

40

60

80

100 PCPEGPI/GPS

RestingFa

tty a

cids

(% m

ol)

16:0

16:1

n-7 18:0

18:1

n-9

18:1

n-7

18:2

n-6

20:3

n-6

20:4

n-6

22:4

n-6

22:5

n-3

22:6

n-30

20

40

60

80

100

*

**

*

*

**

*

*

*

*

**

***

*

*

****

Proliferating

Fatty acids

Fatty

aci

ds

(% m

ol)

43


transmethylated, and individual fatty acids were measured by GC-FID. Values

represent the mean ± SEM of 9-10 independent experiments. *Different from resting

cells (p<0.05) as determined by student’s t-test.

In both quiescent cell populations (Resting T and S-NS cells) the mass of cellular AA is

equally distributed between PC and PE species of phospholipids, but is significantly

redistributed from PC to PE and to PI/PS species in actively proliferating populations

(Proliferating T and Jurkat cells) (Figure 3.8 and Figure 3.15 (Supplemental Figure SIII)).

Figure 3.8. Arachidonic acid mass content in glycerophospholipid (GPL) classes

from different cell populations.


proliferating T cells incubated with 1 µg/ml anti-CD3 and 20 units/ml IL-2 for 3 days,





100

200

300 PCPEPI/PSTotal

a a

a

ab

b

b

b

aab

b

a

b

b

abc

b

Cells

Arac

hido

nic

acid

(n

mol

/ 108 c

ells

)

44


transmethylated, and fatty acids were measured by GC-FID. Values represent the mean

± SEM of 9-10 independent experiments for resting and proliferating T cells and 3

independent experiments for the Jurkat and S-NS T cells. Values within each GPL

class that do not have a common superscript are significantly different p<0.05 as


Arachidonate distribution in GPL sub-classes. In light of the redistribution of cellular

arachidonate following the stimulation of T cells, the distribution of arachidonate in GPL

sub-classes was measured. In resting T cells the most abundant arachidonate-containing GPL

were 1-acyl-PC species, although important amounts of 1-acyl-PE and 1-alk-1-enyl-PE

(Figure 3.9) as well as 1-acyl-PI/PS (Figure 3.8) species were measured.

Figure 3.9. Arachidonic acid composition of glycerophospholipid (GPL) sub-

classes from resting and proliferating T cells.


and proliferating T cells incubated with 1 µg/ml anti-CD3 and 20 units/ml IL-2 for 3

Resting Proliferating0

10

20

30

40

50

60

70

80 1-acyl-PC1-alkyl-PC1-alk-1-enyl-PC1-acyl-PE1-alkyl-PE1-alk-1-enyl-PE

**

*

Cells

Arac

hido

nic

acid

(n

mol

/ 108 c

ells

)

45

days. Phosphatidylethanolamine (PE) and phosphatidylcholine (PC) were separated by

HPLC, and 1-acyl, 1-alkyl, and 1-alk-1-enyl-linked subclasses were separated and

associated fatty acids were measured by GC-MS using 2H8-AA as internal standard.

Values represent the mean ± SEM of 3 independent experiments. *Different from

resting cells (p<0.05) as determined by student’s t-test.

However, in proliferating cells 1-acyl-PC was no longer the predominant reservoir of cellular

arachidonate and was the only subclass of GPL to have a net loss of cellular arachidonate

compared to resting cells. Increases in arachidonate content were measured mostly in the 1-

alk-1-enyl-PE and 1-acyl-PI/PS species, while 1-acyl-PE remained an important reservoir of

cellular AA in proliferating cells (Figure 3.9). The molar composition of other unsaturated

FA in GPL sub-classes was also significantly changed in proliferating T cells compared to

the resting T cells (Table S3.1) but the redistribution of arachidonate was unlike that of any

other FA.

[3H]Arachidonate-phospholipid remodeling. It was previously shown that following

stimulation of human or murine T cells, arachidonate remodeling and CoA-IT activity are

increased (25, 38). This enzyme catalyzes the transfer of arachidonate from 1-acyl-2-AA-PC

to 1-alkyl-PC, 1-acyl-PE and 1-alk-1-enyl-PE species and its activation in intact cells can be

measured by tracking the remodeling of pulse-labeled [3H]AA in cellular GPL classes over

time. Pulse-label experiments in resting and proliferating cells show that pulsed [3H]AA is

preferentially incorporated into PC and then transfers to PE species, but the transfer is much

more rapid in proliferating cells indicating that the arachidonate-GPL remodeling rate is

enhanced (Figure 3.10A and 3.10B).

46

Figure 3.10. Arachidonate-phospholipid remodeling in resting and

proliferating T cells.

Resting T cells incubated for 3 days without stimulation (A) and proliferating T cells

incubated with 1 µg/ml anti-CD3 and 20 units/ml IL-2 for 3 days (B) were pulse-

0 4 8 12 16 20 240

20

40

60

80

100

PEPI/PS

PCResting

A

Time (h)

[3 H] A

rach

idon

ic a

cid

(% C

PM)

0 4 8 12 16 20 240

20

40

60

80

100

PEPI/PS

PC

B Proliferating

Time (h)

[3 H] A

rach

idon

ic a

cid

(% C

PM)

0 4 8 12 16 20 240

1

2

3

4

5RestingProliferating

C

Time (h)

Rat

io o

f Spe

cific

Act

ivitie

sG

PC / G

PE

47

labeled with [3H]AA, washed and incubated for the indicated times prior to lipid

extraction. GPL classes were separated by HPLC and phosphatidylcholine (PC),



transmethylated, and fatty acids were measured by GC-FID and the radioactivity

associated with each fraction was measured by liquid scintillation counting. To

calculate the specific activity in (C), the counts per minute were divided by the mass

of AA in each fraction. Values represent the mean ± SD of 6-7 independent

experiments.

However, the apparent more rapid remodeling kinetics of [3H]AA may be a function of the

large difference in the mass distribution of arachidonate between resting and proliferating

cells. To correct for the potential bias associated with this difference in mass distribution, the

change in the specific activity (cpm / ng AA) of PC and PE were measured (Figure 3.10C).

As the pulse-labeled [3H]AA comes into isotopic equilibrium with arachidonate mass, the

ratio of the specific activities of PC to PE should approach a value of 1. The much more rapid

decrease in specific activity ratios in proliferating cells compared to resting cells confirms

that the arachidonate-GPL remodeling rate was indeed enhanced in proliferating cells.

Incorporation of exogenous arachidonic acid into GPL. Proliferating T cells incorporated

significantly more [3H]AA into GPL in pulse label experiments (21.1 ± 1.5 fold greater; p ≤

0.0002, student t test, n=3) compared to resting T cells. To evaluate the possible mechanism

responsible for this increased uptake into GPL, ACSL activity was measured and shown to

be significantly elevated in proliferating T cells compared to resting T cells (Figure 3.11A).

48

Figure 3.11. Arachidonoyl-CoA synthetase (A), lysophosphatidylcholine

acyltransferase (B), lysophosphatidylinositol acyltransferase (C) and

lysophosphatidylethanolamine (D) activities in resting and proliferating human

T cells.

Resting T cells incubated for 3 days without stimulation and proliferating T cells

incubated with 1 µg/ml anti-CD3 and 20 units/ml IL-2 for 3 days were sonicated and

activities were measured in homogenates as described in the Experimental procedures

section. Values represent the mean ± SEM (A) and mean ± SD (B-D) of 3 independent

experiments. *Different from resting cells (p<0.05) as determined by student’s t-test.


100

200

300

400

*A

Cells

Arac

hido

noyl

-CoA

syn

thet

ase

(pm

ole/

min

/mg

prot

ein)

0 10 20 30 40 500

1000

2000

3000

4000

5000

6000 Resting T cellsProliferating T cells

Vmax = 2064 ± 124Km = 1.4 ± 0.8

Vmax = 923 ± 90Km = 3.4 ± 1.7

C

* * **

µM 1-acyl-LPI

Lyso

phos

phol

ipid

acy

ltran

sfer

ase

(pm

ole/

min

/mg

prot

ein)

0 10 20 30 40 500

1000

2000

3000

4000

5000

6000Resting T cellsProliferating T cells

B

Vmax = 7183 ± 937Km = 23.9 ± 6.7

Vmax = 4551 ± 562Km = 44.8 ± 9.6

**

*

*

µM 18:0-LPC

Lyso

phos

phol

ipid

acy

ltran

sfer

ase

(pm

ole/

min

/mg

prot

ein)

0 10 20 30 40 500

1000

2000

3000

4000

5000

6000 Resting T cellsProliferating T cells

D

Vmax = 803 ± 591Km = 2.8 ± 11,9

Vmax = 726 ± 304Km = 1.4 ± 5.6

µM 18:0-LPE

Lyso

phos

phol

ipid

acy

ltran

sfer

ase

(pm

ole/

min

/mg

prot

ein)

•×

49

The expression of four different genes coding for ACSL known to use AA (10, 11, 39-42)

were also significantly increased, although the fatty acid transport protein-4, which also

possesses ACSL activity (11), was not significantly changed (Table 3.2B). The increased

incorporation of exogenous AA into proliferating T cells was also associated with

significantly increased LPCAT and LPIAT activity while LPEAT activity was unchanged

(Figure 3.11B-D). To evaluate the LPLAT isoforms responsible for these activity changes,

the expression of selected LPLAT genes whose gene products show selectivity for

arachidonoyl-CoA (8, 9, 43-46) were measured. The expression of all evaluated LPLAT

genes was elevated with the exception of LPCAT2 (Table 3.2C). These increases in gene

expression were accompanied by markedly increased protein levels of LPCAT3 and LPIAT1

in proliferating T cells (Figure 3.12). LPCAT2 was undetectable in these cells.

Figure 3.12. Lysophospatidylcholine acyltransferase 3 (LPCAT3),

lysophospatidylinositol acyltransferase 1 (LPIAT1) and phospholipase A2 IVC

(PLA2) expression in resting and proliferating T cells.

Proteins (20 µg) from resting T cells and proliferating T cells were separated by SDS-

PAGE and transferred on PVDF membrane as described in the experimental

procedures section. Western blotting was performed using anti-LPCAT3 (1:1000),

anti-LPIAT1 (1:1000) and anti-PLA2 IVC (1:1000) antibodies and anti-β-actin

*Data 1

0 50 100 1500

50

100

150 LPCAT3

LPIAT1

PLA2 IVC

β-Actin

50

(1:10000) as loading control. These images are representative of 3 independent

experiments using different donors.

Finally, given the measured changes in the FA composition of GPL associated with the

induction of cell proliferation, the expression of a number of selected PLA2 genes whose

gene products show selectivity for arachidonate-containing GPL or which have been

suggested to participate in GPL remodeling were also measured (5-7, 25, 26, 47-52). All of

the measured genes coding for PLA2 showed significant differences in their expression

between resting and proliferating T cells though the extent of the increase in the expression

of the group IVA and IVC PLA2 in proliferating T cells was especially noteworthy (Table

3.2D). Accordingly, group IVC PLA2 protein expression was also increased in proliferating

T cells compared to resting cells (Figure 3.12) while group IVA PLA2 protein levels were

previously shown to be increased following induction of T cells proliferation (25).

3.6. Discussion In this study, significant differences in FA composition and metabolism in quiescent and

proliferating T cell populations are reported. Striking changes in the content and distribution

of FA in GPL classes between resting and proliferating cells were measured that

accompanied the expected increase in total GPL mass associated with an increase in cell size

(36, 37). Since de novo FA synthesis is known to accompany cell proliferation, the increase

in SFA mass in proliferating T cells was not surprising (53), however important changes in

the unsaturated fatty acyl content of GPL were also measured and these may be the result of

fundamental processes associated with cell proliferation.

A salient feature of proliferating cells was the enrichment of proliferating primary T cells

and Jurkat cells with MUFA compared to resting cells and S-NS cells. Both palmitoleic acid

(16:1 n-7) and oleic acid (18:1 n-9) are products of the SCD1, while 18:1 n-7 is the elongation

product of 16:1 n-7. Consistent with this FA profile that is indicative of SCD-1 activity,

mRNA and protein expression of SCD1 were impressively increased in proliferating T cells

compared to resting cells. To our knowledge, this is the first description of an induction of

SCD1 in a non-transformed cell type that accompanies the induction of cell proliferation.

51

This observation is consistent with the reported expression of SCD1 in human cancers,

chemically induced tumors, and oncogene-transformed cells (54-57). Importantly, several

recent reports have shown that the knockdown or the inhibition of SCD1 in transformed cells

reduces proliferation, invasiveness and the capacity for tumor formation and induces

apoptosis (58-62). Therefore, the induction of SCD1 and associated changes in cellular

MUFA content may be a hallmark of proliferating cells, transformed or not, and SCD1 could

represent a therapeutic target for proliferative disorders including cancers and autoimmune

diseases.

One of the important changes measured in T cells once they entered the cell cycle was a

profound and very specific redistribution of arachidonate within GPL classes and subclasses.

Importantly, although T cells contain a number of different cellular PUFA, the redistribution

of arachidonate mass associated with cell proliferation was unique to this FA suggesting that

the cell has developed a mechanism to specifically control the placement of AA, and that this

placement is important for progression through the cell cycle. Indeed, the shift in cellular

arachidonate mass following the induction of T cell proliferation, mainly from 1-acyl-PC to

1-radyl-PE species, coincided with an increased capacity of cells to remodel [3H]AA in pulse-

label experiments. While such CoA-IT-driven remodeling has been linked to AA release for

eicosanoid production following acute leukocyte stimulation (17, 20, 63-67), the present

study shows that an enhanced remodeling activity is associated with a redistribution of

cellular arachidonate mass. Previous studies have shown that the inhibition of CoA-IT results

in the induction of apoptosis in neoplastic cell line and in proliferating human T cells (18,

21, 25, 68). Thus the ability to transfer arachidonate between different GPL classes and sub-

classes, resulting in its redistribution into PE sub-classes following the induction of cell

proliferation, is likely an important event during cell division. The identity of the CoA-IT

enzyme has not yet been determined; however its likely central role in controlling the cellular

distribution of arachidonate mass suggests that the elucidation of its identity may reveal a

new target for the control of cell proliferation.

The redistribution of arachidonate mass does not appear to be a phenomenon simply

associated with activation of peripheral blood T cells. The Jurkat T cell line resembles

52

stimulated proliferating T cells in that arachidonate is significantly more enriched in PE

species compared to PC species. Additionally, removal of the stimuli that maintain T cells in

a proliferative state reverts the cells to a senescent non-proliferating phenotype (35) and

although this cell population maintains the elevated amount of total GPL measured in

activated T cells, arachidonate is redistributed to the pattern observed in resting T cells where

its content in PE and PC species is nearly equivalent. Thus, it appears that the redistribution

of cellular arachidonate mass from PC to PE species is a phenomenon that accompanies the

induction of cell proliferation, which is reversed when cells revert to a non-proliferating state.

It is worth noting that this redistribution of arachidonate mass when cells cease to proliferate

may be a different phenomenon from what is observed when cells are exposed to CoA-IT

inhibitors (69) or when growth-promoting cytokines are removed from bone marrow-derived

mast cells (70) where significant amounts of free unesterified AA accumulate due to an

inhibition or loss of CoA-IT activity and cells undergo apoptosis. Such induction of cell death

associated with the inability to control free unesterified AA leading to increased ceramide

concentrations was also suggested to occur following group IVA PLA2 activation in TNF-

sensitive cells and in cells treated with cyclooxygenase or ACSL inhibitors (71-74).

Interestingly, upon cell proliferation the cellular content of all measured FA increased except

for that of arachidonate, which instead remained constant at approximately 140 nmol/108

cells, but which was much more rapidly remodeled from PC to PE species and exhibited a

unique shift in its cellular mass distribution in GPL classes and subclasses. Although the

content of cellular arachidonate remained steady, unlike resting cells, the proliferating cells

must nevertheless constantly incorporate new AA into newly synthesized membranes to

maintain cellular arachidonate levels and this was confirmed by the significantly increased

capacity of the cells to incorporate exogenous AA. This incorporation of AA into membranes

requires PLA2 activity to generate lyso-GPL and ACSL and LPLAT activities to incorporate

PUFA into GPL, a phenomenon called the Lands cycle and proposed several decades ago to

account for the diversity of GPL molecular species generated following de novo GPL

biosynthesis (2, 4) (Figure 3.1).

53

Recently, a number of new ACSL, LPLAT and PLA2 have been discovered that exhibit

different substrate specificities towards different FA or GPL classes and likely contribute to

cellular FA diversity (5-11) although the individual isoforms responsible for the diversity of

GPL molecular species in different cell types have not been definitively identified. It is

therefore probable that genes coding for different isoforms of these enzymes with specificity

towards AA may be differentially regulated with the induction of cell proliferation. ACSL,

LPCAT and LPIAT activities were significantly increased in proliferating T cells and the

expression of ACSL and LPLAT known to show utilize AA as a substrate (10, 11, 39-42)

were measured. The expression of all four measured ACSL genes was significantly increased

in proliferating T cells compared to resting cells, suggesting that an overall increased

requirement for these enzymes to assimilate exogenous sources of PUFA is associated with

the induction of cell proliferation. With respect to LPCAT expression, LPCAT2, LPCAT3

(also called MBOAT5) and LPCAT4 (also called LPEAT2 and MBOAT2) have all shown

activity for AA-CoA as a substrate (8, 9, 43-46). LPCAT3 and LPCAT4 gene expression

were slightly upregulated with cell stimulation, and LPCAT3 protein expression was

significantly elevated in proliferating T cells. It is noteworthy that different apparent Km

values were measured in resting and proliferating cells that may be indicative of differential

isoform expression in the two cell populations or of potential posttranslational modifications

of the enzyme. Overall, the enhanced expression of ACSL and LPLAT genes had not been

previously associated with cell proliferation, however, their induction is consistent with the

enhanced capacity for these cells to incorporate arachidonic acid.

Another LPLAT that plays a potential role in the altered distribution of cellular arachidonate

is LPIAT1 (MBOAT7). It is the only known isoform that shows specificity for lyso-PI and

this isoform is also specific for AA-CoA as substrate (44). Interestingly, LPIAT enzymatic

activity as well as gene and protein expression of the LPIAT1 isoform were significantly

increased in proliferating cells compared to resting cells. This accompanied an increase in

the proportion of [3H]AA that is initially incorporated into PI of proliferating cells compared

to resting cells in pulse-label experiments, and an increase in the proportion of cellular

arachidonate mass associated with PI/PS compared to resting cells. Therefore, proliferating

cells preferentially incorporate newly acquired AA into PI/PS compared to resting cells but

54

this PI/PS-associated arachidonate does not participate in the CoA-IT-driven remodeling

between GPL species as seen by the stability of the [3H]AA associated in PI/PS over time in

pulse-label experiments. The importance of an increased content of AA-containing PI/PS

species is not clear, however, phosphatidylinositol-4-phosphate-5-kinase I isoforms are

specific for AA-containing PI (75) and are responsible for the synthesis of PIP2 which is

concentrated in the cleavage furrow and has been postulated to be critical for the recruitment

of proteins in the actomyosin ring and thus cell division (76).

Similarly, gene expression of group VIA PLA2, known to play a role in GPL remodeling (48,

77, 78), and the group IV PLA2s that show specificity for AA-containing GPL (49) were also

measured. There was little change in the expression of the group VIA PLA2, although the

protein content of the group VIA PLA2 was previously shown to be increased in stimulated

T cells (25) and its expression has been associated with cell cycle progression (26, 50). This

isoform is likely not involved in the redistribution of arachidonate mass since treatment of

cells with its inhibitor, BEL, has no effect on [3H]AA remodeling rates (25). Interestingly,

the group IVA and IVC PLA2 gene and protein expression were both greatly upregulated in

proliferating cells compared to resting cells. However, treatment of Jurkat cells with the

specific group IVA inhibitor, pyrophenone, did not modify [3H]AA remodeling rates (data

not shown) which is consistent with previous data using MAFP in T cells (25). Thus this

enzyme is likely not associated with enhanced remodeling rates. The group IVC PLA2, whose

physiological function has not yet been clearly identified, possesses multiple hydrolytic

activities including a CoA-IT activity (2, 51, 52), and its overexpression in HEK293 cells

was specifically associated with changes arachidonoyl-containing PE species (47). Studies

are underway to further investigate the possible role of the group IVC PLA2 isoform in the

regulation of cellular FA distribution and its potential importance in cell proliferation.

Overall, the induction of T cell proliferation was accompanied by profound changes in FA

metabolism that included significant remodeling of PUFA within GPL species. These

metabolic changes were accompanied by the modified expression of a number of newly-

identified enzyme isoforms whose involvement in these pathways is poorly understood, but

whose expression now appears to be associated with the induction of cell proliferation. These

55

key changes in the expression of enzymes associated with GPL remodeling and FA

metabolism have unveiled several potential targets for the treatment not only of

lymphoproliferative disorders, but potentially other pathologies in which unwanted cell

proliferation occurs.

3.7. Supplemental data

Figure 3.13. Supplemental Figure SI. Cell cycle analysis of proliferating and

quiescent (S-NS) T cells.

The cell cycle distribution of proliferating T cells incubated with 1 µg/ml anti-CD3

and 20 U/ml IL-2 for 3 days (A) and proliferating T cells incubated for an additional

4 days without stimulation (S-NS) (B) was assayed by flow cytometry using propidium

iodide (PI).

56

Figure 3.14. Supplemental Figure SII. Lipid phosphorus composition (A)

and lipid phosphorus distribution (B) of glycerophospholipid (GPL) classes from

resting and proliferating T cells.


and proliferating T cells were incubated with 1 µg/ml anti-CD3 and 20 U/ml IL-2 for

3 days. GPL classes were separated by HPLC and phosphatidylcholine (PC),


were collected separately. Each GPL fraction was dried and digested with perchloric

acid followed by a complexion of the phosphorus with ammonium molybdate in the

presence of ascorbic acid. These results are the mean ± the variance of 2 independent

experiments.


200400600800

100012001400 PC

PEPI/PSTotal

A

Cells

Lipi

d ph

osph

orus

(nm

ol / 1

08 cel

ls)


20

40

60

80 PCPEPI/PS

B

Cells

Lipi

d ph

osph

orus

(% m

ol)

57

Figure 3.15. Supplemental Figure SIII. Arachidonic acid distribution

between glycerophospholipid (GPL) classes for resting, proliferating and S-NS T

cells and for Jurkat cells.


proliferating T cells incubated with 1 µg/ml anti-CD3 and 20 units/ml IL-2 for 3 days,





transmethylated, and fatty acids were measured by GC-FID. Values represent the mean

± SEM of 9-10 independent experiments for resting and proliferating T cells and 3

independent experiments for the Jurkat and S-NS T cells. Values within each GPL

class that do not have a common superscript are significantly different p<0.05 as



20

40

60

80 PCPEPI/PS

a a

a

a

b

b

b

a

b

c

c

a

Cells

Ara

chid

onic

aci

d(%

mol

)

58

Table 3.3. Supplemental Table SI. Fatty acid composition in

glycerophospholipid sub-classes of resting and proliferating T cells.

Glycerophospholipids from resting T cells (R) incubated without stimulation and

proliferating (P) T cells incubated with 1 µg/ml anti-CD3 and 20 U/ml of IL-2 for 3

days were extracted and separated by HPLC. Phosphatidylethanolamine (PE) and

phosphatidylcholine (PC) were separated by HPLC, and 1-acyl, 1-alkyl, and 1-alk-1-

enyl-linked subclasses were separated and associated fatty acids were measured by

GC-MS using 2H8-AA as internal standard. Values represent the mean ± SEM of 3

independent experiments. *Different from resting cells (p<0.05) as determined by

student’s t-test.

*Different from resting cells (p<0.05) as determined by student’s t-test.

3.8. Abbreviations

GPL, glycerophospholipid; FA, fatty acid; MUFA, monounsaturated fatty acid; SFA

saturated fatty acid; PLA2, phospholipase A2; ACSL, acyl-CoA synthetase; LPLAT,

lysophospholipid acyl-CoA acyltransferase; CoA-IT, CoA-independent transacylase; AA,

arachidonic acid; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PI,

PC PE 1-Acyl 1-Alkyl 1-Alk-1-enyl 1-Acyl 1-Alkyl 1-Alk-1-enyl

FA Cells nM ± SEM nM ± SEM nM ± SEM nM ± SEM nM ± SEM nM ± SEM

16:1 n-7 R 3.1 ± 0.3 1.0 ± 0.1 1.0 ± 0.2 0.3 ± 0.1 0.3 ± 0.0 0.5 ± 0.1 P 30.9 ± 0.3* 14.4 ± 0.3* 3.3 ± 0.3* 7.0 ± 0.1* 0.5 ± 0.1 1.9 ± 0.1*

18:1 n-9 R 12.4 ± 0.7 11.2 ± 0.6 11.6 ± 0.6 4.8 ± 0.2 4.9 ± 0.2 4.6 ± 0.1 P 108.8 ± 3.5* 45.4 ± 1.6* 43.9 ± 5.1* 26.0 ± 2.0* 19.8 ± 1.0* 19.0 ± 1.1*

18:1 n-7 R 10.7 ± 0.3 3.1 ± 0.4 3.2 ± 0.1 1.5 ± 0.1 0.7 ± 0.1 0.8 ± 0.0 P 48.6 ± 1.0* 17.4 ± 0.5* 11.1 ± 0.5* 11.3 ± 0.1* 3.3 ± 0.0* 4.6 ± 0.2*

18:2 n-6 R 7.2 ± 0.4 2.3 ± 0.2 2.5 ± 0.2 3.1 ± 0.1 1.1 ± 0.1 1.2 ± 0.0 P 15.2 ± 0.1* 5.6 ± 0.1* 3.6 ± 0.1* 7.1 ± 0.2* 1.7 ± 0.1* 2.7 ± 0.1*

20:3 n-6 R 7.0 ± 0.0 0.1 ± 0.0 0.1 ± 0.0 2.7 ± 0.0 0.1 ± 0.0 0.2 ± 0.0 P 9.8 ± 0.0* 2.5 ± 0.1* 0.4 ± 0.0* 7.1 ± 0.1* 0.2 ± 0.0 2.8 ± 0.0*

20:4 n-6 R 51.8 ± 1.0 3.7 ± 0.6 1.3 ± 0.4 35.9 ± 0.9 0.9 ± 0.3 19.9 ± 0.7 P 12.8 ± 0.3* 5.8 ± 0.3* 1.6 ± 0.1 38.8 ± 1.6 2.0 ± 0.5 33.7 ± 2.1*

22:4 n-6 R 2.6 ± 0.0 0.1 ± 0.0 0.1 ± 0.0 2.2 ± 0.2 0.1 ± 0.0 3.5 ± 0.2 P 2.3 ± 0.0* 0.5 ± 0.0* 0.1 ± 0.0* 3.3 ± 0.4* 0.3 ± 0.1 5.8 ± 0.3*

22:5 n-3 R 5.6 ± 0.1 0.2 ± 0.1 0.1 ± 0.0 2.7 ± 0.3 0.2 ± 0.1 8.6 ± 0.3 P 5.5 ± 0.1 1.5 ± 0.1* 0.3 ± 0.0* 5.3 ± 0.5* 0.6 ± 0.1* 21.0 ± 0.4*

22:6 n-3 R 3.4 ± 0.0 0.2 ± 0.0 0.1 ± 0.0 4.1 ± 0.5 0.2 ± 0.0 9.1 ± 0.5 P 5.4 ± 0.0* 1.4 ± 0.0* 0.3 ± 0.0* 9.5 ± 0.3* 0.5 ± 0.1 25.6 ± 0.3*

59

phosphatidylinositol; PS, phosphatidylserine; LPCAT, lysophosphatidylcholine

acyltransferase; LPEAT, lysophosphatidylethanolamine acyltransferase; LPIAT,

lysophosphatidylinositol acyltransferase; PBMC, peripheral blood mononuclear cells;

FAME, fatty acid methyl esters; FASN, fatty acid synthase; SCD1, stearoyl-CoA desaturase

1.

3.9. Acknowledgements We thank Natalie Levesque for technical support with fatty acid analysis on GC-FID and

GC-MS. This work was supported by grants from the Canadian Institutes of Health Research

(CIHR) and the New Brunswick Health Research Foundation (NBHRF). PP Robichaud was

supported by Doctoral Scholarships from the CIHR, the NBHRF and the Fonds de recherche

sur l'arthrite et les maladies rhumatismales de l’université Laval. ME Surette was supported

by the Canada Research Chairs Program.

3.10. References 1. Spector, A. A., and M. A. Yorek. 1985. Membrane lipid composition and cellular function. J Lipid Res 26: 1015-1035. 2. Yamashita, A., T. Sugiura, and K. Waku. 1997. Acyltransferases and transacylases involved in fatty acid remodeling of phospholipids and metabolism of bioactive lipids in mammalian cells. J Biochem 122: 1-16. 3. Fahy, E., S. Subramaniam, H. A. Brown, C. K. Glass, A. H. Merrill, Jr., R. C. Murphy, C. R. Raetz, D. W. Russell, Y. Seyama, W. Shaw, T. Shimizu, F. Spener, G. van Meer, M. S. VanNieuwenhze, S. H. White, J. L. Witztum, and E. A. Dennis. 2005. A comprehensive classification system for lipids. J Lipid Res 46: 839-861. 4. Lands, W. E., M. Inoue, Y. Sugiura, and H. Okuyama. 1982. Selective incorporation of polyunsaturated fatty acids into phosphatidylcholine by rat liver microsomes. J Biol Chem 257: 14968-14972. 5. Diaz, B. L., and J. P. Arm. 2003. Phospholipase A(2). Prostaglandins Leukot Essent Fatty Acids 69: 87-97. 6. Kudo, I., and M. Murakami. 2002. Phospholipase A2 enzymes. Prostaglandins Other Lipid Mediat 68-69: 3-58. 7. Murakami, M., Y. Taketomi, Y. Miki, H. Sato, T. Hirabayashi, and K. Yamamoto. Recent progress in phospholipase A research: from cells to animals to humans. Prog Lipid Res 50: 152-192. 8. Hishikawa, D., H. Shindou, S. Kobayashi, H. Nakanishi, R. Taguchi, and T. Shimizu. 2008. Discovery of a lysophospholipid acyltransferase family essential for membrane asymmetry and diversity. Proc Natl Acad Sci U S A 105: 2830-2835.

60

9. Shindou, H., D. Hishikawa, T. Harayama, K. Yuki, and T. Shimizu. 2009. Recent progress on acyl CoA: lysophospholipid acyltransferase research. J Lipid Res 50 Suppl: S46-51. 10. Soupene, E., and F. A. Kuypers. 2008. Mammalian long-chain acyl-CoA synthetases. Exp Biol Med (Maywood) 233: 507-521. 11. Johnsen, G. M., M. S. Weedon-Fekjaer, K. A. Tobin, A. C. Staff, and A. K. Duttaroy. 2009. Long-chain polyunsaturated fatty acids stimulate cellular fatty acid uptake in human placental choriocarcinoma (BeWo) cells. Placenta 30: 1037-1044. 12. Kramer, R. M., and D. Deykin. 1983. Arachidonoyl transacylase in human platelets. Coenzyme A-independent transfer of arachidonate from phosphatidylcholine to lysoplasmenylethanolamine. J Biol Chem 258: 13806-13811. 13. Kramer, R. M., G. M. Patton, C. R. Pritzker, and D. Deykin. 1984. Metabolism of platelet-activating factor in human platelets. Transacylase-mediated synthesis of 1-O-alkyl-2-arachidonoyl-sn-glycero-3-phosphocholine. J Biol Chem 259: 13316-13320. 14. Sugiura, T., O. Katayama, J. Fukui, Y. Nakagawa, and K. Waku. 1984. Mobilization of arachidonic acid between diacyl and ether phospholipids in rabbit alveolar macrophages. FEBS Lett 165: 273-276. 15. Robinson, M., M. L. Blank, and F. Snyder. 1985. Acylation of lysophospholipids by rabbit alveolar macrophages. Specificities of CoA-dependent and CoA-independent reactions. J Biol Chem 260: 7889-7895. 16. Sugiura, T., Y. Masuzawa, Y. Nakagawa, and K. Waku. 1987. Transacylation of lyso platelet-activating factor and other lysophospholipids by macrophage microsomes. Distinct donor and acceptor selectivities. J Biol Chem 262: 1199-1205. 17. Chilton, F. H., A. N. Fonteh, M. E. Surette, M. Triggiani, and J. D. Winkler. 1996. Control of arachidonate levels within inflammatory cells. Biochim Biophys Acta 1299: 1-15. 18. Surette, M. E., and F. H. Chilton. 1998. The distribution and metabolism of arachidonate-containing phospholipids in cellular nuclei. Biochem J 330: 915-921. 19. Chilton, F. H., A. N. Fonteh, C. M. Sung, D. M. Hickey, T. J. Torphy, R. J. Mayer, L. A. Marshall, J. D. Heravi, and J. D. Winkler. 1995. Inhibitors of CoA-independent transacylase block the movement of arachidonate into 1-ether-linked phospholipids of human neutrophils. Biochemistry 34: 5403-5410. 20. Fonteh, A. N. 2002. Differential effects of arachidonoyl trifluoromethyl ketone on arachidonic acid release and lipid mediator biosynthesis by human neutrophils. Evidence for different arachidonate pools. Eur J Biochem 269: 3760-3770. 21. Winkler, J. D., T. Eris, C. M. Sung, M. Chabot-Fletcher, R. J. Mayer, M. E. Surette, and F. H. Chilton. 1996. Inhibitors of coenzyme A-independent transacylase induce apoptosis in human HL-60 cells. J Pharmacol Exp Ther 279: 956-966. 22. Winkler, J. D., A. N. Fonteh, C. M. Sung, J. D. Heravi, A. B. Nixon, M. Chabot-Fletcher, D. Griswold, L. A. Marshall, and F. H. Chilton. 1995. Effects of CoA-independent transacylase inhibitors on the production of lipid inflammatory mediators. J Pharmacol Exp Ther 274: 1338-1347. 23. Winkler, J. D., C. M. Sung, M. Chabot-Flecher, D. E. Griswold, L. A. Marshall, F. H. Chilton, W. Bondinell, and R. J. Mayer. 1998. Beta-lactams SB 212047 and SB 216754 are irreversible, time-dependent inhibitors of coenzyme A-independent transacylase. Mol Pharmacol 53: 322-329.

61

24. Boyum, A. 1968. Isolation of mononuclear cells and granulocytes from human blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl 97: 77-89. 25. Boilard, E., and M. E. Surette. 2001. Anti-CD3 and concanavalin A-induced human T cell proliferation is associated with an increased rate of arachidonate-phospholipid remodeling. Lack of involvement of group IV and group VI phospholipase A2 in remodeling and increased susceptibility of proliferating T cells to CoA-independent transacyclase inhibitor-induced apoptosis. J Biol Chem 276: 17568-17575. 26. Roshak, A. K., E. A. Capper, C. Stevenson, C. Eichman, and L. A. Marshall. 2000. Human calcium-independent phospholipase A2 mediates lymphocyte proliferation. J Biol Chem 275: 35692-35698. 27. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37: 911-917. 28. Chilton, F. H. 1990. Separation and characterization of arachidonate-containing phosphoglycerides. Methods Enzymol 187: 157-167. 29. Surette, M. E., I. L. Koumenis, M. B. Edens, K. M. Tramposch, and F. H. Chilton. 2003. Inhibition of leukotriene synthesis, pharmacokinetics, and tolerability of a novel dietary fatty acid formulation in healthy adult subjects. Clin Ther 25: 948-971. 30. Rouser, G., A. N. Siakotos, and S. Fleischer. 1966. Quantitative analysis of phospholipids by thin-layer chromatography and phosphorus analysis of spots. Lipids 1: 85-86. 31. Markwell, M. A., S. M. Haas, N. E. Tolbert, and L. L. Bieber. 1981. Protein determination in membrane and lipoprotein samples: manual and automated procedures. Methods Enzymol 72: 296-303. 32. Perez-Chacon, G., A. M. Astudillo, V. Ruiperez, M. A. Balboa, and J. Balsinde. 2010. Signaling role for lysophosphatidylcholine acyltransferase 3 in receptor-regulated arachidonic acid reacylation reactions in human monocytes. J Immunol 184: 1071-1078. 33. Zarini, S., M. A. Gijon, G. Folco, and R. C. Murphy. 2006. Effect of arachidonic acid reacylation on leukotriene biosynthesis in human neutrophils stimulated with granulocyte-macrophage colony-stimulating factor and formyl-methionyl-leucyl-phenylalanine. J Biol Chem 281: 10134-10142. 34. Kerkhoff, C., and V. Kaever. 2003. A systematic approach for the solubilization of the integral membrane protein lysophospholipid: Acyl-Coa acyltransferase (LAT). Methods Mol Biol 228: 111-127. 35. Bettens, F., F. Kristensen, C. Walker, G. D. Bonnard, and A. L. de Weck. 1984. Lymphokine regulation of human lymphocyte proliferation: formation of resting G0 cells by removal of interleukin 2 in cultures of proliferating T lymphocytes. Cell Immunol 86: 337-346. 36. Anel, A., J. Naval, B. Gonzalez, J. M. Torres, Z. Mishal, J. Uriel, and A. Pineiro. 1990. Fatty acid metabolism in human lymphocytes. I. Time-course changes in fatty acid composition and membrane fluidity during blastic transformation of peripheral blood lymphocytes. Biochim Biophys Acta 1044: 323-331. 37. Calder, P. C., P. Yaqoob, D. J. Harvey, A. Watts, and E. A. Newsholme. 1994. Incorporation of fatty acids by concanavalin A-stimulated lymphocytes and the effect on fatty acid composition and membrane fluidity. Biochem J 300: 509-518. 38. Tomita, M., R. C. Baker, S. Ando, and T. J. Santoro. 2004. Arachidonoyl-phospholipid remodeling in proliferating murine T cells. Lipids Health Dis 3: 1.

62

39. Poppelreuther, M., B. Rudolph, C. Du, R. Grossmann, M. Becker, C. Thiele, R. Ehehalt, and J. Fullekrug. 2012. The N-terminal region of acyl-CoA synthetase 3 is essential for both the localization on lipid droplets and the function in fatty acid uptake. J Lipid Res 53: 888-900. 40. Maloberti, P. M., A. B. Duarte, U. D. Orlando, M. E. Pasqualini, A. R. Solano, C. Lopez-Otin, and E. J. Podesta. 2010. Functional interaction between acyl-CoA synthetase 4, lipooxygenases and cyclooxygenase-2 in the aggressive phenotype of breast cancer cells. PLoS One 5: e15540. 41. Orlando, U. D., J. Garona, G. V. Ripoll, P. M. Maloberti, A. R. Solano, A. Avagnina, D. E. Gomez, D. F. Alonso, and E. J. Podesta. 2012. The functional interaction between Acyl-CoA synthetase 4, 5-lipooxygenase and cyclooxygenase-2 controls tumor growth: a novel therapeutic target. PLoS One 7: e40794. 42. Van Horn, C. G., J. M. Caviglia, L. O. Li, S. Wang, D. A. Granger, and R. A. Coleman. 2005. Characterization of recombinant long-chain rat acyl-CoA synthetase isoforms 3 and 6: identification of a novel variant of isoform 6. Biochemistry 44: 1635-1642. 43. Cao, J., D. Shan, T. Revett, D. Li, L. Wu, W. Liu, J. F. Tobin, and R. E. Gimeno. 2008. Molecular identification of a novel mammalian brain isoform of acyl-CoA:lysophospholipid acyltransferase with prominent ethanolamine lysophospholipid acylating activity, LPEAT2. J Biol Chem 283: 19049-19057. 44. Gijon, M. A., W. R. Riekhof, S. Zarini, R. C. Murphy, and D. R. Voelker. 2008. Lysophospholipid acyltransferases and arachidonate recycling in human neutrophils. J Biol Chem 283: 30235-30245. 45. Shindou, H., D. Hishikawa, H. Nakanishi, T. Harayama, S. Ishii, R. Taguchi, and T. Shimizu. 2007. A single enzyme catalyzes both platelet-activating factor production and membrane biogenesis of inflammatory cells. Cloning and characterization of acetyl-CoA:LYSO-PAF acetyltransferase. J Biol Chem 282: 6532-6539. 46. Shindou, H., and T. Shimizu. 2009. Acyl-CoA:lysophospholipid acyltransferases. J Biol Chem 284: 1-5. 47. Asai, K., T. Hirabayashi, T. Houjou, N. Uozumi, R. Taguchi, and T. Shimizu. 2003. Human group IVC phospholipase A2 (cPLA2gamma). Roles in the membrane remodeling and activation induced by oxidative stress. J Biol Chem 278: 8809-8814. 48. Balsinde, J., I. D. Bianco, E. J. Ackermann, K. Conde-Frieboes, and E. A. Dennis. 1995. Inhibition of calcium-independent phospholipase A2 prevents arachidonic acid incorporation and phospholipid remodeling in P388D1 macrophages. Proc Natl Acad Sci U S A 92: 8527-8531. 49. Lucas, K. K., and E. A. Dennis. 2004. The ABC's of Group IV cytosolic phospholipase A2. Biochim Biophys Acta 1636: 213-218. 50. Manguikian, A. D., and S. E. Barbour. 2004. Cell cycle dependence of group VIA calcium-independent phospholipase A2 activity. J Biol Chem 279: 52881-52892. 51. Yamashita, A., R. Kamata, N. Kawagishi, H. Nakanishi, H. Suzuki, T. Sugiura, and K. Waku. 2005. Roles of C-terminal processing, and involvement in transacylation reaction of human group IVC phospholipase A2 (cPLA2gamma). J Biochem 137: 557-567. 52. Yamashita, A., K. Tanaka, R. Kamata, T. Kumazawa, N. Suzuki, H. Koga, K. Waku, and T. Sugiura. 2009. Subcellular localization and lysophospholipase/transacylation activities of human group IVC phospholipase A2 (cPLA2gamma). Biochim Biophys Acta 1791: 1011-1022.

63

53. Resch, K., and W. Bessler. 1981. Activation of lymphocyte populations with concanavalin A or with lipoprotein and lipopeptide from the outer cell wall of Escherichia coli: correlation of early membrane changes with induction of macromolecular synthesis. Eur J Biochem 115: 247-252. 54. Li, J., S. F. Ding, N. A. Habib, B. F. Fermor, C. B. Wood, and R. S. Gilmour. 1994. Partial characterization of a cDNA for human stearoyl-CoA desaturase and changes in its mRNA expression in some normal and malignant tissues. Int J Cancer 57: 348-352. 55. Scaglia, N., J. M. Caviglia, and R. A. Igal. 2005. High stearoyl-CoA desaturase protein and activity levels in simian virus 40 transformed-human lung fibroblasts. Biochim Biophys Acta 1687: 141-151. 56. Thai, S. F., J. W. Allen, A. B. DeAngelo, M. H. George, and J. C. Fuscoe. 2001. Detection of early gene expression changes by differential display in the livers of mice exposed to dichloroacetic acid. Carcinogenesis 22: 1317-1322. 57. Yahagi, N., H. Shimano, K. Hasegawa, K. Ohashi, T. Matsuzaka, Y. Najima, M. Sekiya, S. Tomita, H. Okazaki, Y. Tamura, Y. Iizuka, K. Ohashi, R. Nagai, S. Ishibashi, T. Kadowaki, M. Makuuchi, S. Ohnishi, J. Osuga, and N. Yamada. 2005. Co-ordinate activation of lipogenic enzymes in hepatocellular carcinoma. Eur J Cancer 41: 1316-1322. 58. Hess, D., J. W. Chisholm, and R. A. Igal. Inhibition of stearoylCoA desaturase activity blocks cell cycle progression and induces programmed cell death in lung cancer cells. PLoS One 5: e11394. 59. Igal, R. A. Stearoyl-CoA desaturase-1: a novel key player in the mechanisms of cell proliferation, programmed cell death and transformation to cancer. Carcinogenesis 31: 1509-1515. 60. Minville-Walz, M., A. S. Pierre, L. Pichon, S. Bellenger, C. Fevre, J. Bellenger, C. Tessier, M. Narce, and M. Rialland. Inhibition of stearoyl-CoA desaturase 1 expression induces CHOP-dependent cell death in human cancer cells. PLoS One 5: e14363. 61. Scaglia, N., and R. A. Igal. 2005. Stearoyl-CoA desaturase is involved in the control of proliferation, anchorage-independent growth, and survival in human transformed cells. J Biol Chem 280: 25339-25349. 62. Scaglia, N., and R. A. Igal. 2008. Inhibition of Stearoyl-CoA Desaturase 1 expression in human lung adenocarcinoma cells impairs tumorigenesis. Int J Oncol 33: 839-850. 63. Balsinde, J., B. Fernandez, and J. A. Solis-Herruzo. 1994. Increased incorporation of arachidonic acid into phospholipids in zymosan-stimulated mouse peritoneal macrophages. Eur J Biochem 221: 1013-1018. 64. Fonteh, A. N., and F. H. Chilton. 1992. Rapid remodeling of arachidonate from phosphatidylcholine to phosphatidylethanolamine pools during mast cell activation. J Immunol 148: 1784-1791. 65. Fonteh, A. N., and F. H. Chilton. 1993. Mobilization of different arachidonate pools and their roles in the generation of leukotrienes and free arachidonic acid during immunologic activation of mast cells. J Immunol 150: 563-570. 66. Neville, N. T., J. Parton, J. L. Harwood, and S. K. Jackson. 2005. The activities of monocyte lysophosphatidylcholine acyltransferase and coenzyme A-independent transacylase are changed by the inflammatory cytokines tumor necrosis factor alpha and interferon gamma. Biochim Biophys Acta 1733: 232-238. 67. Winkler, J. D., C. M. Sung, L. Huang, and F. H. Chilton. 1994. CoA-independent transacylase activity is increased in human neutrophils after treatment with tumor necrosis factor alpha. Biochim Biophys Acta 1215: 133-140.

64

68. Surette, M. E., J. D. Winkler, A. N. Fonteh, and F. H. Chilton. 1996. Relationship between arachidonate--phospholipid remodeling and apoptosis. Biochemistry 35: 9187-9196. 69. Surette, M. E., A. N. Fonteh, C. Bernatchez, and F. H. Chilton. 1999. Perturbations in the control of cellular arachidonic acid levels block cell growth and induce apoptosis in HL-60 cells. Carcinogenesis 20: 757-763. 70. Fonteh, A. N., T. LaPorte, D. Swan, and M. A. McAlexander. 2001. A decrease in remodeling accounts for the accumulation of arachidonic acid in murine mast cells undergoing apoptosis. J Biol Chem 276: 1439-1449. 71. Cao, Y., A. T. Pearman, G. A. Zimmerman, T. M. McIntyre, and S. M. Prescott. 2000. Intracellular unesterified arachidonic acid signals apoptosis. Proc Natl Acad Sci U S A 97: 11280-11285. 72. Chan, T. A., P. J. Morin, B. Vogelstein, and K. W. Kinzler. 1998. Mechanisms underlying nonsteroidal antiinflammatory drug-mediated apoptosis. Proc Natl Acad Sci U S A 95: 681-686. 73. Hollenbach, P. W., D. L. Zilli, and S. M. Laster. 1992. Inhibitors of transcription and translation act synergistically with tumor necrosis factor to cause the activation of phospholipase A2. J Biol Chem 267: 39-42. 74. Jayadev, S., H. L. Hayter, N. Andrieu, C. J. Gamard, B. Liu, R. Balu, M. Hayakawa, F. Ito, and Y. A. Hannun. 1997. Phospholipase A2 is necessary for tumor necrosis factor alpha-induced ceramide generation in L929 cells. J Biol Chem 272: 17196-17203. 75. Shulga, Y. V., M. K. Topham, and R. M. Epand. 2011. Study of arachidonoyl specificity in two enzymes of the PI cycle. J Mol Biol 409: 101-112. 76. Logan, M. R., and C. A. Mandato. 2006. Regulation of the actin cytoskeleton by PIP2 in cytokinesis. Biol Cell 98: 377-388. 77. Balsinde, J., M. A. Balboa, and E. A. Dennis. 1997. Inflammatory activation of arachidonic acid signaling in murine P388D1 macrophages via sphingomyelin synthesis. J Biol Chem 272: 20373-20377. 78. Balsinde, J., and E. A. Dennis. 1997. Function and inhibition of intracellular calcium-independent phospholipase A2. J Biol Chem 272: 16069-16072.

65

4. CHAPITRE IV: The role of Stearoyl-CoA desaturase in

proliferation maintenance of human leukemic Jurkat T cells

*Yasmina Néchadi, *Philippe Pierre Robichaud, Eric Boilard and Marc E Surette


Cet article est en préparation


P.P.R. et Y.N. ont contribués aux travaux expérimentaux. P.P.R., Y.N., E.B. et M.E.S. ont

contribués au développement du plan expérimental et ont écrit le manuscrit.

66

4.1. Résumé La stéaroyl-CoA désaturase-1 (SCD1), qui catalyse la delta-9 désaturation des acyl-CoA

saturés, est un élément clé dans la synthèse de novo des acides gras (AG) mono-insaturés. La

SCD1 fut antérieurement démontrée pour être impliquée dans la survie et la prolifération de

plusieurs carcinomes. Nous avons démontré une augmentation significative du contenu

cellulaire en AG mono-insaturés et une induction de l’expression de la SCD1 chez les

lymphocytes T en prolifération comparativement aux cellules T au repos lors de notre

première publication. Dans cette deuxième étude, nous avons évalué le rôle de la SCD1 dans

la prolifération et la survie de la lignée cellulaire leucémique Jurkat. L’atténuation de la

SCD1 induit une diminution significative de l’acide palmitoléique (16:1n-7) et l’acide

vaccénique (18:1n-7), mais pas de l’acide oléique (18:1n-9). L’atténuation de la SCD1 n’a

eu aucun effet sur la prolifération cellulaire des cellules Jurkat. La SCD5 serait possiblement

un élément compensateur de l’activité delta-9 désaturase responsable du maintien de l’acide

oléique (18:1n-9) cellulaire et de la capacité proliférative. L’inhibition ou l’atténuation de la

combinaison des deux gènes, SCD1 et SCD5, pourrait être une stratégie thérapeutique pour

des maladies prolifératives.

67

4.2. Abstract Cancer cells undergo metabolic alteration by energy pathway reprogramming to sustain

tumoral growth. Metabolic changes such as increased lipogenesis and monounsaturated fatty

acid (MUFA) dependence are frequently reported. Stearoyl-CoA desaturase 1 (SCD1), a key

enzyme in the delta 9 desaturation of fatty acids (FA) has been shown to be a therapeutic

target in many carcinomas. However, the role of SCD1 in the proliferation and survival of

lymphoid cells is still unknown. In the studies reported here, we investigated the role of SCD1

in the proliferation of leukemic T cells line Jurkat. SCD1 knockdown was performed on

Jurkat cells. SCD1 inhibition modulated cellular FA profiles with decreases in palmitate

(16:0) desaturation products 16:1n-7 and 18:1n-7. The stearate desaturation product (18:1n-

9) was almost unaltered. Contrary to carcinomas, proliferation was unaltered following

SCD1 knockdown in Jurkat. SCD5 isoform is may be responsible for the maintenance of

cellular 18:1n-9 content and cell proliferation following SCD1 sillencing. Overall, targeting

both SCD isoforms 1 and 5 may be necessary to have a therapeutic impact on T cell leukemia.

68

4.3. Introduction Cancers cells are characterized by an altered metabolism, which tends to activate various

metabolic pathways, including lipogenesis, to maintain the high rate of tumoral growth and

promote features of malignant transformation (1-3). Cancerous cells activate de novo fatty

acid (FA) biosynthesis to support membrane phospholipid biosynthesis required for cell

proliferation, thereby resulting in elevated amounts of saturated fatty acids (SFA) and

monounsaturated fatty acids (MUFA) (2-6). The key enzyme of the MUFA biosynthesis is

the stearoyl-CoA desaturase-1 (SCD1). SCD1 is the main enzyme in the desaturation process

of FA that catalyzes the conversion of SFA to MUFA. SCD1 introduces the first double bond

in the cis-delta 9 position of a fatty acyl-CoA, thereby producing MUFAs, which are vital

elements for membrane biogenesis and appropriate fluidity. SCD1 acts mainly on palmitic

acid (16:0) and stearic acid (18:0) to form palmitoleic (16:1n-7) and oleic acid (18:1 n-9),

respectively (7-9). However, there is another stearoyl-CoA desaturase in humans, the SCD5,

which is not as well characterized as SCD1 (10, 11).

A growing number of reports indicate a positive correlation between SCD1 expression and

cell malignancy. More specifically, SCD1 expression and activity are upregulated in several

carcinomas including as hepatocarcinomas, and those of the lung, breast and prostate, and its

inhibition or knockdown decreases carcinoma cell proliferation (12-22). In the same way,

high MUFA levels have been associated with poor prognosis and greater death rates in

patients (20, 21, 23). As for SCD5, little is known about its physiological and pathological

functions, although recent studies show its implication in neuronal differentiation and

malignancy in melanomas (24, 25).

In contrast to the elucidated role of SCD1 in many carcinomas, the role of SCD1 in

leukemogenesis and hematopoiesis remains unknown, although some recent studies in stem

cells suggest that FA metabolism is implicated in multiple myeloma and in leukemia

development where SCD1 may even play a suppressive role (26). Similarly, although SCD1

expression was recently shown to be significantly enhanced following the activation of

primary T cells (27), its role in the maintenance of lymphocyte proliferation has not been

investigated.

69

Given the identification of SCD1 as a potential therapeutic target for carcinomas, we set out

to investigate the effect of SCD1 knockdown on FA composition and on proliferation of the

human Jurkat T cell leukemia cell line. This is to determine whether SCD1 represents a viable

antineoplastic target for T cell leukemia. Our results demonstrate that contrary to carcinomas,

SCD1 is not required for the maintenance of Jurkat or T cell proliferation, possibly due to

the compensating effect of SCD5 expression in these cells.

4.4. Materials and methods Reagents

Cell culture media RPMI-1640, fetal bovine serum (FBS) and tetracycline-free FBS were

purchased from Thermo Fisher Scientific (Mississauga, ON, Canada). Doxycycline hyclate,

horseradish peroxidase-conjugated anti-B-actin (A3854), boron trifluoride (14% in

methanol) and bovine serum albumin were purchased from Sigma-Aldrich (Oakville, ON,

Canada). Anti-stearoyl-CoA desaturase 1 (SCD1) (ab19862) was from Abcam (Toronto,

ON).

Cell Culture

The Jurkat cells were purchased from ATCC (Manassas, VA) and were maintained in RPMI

1640 medium supplemented with 10% FBS at 37°C in a humidified 5% CO2 atmosphere.

Stably transfected clonal populations of Jurkat cells bearing a doxycycline-inducible

expression vector (DharmaconTM GIPZ TM Lentiviral shRNA, GE Healthcare) with an

shRNA sequence targeting human SCD1 or a random sequence were developed. Clones were

cultured in RPMI 1640 medium supplemented with 10% Tet-free FBS. In some experiments

RPMI 1640 medium containing 2% FBS were utilized to reduce the contribution of

exogenous FA.

SCD1 knockdown

Before treatments, Jurkat cells and Jurkat cell clones were cultured for 3 to 5 days in culture

medium containing the indicated amount of FBS. For knockdown experiments, Jurkat cell

clones were then treated with doxycycline (1 µg/ml) for the indicated periods of time. Culture

medium was refreshed every 2 days.

70

Cell Proliferation and apoptosis assays

To measure cell proliferation, cells were subjected first to staining with carboxyfluorescein

succinimidyl ester (CFSE) using the CellTrace™ CFSE Cell Proliferation Kit as described

by the manufacturer (Molecular Probes, Cat # C34554). Briefly, cells were resuspended in

PBS containing 1 µM of CFSE diluted in DMSO, were incubated for 20 min at 37 °C

followed by 2 washes with culture media to remove free dye. Then the appropriate SCD1

inhibition protocol was followed, and cell proliferation was assessed by flow cytometry for

the indicated number of days. The analyses were performed using a Beckman Coulter

Cytometry FC 500 flow cytometer, and the results were analyzed with Kaluza Software.

Fatty acid analysis

Cellular lipids were extracted into chloroform using a modified version of the Bligh and Dyer

method (28) as fully described (12). The internal standard 1,2-diheptadecanoyl sn-glycerol-

3-phosphorylcholine (Biolynx, Brockville, On) was used. The extracted samples were dried

under gaseous nitrogen, the lipids were saponified by adding 400 µl of 0.5 M KOH in

methanol and heated at 100 °C for 15 min. Fatty acid methyl ester (FAME) were then

prepared by adding 500 µl of 14% boron trifluoride (BF3) in methanol (Sigma-Aldrich,

Oakville, ON, Canada) and heating at 100 °C for 10 min. The FAME were separated and

quantified by gas chromatography (GC) using a Thermo Trace GC equipped with a Trace-

FAME column with FID detector and Xcalibur software (Thermo, Austin TX) (29, 30).

FAME peak identities and quantities were determined by retention times and standard curves.

Cellular FA profiles were determined and SCD1 product/substrate ratios were used as an

indicator of SCD1 activity (31).

Western blot analyses

Cells were washed in PBS and resuspended in lysis buffer (150 mM NaCl, 1% Nonidet P-

40, 2 mM EDTA and 50 mM Tris-HCL, pH 7.6) containing protease inhibitor cocktail

(Roche). Following a vortex, 5× Laemmli sample buffer was added (300 mM Tris-HCL, 50%

glycerol, 10% SDS, 25% β-mercaptoethanol and 0.05% bromophenol blue, pH 6.8), samples

were boiled for 10 min then proteins were quantified by EZQ protein quantitation kit

(Molecular Probes). Thirty µg of cellular proteins were separated on Criterion 4-15%

71

polyacrylamide gels (Bio-Rad), proteins were transferred onto PVDF membranes, which

were then blocked in 5% non-fat dry milk in TBS-Tween. Western blotting was then

performed using anti-SCD1 antibody and horseradish peroxidase-conjugated secondary

antibody, or horseradish peroxidase-conjugated anti-β-actin. Membranes were visualized

using Amersham ECL Prime (GE Healthcare) and images were taken with an Alpha Innotech

Fluorchem Imager (San Leandro, CA).

Ethics

The institutional review committee for research involving human subjects of Université de

Moncton approved this study. All subjects provided informed consent before their

participation.

Statistical analyses

Analysis of differences between treatments was performed using the two-tailed Student’s t-

test using GraphPad Prism software.

4.5. Results SCD1 knockdown and fatty acid analysis in Jurkat cells

SCD1 knockdown using inducible shRNA was performed to assess the importance of SCD1

in the proliferation and survival of human Jurkat cells. Jurkat clones 29 and 36, harboring a

doxycycline-inducible shRNA sequence against SCD1, and control NS harboring a

doxycycline-inducible random shRNA sequence, were used. After incubation of cells for six

days with or without 1 µg/ml doxycycline, clones 29 and 36 showed a significant decrease

in the expression of SCD1 protein with no effect in the control NS (Figure 4.1). Experiments

conducted in reduced (2% FBS) or rich media (10% FBS) showed similar results.

72

Figure 4.1. Activation of knockdown in Jurkat cell clones induces diminution in

SCD1 protein expression.

Jurkat cell control NS, clone 29 and clone 36 were incubated for 6 days in Tet-free

serum media supplemented or not with 1µg/ml of doxycycline. After 6 days of

treatment, cellular proteins were extracted and separated by SDS-PAGE. Immunoblot

analysis of SCD1 expression was performed using actin as a loading control in cells

incubated in rich serum condition (10% FBS) (A) or in reduced serum condition (2%

FBS) (B). Graphs show densitometry quantification of the SCD1 blots in rich (C) and

reduced (D) serum conditions. Immunoblots are representative of three separate

experiments, and data are means ± SEM, n=3 independent experiments. *Different

from non-treated (-Dox) control as determined by Student’s t-test (p < 0.05).

The cellular FA profiles were then measured to determine the impact of SCD1 knockdown

on cellular FA composition. Consistent with the decrease in SCD1 expression, doxycycline

treatment of clones 29 and 36 was accompanied by significant decreases in the proportion of

the 16:1n-7 and the 18:1n-7 as well as in SCD1 product/substrate ratios, a measure of cellular

SCD1 activity (31) (Table 4.1).

73

Table 4.1. Fatty acid composition of Jurkat cells with induced SCD1 knockdown.

Jurkat cells clones (NS, 29 and 36) were incubated for 6 days in Tet-free rich (10%

FBS) or reduced (2% FBS) media supplemented or not with 1ug/ml of doxycycline.

Cellular lipids were extracted, and fatty acid methyl esters were prepared and

quantified by GC/FID. The results are expressed as percentage total cellular FA. The

results are the means ± SEM, n =4 independent experiments. * Different from control

(p < 0.05) as determined by student’s t-test.

A. 10% Serum

Clone NS Clone 29 Clone 36 Fatty acids Ctrl DOX Ctrl DOX Ctrl DOX 16:0 30.3±1.6 29.3±2.6 32.0±1.2 34.1±2.7 28.8±0.3 31.5±1.8 16:1 n-7 2.1±0.1 2.0±0.3 2.1±0.1 1.1±0.2* 1.5±0.1 0.7±0.1* 18:0 17.3±1.4 17.5±3.0 15.3±1.2 19.4±2.6 15.0±0.4 19.2±1.9 18:1 n-9 19.1±1.1 18.8±1.8 19.8±0.8 18.0±1.7 21.1±0.9 17.7±1.4 18:1 n-7 7.9±0.5 7.5±0.6 7.7±0.4 6.4±0.3* 7.8±0.5 5.8±0.4* 16:1 n-7/16:0 0.07±0.0 0.07±0.0 0.07±0.0 0.04±0.0* 0.05±0.0 0.02±0.0* 18:1n-9/18:0 1.13±0.1 1.19±0.2 1.32±0.1 1.00±0.2* 1.4±0.0 0.96±0.1* 16:1n-7+18:1n-7/16:0 0.34±0.0 0.34±0.0 0.31±0.0 0.23±0.0 0.33±0.0 0.21±0.0*

B. 2% Serum

Clone NS Clone 29 Clone 36 Fatty acids Ctrl DOX Ctrl DOX Ctrl DOX

16:0 31.3±2.3 30.0±1.4 28.4±1.6 30.3±1.0 29.4±1.1 26.0±1.2 16:1 n-7 3.4±0.3 3.4±0.2 3.2±0.2 1.9±0.3* 2.9±0.1 1.5±0.0* 18:0 18.4±1.4 17.6±1.3 14.7±0.6 20.3±1.5* 15.1±0.8 18.4±0.8* 18:1 n-9 21.4±1.7 23.0±1.1 25.8±1.0 22.5±1.0 27.4±1.2 29.1±1.4 18:1 n-7 8.7±0.2 9.3±0.2 8.9±0.5 7.3±0.4 9.4±0.5 6.8±0.2* 16:1 n-7/16:0 0.11±0.0 0.12±0.0 0.11±0.0 0.06±0.0* 0.1±0.0 0.06±0.0* 18:1n-9/18:0 1.2±0.1 1.33±0.1 1.75±0.1 1.33±0.1 1.83±0.1 1.60±0.1* 16:1n-7+18:1n-7/16:0 0.4±0.0 0.43±0.0 0.42±0.0 0.31±0.0* 0.42±0.0 0.32±0.0*

These changes were observed in both rich (Table 4.1A) and reduced serum media conditions

(Table 4.1B), but the 18:0 was significantly increased in reduced serum media conditions

(Table 4.1B). However, the amount of the other product of the SCD1, the 18:1n-9, was not

significantly decreased. FA profiles of the NS control clone were unchanged following

doxycycline treatment in both in rich or reduced serum conditions.

74

SCD1 knockdown and cell proliferation in Jurkat cells

As protein expression and activity measurements confirmed SCD1 knockdown in Jurkat cell

clones, the impact on cell proliferation was measured. Cells were maintained in rich media

(10% FBS) or reduced media (2% FBS) for up to 6 days in the presence or absence of

doxycycline, and cells were counted. Overall, incubation of cells in reduced serum media

slowed their growth kinetics. However, the presence of doxycycline in both media conditions

resulted in no difference in cell numbers of any of the clones compared to control cells grown

in the absence of doxycycline (Figure 4.2A and 4.2B).

Figure 4.2. SCD1 knockdown and cell proliferation in Jurkat cell clones.

Jurkat cell clones NS, 29 and 36 were stained with CFSE or not prior to incubation for

6 days in rich (10% FBS) or reduced (2% FBS) Tet-free serum media supplemented

0 2 4 60

10

20

30

40

Days

Cel

l nu

mb

er ×

106

0 2 4 60

10

20

30

Days

Cel

l nu

mb

er ×

106

NS-NS+29-29+36-36+

A B

C

D

Clone&NS Clone&36Clone&29

CFSE

Even

ts

0

5

10

15

20

Fluo

rese

nce

arith

miti

c m

ean

Day 2Day 4Day 6

- + - + - + DoxClone NS Clone 29 Clone 36

75

or not with 1µg/ml of doxycycline. The culture media were changed every two days

and cells were then counted or assessed for CFSE fluorescence intensities after 2, 4

and 6 days post-treatment. Count of cells incubated in 10% (A) and 2% (B) serum

media. CFSE fluorescence intensities from cells cultured in rich media were analyzed

by flow cytometry (C). Bar diagrams showing the arithmetic means of cell

fluorescence intensities (D). Flow cytograms are representative of three independent

experiments. Data are means ± SEM, n=3 independent experiments.

To obtain a more specific measure of cell proliferation, cells were stained with CFSE, an

amine-reactive fluorescent ester that binds to cellular proteins and is distributed equally

between daughter cells during cell division. Proliferation can then be tracked over time using

flow cytometry analysis of cellular CFSE fluorescence intensities. Cells were stained with

CFSE prior to incubation in culture media supplemented with 1µg/ml of doxycycline or its

diluent, and CFSE fluorescence intensities were measured over the next 6 days. The

fluorescence intensities of all clones decreased with time as expected for proliferating cells,

however the fluorescence cytograms of doxycycline-treated and control cells were

superimposed at all time points indicating that SCD1 silencing had no impact on cell

proliferation (Figure 4.2C). When the mean CFSE fluorescence intensities were quantified

no significant differences in mean fluorescence intensities were measured between

doxycycline-treated and control cells (Figure 4.2D). These flow cytometry results concurred

with the cell counting results.

4.6. Discussion Since the characterization of the Warburg effect, cell metabolism has become an area of focus

in cancer research. This altered metabolism is also associated with a shift in the cell’s

requirement for FA that are necessary to maintain appropriate membrane phospholipid

synthesis that accompanies cell proliferation. Therefore, lipogenesis has gained attention as

an attractive cancer target. Amongst the lipogenic enzymes, SCD1 was shown to be a

potential target in many carcinomas (7, 12-15, 17-19, 22, 32). However, the importance of

SCD1 in many circulatory cancers such as leukemia is not known. Similarly, MUFA content

and SCD1 expression were shown to be increased in primary human T cells that had been

76

stimulated to proliferate (27), however the importance of SCD1 expression in activated T

cells is not known.

In the current study, the requirement of SCD1 expression for the proliferation and survival

of T cell leukemia Jurkat cells was investigated. Using shRNA silencing of SCD1, the loss

of SCD1 activity resulted in significant changes in cellular FA profiles consistent with SCD1

inhibition (12). However, unlike carcinoma cells, SCD1 silencing did not impair proliferation

in Jurkat cells. While some carcinomas are resistant to SCD1 inhibition because they are able

to access extracellular MUFA when grown in FBS-rich media (13, 33), Jurkat cells cultured

in reduced serum conditions (2% FBS) were still resistant to SCD1 silencing as cells

proliferation was not affected. Overall, this suggests that SCD1 may not be a therapeutic

target for leukemia.

The silencing of SCD1 significantly impacted on the cellular FA profiles in Jurkat cells that

is consistent with a loss of SCD1 activity. The SCD1 silencing induced a significant decrease

in palmitate desaturation products 16:1n-7 and 18:1 n-7 that resulted in changes in

MUFA/SFA ratios, typically used as a measure of cellular SCD1 activity. However, silencing

of SCD1 had no significant impact on cellular oleate (18:1n-9) levels. This may be because

oleic acid is a prominent serum FA and the cells were able to more easily obtain exogenous

oleate compared to other MUFA. Cellular stearic acid was significantly increased in Jurkat

cells following SCD1 silencing, likely as a result of the shuttling of palmitate toward the

elongation pathway when desaturation is ineffective. This increase in stearic acid availability

could potentially explain the maintenance of 18:1n-9 levels as any residual SCD1 activity

would be exposed to greater amounts of the 18:0 substrate.

The only other known SCD in human cells is SCD5 whose expression is mainly associated

with neural tissue and has not been reported in lymphoid cells. SCD5 shows a preference for

oleic acid as a substrate when overexpressed in the human melanoma A375M cell line and

in a liver specific SCD5 transgenic mouse model which is SCD1 knockout (24, 34). However,

the opposite was shown with the overexpression of the human SCD5 in the mouse Neuro2a

cell line that increased the 16:1n-7/16:0 and 16:1n-7+18:1n-7/16:0 ratios but not the 18:1n-

77

9/18:0 ratios (25). Therefore, SCD5 expression could explain both the cellular FA profiles

observed, as well as the lack of effect of SCD1 silencing on cell proliferation. SCD5 is less

characterized than SCD1 and little is known about its physiological and pathological roles.

Overall, this study shows that the changes in FA profiles following SCD1 knockdown

suggest the presence of a compensatory stearoyl-CoA desaturase activity to maintain the

level of 18:1n-9, which is probably the SCD5. Unlike carcinomas, SCD1 knockdown is not

vital for the maintenance of cell proliferation in these lymphoid cells likely because of a

compensatory effect of SCD5 that allows cells to maintain adequate FA unsaturation.

Therefore, SCD1 may not be a good therapeutic target in leukemia but targeting both SCD

isoforms 1 and 5 may be necessary to have a therapeutic impact on T cells leukemia.

4.7. Abbreviations SCD1: stearoyl-CoA désaturase-1; SCD5: stearoyl-CoA désaturase-5, FA: fatty acid;

MUFA: monounsaturated fatty acid; SFA: saturated fatty acid; PUFA: polyunsaturated fatty

acid; CFSE: carboxy-fluorescein diacetate succinimidyl ester.

4.8. Aknowledgements The authors thank Natalie Levesque and Jeremie Doiron for technical support with fatty acid

analysis. This work was supported by Canadian Institutes of Health Research (CIHR) and

New Brunswick Health Research Foundation (NBHRF) grants awarded to ME Surette. PP

Robichaud was supported by Doctoral Scholarships from the CIHR, the NBHRF and the

Fonds de recherche sur l'arthrite et les maladies rhumatismales de l’université Laval. E.

Boilard was the recipient of a New Investigator Award from the CIHR. ME Surette was

supported by the Canada Research Chair Program and a New Brunswick Innovation

Research Chair.

78

4.9. References 1. Zaidi, N., Lupien, L., Kuemmerle, N. B., Kinlaw, W. B., Swinnen, J. V., and

Smans, K. (2013) Lipogenesis and lipolysis: the pathways exploited by the cancer cells to acquire fatty acids. Progress in lipid research 52, 585-589

2. Daniels, V. W., Smans, K., Royaux, I., Chypre, M., Swinnen, J. V., and Zaidi, N. (2014) Cancer cells differentially activate and thrive on de novo lipid synthesis pathways in a low-lipid environment. PloS one 9, e106913

3. Swinnen, J. V., Brusselmans, K., and Verhoeven, G. (2006) Increased lipogenesis in cancer cells: new players, novel targets. Current opinion in clinical nutrition and metabolic care 9, 358-365

4. Ntambi, J. M., Miyazaki, M., and Dobrzyn, A. (2004) Regulation of stearoyl-CoA desaturase expression. Lipids 39, 1061-1065

5. Mashima, T., Seimiya, H., and Tsuruo, T. (2009) De novo fatty-acid synthesis and related pathways as molecular targets for cancer therapy. Br J Cancer 100, 1369-1372

6. Currie, E., Schulze, A., Zechner, R., Walther, T. C., and Farese, R. V., Jr. (2013) Cellular fatty acid metabolism and cancer. Cell metabolism 18, 153-161

7. Igal, R. A. (2011) Roles of StearoylCoA Desaturase-1 in the Regulation of Cancer Cell Growth, Survival and Tumorigenesis. Cancers (Basel) 3, 2462-2477

8. Paton, C. M., and Ntambi, J. M. (2009) Biochemical and physiological function of stearoyl-CoA desaturase. American journal of physiology. Endocrinology and metabolism 297, E28-37

9. Igal, R. A. (2016) Stearoyl CoA desaturase-1: New insights into a central regulator of cancer metabolism. Biochim Biophys Acta 1861, 1865-1880

10. Wang, J., Yu, L., Schmidt, R. E., Su, C., Huang, X., Gould, K., and Cao, G. (2005) Characterization of HSCD5, a novel human stearoyl-CoA desaturase unique to primates. Biochem Biophys Res Commun 332, 735-742

11. Castro, L. F., Wilson, J. M., Goncalves, O., Galante-Oliveira, S., Rocha, E., and Cunha, I. (2011) The evolutionary history of the stearoyl-CoA desaturase gene family in vertebrates. BMC Evol Biol 11, 132

12. Belkaid, A., Duguay, S. R., Ouellette, R. J., and Surette, M. E. (2015) 17beta-estradiol induces stearoyl-CoA desaturase-1 expression in estrogen receptor-positive breast cancer cells. BMC Cancer 15, 440

13. Mason, P., Liang, B., Li, L., Fremgen, T., Murphy, E., Quinn, A., Madden, S. L., Biemann, H. P., Wang, B., Cohen, A., Komarnitsky, S., Jancsics, K., Hirth, B., Cooper, C. G., Lee, E., Wilson, S., Krumbholz, R., Schmid, S., Xiang, Y., Booker, M., Lillie, J., and Carter, K. (2012) SCD1 inhibition causes cancer cell death by depleting mono-unsaturated fatty acids. PloS one 7, e33823

14. Minville-Walz, M., Pierre, A. S., Pichon, L., Bellenger, S., Fevre, C., Bellenger, J., Tessier, C., Narce, M., and Rialland, M. (2010) Inhibition of stearoyl-CoA desaturase 1 expression induces CHOP-dependent cell death in human cancer cells. PloS one 5, e14363

79

15. Mauvoisin, D., Charfi, C., Lounis, A. M., Rassart, E., and Mounier, C. (2013) Decreasing stearoyl-CoA desaturase-1 expression inhibits beta-catenin signaling in breast cancer cells. Cancer science 104, 36-42

16. Luyimbazi, D., Akcakanat, A., McAuliffe, P. F., Zhang, L., Singh, G., Gonzalez-Angulo, A. M., Chen, H., Do, K. A., Zheng, Y., Hung, M. C., Mills, G. B., and Meric-Bernstam, F. (2010) Rapamycin regulates stearoyl CoA desaturase 1 expression in breast cancer. Molecular cancer therapeutics 9, 2770-2784

17. Hess, D., Chisholm, J. W., and Igal, R. A. (2010) Inhibition of stearoylCoA desaturase activity blocks cell cycle progression and induces programmed cell death in lung cancer cells. PloS one 5, e11394

18. Fritz, V., Benfodda, Z., Rodier, G., Henriquet, C., Iborra, F., Avances, C., Allory, Y., de la Taille, A., Culine, S., Blancou, H., Cristol, J. P., Michel, F., Sardet, C., and Fajas, L. (2010) Abrogation of de novo lipogenesis by stearoyl-CoA desaturase 1 inhibition interferes with oncogenic signaling and blocks prostate cancer progression in mice. Molecular cancer therapeutics 9, 1740-1754

19. Scaglia, N., and Igal, R. A. (2008) Inhibition of Stearoyl-CoA Desaturase 1 expression in human lung adenocarcinoma cells impairs tumorigenesis. Int J Oncol 33, 839-850

20. Holder, A. M., Gonzalez-Angulo, A. M., Chen, H., Akcakanat, A., Do, K. A., Fraser Symmans, W., Pusztai, L., Hortobagyi, G. N., Mills, G. B., and Meric-Bernstam, F. (2013) High stearoyl-CoA desaturase 1 expression is associated with shorter survival in breast cancer patients. Breast cancer research and treatment 137, 319-327

21. Chajes, V., Joulin, V., and Clavel-Chapelon, F. (2011) The fatty acid desaturation index of blood lipids, as a biomarker of hepatic stearoyl-CoA desaturase expression, is a predictive factor of breast cancer risk. Current opinion in lipidology 22, 6-10

22. Scaglia, N., Chisholm, J. W., and Igal, R. A. (2009) Inhibition of stearoylCoA desaturase-1 inactivates acetyl-CoA carboxylase and impairs proliferation in cancer cells: role of AMPK. PloS one 4, e6812

23. Bougnoux, P., Chajes, V., Lanson, M., Hacene, K., Body, G., Couet, C., and Le Floch, O. (1992) Prognostic significance of tumor phosphatidylcholine stearic acid level in breast carcinoma. Breast cancer research and treatment 20, 185-194

24. Bellenghi, M., Puglisi, R., Pedini, F., De Feo, A., Felicetti, F., Bottero, L., Sangaletti, S., Errico, M. C., Petrini, M., Gesumundo, C., Denaro, M., Felli, N., Pasquini, L., Tripodo, C., Colombo, M. P., Care, A., and Mattia, G. (2015) SCD5-induced oleic acid production reduces melanoma malignancy by intracellular retention of SPARC and cathepsin B. J Pathol 236, 315-325

25. Sinner, D. I., Kim, G. J., Henderson, G. C., and Igal, R. A. (2012) StearoylCoA desaturase-5: a novel regulator of neuronal cell proliferation and differentiation. PloS one 7, e39787

26. Zhang, H., Li, H., Ho, N., Li, D., and Li, S. (2012) Scd1 plays a tumor-suppressive role in survival of leukemia stem cells and the development of chronic myeloid leukemia. Molecular and cellular biology 32, 1776-1787

80

27. Robichaud, P. P., Boulay, K., Munganyiki, J. E., and Surette, M. E. (2013) Fatty acid remodeling in cellular glycerophospholipids following the activation of human T cells. J Lipid Res 54, 2665-2677

28. Bligh, E. G., and Dyer, W. J. (1959) A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37, 911-917

29. Lefort, N., LeBlanc, R., Giroux, M. A., and Surette, M. E. (2016) Consumption of Buglossoides arvensis seed oil is safe and increases tissue long-chain n-3 fatty acid content more than flax seed oil - results of a phase I randomised clinical trial. J Nutr Sci 5, e2

30. Surette, M. E., Koumenis, I. L., Edens, M. B., Tramposch, K. M., and Chilton, F. H. (2003) Inhibition of leukotriene synthesis, pharmacokinetics, and tolerability of a novel dietary fatty acid formulation in healthy adult subjects. Clin Ther 25, 948-971

31. Sjögren, P., Sierra-Johnson, J., Gertow, K., Rosell, M., Vessby, B., de Faire, U., Hamsten, A., Hellenius, M. L., and Fisher, R. M. (2008) Fatty acid desaturases in human adipose tissue: relationships between gene expression, desaturation indexes and insulin resistance. Diabetologia 51, 328-335

32. Igal, R. A. (2010) Stearoyl-CoA desaturase-1: a novel key player in the mechanisms of cell proliferation, programmed cell death and transformation to cancer. Carcinogenesis 31, 1509-1515

33. Roongta, U. V., Pabalan, J. G., Wang, X., Ryseck, R. P., Fargnoli, J., Henley, B. J., Yang, W. P., Zhu, J., Madireddi, M. T., Lawrence, R. M., Wong, T. W., and Rupnow, B. A. (2011) Cancer cell dependence on unsaturated fatty acids implicates stearoyl-CoA desaturase as a target for cancer therapy. Molecular cancer research : MCR 9, 1551-1561

34. Burhans, M. S., Flowers, M. T., Harrington, K. R., Bond, L. M., Guo, C. A., Anderson, R. M., and Ntambi, J. M. (2015) Hepatic oleate regulates adipose tissue lipogenesis and fatty acid oxidation. J Lipid Res 56, 304-318

81

5. CHAPITRE V: Polyunsaturated fatty acid elongation and

desaturation following activation of human T cells: ELOVL5

is responsible for fatty acid elongation

*Philippe Pierre Robichaud, *Jean Éric Munganyiki, Eric Boilard and Marc E Surette


Cet article a été soumis chez BBA Molecular and Cell Biology of Lipids le 26 Mai 2017,

Manuscript Number : BBALIP-17-143.


P.P.R. et J.E.M. ont contribués aux travaux expérimentaux. P.P.R., J.E.M., E.B. et M.E.S.

ont contribués au développement du plan expérimental et ont écrit le manuscrit.

82

5.1. Résumé Les acides gras (AG) polyinsaturés sont les principaux constituants des

glycérophospholipides qui forment la bicouche des membranes cellulaires. Cependant, les

changements dans la capacité cellulaire d’incorporer et de métaboliser les AG polyinsaturés

quand les cellules entrent dans le cycle cellulaire ne sont pas très bien connus. Dans cette

étude, nous avons mesuré l’incorporation et le métabolisme des AG polyinsaturés exogènes

chez les cellules T primaires humains au repos et en prolifération ainsi que chez la lignée

lymphocytaire T Jurkat. Les cellules T en prolifération et la lignée Jurkat ont une très grande

capacité d’incorporer les AG polyinsaturés de 18 et 20 carbones comparativement aux

cellules au repos. Les cellules T en prolifération et les Jurkat ont également une plus grande

capacité d’élongation et de désaturation des AG n-3 et n-6 de 18-carbones que les cellules T

en repos et ont acquis la capacité d'élongation des AG polyinsaturés de 20-carbones. En

accord avec ces observations, une induction significative de l’expression génique et

protéinique des désaturases 1 et 2 (FADS1 et FADS2) ainsi que l’élongase 5 (ELOVL5) fut

mesurée chez les cellules T en prolifération comparativement au cellules T au repos. Par

contre, l’expression génique et protéinique de l’élongase 2 était non mesurable chez les

cellules T humaines primaire et chez les Jurkat. L’atténuation de l’expression de l’ELVOL5

chez les cellules T en prolifération et les Jurkat modifie significativement le profil des AG

mono-insaturés et polyinsaturés, et inhibe significativement l’élongation des AG

polyinsaturés omega-3 et omega-6 exogènes de 18 et 20 carbones. Pour conclure, l’induction

de la prolifération des lymphocytes T primaires humains est associée avec une augmentation

significative de la capacité d’incorporer et de métaboliser les AG polyinsaturés exogènes

comparativement au cellules T au repos, et l’ELOVL5 est l’enzyme responsable de

l’élongation des AG polyinsaturés omega-3 et omega-6 de 18 et 20 carbones chez ces

cellules.

83

5.2. Abstract Polyunsaturated fatty acids (PUFA) are main constituents of the glycerophospholipids that

form the bilayer of cellular membranes. However, changes in the capacities to incorporate

and metabolize PUFA when cells enter the cell cycle have not been thoroughly studied. In

this study, differences in the incorporation and metabolism of exogenous PUFA in resting

and proliferating primary human T cells and in the human Jurkat cell line were measured.

Overall proliferating T cells and Jurkat cells had a much greater capacity to take up

exogenous 18-carbon and 20-carbon PUFA. Proliferating T cells and Jurkat cells also showed

a greater capacity to elongate and desaturate 18-carbon n-3 and n-6 substrates than resting T

cells and acquired the capacity to elongate 20-carbon PUFA. Consistent with these

observations, a significant increase in gene and protein expression of fatty acid desaturases

1 and 2 (FADS1 and FADS2) as well as the elongation of very long chain fatty acids protein

5 (ELOVL5) were measured in proliferating T cells compared to resting T cells. However,

no quantifiable ELOVL2 gene and protein expression was measured. Knockdown of

ELVOL5 in T cells and Jurkat cells significantly impacted the cellular monounsaturated and

PUFA profile and strongly impaired elongation of exogenous 18-carbon and 20-carbon

PUFA from the n-3 and n-6 families. In conclusion, the induction of proliferation in human

T cells is associated with a significant increase in the capacity to take up and metabolize

exogenous PUFA, and ELOVL5 is responsible for the elongation of 18-carbon and 20-carbon

PUFA in these cells.

84

5.3. Introduction Cellular proliferation is a natural phenomenon by which cells reproduce by mitosis.

However, in certain pathologies like cancers, as well as autoimmune and inflammatory

diseases like rheumatoid arthritis, atherosclerosis and lupus erythematosus, unwanted cell

proliferation occurs. During the proliferative state, cells need to synthesize cellular

constituents, including membranes, before cell division ensues. The major constituents of

cellular membranes are glycerophospholipids (GPL) and each GPL contains two acylated

fatty acids (FA). The de novo biosynthesis of saturated fatty acids (SFA) and

monounsaturated fatty acids (MUFA) is enhanced in cancer cells to support GPL and

membranes biosynthesis. This is a result of increased expression of key enzymes like acetyl-

CoA carboxylase (ACC), fatty acid synthase (FAS) and stearoyl-CoA desaturase 1 (SCD1)

(1-6).

Membrane GPL contain numerous different fatty acyl moieties, including the

polyunsaturated fatty acids (PUFA) that are not products of de novo FA biosynthesis. PUFA

are important structural components for the modulation of fluidity and permeability of

cellular membranes (7-10), but they also perform signaling functions serving as ligands for

nuclear receptors as well as precursors to lipid mediators like the eicosanoids (11-15). While

de novo FA biosynthesis provides substrates for GPL biosynthesis during cell proliferation,

GPL undergo subsequent remodeling via the Lands cycle, which incorporates PUFA in GPL

for proper membrane and cellular function (16, 17). Most PUFA are members of the n-3 and

n-6 families that are defined as essential FA because they cannot be synthesized in mammals.

Both families of essential PUFA are obtained through diet with linoleic acid (LA 18:2 n-6)

and alpha-linolenic acid (ALA 18:3 n-3) being the primary PUFA in each family. Once

incorporated into cells, these 18-carbon PUFA can undergo a series of elongation and

desaturation reactions to generate other members of the PUFA families such as arachidonic

acid (AA, 20:4 n-6), eicosapentaenoic acid (EPA, 20:5 n-3) and docosahexaenoic acid (DHA,

22:6 n-3) (18-22) (Figure 5.1).

85

Figure 5.1. The metabolic pathway of the n-6 and n-3 families of PUFA.

The elongation and desaturation reactions to which PUFA are subjected depends on the

cellular PUFA requirements and the expression of elongases and desaturases. The cellular

PUFA can be elongated by the elongation of very long chain fatty acids proteins (ELOVL)

and seven members of ELOVL have been identified in humans (18-20, 22), while

desaturation reactions are catalyzed by ∆5- and ∆6-desaturases (19, 21, 22). However, despite

the requirement of PUFA for the remodeling of newly synthesized cellular GPL during cell

proliferation, the differential expression of the enzymes linked to PUFA elongation and

desaturation following the induction of cell proliferation is not known.

86


Human recombinant IL-2, boron trifluoride (14% in methanol), 2,3,4,5,6-pentafluorobenzyl

bromide (PFB-Br), N,N-diisopropylethylamine (DIPA), horseradish peroxidase-conjugated

anti-β-actin (A3854) and the horseradish peroxidase-conjugated anti-rabbit antibodies were

from Sigma-Aldrich (Oakville, ON). The 1,2,diheptadecanoyl-PC was from Biolynx

(Brockville, ON). Fatty acid methyl esters (FAME) and free FA were obtained from Nu-

check Prep (Elysian, MN). The deuterated arachidonic acid (5, 8, 11, 14 eicosatetraenoic-5,

6, 8, 9, 11, 12, 14, 15-d8 acid, AA-d8) and the deuterated eicosapentaenoic acid (5,8,11,14,17-

eicosapentaenoic-19,19,20,20,20-d5 acid, EPA-d5) were from Cayman Chemical (Ann

Arbor, MI). Antibodies against ACSL4 (FACSL4, ab155282), FADS1 (ab126706), FADS2

(ab72189) and ELOVL2 (ab176327) were from Abcam (Toronto, ON). Antibody against

ELOVL5 (TA315700) was from OriGene Technologies (Rockville, MD), antibody against

βTechno (A3854) was from Sigma-Aldrich (Oakville, ON) and the goat anti-rabbit

horseradish peroxidase conjugated secondary antibody (111-035-144) was from Jackson

ImmunoResearch Laboratories (West Grove, PA). The non-silencing negative control siRNA

and the siRNA against ELOVL5 (SR311827) were from OriGene Technologies (Rockville,

MD).

Cell culture

Human peripheral blood mononuclear cells (PBMC) were obtained from blood of healthy

donors following centrifugation on Lymphocyte Separation Solution (Wisent Inc., St-Bruno,

QC.) as previously described (23). T cells were then isolated by negative selection using the

Human T cells enrichment kit from Stem Cell Technologies (Vancouver, BC) following the

manufacturer’s instructions. Primary T cells and the Jurkat cell line (ATCC, Manassas, VA)

were cultured in RPMI-1640 supplemented with 10% fetal bovine serum, 100 U/ml

penicillin, 10 µg/ml streptomycin, 10 mM HEPES, D-glucose (to 25 mM) and 1 mM sodium

pyruvate at 37oC in a 5% CO2 atmosphere. T cells were stimulated with anti-CD3/anti-CD28

Dynabeads (Invitrogen) in the presence of 30 units/ml of IL-2 (Sigma-Aldrich, Oakville, On.)

for 48h before all experiments. HepG2 cells (ATCC) were cultured in EMEM media

87

supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 10 µg/ml streptomycin

at 37oC in a 5% CO2 atmosphere.

Gene expression analysis

Total mRNA was extracted from resting and stimulated T cells using Ribozol reagent

(AMRESCO) and the extracted mRNA was purified with the Direct-zol kit (Zymo Research).

After mRNA integrity was evaluated by electrophoretic migration on a 1% agarose gel,

mRNA reverse transcription was performed on 1 µg of RNA using the Quantitect Reverse

transcription kit (QIAGEN). Gene expression was evaluated by qPCR (ABI 7500, Applied

Biosystems) using Prime time assay (Integrated DNA Technologies) with PerfeCTa qPCR

SuperMix Low ROX (Quanta Biosciences). The efficiency of primer pairs (Table 5.1) was

evaluated using a standard curve and the stability of the RN18S1 reference gene expression

between treatments was verified. Specific primers for ELOVL2, ELOVL5, FADS1, FADS2

and RN18S1 were created by using Primerquest at Integrated DNA Technologies (IDT)

website.

Table 5.1. List of primer sequences used in qPCR experiments and product size

in base pairs (bp) for each of the indicated transcripts. Transcript (Accession)

Primers Sequences

Products (bp)

ELOVL2 NM_017770

FWD Probe REV

TTGGAATCACACTTCTCTCCGCGT 56-FAM/TCCACTTGG/ZEN/GAAGGAGGCTACAACTT/3IABkFQ

AGTACCACCAAAGCACCTTGGCTA

141

ELOVL2 NM_017770

FWD Probe REV

TGTGTCCAGGAACTCTACTGA 56-FAM/TTGGCTACC/ZEN/CGGATGTCAGCTTC/3IABkFQ

GGCTACAACTTACAGTGTCAAGA

111

ELOVL5 NM_021814

FWD Probe REV

TTCATCCTGCGCAAGAACAACCAC 56-FAM/TACCACCAT/ZEN/GCCTCGATGCTGAACAT/3IABkFQ

ATGGAAGGGACTGACGACAAACCA

188

FADS1 NM_013402

FWD Probe REV

AAGCAACTGGTTTGTGTGGGTGAC 56-FAM/AGGCCACAT/ZEN/GCAATGTCCACAAGTCT/3IABkFQ

TAATTGTGTCGAGGCATCGTGGGA

198

FADS2 NM_004265

FWD Probe REV

TACGCTGGAGAAGATGCAACGGAT 56-FAM/TGACCTGGA/ZEN/ATTCGTGGGCAAGTTCT/3IABkFQ

TCTTTGAGTTCTTGCCGTGGTCCT

139

RN18S1 NR_003286

FWD Probe REV

GAGACTCTGGCATGCTAACTAG 56-FAM/TGCTCAATC/ZEN/TCGGGTGGCTGAA/3IABkFQ

GGACATCTAAGGGCATCACAG

129

Western blot analysis

Cells were washed two times with PBS and lysis buffer (150 mM NaCl; 1% Nonidet P-40; 2

mM EDTA; and 50 mM Tris-HCL, pH 7.6) containing protease inhibitor cocktail (Roche)

88

was added to the pellets. After complete homogenization, proteins were quantified by the

Microplate BCA Protein Assay Kit (Pierce). 5x Laemmli sample buffer was added and

samples were heated 10 min at 40ºC (24). Cellular proteins (10 µg) were separated on

Criterion 4-15% polyacrylamide gels (Bio-Rad) and transferred onto a polyvinylidene

difluoride (PVDF) membrane. Membranes were incubated with indicated primary antibodies

and horseradish peroxidase-conjugated secondary antibodies. Western blots were developed

using Amersham ECL prime (GE Healthcare) and images were captured using an Alpha

Innotech Fluorchem imager (San Leandro, CA).

Incubation with fatty acids

After two days (48 hours) of incubation, the incorporation and metabolism of PUFA were

evaluated by incubating resting T cells, stimulated T cells, Jurkat or HepG2 cells for 24 hours

with different PUFA or their diluent (0.05% ethanol). Stimulated T cells, Jurkat and HepG2

cells were incubated with 5 µM of each PUFA whereas resting T cells were incubated with

15 µM of each PUFA. The PUFA utilized were linoleic acid (18:2 n-6, LA), gamma linolenic

acid (18:3 n-6, GLA), arachidonic acid (20:4 n-6, AA), alpha linolenic acid (18:3 n-3, ALA),

stearidonic acid (18:4 n-3, SDA) eicosapentaenoic acid (20:5 n-3, EPA), deuterated

arachidonic acid (AA-d8) and deuterated eicosapentaenoic acid (EPA-d5).

Lipid extraction and quantification of fatty acids by gas chromatography

After 24 hours of incubation with different PUFA or their diluent, cells were washed by

centrifugation using PBS containing 1 mg/ml BSA, and cellular lipids were extracted using

the Bligh and Dyer method (25) containing the internal standard 1,2 diheptadecanoyl sn-

glycerol-3-phosphorylcholine (Biolynx, Brockville, ON). Fatty acid methyl esters (FAME)

were prepared and quantified by gas chromatography with flame ionization detection (GC-

FID) as previously described (24, 26). FAME standards (NuChek Prep, Elysian, MN) were

utilized for identification of peak retention times and standard curves were used for FAME

quantification. For the deuterated FA experiments, pentafluorobenzyl esters of FAs were

prepared and measured by negative ion chemical ionization GC-MS using a Polaris Q mass

spectrometer (Thermo Electron Corporation) as previously described (24, 26).

89

Gene knockdown

Jurkat cells, proliferating T cells and HepG2 cells cultured without penicillin and

streptomycin for at least 24h before electroporation, were washed two times with RPMI

without L-glutamine. Electroporation (270 V and 600 µF) was done in 0.4 cm cuvettes on 1

x 107 cells in 300 µl of RPMI without L-glutamine in the presence of 300 nM of non-silencing

siRNA (siRNA NS) or of siRNA against ELOVL5 (siRNA ELOVL5). Cells were transferred

to culture flasks pre-warmed with complete culture medium without penicillin and

streptomycin.

Cell proliferation assays

Cell proliferation was measured by flow cytometry using the CellTrace™ CFSE Cell

Proliferation Kit (C34554, ThermoFisher). Briefly, wildtype Jurkat cells were stained with 1

µM of CFSE in PBS for 20 min and unincorporated CFSE was quenched and wash with

complete culture medium following the manufacture protocol. Stained cells were incubated

for 48h before their transfection with the non-silencing control siRNA (siRNA NS) and the

siRNA against the ELOVL5 (siRNA ELOVL5). Cells were then analysed by flow cytometry

(FC500 from Beckman) at 48h and 96h post-transfection.

Cell proliferation was also measured using the Click-iT® EdU (5-ethynyl-2'-deoxyuridine)

Alexa Fluor® 488 Flow Cytometry Assay Kit (C10425, ThermoFisher) in combination with

the FxCycle™ Violet Stain (F10347, ThermoFisher) following the manufacture protocol.

Briefly, at 72h and 96h post-transfection, Jurkat cells were incubated with 10 µM EDU for

2h at 37° C and cells were washed, fixed and permeabilized and the click-iT reaction was

done to conjugate the incorporated EDU molecules to the Alexa Fluor 488. All components

used were provided with the kit. Cells were then resuspended in 1 ml of PBS and stained

with the FxCycle™ Violet Stain following the manufacture protocol before their analysis by

flow cytometry (FC500 from Beckman).

Apoptosis assay

Jurkat cells transfected with the non-silencing control siRNA (siRNA NS) and the siRNA

against the ELOVL5 (siRNA ELOVL5) and incubated for 72h were stained with annexin V

90

(BioLegend) and with propidium iodide (Invitrogen) following the BioLegend protocol and

analysed by flow cytometry (FC500 from Beckman).

Statistics.

Statistical analyses using GraphPad Prism software were performed as described in Figure

and Table legends.

Ethics

This study was approved by the Université de Moncton institutional Review Committee for

Research involving human subjects. All subjects provided informed consent prior to their

participation in the study.

5.5. Results Primary T cell culture and proliferation

After three days of incubation, the stimulated T cells grew in clusters and the cell size and

cell counts were increased compared to resting cells, in accordance with previous reports (24,

27-29).

Supplementation with PUFA in T cells and Jurkat cells

In preliminary experiments, cells were incubated with 5 µM of exogenous PUFA for 24

hours. However, resting T cells incorporated very little FA and thus PUFA metabolism was

difficult to assess. Therefore, all further experiments with resting T cells utilized PUFA

concentrations of 15 µM.

Incorporation and metabolism of n-6 PUFA

When cells were incubated with 18:2 n-6 (LA), there was a significant increase in the cellular

content of LA, but not that of other n-6 PUFA in resting T cells compared to non-

supplemented controls (Figure 5.2A). However, a greater accumulation of LA was measured

in proliferating T cells and in Jurkat cells that was accompanied by an augmentation of

cellular 20:2 n-6 content, and in Jurkat cells there was also an increase in 18:3 n-6, 20:3 n-6

and 22:4 n-6 (Figure 5.2B-C).

91

Figure 5.2. The percent distribution of n-6 and n-3 fatty acids in resting T cells,

proliferating T cells and Jurkat cells following supplementation with different

PUFA.

Resting T cells were incubated without stimulation and proliferating T cells were

incubated with anti-CD3/anti-CD28 beads in the presence of 30 units/ml of IL-2 for 3

Proliferating

18:2

n-6

18:3

n-6

20:2

n-6

20:3

n-6

20:4

n-6

22:4

n-6

0

5

10

15

Fatt

y ac

ids

(% m

ol) a

b

a a

aba

b

ab a

ba a a

a

b

a

a a a

b

a a a

b

Jurkat

18:2

n-6

18:3

n-6

20:2

n-6

20:3

n-6

20:4

n-6

22:4

n-6

0

5

10

15

Fatt

y ac

ids

(% m

ol)

a

b

c c

a bc

d ab

c c

a

b

c

aab

a

b

b

a

b

c

c

Resting

18:3

n-3

18:4

n-3

20:3

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-3

0

1

2

3

Fatt

y ac

ids

(% m

ol)

EtOH18:3 n-318:4 n-320:5 n-3

a

b

a a aa

b

a a a

b

a

a a a

b

Proliferating

18:3

n-3

18:4

n-3

20:3

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-3

0

2

4

6

Fatt

y ac

ids

(% m

ol)

a

b

a aa a b

aa

b

a a a

a

b

a ab

c

d

aa a

b

Jurkat

18:3

n-3

18:4

n-3

20:3

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-3

0

2

4

6

8

Fatt

y ac

ids

(% m

ol)

a

b

a aa b ba a

b

a

a a

bb

aa

b

dc

a

b

b

c

Resting

18:2

n-6

18:3

n-6

20:2

n-6

20:3

n-6

20:4

n-6

22:4

n-6

0

5

10

15

20

Fatt

y ac

ids

(% m

ol)

EtOH18:2 n-618:3 n-620:4 n-6

a

b

a a

a ab

a

ab a b b

a ab

a

A

B

C

D

E

F

92

days. T cells and Jurkat cells were then incubated for 24 hours with different n-6 (A-

C) and n-3 (D-F) PUFA (18:2n-6, 18:3n-6, 20:4n-6, 18:3 n-3, 18:4 n-3 or 20:5 n-3), or

ethanol as control. Resting T cells (A and D) were incubated with 15 µM of each PUFA

whereas proliferating T cells (B and E) and Jurkat cells (C and F) were incubated with

5 µM of each PUFA. Cellular lipids were extracted, hydrolyzed and transmethylated.

Individual FA were measured by GC-FID. The results are means +/- SEM of 3-4

independent experiments. Values for each measured FA that do not have a common

superscript are significantly different p < 0.05 as determined by oneway ANOVA with

Dunnett’s post hoc test.

When cells were incubated with 18:3 n-6 (GLA), only the accumulation of a small quantity

of GLA and of its elongation product 20:3 n-6 were measured in resting T cells that was

different from controls (Figure 5.2A). In proliferating T cells a small increase in cellular GLA

was also measured, however a much greater accumulation of its elongation product 20:3 n-6

was measured indicating that T cell stimulation enhanced the cells capacity to incorporate

and elongate GLA (Figure 5.2B). In Jurkat cells there was also a large increase of 20:3 n-6

content compared to controls as well as smaller, but significant increases in 20:4 n-6 and 22:4

n-6 content (Figure 5.2C). When cells were incubated with 20:4 n-6 (AA), there was no

change in the n-6 PUFA content of resting T cells compared to controls, while in proliferating

T cells and Jurkat cells an increase in both AA and 22:4 n-6 content were measured (Figure

5.2A-C).

Overall, these results indicate that T cell stimulation increases the capacity of the cells to take

up and elongate these PUFA. These patterns of changes were similar when comparisons of

molar mass of FA per cell number were made (Figure 5.8. (Supplemental Figure SIA-C)),

though these molar data additionally demonstrate the much greater capacity of stimulated T

cells and Jurkat cells to take up exogenous FA (> 100 nmol/108 cells) compared to resting T

cells (< 20 nmol/108 cells) despite the resting cells having been exposed to greater

concentrations of exogenous PUFA.

93

Incorporation and metabolism of n-3 PUFA

When cells were incubated with 18:3 n-3 (ALA), a significant increase in cellular ALA and

was measured in resting and proliferating T cells compared to controls, although the

magnitude of the increases were much greater in proliferating T cells (Figure 5.2D-E). A

significant increase in cellular 20:3 n-3, 20:4 n-3 and 20:5 n-3 (EPA) content was also

measured in proliferating T cells, indicating a greater capacity to elongate and desaturate n-

3 PUFA than in resting T cells. In Jurkat cells incubated with ALA, significant increases in

ALA, 18:4 n-3, 20:3 n-3, 20:4 n-3, EPA and 22:5 n-3 were measured compared to controls.

The extent of the metabolism of ALA to 22:5 n-3 indicates that Jurkat cells have a greater

capacity to elongate and desaturate PUFA than primary T cells (Figure 5.2F). When cells

were incubated with 18:4 n-3 (SDA), a small accumulation of SDA and an increase in the

cellular content of its elongation product 20:4 n-3 was measured in resting T cells compared

to controls. The elongation of incorporated SDA to 20:4 n-3 was much more pronounced in

proliferating T cells, which also showed an increase in EPA content compared to controls. In

Jurkat cells, a significant increase in 20:4 n-3, EPA and 22:5 n-3 was measured, the most

important increase being in 22:5 n-3 content (Figure 5.2D-F). When cells were incubated

with 20:5 n-3 (EPA), there was an accumulation of EPA in all cells, and a significant increase

in the cellular 22:5 n-3 content was also measured in proliferating T cells and Jurkat cells

compared to non-supplemented controls (Figure 5.2D-F).

As with the n-6 PUFA, these patterns of change were similar when comparisons of molar

mass of FA per cell number were made (Figure 5.8. (Supplemental Figure SID-F)). Again,

the molar mass data also show the much greater capacity of stimulated T cells and Jurkat

cells to take up exogenous FA compared to resting T cells.

Elongation and desaturation of exogenously added PUFA

Following the addition of exogenous PUFA to the different cell populations, significant

increases in the cellular content of the PUFA itself or of its elongation/desaturation products

were measured as presented in Figure 5.2 and Figure 5.8. (Supplemental Figure SI).

However, the measurement of the molar mass changes of cellular PUFA in Figure 5.8.

(Supplemental Figure SI) revealed the differential capacities of the different cells to elongate

94

and desaturate PUFA after their incorporation into the cells. For example, resting T cells

showed no measurable capacity to elongate and desaturate exogenously-added 18:3 n-3,

while approximately 25% of the increase in n-3 PUFA in proliferating T cells was the result

of the elongation of incorporated 18:3 n-3 to 20:3 n-3 and its delta-6 desaturase-catalyzed

desaturation to 20:4 n-3. However, in Jurkat cells approximately 85% of the exogenous 18:3

n-3 that was taken up by the cells was metabolized to elongation and/or desaturation products,

with significant increases measured in all n-3 PUFA species. When cells were incubated with

18:4 n-3, 35% of the n-3 PUFA that accumulated in resting T cells was in the form of 18:4

n-3 itself, while 65% was elongated to 20:4 n-3. In proliferating T cells and Jurkat cells

essentially all of the 18:4 n-3 that entered the cells was subjected to elongation/desaturation,

with the elongation product 20:4 n-3 being the main PUFA that accumulated in proliferating

T cells whereas products that had further undergone delta-5 desaturation and elongation (20:5

n-3 and 22:5 n-3) were the major PUFA that accumulated in Jurkat cells. Finally, while

resting T cells showed no capacity to elongate 20:5 n-3, proliferating T cells and Jurkat cells

elongated approximately 50% and 73%, respectively, of the EPA that was taken up by the

cell.

A very similar utilization of n-6 PUFA was also measured in the different cell populations

where the capacities to elongate and desaturate the PUFA were more evident in stimulated

proliferating T cells and Jurkat cells than in resting T cells. Overall, the results show that in

addition to an enhanced capacity to incorporate exogenous PUFA, the stimulation of primary

T cells to proliferate is associated with an enhanced capacity to elongate 18-carbon PUFA, a

newly acquired capacity to elongate 20-carbon PUFA, and a newly acquired capacity to

desaturate 18-carbon and 20-carbon PUFA. The Jurkat cell line showed a greater capacity to

metabolize PUFA through all desaturation and elongation steps compared to primary T cells.

Gene expression analyses

Given the significant increase in the capacities for cellular PUFA metabolism when

peripheral T cells are stimulated to proliferate, the expression of potentially related genes

were measured by qPCR (Table 5.2).

95

Table 5.2. Gene expression of selected enzymes in resting and proliferating T

cells.

RNA from resting and proliferating T cells was extracted, purified and reversed

transcribed into cDNA. qPCR was performed using RN18S1 as reference gene. Values

represent the mean ± SEM of fold increases of RNA expression in proliferating T cells

compared to resting T cells for three to six independent experiments. nd = not detected.

*Different from resting cells (p<0.05) as determined by student's t-test.

The significant increase in the capacity to elongate PUFA in proliferating T cells compared

to resting T cells was associated with a significant increase in the expression of ELOVL5.

However, no signal for ELOVL2, another elongase known to prefer long chain PUFA as

substrates, was measured in T cells despite the design of two different primer pairs (see Table

1). Additionally, the expression of FADS1 and FADS2 was also significantly increased in

proliferating T cells compared to resting T cells, again consistent with the enhanced capacity

to desaturate exogenously-provided PUFA in proliferating T cells.

Protein expression analysis

Protein expression of elongases (ELOVL), desaturases (FADS) and acyl-CoA synthetase 4

(ACSL4) known to utilize PUFA were measured (Figure 5.3). The protein expression of

FADS1 and FADS2 as well as that of ELOVL5 were induced in proliferating T cells

compared to resting T cells. However, no quantifiable ELOVL2 protein expression was

measured in primary human T cells nor in the Jurkat cell line. As a positive control, both

ELOVL2 and ELOVL5 proteins were expressed in hepatic HepG2 cells. Since acyl-CoA

synthetases are implicated in cellular FA uptake and are required for the elongation and

Genes Fold increase

ELOVL2 nd

ELOVL5 1.6 ± 0.2*

FADS1 (∆-5) 16.4 ± 1.7*

FADS2 (∆-6) 10.3 ± 0.6*

96

desaturation of fatty acyl-CoA, the protein expression of ACSL4 known to utilize PUFA as

substrates was measured by western blot and was shown to be induced in stimulated

proliferating T cells compared to resting cells (Figure 5.3).

Figure 5.3. Protein expression of indicated enzymes.

Proteins (10 µg) from primary resting and proliferating T cells, Jurkat cells and HepG2

cells were separated on 10% SDS-PAGE gels and transferred on a PVDF membrane.

Western blotting was performed using primary and secondary antibody listed in the

material and methods section. These results are representative of three independent

experiments.

ELOVL5 silencing in Jurkat cells

The elongases ELOVL2 and ELOVL5 are the enzymes known to prefer 18- and 20-carbon

n-3 and n-6 PUFA (18-20, 22). Since primary T cells and Jurkat cells did not express

measurable ELOVL2, silencing experiments targeting ELOVL5 were performed in

proliferating T cells and in Jurkat cells to measure the impact on PUFA metabolism. The

silencing of ELOVL5 in Jurkat cells, which was confirmed by western blot (Insert Figure

5.4A), caused a significant increase in cellular AA and EPA that was associated with a

decrease in cellular 22:4 n-6 (Figure 5.4A).

97

Figure 5.4. Jurkat cell fatty acid distribution following ELOVL5 knockdown and

supplementations with or without different PUFA.

Jurkat cells were transfected with non-silencing control (NS) siRNA and siRNA

against ELOVL5. Cells were incubated for 48 hours in regular culture media before a

24h supplementation with 5 µM of different PUFA (18:2 n-6, 18:3 n-6, 20:4 n-6, 18:3

n-3, 18:4 n-3 or 20:5 n-3), or ethanol as control. (A) FA composition of of cells

transfected with the siRNA NS and the siRNA against the ELOVL5. Insert is western

14:0

16:0

16:1

n-718

:0

18:1

n-9

18:1

n-7

18:2

n-6

18:3

n-620

:0

18:4

n-3

20:1

n-9

20:2

n-6

20:3

n-6

20:4

n-622

:0

20:4

n-3

22:1

n-9

20:5

n-3

22:4

n-624

:0

24:1

n-9

22:5

n-3

22:6

n-30

5

10

15

20

25

30

Cellular fatty acids

Fatty

aci

ds(%

mol

)

siRNA NSsiRNA ELOVL5

*

**

*

*

**

*

18:3

n-6

20:3

n-6

20:4

n-6

22:4

n-60

5

10

15

20


Fatty

aci

ds(%

mol

)

siRNA NS + ETOH

siRNA NS + GLAsiRNA ELOVL5 + ETOH

siRNA ELOVL5 + GLA

a a ab a

b

c

a

a

bcab

c

a

b

c

ab

18:3

n-6

20:3

n-6

20:4

n-6

22:4

n-60

5

10

15

20


Fatty

aci

ds(%

mol

)

siRNA NS + ETOH

siRNA NS + AAsiRNA ELOVL5 + ETOH

siRNA ELOVL5 + AA

a

bb

c

a

b

c

a

18:4

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-30

2

4

6

8


Fatty

aci

ds(%

mol

)

siRNA NS + ETOH

siRNA NS + SDAsiRNA ELOVL5 + ETOH

siRNA ELOVL5 + SDA

a ba

c

a

b

a

b

a

b

a

c

a

b

a

c

18:4

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-30

5

10

15


Fatty

aci

ds(%

mol

)

siRNA NS + ETOH

siRNA NS +EPAsiRNA ELOVL5 + ETOH

siRNA ELOVL + EPA

a

b

a

c

a

b

a

c

a aab b

A

B

C

D

E

98

blot against ELOVL5 and β-actin on protein from cells transfected with the siRNA NS

and the siRNA against the ELOVL5. (B) n-6 PUFA composition of controls and cells

incubated with GLA (18:3 n-6), (C) n-6 PUFA composition of controls and cells

incubated with AA (20:4 n-6), (D) n-3 PUFA composition of controls and cells

incubated with SDA (18:4 n-3), (E) n-3 PUFA composition of controls and cells

incubated with EPA (20:5 n-3). Cellular lipids were extracted, hydrolyzed and

transmethylated. Individual FA were measured by GC-FID. These results are means

+/- SEM of 4 independent experiments. A) *Different from cells transfected with the

NS siRNA (p<0.05) as determined by student's t-test. (B-E) Different values for each

PUFA that do not have a common superscript are significantly different p < 0.05 as

determined by oneway ANOVA with Dunnett’s post hoc test.

The role of ELOVL5 in the elongation of 18- and 20-carbon n-3 and n-6 PUFA was more

evident following supplementation of the culture media of transfected cells with GLA, AA,

SDA and EPA (Figure 5.4B-E). In almost all supplementations, silencing of ELOVL5 is

associated with an accumulation of the added substrate and a nearly complete loss of the

elongation of the supplemented FA. For example, when Jurkat cells were transfected with

the non-silencing siRNA NS and supplemented with AA, a significant accumulation of AA

was measured and the amount of its elongation product, 22:4 n-6, doubled (Figure 5.4C).

However, silencing of ELOVL5 was associated with a greater accumulation of AA and the

amount of its elongation product, 22:4 n-6, was comparable to that of non-supplemented cells

(Figure 5.4C).

Additionally, an increase in 16:1 n-7 coupled to a decrease in 18:1 n-7 in ELOVL5 silencing

experiments suggested that ELOVL5 is not only implicated in the elongation of PUFA but

also in the elongation of the n-7 MUFA. Moreover, the cellular content of the longer chain

n-9 MUFA, 20:1 n-9, 22:1 n-9 and 24:1 n-9, were all significantly decreased when ELOVL5

was silenced compared to controls (Figure 5.4A).

99

ELOVL5 silencing in T cells

The silencing of ELOVL5 in proliferating T cells (see western blot, Insert Figure 5.5A), also

impacted on SFA and MUFA (Figure 5.5A), but the impact on the cellular PUFA profile was

not as evident as with Jurkat cells.

Figure 5.5. Primary proliferating T cell fatty acid distribution following ELOVL5

knockdown with and without supplementation with different PUFA.

14:0

16:0

16:1

n-718

:0

18:1

n-9

18:1

n-7

18:2

n-6

18:3

n-620

:0

18:4

n-3

20:1

n-9

20:2

n-6

20:3

n-6

20:4

n-622

:0

20:4

n-3

22:1

n-9

20:5

n-3

22:4

n-624

:0

24:1

n-9

22:5

n-3

22:6

n-30

5

10

15

20

25

30

35


Fatty

aci

ds(%

mol

)siRNA NSsiRNA ELOVL5

*

*

* * *

18:3

n-6

20:3

n-6

20:4

n-6

22:4

n-60

5

10

15


Fatty

aci

ds(%

mol

)

siRNA NS + ETOHsiRNA ELOVL5 + ETOHsiRNA NS + GLAsiRNA ELOVL5 + GLA

ab a b

ca

b

a

b

18:3

n-6

20:3

n-6

20:4

n-6

22:4

n-60

5

10

15

20


Fatty

aci

ds(%

mol

)

siRNA NS + ETOHsiRNA ELOVL5 + ETOHsiRNA NS + AAsiRNA ELOVL5 + AA

aa

b

b

a a

ab

a b b b

b

18:4

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-30

2

4

6

8

10


Fatty

aci

ds(%

mol

)

siRNA NS + ETOHsiRNA ELOVL5 + ETOHsiRNA NS + SDAsiRNA ELOVL5 + SDA

a a aba

b

a

b

a a

b

c

18:4

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-30

2

4

6

8

10

12


Fatty

aci

ds(%

mol

)

siRNA NS + ETOHsiRNA ELOVL5 + ETOHsiRNA NS + EPAsiRNA ELOVL5 + EPA

a

b

a

c

ab

c

a

bc

A

B

C

D

E

100

Proliferating T cells (48h after stimulation) were transfected with non-silencing control

(NS) siRNA and siRNA against ELOVL5. Cells were incubated for 48 hours in regular

culture media with stimulation before a 24h supplementation with 5 µM of different

PUFA (18:2 n-6, 18:3 n-6, 20:4 n-6, 18:3 n-3, 18:4 n-3 or 20:5 n-3), or ethanol as

control. (A) FA composition of cells transfected with the siRNA NS and the siRNA

against the ELOVL5. Insert is western blot against ELOVL5 and β-actin on protein

from cells transfected with the siRNA NS and the siRNA against the ELOVL5. (B) n-

6 PUFA composition of controls and cells incubated with GLA (18:3 n-6), (C) n-6

PUFA composition of controls and cells incubated with AA (20:4 n-6), (D) n-3 PUFA

composition of controls and cells incubated with SDA (18:4 n-3), (E) n-3 PUFA

composition of controls and cells incubated with EPA (20:5 n-3). Cellular lipids were

extracted, hydrolyzed and transmethylated. Individual FA were measured by GC-FID.

These results are means +/- SEM of 3 independent experiments. A) *Different from

cells transfected with the NS siRNA (p<0.05) as determined by student's t-test. (B-E)

Different values for each PUFA that do not have a common superscript are

significantly different p < 0.05 as determined by oneway ANOVA with Dunnett’s post

hoc test.

In PUFA supplementation experiments, silencing of ELOVL5 caused an accumulation of the

added substrate in some experiments, and in others it prevented the elongation of the

supplemented PUFA (Figure 5.5B-E). For example, when proliferating T cells were

transfected with the non-silencing siRNA NS and supplemented with GLA, a significant

accumulation of its elongation product, 20:3 n-6, was observed. This accumulation of 20:3

n-6 was not significantly decreased in GLA-supplemented cells when ELOVL5 was silenced,

but a significant accumulation of the supplemented FA (GLA) was measured (Figure 5.5B).

In another example, when proliferating T cells were transfected with the non-silencing

siRNA NS and supplemented with AA, a significant accumulation of AA and its elongation

product, 22:4 n-6, was observed. The accumulation of AA was not enhanced in AA-

supplemented cells when ELOVL5 was silenced, but the amount of its elongation product

(22:4 n-6) was no longer significantly increased (Figure 5.5C).

101

ELOVL5 silencing in HepG2 hepatocarcinoma cells

To compare the observations in T cells and Jurkat cells with a non-lymphoid cell type,

ELOVL5 was silenced in the HepG2 hepatocarcinoma cell line (see insert Figure 5.6A)

which is frequently used to study ELOVL proteins and which also expresses ELOVL2

(Figure 5.3).

Figure 5.6. HepG2 cell fatty acid distribution following ELOVL5 knockdown

with and without supplementation with different PUFA.

14:0

16:0

16:1

n-718

:0

18:1

n-9

18:1

n-7

18:2

n-6

18:3

n-620

:0

18:4

n-3

20:1

n-9

20:2

n-6

20:3

n-6

20:4

n-622

:0

20:4

n-3

22:1

n-9

20:5

n-3

22:4

n-624

:0

24:1

n-9

22:5

n-3

22:6

n-30

10

20

30


Fatty

aci

ds(%

mol

)


*

*

* * * *

18:3

n-6

20:3

n-6

20:4

n-6

22:4

n-60

2

4

6

8

10

12


Fatty

aci

ds(%

mol

)

siRNA NS + ETOHsiRNA ELOVL5 + ETOHsiRNA NS + GLAsiRNA ELOVL5 + GLA

a aa

b

a a

b

c

aa

bb

a a b a

18:3

n-6

20:3

n-6

20:4

n-6

22:4

n-60

2

4

6

8

10

12

14


Fatty

aci

ds(%

mol

)

siRNA NS + ETOHsiRNA ELOVL5 + ETOHsiRNA NS + AAsiRNA ELOVL5 + AA

aabab b

a a

bb

a a b b

18:4

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-30

1

2

3

4


Fatty

aci

ds(%

mol

)

siRNA NS + ETOHsiRNA ELOVL5 +ETOHsiRNA NS + SDAsiRNA ELOVL5 + SDA

a aa

b

aa

b

ca a

b b

a a

bb

18:4

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-30

1

2

3

4

5

6


Fatty

aci

ds(%

mol

)

siRNA NS + ETOHsiRNA ELOVL5 + ETOHsiRNA NS + EPAsiRNA ELOVL5 + EPA

a a

bb

a a

b

c

A

B

C

D

E

102

HepG2 cells were transfected with non-silencing control (NS) siRNA and siRNA

against ELOVL5. Cells were incubated for 48 hours in regular culture media before a

24h supplementation with 5 µM of different PUFA (18:2 n-6, 18:3 n-6, 20:4 n-6, 18:3

n-3, 18:4 n-3 or 20:5 n-3), or ethanol as control. (A) FA composition of cells

transfected with the siRNA NS and the siRNA against the ELOVL5. Insert is western

blot against ELOVL5 and β-actin on protein from cells transfected with the siRNA NS

and the siRNA against the ELOVL5. (B) n-6 PUFA composition of controls and cells

incubated with GLA (18:3 n-6), (C) n-6 PUFA composition of controls and cells

incubated with AA (20:4 n-6), (D) n-3 PUFA composition of controls and cells

incubated with SDA (18:4 n-3), (E) n-3 PUFA composition of controls and cells

incubated with EPA (20:5 n-3). Cellular lipids were extracted, hydrolyzed and

transmethylated. Individual FA were measured by GC-FID. These results are means

+/- SEM of 4 independent experiments. A) *Different from cells transfected with the

NS siRNA (p<0.05) as determined by student's t-test. (B-E) Different values for each

PUFA that do not have a common superscript are significantly different p < 0.05 as


Though these cells are not as rich in cellular PUFA, modifications in the cellular content of

MUFA and PUFA were also observed following ELOVL5 silencing (Figure 5.6A). Notably,

ELOVL5 silencing again resulted in an accumulation of 16:1 n-7 and a decrease in 18:1 n-7,

as well as significant decreases in 20-, 22- and 24-carbon n-9 MUFA content. In PUFA

supplementation experiments, ELOVL5 silencing impacted on the capacity to elongate 18-

carbon PUFA with little measurable impact on the elongation of 20-carbon PUFA (Figure

5.6B-E). For example, when HepG2 cells were transfected with the siRNA against the

ELOVL5 and supplemented with GLA, the accumulation of its elongation product, 20:3 n-

6, was significantly reduced and GLA was significantly increased compared to non-silencing

controls supplemented with GLA (Figure 5.6B).

Metabolism of deuterated PUFA

To more directly evaluate the elongation of exogenously added AA and EPA, deuterated FA

(AA-d8 and EPA-d5) were used for the cell supplementation experiments and GC-MS was

103

used to measure their incorporation into cells as well as their elongation products 22:4 n-6-

d8 and 22:5 n-3-d5 (Figure 5.7A-C).

Figure 5.7. The elongation of AA-d8 and EPA-d5 following ELOVL5 knockdown

in Jurkat cells, proliferating primary T cells and HepG2 cells.

Jurkat cells (A), proliferating T cells (B) and HepG2 cells (C) were transfected with

non-silencing control (NS) siRNA and siRNA against ELOVL5. Cells were incubated

for 48 hours in regular culture media before a 24h supplementation with 5 µM of AA-

d8 or EPA-d5. Cellular lipids were extracted, hydrolyzed and penta-fluorobenzyl esters

of FAs were prepared and measured by negative ion chemical ionization GC-MS. The

values represent the percent of the cellular AA-d8 and EPA-d5 that were elongated to

22:4-d8 and 22:5-d5, respectively. These results are means +/- SEM of 3 independent

experiments. *Different from cells transfected with the NS siRNA (p<0.05) as

determined by two-sided student's t-test.

22:4

n-6-d 8

22:5

n-3-d 5

0

10

20

30

40

50

60

AA

-d8 a

nd E

PA-d

5 elo

ngat

ion

(% m

ol)

Jurkat


*

*

22:4

n-6-d 8

22:5

n-3-d 5

0

10

20

30

40

50

60

AA

-d8 a

nd E

PA-d

5 elo

ngat

ion

(% m

ol)

Proliferating T cells


*

*

22:4

n-6-d 8

22:5

n-3-d 5

0

5

10

15

20

AA

-d8 a

nd E

PA-d

5 elo

ngat

ion

(% m

ol)

HepG2


*

*

A B

C

104

When Jurkat cells transfected with the siRNA NS were supplemented with AA-d8 and EPA-

d5 for 24h, about 23% of the incorporated AA-d8 was elongated to 22:4 n-6-d8 and 55% of

the incorporated EPA-d5 was elongated to 22:5 n-3-d5. However, in Jurkat cells transfected

with the siRNA against ELOVL5 only 7% of the incorporated AA-d8 was elongated to 22:4

n-6-d8 (70% decrease in elongation) and only 22% of the incorporated EPA-d5 was elongated

to 22:5 n-3-d5 (60% decrease in elongation) (Figure 5.7A). The ELOVL5 knockdown in

primary T cells also significantly decreased the elongation of AA-d8 to 22:4 n-6-d8 from 13%

to 4% (70% decrease) and the elongation of EPA-d5 to 22:5 n-3-d5 from 43% to 19% (56%

decrease) (Figure 5.7B). In HepG2 cells, the knockdown of ELOVL5 significantly decreased

the elongation of AA-d8 to 22:4 n-6-d8 from 3% to 1.3% (57% decrease) and significantly

decreased the elongation of EPA-d5 to 22:5 n-3-d5 from 19% to 13% (32% decrease) (Figure

5.7C). Of note, in all cell types the efficiency of elongation of EPA was greater than that of

AA, but the elongation of AA was more impacted than that of EPA in ELOVL5 knockdown

experiments.

ELOVL5 silencing, apoptosis and cell proliferation

The impact of ELOVL5 knockdown on cell proliferation and cell death was evaluated in

Jurkat cells. ELOVL5 knockdown had no effect on Jurkat cell proliferation as assessed by

the rate CFSE distribution to daughter cells for up to 96 hours, as shown in the fluorescence

cytograms of cells treated with negative control siRNA NS and siRNA against ELOVL5

which were superimposed at all time points (Figure 5.9 (Supplemental Figure SII)). Similarly

there were no significant differences over 96 hours in the staining of cells with the thymidine

analogue EdU and propidium iodide (PI) analogue FxCycle, indicating that the cell cycle was

not affected by ELOVL5 knockdown (Figure 5.10 (Supplemental Figure SIII)). Apoptosis

was also measured in cells treated with siRNA NS and siRNA against ELOVL5 and there

was no significant difference in Annexin V/PI staining between the two treatments (Figure

5.11 (Supplemental Figure SIV)). Overall, these results indicate that ELOVL5 expression is

not required for the maintenance of cell proliferation and viability under these culture

conditions.

105

5.6. Discussion In many cancers both de novo SFA biosynthesis and stearoyl-CoA desaturase-1 (SCD1, ∆9

desaturase) expression are significantly increased, likely to generate a supply of SFA and

MUFA required for membrane biogenesis to support cell proliferation (1-6, 30).

Accordingly, we have previously shown that fatty acid synthase and SCD1 expression are

also greatly increased in primary human T cells following the induction of cell proliferation,

suggesting that this is a common phenomenon associated with cell proliferation (24). Despite

significant evidence for enhanced de novo SFA and MUFA biosynthesis in proliferating cells

such as carcinomas (1-6, 30, 31), there is limited information on potential changes in PUFA

uptake and metabolism once human T lymphocytes enter the cell cycle (32) and no

information on any changes in the expression of enzymes that catalyze these processes. In

the current study, using primary human T cells, we show that the induction of cell

proliferation is associated with significant changes in the cellular capacities to incorporate,

elongate and desaturate PUFA from both the n-6 and n-3 families and this is associated with

the increased expression of ELOVL5, FADS1 and FADS2 expression.

Based on the cellular FA composition, resting primary T cells showed no measurable

capacity to desaturate any of the exogenously-provided PUFA through the delta-6 or delta-5

desaturase-catalyzed reactions. These resting cells could elongate 18:3 n-6 and its homologue

18:4 n-3 which are the products of the delta-6 desaturase-catalyzed reaction (Figure 5.1),

suggesting that FA with a double bond at the delta-6 position are the preferred 18-carbon

substrates for the elongases expressed in these cells. This pattern of 18-carbon PUFA

elongation suggested that resting cells may express ELOVL5 which, when expressed in

yeast, catalyzes the elongation of 18:3 n-6 and 18:4 n-3, but is less active with 18:3 n-3 as a

substrate (33). This was confirmed in western blot experiments where these cells expressed

measureable ELOVL5 but not ELOVL2, that has also been suggested to elongate 18-carbon

PUFA. However, human ELOVL5 also utilizes 20:5 n-3 very efficiently in yeast (33) but

there was no measurable evidence that resting T cells could elongate or desaturate the

exogenously-provided 20-carbon FA EPA and AA. These observations suggest that the

substrate preference of ELOVL isotypes observed in forced expression experiments does not

necessarily reflect on the actual capacity of cells to elongate FA.

106

The induction of cell proliferation in human T cells was associated with a significant increase

in the cells capacity to take up, to elongate and to desaturate PUFA. However, there were

some differences dependent on the PUFA provided to the cells. While proliferating T cells

efficiently elongated 18:3 n-3 compared to resting cells, the capacity to elongate its

homologue 18:2 n-6 was not as pronounced suggesting the induction of an elongase that may

show a preference for 18:3 n-3. This is consistent with the elongation of 18:2 n-6 and 18:3

n-3 previously shown in PHA activated T cells (32). Not only was 18:3 n-3 elongated in

stimulated cells, but a significant fraction of the FA was further desaturated to 20:5 n-3

indicating the presence of both delta-6 and delta-5 desaturase activities. The induction of

elongase activity was also evident in proliferating T cells when cells were incubated in the

presence of 18:4 n-3 or its homologue 18:3 n-6 which were both nearly completely subjected

to elongation reactions with little accumulation of the exogenously-added PUFA itself.

However, once again only the n-3 homologue, 18:4 n-3 showed any evidence of undergoing

desaturation through the delta-5 desaturase-catalyzed reaction.

The changes in PUFA elongation and desaturation capacities in stimulated T cells was

accompanied by increased gene and protein expression of FADS1 and FADS2, the two

enzymes known to desaturate PUFA at the delta-5 and delta-6 positions, respectively, as well

as that of the elongase ELOVL5. This is the first report of the induction of the expression of

these enzymes in association with cell proliferation and may be related to the requirement of

proliferating cells to maintain a cellular PUFA content for the biogenesis of functional

membranes. Knockdown experiments clearly showed that this elongase isotype was

responsible for the enhanced elongation capacities. Of note, ELOVL2, that has also been

suggested to play an important role in PUFA elongation based on overexpression

experiments, was not expressed in these cells. This result is consistent with the limited

expression profile of ELOVL2 in most human tissues including an apparent a lack of

expression in resting leukocytes (34). Comparable results were obtained in T leukemia Jurkat

cells that also did not express ELOVL2, and in which ELOVL5 knockdown significantly

impacted on 18-carbon PUFA elongation. ELOVL5 knockdown experiments also

significantly decreased the majority of the elongation capacity of 18-carbon PUFA in HepG2

hepatoma cells, despite the fact that these cells also express ELOVL2. Although ELOVL5

107

knockdown was not complete in these experiments, these results suggest that ELOVL5 is the

main if not the sole elongase responsible for 18-carbon PUFA elongation in these cells types.

With regard to the 20-carbon PUFA EPA and AA, the induction of T cell proliferation was

associated a newly acquired capacity to elongate these FA, though the conversion of EPA to

22:5 n-3 was more complete than that measured for the elongation of AA, again suggesting

that the n-3 PUFA undergo elongation-desaturation more readily than their n-6 counterparts.

This was especially evident in experiment using deuterated substrates. The elongation of AA

in activated T cells was previously shown, however they did not compare with resting cells

and EPA elongation was not measured (32). Once again, ELOVL5 knockdown experiments

showed that this elongase isotype was also responsible for the elongation of 20-carbon

PUFA, not only in primary T cells but also in Jurkat cells. In HepG2 cells, ELOVL5

knockdown also eliminated the majority of AA elongation but was less was effective at

eliminating EPA elongation with only a 30% reduction compared to controls, suggesting that

ELOVL5 is only partially responsible for the elongation of EPA in this hepatocarcinoma cell

line. Overall these results suggest that ELOVL2 is not associated with the elongation of

PUFA in human lymphoid cells and despite its ability to catalyze the elongation of 20-carbon

PUFA when overexpressed in yeast, the present results along with its limited tissue

expression profile casts doubt on a dominant role of this enzyme in the elongation of essential

PUFA in humans.

A noteworthy observation was that the enhanced capacity to elongate and desaturate PUFA

following the induction of T cell proliferation was not equivalent for n-3 and n-6 families.

The proportion of newly incorporated n-3 PUFA that underwent elongation or desaturation

was generally greater than that measured for the n-6 PUFA. While this could be a reflection

of a preference of desaturases and elongases for the n-3 PUFA, other factors could explain

this observation. For example, the cellular uptake of exogenous n-6 PUFA was generally

greater than the uptake of n-3 PUFA, therefore the actual mass of n-6 PUFA metabolized

through the pathways was greater than that of n-3 PUFA. Also, the PUFA that were measured

in the cells were primarily associated with GPL, therefore the measured FA composition is

108

also a function of the specificities of the acyl-CoA synthetases and acyl-transferases that are

expressed in the cells.

The knockdown of ELOVL5 also had a significant impact on cellular MUFA content.

Significant increases were measured in 16:1 n-7 content in all three cells types indicating that

ELOVL5 is associated with the elongation of this MUFA, consistent with a previous report

that ELOVL5 silencing increases cellular 16:1/16:0 ratios (35). Furthermore, ELOVL5

silencing also resulted in decreases in the cellular longer chain 20-, 22- and 24-carbon n-9

MUFA content. Although ELOVL5 overexpression in COS-7 monkey kidney fibroblast cells

have shown that ELOVL5 can utilize 16- and 18-carbons SFA and MUFA as substrates (36),

this is the first report in which ELOVL5 silencing impacts on the content of these long chain

MUFA. While the role of human ELOVL5 has been mainly associated with PUFA

elongation, the present study clearly shows in three different cell models that ELOVL5 may

play a more prominent role in long chain MUFA metabolism than previously recognized.

Accordingly, whether an impact on MUFA metabolism is associated with the role of

ELOVL5 mutations in neurodegenerative disorders such as spinocerebellar ataxia 38 (37, 38)

remains to be determined.

Since ELOVL5 expression was associated with the induction of cell proliferation and

appeared to be the main ELOVL isotype required for PUFA and MUFA elongations in T

cells and Jurkat cells, an attempt was made to determine if its expression was required for

Jurkat cell proliferation and survival. However, no measurable effect of ELOVL5

knockdown on cell proliferation as measured by two different methods, nor on apoptosis as

measured by Annexin-V labeling was achieved. Therefore, although cellular FA elongation

is largely dependent on ELOVL5 expression its role in the maintenance of cellular functional

capacities remains to be determined.

As indicated above, stimulated T cells had a much greater capacity to incorporate PUFA than

resting T cells, and this was true for all of the tested PUFA. On a molar basis, proliferating

cells took up approximately two times more n-6 PUFA than n-3 PUFA, except for AA whose

incorporation was similar to that of the n-3 PUFA. The increased uptake of PUFA by

109

proliferating T cells could be due to a number of mechanisms, including the expression of

acyl-CoA synthetases (ACSL) that have been shown to play a role in PUFA incorporation

by trapping newly-incorporated PUFA in the cells as CoA-esters (39-41). We previously

showed that the induction of T cell proliferation was associated with increased in acyl-CoA

synthetase activity and in mRNA expression of a number of ACSL isotypes compared to

resting T cells (24). Thus, the significant increase of the ACSL4 protein expression may

explain this increased cellular uptake, though future experiments will be required to

determine the extent to which these enzymes may be involved in the enhanced cellular PUFA

uptake.

In conclusion, significant changes in the capacities to incorporate and metabolize PUFA

occur when T cells are induced to proliferate and these changes are accompanied by the

enhanced expression of several genes and enzymes associated with these processes. These

observations along with our previous findings that de novo FA biosynthesis is enhanced and

that the highly unsaturated AA undergoes significant remodeling between GPL species (24)

indicate that several impactful changes in cellular FA and GPL remodeling accompany entry

into the cell cycle. Future studies will evaluate to what extent these changes in lipid handling

may be required for continued progression in the cell cycle and for optimal functional

responses.

110


Figure 5.8. Supplemental Figure SI. The mass content of n-6 and n-3 fatty acids

in resting T cells, proliferating T cells and Jurkat cells following supplementation

with different n-6 PUFA.

Resting T cells incubated without stimulation and proliferating T cells incubated with

anti-CD3/anti-CD28 beads in the presence of 30 units/ml of IL-2 for 3 days. T cells

Resting

18:2

n-6

18:3

n-6

20:2

n-6

20:3

n-6

20:4

n-6

22:4

n-6

0

20

40

60

80

100

Fatt

y ac

ids

(nm

ol/1

08 ce

lls)

EtOH18:2 n-618:3 n-620:4 n-6

aa

a ab

a ba

ab

b

ab b

Proliferating

18:2

n-6

18:3

n-6

20:2

n-6

20:3

n-6

20:4

n-6

22:4

n-6

0

100

200

300

400

500

Fatt

y ac

ids

(nm

ol/1

08 ce

lls)

a

b

a

a

a a

ab

a aa

a

b

a a a a

b

bab

Jurkat

18:2

n-6

18:3

n-6

20:2

n-6

20:3

n-6

20:4

n-6

22:4

n-6

0

100

200

300

400

500

600

Fatt

y ac

ids

(nm

ol/1

08 ce

lls)

a

b

aa

ab b

a ab

a a

a

b

b

aa

a

a

b

a

b

a

a

Resting

18:3

n-3

18:4

n-3

20:3

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-3

0

2

4

6

8

10

Fatt

y ac

ids

(nm

ol/1

08 ce

lls)

EtOH18:3 n-318:4 n-320:5 n-3

a

b

a a a a

b

a a a

b

a

a a a

b

Proliferating

18:3

n-3

18:4

n-3

20:3

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-3

0

20

40

60

80

100

120

140

Fatt

y ac

ids

(nm

ol/1

08 ce

lls) b

a a aa a

ba

a

b

a aa

a

b

aa

b

aa

a

b

a

a

Jurkat

18:3

n-3

18:4

n-3

20:3

n-3

20:4

n-3

20:5

n-3

22:5

n-3

22:6

n-3

0

50

100

150

200

250

300

350

400

Fatt

y ac

ids

(nm

ol/1

08 ce

lls)

a

b

aa a bb a ab

aa a

b b

ab a

b b

c

a

bb

c

a a a

b

A

B

C

D

E

F

111

and Jurkat cells were then incubated for 24 hours with different PUFA (18:2n-6, 18:3n-

6, 20:4n-6, 18:3 n-3, 18:4 n-3 or 20:5 n-3) or ethanol as control. Resting T cells (A and

D) were incubated with 15 µM of each FA whereas proliferating T cells (B and E) and

Jurkat cells (C and F) were incubated with 5 µM of each PUFA. Cellular lipids were

extracted, hydrolyzed and transmethylated. Individual FA were measured by GC-FID.

These results are means +/- SEM of 3-4 independent experiments. Different values for

each FA that do not have a common superscript are significantly different p < 0.05 as


Figure 5.9. Supplemental Figure SII. Proliferation of Jurkat cells measured by

the CellTrace™ CFSE flow cytometry cell proliferation assay following ELOVL5

knockdown.

Jurkat cells were stained with 1 µM of CFSE in PBS for 20 min following the

manufacture’s protocol. Stained cells were then incubated for 48h before their

transfection with the non-silencing control siRNA (siRNA NS) and the siRNA against

the ELOVL5 (siRNA ELOVL5). Cells were then analysed by flow cytometry at 48h

and 96h post-transfection. Note: the tracings for the siRNA ELOVL5 cells are

superimposed on those of the siRNA NS cells. These results are representative of 3

independent experiments.

112

Figure 5.10. Supplemental Figure SIII. Proliferation of Jurkat cells

measured by the Click-iT® EdU Alexa Fluor® 488 and FxCycle flow cytometry

cell proliferation assay following ELOVL5 knockdown.

Cellular proliferation of Jurkat cells transfected with the non-silencing control siRNA

(siRNA NS) (A) and the siRNA against the ELOVL5 (siRNA ELOVL5) (B) was

analysed by flow cytometry following the manufacture’s protocol. Briefly, at 72h and

96h post-transfection, Jurkat cells were incubated with 10 µM EDU for 2h at 37° C,

cells were washed, fixed and permeabilized and the click-iT reaction was done to

conjugate the incorporated EDU molecules to Alexa Fluor 488. Cells were then

resuspended in PBS and stained with the FxCycle™ Violet Stain following the

manufacture’s protocol before their analysis by flow cytometry (FC500 from

Beckman). The cytogram results are from one representative experiment. The

tabulated results are percent of cells in each gate expressed as the means +/- SEM of 3

independent experiments.

113

Figure 5.11. Supplemental Figure SIV. Annexin V / propidium iodide (PI)

flow cytometry apoptosis assay.

Jurkat cells transfected with the non-silencing control siRNA (siRNA NS) (A) and the

siRNA against the ELOVL5 (siRNA ELOVL5) (B) were incubated for 72h and were

then stained with annexin V and with propidium iodide following the BioLegend

protocol and analysed by flow cytometry. The cytograms are representative of 3

independent experiments. The tabulated results are percent of cells in each gate

expressed as means +/- SEM of 3 independent experiments.

5.8. Aknowledgements The authors thank Natalie Levesque and Jeremie Doiron for technical support with fatty acid

analysis. This work was supported by Canadian Institutes of Health Research (CIHR) and

New Brunswick Health Research Foundation (NBHRF) grants awarded to ME Surette. PP


Fonds de recherche sur l'arthrite et les maladies rhumatismales de l’université Laval. E.

Boilard was the recipient of a New Investigator Award from the CIHR. ME Surette was

supported by the Canada Research Chair Program and a New Brunswick Innovation

Research Chair.

114

5.9. References 1. Swinnen, J. V., Brusselmans, K., and Verhoeven, G. (2006) Increased lipogenesis in cancer

cells: new players, novel targets. Curr Opin Clin Nutr Metab Care 9, 358-365 2. Zaidi, N., Lupien, L., Kuemmerle, N. B., Kinlaw, W. B., Swinnen, J. V., and Smans, K.

(2013) Lipogenesis and lipolysis: the pathways exploited by the cancer cells to acquire fatty acids. Prog Lipid Res 52, 585-589

3. Belkaid, A., Duguay, S. R., Ouellette, R. J., and Surette, M. E. (2015) 17beta-estradiol induces stearoyl-CoA desaturase-1 expression in estrogen receptor-positive breast cancer cells. BMC Cancer 15, 440

4. Currie, E., Schulze, A., Zechner, R., Walther, T. C., and Farese, R. V., Jr. (2013) Cellular fatty acid metabolism and cancer. Cell Metab 18, 153-161

5. Daniels, V. W., Smans, K., Royaux, I., Chypre, M., Swinnen, J. V., and Zaidi, N. (2014) Cancer cells differentially activate and thrive on de novo lipid synthesis pathways in a low-lipid environment. PLoS One 9, e106913

6. Igal, R. A. (2011) Roles of StearoylCoA Desaturase-1 in the Regulation of Cancer Cell Growth, Survival and Tumorigenesis. Cancers (Basel) 3, 2462-2477

7. Smith, A. D., and Stubbs, C. D. (1987) Modulation of membrane protein function by bilayer lipids. Basic Res Cardiol 82 Suppl 1, 93-97

8. Spector, A. A., and Yorek, M. A. (1985) Membrane lipid composition and cellular function. J Lipid Res 26, 1015-1035

9. Stubbs, C. D., and Smith, A. D. (1984) The modification of mammalian membrane polyunsaturated fatty acid composition in relation to membrane fluidity and function. Biochim Biophys Acta 779, 89-137

10. Thewke, D., Kramer, M., and Sinensky, M. S. (2000) Transcriptional homeostatic control of membrane lipid composition. Biochem Biophys Res Commun 273, 1-4

11. Harizi, H., Corcuff, J. B., and Gualde, N. (2008) Arachidonic-acid-derived eicosanoids: roles in biology and immunopathology. Trends Mol Med 14, 461-469

12. Buckley, C. D., Gilroy, D. W., and Serhan, C. N. (2014) Proresolving lipid mediators and mechanisms in the resolution of acute inflammation. Immunity 40, 315-327

13. Peters-Golden, M., and Henderson, W. R., Jr. (2007) Leukotrienes. N Engl J Med 357, 1841-1854

14. Shimizu, T. (2009) Lipid mediators in health and disease: enzymes and receptors as therapeutic targets for the regulation of immunity and inflammation. Annu Rev Pharmacol Toxicol 49, 123-150

15. Nakamura, M. T., Cheon, Y., Li, Y., and Nara, T. Y. (2004) Mechanisms of regulation of gene expression by fatty acids. Lipids 39, 1077-1083

16. Lands, W. E., Inoue, M., Sugiura, Y., and Okuyama, H. (1982) Selective incorporation of polyunsaturated fatty acids into phosphatidylcholine by rat liver microsomes. J Biol Chem 257, 14968-14972

17. Yamashita, A., Sugiura, T., and Waku, K. (1997) Acyltransferases and transacylases involved in fatty acid remodeling of phospholipids and metabolism of bioactive lipids in mammalian cells. J Biochem 122, 1-16

18. Gregory, M. K., Gibson, R. A., Cook-Johnson, R. J., Cleland, L. G., and James, M. J. (2011) Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis. PLoS One 6, e29662

115

19. Guillou, H., Zadravec, D., Martin, P. G., and Jacobsson, A. (2010) The key roles of elongases and desaturases in mammalian fatty acid metabolism: Insights from transgenic mice. Prog Lipid Res 49, 186-199

20. Jakobsson, A., Westerberg, R., and Jacobsson, A. (2006) Fatty acid elongases in mammals: their regulation and roles in metabolism. Prog Lipid Res 45, 237-249

21. Nakamura, M. T., and Nara, T. Y. (2004) Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. Annu Rev Nutr 24, 345-376

22. Zhang, J. Y., Kothapalli, K. S., and Brenna, J. T. (2016) Desaturase and elongase-limiting endogenous long-chain polyunsaturated fatty acid biosynthesis. Curr Opin Clin Nutr Metab Care 19, 103-110

23. Boyum, A. (1968) Isolation of mononuclear cells and granulocytes from human blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl 97, 77-89

24. Robichaud, P. P., Boulay, K., Munganyiki, J. E., and Surette, M. E. (2013) Fatty acid remodeling in cellular glycerophospholipids following the activation of human T cells. J Lipid Res 54, 2665-2677

25. Bligh, E. G., and Dyer, W. J. (1959) A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37, 911-917

26. Robichaud, P. P., Poirier, S. J., Boudreau, L. H., Doiron, J. A., Barnett, D. A., Boilard, E., and Surette, M. E. (2016) On the cellular metabolism of the click chemistry probe 19-alkyne arachidonic acid. J Lipid Res 57, 1821-1830

27. Boilard, E., and Surette, M. E. (2001) Anti-CD3 and concanavalin A-induced human T cell proliferation is associated with an increased rate of arachidonate-phospholipid remodeling. Lack of involvement of group IV and group VI phospholipase A2 in remodeling and increased susceptibility of proliferating T cells to CoA-independent transacyclase inhibitor-induced apoptosis. J Biol Chem 276, 17568-17575

28. Anel, A., Naval, J., Gonzalez, B., Torres, J. M., Mishal, Z., Uriel, J., and Pineiro, A. (1990) Fatty acid metabolism in human lymphocytes. I. Time-course changes in fatty acid composition and membrane fluidity during blastic transformation of peripheral blood lymphocytes. Biochim Biophys Acta 1044, 323-331

29. Calder, P. C., Yaqoob, P., Harvey, D. J., Watts, A., and Newsholme, E. A. (1994) Incorporation of fatty acids by concanavalin A-stimulated lymphocytes and the effect on fatty acid composition and membrane fluidity. Biochem J 300 ( Pt 2), 509-518

30. Igal, R. A. (2010) Stearoyl-CoA desaturase-1: a novel key player in the mechanisms of cell proliferation, programmed cell death and transformation to cancer. Carcinogenesis 31, 1509-1515

31. Igal, R. A. (2016) Stearoyl CoA desaturase-1: New insights into a central regulator of cancer metabolism. Biochim Biophys Acta 1861, 1865-1880

32. Anel, A., Naval, J., Gonzalez, B., Uriel, J., and Pineiro, A. (1990) Fatty acid metabolism in human lymphocytes. II. Activation of fatty acid desaturase-elongase systems during blastic transformation. Biochim Biophys Acta 1044, 332-339

33. Leonard, A. E., Bobik, E. G., Dorado, J., Kroeger, P. E., Chuang, L. T., Thurmond, J. M., Parker-Barnes, J. M., Das, T., Huang, Y. S., and Mukerji, P. (2000) Cloning of a human cDNA encoding a novel enzyme involved in the elongation of long-chain polyunsaturated fatty acids. Biochem J 350 Pt 3, 765-770

116

34. Ohno, Y., Suto, S., Yamanaka, M., Mizutani, Y., Mitsutake, S., Igarashi, Y., Sassa, T., and Kihara, A. (2010) ELOVL1 production of C24 acyl-CoAs is linked to C24 sphingolipid synthesis. Proc Natl Acad Sci U S A 107, 18439-18444

35. Green, C. D., Ozguden-Akkoc, C. G., Wang, Y., Jump, D. B., and Olson, L. K. (2010) Role of fatty acid elongases in determination of de novo synthesized monounsaturated fatty acid species. J Lipid Res 51, 1871-1877

36. Kitazawa, H., Miyamoto, Y., Shimamura, K., Nagumo, A., and Tokita, S. (2009) Development of a high-density assay for long-chain fatty acyl-CoA elongases. Lipids 44, 765-773

37. Di Gregorio, E., Borroni, B., Giorgio, E., Lacerenza, D., Ferrero, M., Lo Buono, N., Ragusa, N., Mancini, C., Gaussen, M., Calcia, A., Mitro, N., Hoxha, E., Mura, I., Coviello, D. A., Moon, Y. A., Tesson, C., Vaula, G., Couarch, P., Orsi, L., Duregon, E., Papotti, M. G., Deleuze, J. F., Imbert, J., Costanzi, C., Padovani, A., Giunti, P., Maillet-Vioud, M., Durr, A., Brice, A., Tempia, F., Funaro, A., Boccone, L., Caruso, D., Stevanin, G., and Brusco, A. (2014) ELOVL5 mutations cause spinocerebellar ataxia 38. Am J Hum Genet 95, 209-217

38. Borroni, B., Di Gregorio, E., Orsi, L., Vaula, G., Costanzi, C., Tempia, F., Mitro, N., Caruso, D., Manes, M., Pinessi, L., Padovani, A., Brusco, A., and Boccone, L. (2016) Clinical and neuroradiological features of spinocerebellar ataxia 38 (SCA38). Parkinsonism Relat Disord 28, 80-86

39. Mashek, D. G., Li, L. O., and Coleman, R. A. (2007) Long-chain acyl-CoA synthetases and fatty acid channeling. Future Lipidol 2, 465-476

40. Belkaid, A., Ouellette, R. J., and Surette, M. E. (2017) 17beta-estradiol-induced ACSL4 protein expression promotes an invasive phenotype in estrogen receptor positive mammary carcinoma cells. Carcinogenesis 38, 402-410

41. Cao, Y., Traer, E., Zimmerman, G. A., McIntyre, T. M., and Prescott, S. M. (1998) Cloning, expression, and chromosomal localization of human long-chain fatty acid-CoA ligase 4 (FACL4). Genomics 49, 327-330

117

6. CHAPITRE VI: On the cellular metabolism of the click

chemistry probe 19-alkyne arachidonic acid

Philippe Pierre Robichaud, Samuel J Poirier, Luc H Boudreau, Jeremie A Doiron, David A

Barnett, Eric Boilard and Marc E Surette

The Journal of Lipid Research. 2016 Oct;57(10):1821-1830.


P.P.R., S.J.P., L.H.B., J.A.D., D.A.B. ont contribués aux travaux expérimentaux. P.P.R., E.B.

et M.E.S. ont contribués au développement du plan expérimental et ont écrit le manuscrit.

118

6.1. Résumé Les analogues de composantes cellulaires ayant un groupement alcyne ou azide, qui peuvent

être facilement couplés à d’autres molécules comme la biotine, et des fluorochromes par la «

Click Chemistry » sont de nouveaux outils très puissants pour étudié des procédés

biologiques. Le 19-alcyne acide arachidonique (AA-Alk) est un analogue cliquable de l’acide

arachidonique (AA), mais son utilisation comme outils de recherche nécessite une évaluation

afin de s’assurer qu’il agit de la même façon que l’AA. Dans cette étude, le métabolisme

cellulaire de l’AA alcyne fut comparé à celui de l’AA chez différents types de cellules

humaines. La lignée cellulaire lymphocytaire T Jurkat incorpore 2x plus d’AA que d’AA

alcyne, mais l’AA alcyne fut significativement plus élongé en 22:4 comparativement à l’AA.

Suite à l’incorporation de l’AA et l’AA alcyne dans les glycérophospholipides (GPL), leur

distribution et remodelage dans les différentes classes de GPL était très similaire indiquant

une utilisation équivalente par la CoA-independente transacylase. Cependant, les quantités

et les proportions des différents médiateurs lipidiques produits suite à la stimulation de

plaquettes et de neutrophiles humains en présence d’AA alcyne étaient significativement

différentes qu’en présence d’AA normale. De plus, l’induction de la boucle autocrine chez

les neutrophiles avec l’AA alcyne exogènes stimule significativement moins la production

du LTB4 qu’avec l’AA, et le LTB4 alcyne est 12x moins bon pour stimuler la migration des

neutrophiles comparativement au LTB4. Ces observations qui suggèrent que le LTB4 alcyne

est un moins bon agoniste pour le récepteur BLT1 comparativement au LTB4. Ces résultats

démontrent que l’utilisation de l’AA alcyne pour étudier le métabolisme de l’AA nécessite

la prise de certaines précautions, car cet analogue n’est pas utilisé exactement comme l’AA

par les enzymes cellulaires.

119

6.2. Abstract Alkyne and azide analogues of natural compounds that can be coupled to sensitive tags by

click chemistry are powerful tools to study biological processes. Arachidonic acid (AA) is a

fatty acid precursor to biologically-active compounds. 19-alkyne-AA (AA-alk) is a sensitive

clickable AA analogue, however its use as a surrogate to study AA metabolism requires

further evaluation. In this study AA-alk metabolism was compared to that of AA in human

cells. Jurkat cell uptake of AA was 2-fold greater than that of AA-alk, but significantly more

AA-Alk was elongated to 22:4. AA and AA-alk incorporation into and remodelling between

phospholipid classes was identical indicating equivalent CoA-independent AA-phospholipid

remodelling. Platelets stimulated in the presence of AA-alk synthesized significantly less 12-

lipoxygenase and cyclooxygenase products than in the presence of AA. Ionophore-stimulated

neutrophils produced significantly more 5-lipoxygenase products in the presence of AA-alk

than AA. Neutrophils stimulated with only exogenous AA-alk produced significantly less 5-

LO products compared to AA, and LTB4-alk was 12-fold less potent at stimulating neutrophil

migration than LTB4 collectively indicative of weaker BLT1 agonist activity of LTB4-alk.

Overall, these results suggest that the use of AA-alk as a surrogate for the study of AA

metabolism should be carried out with caution.

120

6.3. Introduction The click chemistry reactions that easily conjugate molecules together are now widely used

to discover new drugs and inhibitor targets (1-4). Furthermore, alkyne and azide analogues

of naturally-occurring compounds which have minimal structure modifications and which

can be coupled to sensitive tags by click chemistry, are powerful emerging tools to study

biological processes (5, 6). A large number of alkyne and azide analogues and tags have been

described and these are very practical tools that can replace radioactive tracers in many

applications. Alkyne-lipid analogues have been shown to be particularly useful for the

isolation and identification of individual species of lipids from complex mixtures as well as

for profiling protein lipidation because of the ability to specifically extract labeled

compounds (7-12).

Clickable lipid analogues, including alkyne fatty acids, have proven to be very useful as

surrogates to study fatty acid metabolism and fatty acid protein interactions in complex

mixtures (12-17). Amongst these, 19-alkyne arachidonic acid (AA-alk) (Figure 6.1) has been

suggested to be a sensitive probe for the study of cellular arachidonic acid (AA) metabolism

(17, 18).

Figure 6.1. The structures of arachidonic acid and its clickable analogue 19-

alkyne arachidonic acid.

AA is the polyunsaturated fatty acid precursor to a number of potent biologically-active

molecules such as prostaglandins and leukotrienes, thus this probe may serve as a suitable

tracker for cellular AA metabolism that is under tight regulation (Figure 6.2).

121

Figure 6.2. Schematic representation of cellular arachidonic acid incorporation

and metabolism.

Once incorporated into cells, free arachidonic acid (AA) is activated by acyl-CoA

synthetases (ACS) to produce the AA-CoA required for its incorporation into

phospholipids by the action of lysophospholipid acyl-CoA acyltransferases (LPLAT).

The action of phospholipases A2 (PLA2) is required to generate the 2-lyso-PL

substrate. AA-CoA can also be elongated to 22:4 n-6 following the action of elongases

of very long fatty acids (ELOVL). Once incorporated into phospholipids, AA can also

be directly transferred between phospholipid species by CoA-independent

transacylase (CoA-IT) catalyzed reactions. Upon cell stimulation, PLA2 catalyzes the

hydrolysis of AA from phospholipids, which can be converted into various lipid

122

mediators (eicosanoids) by the action of cyclooxygenases (COX) and lipoxygenases

(LO). FA=fatty acid; PC=phosphatidylcholine; PI=phosphatidylinositol;

PE=phosphatidylethanolamine; HETE=hydroxyeicosatetraenoic acid;

LTB4=leukotriene B4; 12-HHTrE=12-hydroxyheptadecatrienoic acid;

PGH2=prostaglandin H2; LTA4H=leukotriene A4 hydrolase.

However, prior to utilizing any new analogue as a surrogate in metabolic studies, it is

important to make sure that its metabolism and regulation resembles that of AA itself.

Mammalian cells cannot synthesize AA de novo and must obtain this essential fatty acid from

exogenous sources as intact AA or as one of its precursors. Cells mainly store AA in the sn-

2 position of membrane phospholipids, although AA can also be elongated to 22:4 n-6 prior

to its incorporation into phospholipids. AA undergoes a specific pattern of incorporation into

phospholipids where initial acylation is primarily in phosphatidylcholine (PC) and

phosphatidylinositol (PI) resulting from reactions catalyzed by acyl-CoA-synthetases and

lysophospholipid acyl-CoA acyltransferases. Once AA is incorporated into PC species, it is

then transferred primarily into 1-radyl phosphatidylethanolamine (PE) species by a CoA-

independent transacylase (CoA-IT)-catalyzed reaction (19-24).

Upon appropriate cell stimulation, AA can be hydrolyzed from PL by a phospholipase A2

(PLA2) and can be converted by lipoxygenases and cyclooxygenases into many different

bioactive lipid mediators, called eicosanoids, that include hydroxyeicosatetraenoic acids

(HETEs), leukotrienes, prostaglandins and lipoxins (24-27). These enzymes can also catalyze

the conversion of exogenous AA. The enzymes expressed in any particular cell type dictate

the bioactive lipid product profile. Significantly, these compounds are important lipid

mediators of inflammation and have been shown to participate in the maintenance of

homeostasis, including host immunity, as well as in numerous pathologies (27-29).

The aim of this study is to evaluate whether AA-alk is a suitable traceable analogue of AA

for studying cellular arachidonate-phospholipid and eicosanoid metabolism. Overall, the

results suggest that AA-alk may be a good surrogate for studying aspects of cellular AA-

phospholipid metabolism, but may not be suitable for studies of bioactive lipid mediator

production and activity.

123


Boron trifluoride (14% in methanol) was obtained from Sigma-Aldrich (Oakville, ON). The

[3H]arachidonic acid was purchased from American Radiolabeled Chemicals Inc. (St. Louis,

MO). The 1,2, diheptadecanoyl-PC was from Biolynx (Brockville, ON). Fatty acid methyl

esters (FAME) and free fatty acids were obtained from Nu-check Prep (Elysian, MN). 19-

alkyne arachidonic acid was purchased from NuChem Thérapeutiques Inc., Montreal, QC.

Cell culture and pulse-labeling (remodeling)

Jurkat cells were cultured in RPMI-1640 medium supplemented with 10% FBS, 10 mM

HEPES, D-glucose (to 25 mM) and 1 mM sodium pyruvate at 37oC in a 5% CO2 atmosphere.

For fatty acid incorporation studies, Jurkat cells were incubated in the presence of 20 µM AA

or 20 µM AA-alk for 2h at 37ºC. Cells were then washed twice with culture medium and

cellular lipids were extracted in chloroform using heptadecanoyl-PC as an internal standard

(30). For pulse labeling experiments, Jurkat cells (6x107) were pulse labeled in 3 ml of culture

medium (2% FBS) containing 20 µM [3H]AA or 20 µM AA-alk for 2h at 37ºC. Cells were

then washed twice with culture medium and incubated for another 0, 4 or 24 hours before

cellular lipid extraction. Cellular lipids were extracted in chloroform (30), phospholipid

classes were separated by reverse phase high performance liquid chromatography (RP-

HPLC) (31) and fractions containing neutral lipids (NL), PE, PI, phosphatidylserine (PS) and

PC were collected using elution times determined with phospholipid standards. The internal

standard heptadecanoyl-PC was added to each fraction prior to further analyses.

Fatty acid analysis

Cellular lipid extracts or HPLC fractions were dried and saponified with 400 µl of 0.5 M

KOH in methanol at 100oC for 15 min, and FAME were then prepared by adding 1 ml of

14% BF3 in methanol and heating at 100oC for 10 min. FAME were extracted in hexane and

quantified by GC-FID using a 30-m trace-FAME column on a Thermo Trace gas

chromatograph (Thermo Electron Corporation, Mississauga, ON) (32). Authentic FAME

standards were used for the identification of fatty acid peak retention times and for standard

124

curve quantification. For pulse-label studies the radioactivity was also measured in each

fraction by liquid scintillation counting (Beckman Instruments LS 5000 CE).

To confirm the identity of the 22:4-alkyne, FAME were analysed and measured by positive

ion chemical ionization gas chromatography/mass spectrometry (GC/MS) using a Polaris Q

mass spectrometer (Thermo). The positive chemical ionization ion trap scan was 300-350 u,

the reagent gas was methane (0.6 ml/min, 180°C) and helium was the damping gas (0.3

ml/min).

Preparation and stimulation of human platelets

Platelets were isolated from heparinized blood obtained from healthy donors as previously

described (33). Briefly, blood was centrifuged at 200 x g for 10 min at room temperature.

The platelet-rich plasma fraction (upper phase) was collected and centrifuged at 400 x g for

2 min to remove remaining erythrocytes. Platelets were then pelleted following

centrifugation at 1 300 x g for 10 min and platelets (300 x 106 cells/ml) were resuspended in

Tyrode buffer (134 mM NaCl, 2.9 mM KCl , 20 mM HEPES, 5 mM CaCl2, 1 mM MgCl2, 5

mM glucose, 0.34 mM Na2HPO4, 12 mM NaHCO3 and 0.5 mg/ml BSA, pH 7.4). Stimulation

of platelets was initiated with the addition of 10 µM calcium ionophore A23187 (Sigma-

Aldrich) in the presence of 10 µM AA or 10 µM AA-alk for 15 min at 37°C. Stimulations

were stopped with the addition of 2 volumes of cold methanol containing 50 ng of 19-OH-

PGB2 (internal standard) and samples were stored at -20°C prior to analysis by RP-HPLC.

Preparation and stimulation of human neutrophils

Neutrophils were isolated from heparinized blood obtained from healthy donors as

previously described (34). Briefly, blood was centrifuged at 200 x g for 10 min at room

temperature, the platelet-rich plasma was discarded and erythrocytes were removed

following dextran sedimentation. Following centrifugation on a lymphocyte separation

medium cushion (density, 1.077 g/ml) (Wisent, St-Bruno, Qc, Canada) at 900 x g for 20 min

at room temperature, mononuclear cells were eliminated and neutrophils (>96%) were

obtained from the pellet after hypotonic lysis in purified water to eliminate contaminating

erythrocytes. Neutrophils suspended in HBSS (1x107 cells/ml) containing 1.6 mM CaCl2 and

125

0.4 U/ml of adenosine deaminase were stimulated with 10 µM calcium ionophore A23187 in

the presence of 10 µM AA or 10 µM AA-alk for 5 min at 37°C. For autocrine loop

experiments, PMN were stimulated with varying concentrations of AA or AA-alk for 5 min

at 37°C (35). All neutrophil stimulations were stopped with the addition of 0.5 volumes of

cold methanol containing 25 ng of 19-OH-PGB2 and samples were stored at -20°C prior to

analysis.

Preparation and stimulation of HEK293 cells

HEK293 cells that were stably transfected to express human 5-LO and human 5-LO

activating protein (FLAP) (36, 37) were cultured in DMEM medium supplemented with 10%

FBS at 37°C in a humidified 5% CO2 environment. Cells were washed, suspended in HBSS

(1x107 cells/ml) containing 1.6 mM CaCl2 and were stimulated with 10 µM calcium

ionophore A23187 in the presence of 10 µM AA or 10 µM AA-alk for 15 min at 37°C.

Stimulations were stopped with the addition of 0.5 volumes of cold methanol containing

25 ng of 19-OH-PGB2 and samples were stored at -20°C prior to analysis by RP-HPLC.

Eicosanoid analysis by RP-HPLC

Samples were centrifuged at 300 x g to remove precipitated proteins and the supernatants

were diluted with water to obtain a final methanol content of 20% (v/v). Samples were then

subjected to in-line solid phase extraction and RP-HPLC analysis with UV detection

optimized to separate lipoxygenase products as previously described (38) with some

variations. Briefly, samples were injected onto an Agilent 1100 HPLC equipped with an

Oasis HLB online cartridge column (3.9 x 20 mm, 15 µm particle size) (Waters, Milford,

MA) for in-line extraction using 0.1% acetic acid as mobile phase at a flow rate of 3 ml/min

for 3 min. The solvent was then changed over 0.1 min to solvent A (54% H2O: 23% methanol:

23% acetonitrile: 0.0025% H3PO4) and a Rheodyne® valve was switched to direct the flow

to a Chromolith® HighResolution RP-18 endcapped column (100 x 4.6 mm) (EMD

Millipore, Etobicoke, ON, Canada) at a flow rate of 2.2 ml/min. After 5.11 min the mobile

phase was then changed to 85% solvent A and 15% solvent B (5% H2O: 32% methanol: 63%

acetonitrile: 0.01% H3PO4) for 1 min, followed by a linear gradient to 55% solvent A and

45% solvent B over the next 0.3 min and held at that proportion for an additional 1.3 min.

126

The gradient was then changed in a linear fashion to 30% solvent A and 70% solvent B over

a 1.3 min period and held for an additional 1.3 min at which time the mobile phase was

changed to 100% solvent B over 0.2 min and held for 3.5 min. Peaks were quantified by

absorbance at 236 nm and 270 nm using a diode array detector.

LC-MS/MS analyses

Selected peaks eluting from the above HPLC analyses were collected for further

characterization by mass spectrometry. LC-MS/MS analysis was performed using a Dionex

Ultimate 3000 liquid chromatograph coupled to a Thermo-Fisher Scientific Linear Ion Trap

(LTQ-XL) using a Hypersil Gold C18 column (150 mm x 2.1 mm i.d.) with a solvent gradient

of 50% to 100% methanol (Solvent B) over 40 minutes at a flow rate of 100 L/min. Solvent

A consisted of water and both solvents were of HPLC grade with no buffer additives. The

sample injection volume was constant for all samples at 5 L. The mass spectrometer was

operated in negative ion mode with LC-MS spectra collected in full scan mode over an m/z

range of 200-800 and LC-MS/MS spectra collected from 90-400. The MS/MS collision

energy was set to 35% with an isolation mass width of 3. Interface parameters for the mass

spectrometer were as follows: sheath gas (15, arbitrary units), auxiliary gas (1, arbitrary

units), capillary temperature (250oC), capillary voltage (-45 volts) and tube lens voltage (-

150 volts). Full scan MS and MS/MS spectra were collected for separate LC injections.

Neutrophil migration assay

In order to produce LTB4 and LTB4-alk for functional studies, HEK293 cells that were stably

transfected to express 5-LO and FLAP (36, 37) were stimulated with A23187 in the presence

of 40 µM of AA or AA-alk, respectively. 5-LO products were separated by RP-HPLC as

described above, the LTB4 and LTB4-alk peaks were collected, dried and resuspended in

ethanol. Control experiments were performed with non-transfected HEK293 cells that do not

express 5-LO and FLAP and do not produce 5-LO products (36).

To measure the chemoattractant activity of LTB4 and LTB4-alk, 200 µl of neutrophil

suspension (2.5 x 106 cells/ml HBSS containing 1.6 mM CaCl2 and 5% FBS) pre-incubated

with 0.3 U/ml ADA were transferred to cell culture inserts (3.0 µm pore size, Falcon).

127

Neutrophils were allowed to migrate (2h, 37°C, 5% CO2) to the lower chamber containing

700 µl HBSS/1.6 mM CaCl2 along with 10 nM of LTB4-alk, LTB4, or diluent as negative

control. Inserts were then discarded and cells that had migrated to the lower chamber were

counted using the MOXI Z Mini automated cell counter (Orflo Technologies, Ketchum, ID,

USA). Calculations were performed as previously described (39).

Statistical analyses

Statistical analyses were performed using Prism software (GraphPad Software Inc., La Jolla,

CA, USA) as described in the figure legends. Data show the means ± standard errors of the

means (SEM) for n=3 to n=6 independent experiments.

Ethics

This study was approved by the Université de Moncton institutional Review Committee for

Research involving human subjects. All subjects provided informed consent prior to their

participation in the study.

6.5. Results Incorporation of AA-alk and AA into cells.

FAMEs were prepared from pure AA and AA-alk and were separated by gas

chromatography. It was determined that AA-alk-methyl ester eluted at a retention time of

approximately 17.5 min, thus about 6 min later than that of AA-methyl ester (Figure 6.7

(Supplemental Figure SI)).

To compare the ability of cells to take up exogenous AA-alk and AA, Jurkat cells were

incubated with 20 µM of each fatty acid for two hours, cells were washed, lipids were

extracted, FAMEs were prepared and cellular fatty acids were measured. In cells incubated

with AA-alk, a peak corresponding to AA-alk was observed on chromatograms, as well as

second peak eluting at 21 min (Figure 6.7 (Supplemental Figure SI)). Based on the relative

elution profiles of AA-alk, AA and 22:4n-6, this second peak eluted at a retention time where

the elongation product 22:4-alk would be expected. The identity of the putative 22:4-alk was

confirmed by mass spectrometry where the molecular mass of the FAME was determined to

128

be 343.3 m/z, which is the expected mass of the protonated methyl-22:4-alk. The quantities

of AA-alk and 22:4-alk were approximately equivalent suggesting a very efficient elongation

of AA-alk during this 2-hour incubation period (Figure 6.3).

Figure 6.3. The incorporation and elongation of exogenous AA and AA-alk into

Jurkat cells.

Jurkat cells were incubated with 20 µM AA, 20 µM AA-alk or their diluent controls

for 2 hours. Cells were then washed, cellular lipids were extracted, fatty acids were

hydrolyzed and transmethylated, and FAMEs were measured by GC-FID. The results

show the increase in the cellular content of AA, 22:4, AA-alk and 22:4-alk compared

to controls following the 2-hour incubation period. Data are the means ± SEM of 3

independent experiments (n=3). *Different from cells incubated with AA (p<0.05) as

determined by two-sided student’s t-tests.

In cells incubated with exogenous AA, both the cellular AA and 22:4 content increased

following the 2-hour incubation period, though the increase in cellular AA was

approximately 4-fold greater than that of 22:4 (Figure 6.3). When the total uptake of

exogenous AA and AA-alk were measured, including their elongation products, cells

incorporated nearly two times more AA than AA-alk during this 2h incubation period (Figure

6.3). Overall this indicates that while the capacity to incorporate AA into cells was greater

than that of AA-alk, a greater proportion of the AA-alk was elongated compared to AA.

0

100

200

300

400

500

600

700

Incr

ease

in c

ellu

lar

fatt

y ac

ids

(pm

ol /

106

cells

)

20:422:420:4 + 22:4

**

20:4-alk22:4-alk20:4-alk + 22:4-alk

AA AA-alk

129

Arachidonate-phospholipid remodeling

The uptake of exogenous AA into glycerophospholipids is known to follow a distinct pattern

where the initial incorporation of AA is primarily into PC species, followed by a CoA-

independent transacylase (CoA-IT)-driven remodeling into PE species (Figure 6.2) (20-24).

To compare the incorporation and remodeling of AA and AA-alk, their distribution in cellular

glycerophospholipid classes was measured over a 24-hour period following a two-hour pulse

with 20 µM of [3H]AA or with 20 µM of AA-alk. The initial incorporation of [3H]AA was

primarily into PC with a subsequent redistribution toward PE species over time (Figure

6.4A).

Figure 6.4. Arachidonate-phospholipid remodeling in Jurkat cells.

Jurkat cells were pulse-labeled with (A) 20 µM [3H]AA or (B) 20 µM AA-alk for 2

hours, were then washed and incubated for the indicated times prior to lipid extraction.

Phospholipid classes were separated by HPLC and phosphatidylcholine (PC),

phosphatidylethanolamine (PE), phosphatidylinositiol (PI) and phosphatidylserine

(PS) were collected separately. The fatty acids from each fraction were hydrolyzed and

transmethylated, and AA-alk and 22:4-alk FAMEs were measured by GC-FID. The

radioactivity associated with each fraction was measured by liquid scintillation

counting. Values represent the mean ± SEM of 3 independent experiments (n=3).

Approximately 20% of the [3H]AA incorporated into glycerophospholipids was in PI and the

proportion of radiolabel associated with PI did not change significantly during the subsequent

24-hour incubation period. This pattern of [3H]AA labeling and remodeling in

0 4 8 12 16 20 240

20

40

60

80

Time (h)

[3 H] A

rach

idon

ic a

cid

(% C

PM)

PEPC

PIPS

0 4 8 12 16 20 240

20

40

60

80

Time (h)

AA

-alk

+ 2

2:4-

alk

(% m

ol)

PCPEPIPS

A B

130

glycerophospholipid classes is consistent with previous reports (21-23, 40). AA-alk

incorporation and remodeling in glycerophospholipids followed a nearly identical pattern to

that observed with [3H]AA, with the characteristic remodeling between PC and PE classes

and a stable incorporation into PI (Figure 6.4B). Since labeling with [3H]AA tracks both

[3H]AA and its [3H]22:4 elongation product, the remodeling pattern of AA-alk was calculated

using the sum of AA-alk and 22:4-alk.

Eicosanoid biosynthesis in human platelets

Stimulated human platelets primarily convert exogenous AA into bioactive eicosanoids

through the 12-lipoxygenase (12-LO) and the cyclooxygenase-1 (COX-1) pathways. 12-LO

catalyzes the oxygenation of AA into 12-hydroperoxyeicosatetraenoic acid that is then

rapidly converted to 12-hydroxyeicosatetraenoic acid (12-HETE). COX-1 catalyzes the

conversion of AA into prostaglandin H2 (PGH2) that, in platelets, is then rapidly and

concurrently converted to thromboxane A2 (TxA2) and 12-hydroxyheptadecatrienoic acid

(HHTrE) by thromboxane synthase (26, 41). To compare the ability of human platelets to

convert AA and AA-alk to eicosanoids in each pathway, platelets were stimulated with

calcium ionophore A23187 in the presence of 10 µM AA or 10 µM AA-alk. The lipid

mediators 12-HETE and HHtrE (or their alkyne analogues) were then measured following

separation by RP-HPLC with UV detection. In platelets stimulated in the presence of

exogenous AA, the typical product profile measured by RP-HPLC was obtained with

detectable quantities of 12-HETE and HHTrE (Figure 6.8 (Supplemental Figure SIIA)). In

platelets incubated in the presence of AA-alk, a peak with the typical spectrum and λ-max

(237nm) of HETEs was observed on HPLC chromatograms that elutes approximately 4

minutes earlier than 12-HETE (Figure 6.8 (Supplemental Figure SIIB)) and was termed 12-

HETE-alk. Similarly, a peak with the typical spectrum and λ-max (232nm) of HHTrE was

observed on HPLC chromatograms that elutes approximately 4 minutes earlier than HHTrE

and was termed 12-HHTrE-alk (Figure 6.8 (Supplemental Figure SIIB)). 12-HETE-alk was

the major AA-alk product (7.6± 2.2 pmol/106 cells, mean±SEM) as very little 12-HHTrE

(0.4± 0.09 pmol/106 cells, mean±SEM) was synthesized by stimulated platelets (Figure

6.5A).

131

Figure 6.5. Eicosanoid biosynthesis by human platelets, neutrophils and 5-LO-

transfected HEK293 cells stimulated in the presence of exogenous AA or AA-alk.

(A) Freshly isolated human platelets were stimulated with 10 µM calcium ionophore

A23187 in the presence of 10 µM AA or 10 µM AA-alk for 15 min at 37°C and

stimulations were stopped with organic solvents. (B) Freshly isolated human

neutrophils were stimulated with 10 µM calcium ionophore A23187 in the presence of

10 µM AA or 10 µM AA-alk for 5 min at 37°C and stimulations were stopped with

organic solvents. (C) HEK293 cells that were stably transfected with 5-LO and FLAP

were stimulated with 10 µM calcium ionophore A23187 in the presence of 10 µM AA

132

or 10 µM AA-alk for 15 min at 37°C and stimulations were stopped with organic

solvents. AA-derived and AA-alk-derived products were separated by HPLC and

measured by UV absorption at 270 nm and 236 nm. *Significantly different (p<0.05)

as determined by two-sided student’s t-tests. Data are the means ± SEM of 6

independent experiments (n=6) for the platelets, 3 independent experiments (n=3) for

the neutrophils and 4 independent experiments for the HEK293 cells (n=4). HETE =

hydroxyeicosatetraenoic acid; HHTrE = hydroxyheptadecatrienoic acid; LTB4 =

leucotriene B4.; Trans-LTB4 = sum of 6-trans-LTB4 and 12-epi-6-trans-LTB4; ω-LTB4

= sum of 20-hydroxy-LTB4 and 20-carboxy-LTB4.

Since mouse COX-2 was shown to produce 11-HETE-alk (18), the identity of the peak

identified as 12-HETE-alk was verified by LC-MS/MS. A parent ion with the expected m/z

of 315 for a HETE-alk product was observed (Figure 6.9 (Supplemental Figure SIIIA)).

Additionally, its expected dehydration/decarboxylation products with m/z of 297 and 253,

respectively, were present, as were the expected fragmentation ions of a 12-hydroxylated

product with m/z of 179 and 208 (Figure 6.9 (Supplemental Figure SIIIB)) (18, 42 ).

Importantly, the expected fragmentation ion of 11-HETE-alk with a m/z of 167 (18, 42 ) was

absent. Platelets stimulated in the presence of exogenous AA-alk also produced 12-HETE

and HHTrE generated from endogenous AA. Overall, the biosynthesis of 12-LO and COX-

1 products was significantly lower in platelets stimulated in the presence of AA-alk than in

platelets stimulated in the presence of exogenous AA (Figure 6.5A).

Eicosanoid biosynthesis in human neutrophils and HEK293 cells

The main arachidonic acid-derived metabolites synthesized by stimulated human neutrophils

are products of the 5-lipoxygenase pathway. Freshly isolated human neutrophils do not

synthesize COX products or express COX enzymes (43, 44). When human neutrophils were

stimulated with calcium ionophore A23187 in the presence of 10 µM exogenous AA, the 5-

LO products 5-HETE, LTB4, 6-trans-LTB4, 12-epi-6-trans-LTB4, and the omega-oxidation

products 20-hydroxy-LTB4 and 20-carboxy-LTB4 were measured following separation by

HPLC with UV detection (Figure 6.10 (Supplemental Figure SIV)). When neutrophils were

stimulated in the presence of 10 µM exogenous AA-alk, several peaks were detected by

133

HPLC that corresponded to expected 5-LO products with the appropriate absorbance spectra,

but whose elution times on HPLC were earlier than those measured for AA metabolites (6.10

(Supplemental Figure SIV)). One main difference with the AA-alk metabolite profile was

the absence of omega-oxidation products. Another difference was that 5-HETE-alk was the

predominant 5-LO product derived from AA-alk whereas 5-HETE was a much less

prominent 5-LO product synthesized by the cells stimulated in the presence of exogenous

AA (Figure 6.5B).

The peak identified as LTB4-alk was characterized by LC-MS/MS and its profile was

compared to that of commercial LTB4. Parent ions were observed with the expected m/z of

335 for LTB4 (LIPID MAPS® LM_ID: LMFA03020001) (45, 46) and m/z of 331 for LTB4-

alk (Figure 5.11 (Supplemental Figure SV)) and (Figure 5.12 (Supplemental Figure SVI)).

Fragmentation ions with m/z of 195, 151 and 129 were measured for both LTB4-alk and

LTB4, as would be expected based on the structures associated with the respective ions that

do not include the omega end of the molecule (46). Several ions from collision-induced

dissociation of LTB4 retain the omega end of the molecule such as ions resulting from one

and two dehydrations (m/z 317 and 299) and their additional decarboxylations (m/z 273 and

255), as well as fragmentation ion m/z 203 (46). Importantly, corresponding ions with m/z

313, 295, 269, 251 and 199 were observed in the MS/MS product ion spectra of LTB4-alk

that are analogous to fragments generated from LTB4 but with m/z values shifted by 4 units,

consistent with ions containing an omega-terminal alkyne (Figure 6.12 (Supplemental Figure

SVIB)). Additionally, the peak identified as 5-HETE-alk showed the expected parent ion and

fragmentation pattern that was previously reported for 5-LO-catalyzed 5-HETE-alk synthesis

(Figure 6.13 (Supplemental Figure SVII)) (18).

The profile of 5-LO products was also measured in HEK293 cells that were stably transfected

with human 5-LO and FLAP (37). This is an attractive model to measure 5-LO product

biosynthesis from exogenous substrates since they do not release endogenous AA when

stimulated and the control cells transfected with a control vector do not produce 5-LO

products. When control cells were stimulated in the presence of AA or AA-alk, no

measurable 5-LO products were produced (not shown). When the 5-LO/FLAP-transfected

134

cells were stimulated in the presence of exogenous substrate, 5-LO products were synthesized

in the same proportions as those measured in neutrophil, with more AA-alk products

produced than those of AA, and with 5-HETE-alk as the predominant AA-alk product (Figure

6.5C). Overall, the biosynthesis of total 5-LO products (AA-derived and AA-alk-derived)

was significantly greater in neutrophils or HEK293 cells stimulated in the presence of AA-

alk than in cells stimulated in the presence of exogenous AA (Figure 6.5B and 6.5C).

Functional studies of AA-alk and LTB4-alkyne

AA can stimulate human neutrophils though an autocrine stimulatory loop where exogenous

AA is converted to LTB4, which then activates the BLT1 receptor allowing a greater calcium-

dependent conversion of exogenous AA via the 5-LO pathway (35). When neutrophils were

incubated with exogenous AA or AA-alk to induce the autocrine stimulatory loop, exogenous

AA induced the expected robust stimulation of 5-LO product biosynthesis, whereas AA-alk

induced a markedly smaller cellular response (Figure 6.6A) suggesting that the autocrine

stimulatory loop was not induced by AA-alk.

Figure 6.6. (A) Autocrine stimulation of neutrophils with exogenous AA and AA-

alk and (B) neutrophil chemoattractant activity of LTB4 and LTB4 alk.

(A) Freshly isolated human neutrophils were stimulated with various concentrations

of AA or AA-alk for 5 min at 37°C and stimulations were stopped with organic

solvents. AA-derived and AA-alk-derived products were separated by HPLC and

measured by UV absorption at 270nm and 236nm. 5-LO products are the sum of 5-

HETE, LTB4, 6-trans-LTB4, 12-epi-6-trans-LTB4, 20-hydroxy-LTB4 and 20-carboxy-

135

LTB4. (B) Freshly isolated human neutrophils were suspended in cell culture inserts

(3.0 µm pore size) and were allowed to migrate for 2 hours at 37°C to the lower

chamber containing the indicated concentrations LTB4-alk, LTB4, or their diluent.

Cells that had migrated to the lower chamber were counted and results show the

percent of cells that had migrated from the upper to the lower chamber. Data are the

means ± SEM of 3 independent experiments (n=3).

One of the main biological functions of LTB4 is its potent chemotactic activity toward human

neutrophils. To compare the biological activities of LTB4 and LTB4-alk, their ability to

induce BLT1-dependent neutrophil chemotaxis was measured. Using a transwell chemotaxis

assay, LTB4 was approximately 12 times more potent at stimulating neutrophil chemotaxis

(apparent EC50 1.7 nM, 95% CI: 0.8 nM - 3.5 nM) than LTB4-alkyne (apparent EC50 20.9

nM, 95% CI: 13.0 nM - 33.7 nM) (Figure 6.6B).

6.6. Discussion The use of alkyne or azide analogues of biological compounds that are amenable to click

chemistry reactions has attracted substantial recent interest. This is due to the ability to tag

the compounds with fluorescent or affinity probes, thus providing sensitive methods of

identifying their potential metabolites or ascertaining macromolecules with which the

compound may interact within complex biological mixtures. The use of these compounds

can also greatly simplify the ability to purify the compounds or their partners of interest

from complex milieus. However, to be truly useful as physiologically relevant probes it is

critical to understand the extent to which a clickable compound may behave like its natural

counterpart.

Fatty acids are attractive candidates for click chemistry probes since the methyl (or omega)

end of the aliphatic chain, which is generally not considered to be a biologically reactive

region of the molecule, can be modified into a terminal alkyne. Such fatty acid alkynes have

proven to be useful in studying the subcellular localization of palmitoylated proteins such as

hedgehog, tubulin and Ras (8, 12, 15) that are subject to posttranscriptional acylation.

Amongst the fatty acids that have been developed as click chemistry probes is the 19-alkyne

136

derivative of AA, AA-alk (Figure 6.1) (17, 18). AA is the precursor of numerous biologically

active lipid mediators and as such undergoes unique mechanisms of regulation compared to

other fatty acids, likely because of its role in regulating several biological processes including

inflammation. The current study compared the cellular metabolism of AA and AA-alk in the

lymphocytic leukemia Jurkat cell line that rapidly remodels AA between phospholipid

classes, as well as in human platelets that express 12-LO and COX-1 and in human

neutrophils that express 5-LO, all enzymes that catalyze the conversion of AA into

biologically active eicosanoids. Overall, AA-alk behaved similarly to AA with regard to

cellular uptake and distribution into cellular phospholipids, however its metabolism as a

precursor for biologically active eicosanoids differed considerably from its native counterpart

AA.

Rapidly proliferating cells typically have an enhanced requirement for unsaturated fatty acids

to support membrane biogenesis required for sustained cell proliferation (23, 47). When

incubated with exogenous AA or AA-alk, rapidly dividing Jurkat cells effectively

incorporated exogenous AA, however the capacity to incorporate exogenous AA-alk was

significantly inferior with about 50% of the capacity measured for AA. Long chain fatty acids

like AA are incorporated into cells by incompletely defined mechanisms that can include

simple diffusion and saturable transport processes. Proteins involved in the uptake of fatty

acids include fatty acid binding protein, caveolin-1, FAT/CD36 and the fatty acid transport

protein (FATP) family of proteins (19, 48, 49). With respect to long chain PUFA in particular,

acyl-CoA synthetase activity has been shown to be important for their incorporation into cells

and five isoforms of human long chain acyl-CoA synthetase have been identified (19, 50-52)

with the ACSL4 isoform showing specificity for AA. While cellular AA incorporation can

involve the participation of fatty acid transfer proteins and acyl-CoA synthetases, the exact

contribution of different proteins isoforms associated with AA uptake is not fully elucidated

and likely several mechanisms can be at play in any given cell type. Although the mechanism

of cellular uptake in lymphocytic leukemia cells has not been elucidated, the results of the

current study suggest that the AA-specific transport mechanisms are not as effective with

AA-alk as a substrate indicating that the use of AA-alk as a tool or substrate to study AA

transport proteins or mechanisms should be performed with caution.

137

Once incorporated into cells, AA is usually converted by acyl-CoA synthetases to AA-CoA

thioesters. AA can then be incorporated into glycerophospholipids by reactions catalyzed by

acyl-CoA lysophospholipid acyl transferases, or undergo elongation to 22:4 by a reaction

catalyzed by elongation of very long chain fatty acids proteins (ELOVLs) prior to

incorporation into glycerophospholipids. Although AA-alk was not as effectively

incorporated into cells as AA, approximately half of the AA-alk that was incorporated

underwent elongation to its 22:4 elongation product compared to only 20% of the newly-

incorporated AA. This suggests that compared to AA, AA-alk is more effectively utilized as

a substrate for the ELOVL enzymes expressed in Jurkat cells. This observation could reflect

differences in substrate preference of the ELOVL enzymes, or these enzymes they may

elongate a smaller proportion of exogenous AA because cells already contain its elongation

product 22:4 and thus substrate/product equilibrium is reached more rapidly than with AA-

alk. Regardless of the mechanism explaining this difference in elongation potential, these

observations once again suggest that results obtained with AA-alk as a surrogate for the study

of AA elongation must be carefully interpreted.

AA undergoes a pattern of incorporation into and remodelling between glycerophospholipid

classes that appears to be specific for AA compared to other fatty acids (20, 23, 53, 54). This

unique remodelling pattern is believed to have evolved partly because AA is the precursor of

very potent bioactive metabolites and cells have developed mechanisms to tightly control its

cellular distribution and bioavailability. Unlike cellular uptake and elongation reactions, the

measured patterns of incorporation of AA-alk and AA into the main glycerophospholipid

classes were nearly identical with between 60-70% of the initial incorporation occurring in

PC species, 15-20% into PE and PI species and less than 5% into PS species. This suggests

that the acyl-CoA lysophospholipid acyl transferases that catalyze the incorporation into

glycerophospholipid classes appear to utilize AA-CoA and AA-alk-CoA in a near-identical

fashion. Furthermore, the typical CoA-independent transacylase-driven remodelling of

newly incorporated AA from PC species to PE species was identical for AA and AA-alk.

Therefore, AA-alk appears to be a very good surrogate of AA when studying AA

incorporation into and remodelling between glycerophospholipid classes.

138

Some cell types like leukocytes and platelets can readily transform exogenous AA into

bioactive eicosanoids by reactions catalyzed by lipoxygenases and cyclooxygenases. When

these cells are activated by stimuli like calcium ionophores, exogenous AA, as well as

endogenous AA hydrolyzed from phospholipids by phospholipases A2, are rapidly

transformed by these enzymes into a diversity of products. Stimulated platelets utilized

exogenous AA-alk as a substrate for both 12-LO and COX-1 product biosynthesis. However

smaller quantities of 12-HETE-alk and the HHTrE-alk were produced by these cells

compared to AA metabolites suggesting that AA-alk is not as efficiently transformed by

platelets as AA. These results are consistent with a previous report comparing the kinetics of

AA and AA-alk transformation by crude human 12-LO preparations where the

transformation of AA was slightly more efficient than that of AA-alk (18). Similarly, purified

murine cyclooxygenases were reported to efficiently oxidize AA-alk, but poorly catalyzed

the cyclization of dioxalanyl intermediates to endoperoxides (18), which is consistent with

the very limited biosynthesis of HHTrE-alk by stimulated platelets. However, the murine

COX-catalyzed production of 11-HETE-alk that resulted from the poor cyclization was not

detected in stimulated human platelets.

Stimulated human neutrophils metabolize AA through the 5-LO pathway. When stimulated

in the presence of AA-alk, alkyne derivatives of the expected 5-LO products were

synthesized with the exception of the LTB4-alk degradation products 20-OH-LTB4-alk and

20-COOH-LTB4-alk. This is likely because CYP4F3A, the cytochrome P450 protein

responsible for the oxidation of the omega methyl end of AA (55), cannot catalyze the

oxidation of the 19-alkyne moiety at the omega end of the AA-alk molecule. Alkynes are

also known to inhibit cytochrome P450 enzymes (56). Despite the inability to degrade LTB4,

cells stimulated in the presence of AA-alk did not show an accumulation of LTB4-alk

compared to LTB4 measured in cells stimulated in the presence of AA. In contrast to platelet

eicosanoids, neutrophils produced more 5-LO metabolites when stimulated in the presence

of AA-alk than in the presence of AA and this was primarily due the significantly greater

production of 5-HETE-alk compared to 5-HETE. In fact, there was a significant shift in

product profiles where 5-HETE-alk was the predominant AA-alk product, while LTB4 and

its derivatives were the predominant AA-derived products. Near identical 5-LO product

139

profiles were also measured in 5-LO/FLAP-transfected HEK293 cells. This suggests that the

lipoxygenation of AA-alk at carbon-5 generating 5-HpETE-alk is efficient, but that the

second pseudolipoxygenation that involves abstraction of a hydrogen at carbon-10 from 5-

HpETE-alk to generate the LTA4-alk epoxide is not as efficient as with the AA-derived

substrate. Thus the presence of the 19-alkyne structure appears to impact on the substrate

specificity of 5-LO differently for each of the two 5-LO-catalyzed reactions. The ultimate

outcome is an altered product profile where (LTB4+derivatives)/5-HETE ratios are

significantly different depending on the substrate. These observations suggest that the use of

AA-alk as a surrogate for the study of AA-derived lipid mediator metabolism must be

performed with caution.

In the absence of other stimuli, exogenous AA can stimulate human neutrophils though an

autocrine stimulatory loop. In this stimulation model basal 5-LO activity converts exogenous

AA into LTB4 in a calcium-independent manner, which then activates the BLT1 receptor

allowing a more robust cellular stimulation with a calcium-dependent activation of 5-LO and

more extensive conversion of exogenous AA via the 5-LO pathway (35). However, AA-alk

produced a much weaker stimulation of human neutrophils through this autocrine stimulatory

loop than that of exogenous AA. This may be because AA-alk is preferentially metabolized

to 5-HETE rather than LTB4, thus lessening the strength of the autocrine stimulatory loop

that relies on a basal production of LTB4. Alternatively, it may indicate that LTB4-alk is a

weaker BLT1 agonist than LTB4 and at low concentrations may not be potent enough to drive

the calcium dependent autocrine stimulation of neutrophils. Regardless of the mechanism

responsible for this diminished stimulation by exogenous AA-alk, this indicates that cellular

responses to exogenous AA-alk are not as robust as those measured in response to exogenous

AA.

In light of the more muted stimulation of neutrophils in response to AA-alk compared to AA,

the biological activity of LTB4-alk was compared to that of LTB4. LTB4 is best known as a

very potent chemotactic agent toward human leukocytes (57-59). When freshly isolated

human neutrophil migration was measured in a trans-well migration assay, LTB4 exhibited

chemotactic activity in the low nanomolar range as expected (60). While LTB4-alk also

140

exhibited chemotactic activity toward neutrophils, it was less potent than that of LTB4 by a

full order of magnitude. Since LTB4-induced chemotaxis is dependent on stimulation of the

BLT1 receptor (58-60), this indicates that LTB4-alk is a weaker BLT1 agonist than LTB4 and

suggests that the biological activity of other AA-alk-derived eicosanoids may warrant

investigation. Once again, these observations regarding the weaker ability of AA-alk and

LTB4-alk to stimulate cells suggests that experiments performed using AA-alk-derived

eicosanoids should be carefully considered.

Reagents that are amenable to click chemistry are proving to be extremely useful analytical

and discovery tools due to structural and biological similarities to their natural analogues,

and the ease with which they can be detected, labeled and purified in complex biological

matrices. Omega-terminal alkyne derivatives of fatty acids are amongst these reagents and

are certainly powerful tools that have already yielded new important information on fatty

acid-protein interactions. While the current study does not invalidate the use of AA-alk as a

potentially powerful tool to investigate AA metabolism and behaviour in biological systems,

some important differences in its metabolism and biological activity have been delineated

that should be useful to investigators who will use these tools to investigate AA in biological

systems.

141


Figure 6.7. Supplemental Figure SI. Gas chromatograms of FAMEs prepared

from Jurkat cells incubated for 2 hours in the absence (A) or presence (B) of 20

µM AA-alk.

A

B

142

Figure 6.8. Supplemental Figure SII. HPLC chromatograms of eicosanoids from

human platelets stimulated with calcium ionophore A23187 in the presence of 10

µM AA (A) 10 µM AA-alk (B). Inserts are UV spectra of indicated peaks.

A

B

143

Figure 6.9. Supplemental Figure SIII. LC-MS/MS analysis of product identified

as 12-HETE-alk.

(A) LC-MS elution profile of ions with a m/z of 314.5-315.5. (B) MS/MS

fragmentation pattern of the parent ion (m/z of 315) eluting at a retention time of 27.15

min. Inset: Structures associated with key selected ions (18, 42 ).

A

B O

O

OHOH

O

[M-H]-

315.1966 C20H27O3

-

m/z

179.1078 C11H15O2

-

m/z

208.1105 C12H16O3

-. O

O

OH

144

A

B

C

D

Figure 6.10. Supplemental Figure SIV. HPLC chromatograms of

eicosanoids from human neutrophils stimulated with calcium ionophore A23187

in the presence of 10 µM AA (A and C) or 10 µM AA-alk (B and D). Inserts are

UV spectra of indicated peaks.

145

Figure 6.11. Supplemental Figure SV. MS/MS analysis of authentic LTB4.

MS/MS fragmentation pattern of the parent ion (m/z of 335). Inset: Structures

associated with key selected ions. (LIPID MAPS® LM_ID: LMFA03020001) (45, 46)

O

OOH

OH

OH

OOHm/z

195.1027 C11H15O3

-

m/z

151,1128 C10H15O-

m/z

129.0557 C6H9O3

-

O

OOHH OHH [M-H]-

335.2228 C20H31O4

-

m/z

203.1805 C15H23

-

146

Figure 6.12. Supplemental Figure SVI. LC-MS/MS analysis of product

identified as LTB4-alk.



min. Inset: Structures associated with key selected ions. (46)

A

B O

OOHH OHH

O

OOH

OH

OH

OOH

[M-H]-

331.1915 C20H27O4

-

m/z

199.1492 C15H19

-

m/z

195.1027 C11H15O3

- m/z

151,1128 C10H15O-

m/z

129.0557 C6H9O3

-

147

Figure 6.13. Supplemental Figure SVII. LC-MS/MS analysis of product

identified as 5-HETE-alk.



min. Inset: Structures associated with key selected ions (18, 42).

A

B OH

O

O

O

O

H

O

[M-H]-

315.1966 C20H27O3

-

m/z

199.1492 C15H19

-

m/z

115.0401 C5H7O3

-

148

6.8. Abbreviations AA, arachidonic acid; alk, Alkyne; LTB4, leukotriene B4; 12-HHTrE, 12-

hydroxyheptadecatrienoic acid; PGH2, prostaglandin H2; LTA4H, leukotriene A4 hydrolase;

PLA2, phospholipase A2; ACSL, acyl-CoA synthetase; CoA-IT, CoA-independent

transacylase; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PI,

phosphatidylinositol; PS, phosphatidylserine; LPLAT, lysophospholipid acyltransferase;

FAME, fatty acid methyl esters.

6.9. Acknowledgements The authors thank Natalie Levesque for technical support with fatty acid analysis by GC-MS.

This work was supported by grants from the Canadian Institutes of Health Research (CIHR)

and the New Brunswick Health Research Foundation (NBHRF) awarded to ME Surette. PP


Fonds de recherche sur l'arthrite et les maladies rhumatismales de l’université Laval. SJ

Poirier was supported by Doctoral Scholarships from the CIHR and the NBHRF. LH

Boudreau was supported by the New Brunswick Innovation Foundation (NBIF). EB is

recipient of a New Investigator Award from the CIHR. ME Surette is the recipient of a New

Brunswick Innovation Research Chair.

6.10. References 1. Kolb, H. C., and K. B. Sharpless. 2003. The growing impact of click chemistry on drug discovery. Drug Discov Today 8: 1128-1137. 2. Cravatt, B. F., A. T. Wright, and J. W. Kozarich. 2008. Activity-based protein profiling: from enzyme chemistry to proteomic chemistry. Annu Rev Biochem 77: 383-414. 3. Niphakis, M. J., and B. F. Cravatt. 2014. Enzyme inhibitor discovery by activity-based protein profiling. Annu Rev Biochem 83: 341-377. 4. Nwe, K., and M. W. Brechbiel. 2009. Growing applications of "click chemistry" for bioconjugation in contemporary biomedical research. Cancer Biother Radiopharm 24: 289-302. 5. McKay, C. S., and M. G. Finn. 2014. Click chemistry in complex mixtures: bioorthogonal bioconjugation. Chem Biol 21: 1075-1101. 6. Best, M. D. 2009. Click chemistry and bioorthogonal reactions: unprecedented selectivity in the labeling of biological molecules. Biochemistry 48: 6571-6584. 7. Milne, S. B., K. A. Tallman, R. Serwa, C. A. Rouzer, M. D. Armstrong, L. J. Marnett, C. M. Lukehart, N. A. Porter, and H. A. Brown. 2010. Capture and release of

149

alkyne-derivatized glycerophospholipids using cobalt chemistry. Nat Chem Biol 6: 205-207. 8. Konitsiotis, A. D., B. Jovanovic, P. Ciepla, M. Spitaler, T. Lanyon-Hogg, E. W. Tate, and A. I. Magee. 2015. Topological analysis of Hedgehog acyltransferase, a multipalmitoylated transmembrane protein. J Biol Chem 290: 3293-3307. 9. Jao, C. Y., M. Roth, R. Welti, and A. Salic. 2009. Metabolic labeling and direct imaging of choline phospholipids in vivo. Proc Natl Acad Sci U S A 106: 15332-15337. 10. Martin-Couce, L., M. Martin-Fontecha, S. Capolicchio, M. L. Lopez-Rodriguez, and S. Ortega-Gutierrez. 2011. Development of endocannabinoid-based chemical probes for the study of cannabinoid receptors. J Med Chem 54: 5265-5269. 11. Tate, E. W., K. A. Kalesh, T. Lanyon-Hogg, E. M. Storck, and E. Thinon. 2015. Global profiling of protein lipidation using chemical proteomic technologies. Curr Opin Chem Biol 24: 48-57. 12. Gao, X., and R. N. Hannoush. 2014. Method for cellular imaging of palmitoylated proteins with clickable probes and proximity ligation applied to Hedgehog, tubulin, and Ras. J Am Chem Soc 136: 4544-4550. 13. Gaebler, A., R. Milan, L. Straub, D. Hoelper, L. Kuerschner, and C. Thiele. 2013. Alkyne lipids as substrates for click chemistry-based in vitro enzymatic assays. Journal of lipid research 54: 2282-2290. 14. Tully, S. E., and B. F. Cravatt. 2010. Activity-based probes that target functional subclasses of phospholipases in proteomes. J Am Chem Soc 132: 3264-3265. 15. Gao, X., and R. N. Hannoush. 2014. Single-cell imaging of Wnt palmitoylation by the acyltransferase porcupine. Nat Chem Biol 10: 61-68. 16. Thiele, C., C. Papan, D. Hoelper, K. Kusserow, A. Gaebler, M. Schoene, K. Piotrowitz, D. Lohmann, J. Spandl, A. Stevanovic, A. Shevchenko, and L. Kuerschner. 2012. Tracing fatty acid metabolism by click chemistry. ACS Chem Biol 7: 2004-2011. 17. Windsor, K., T. C. Genaro-Mattos, H. Y. Kim, W. Liu, K. A. Tallman, S. Miyamoto, Z. Korade, and N. A. Porter. 2013. Probing lipid-protein adduction with alkynyl surrogates: application to Smith-Lemli-Opitz syndrome. Journal of lipid research 54: 2842-2850. 18. Beavers, W. N., R. Serwa, Y. Shimozu, K. A. Tallman, M. Vaught, E. D. Dalvie, L. J. Marnett, and N. A. Porter. 2014. omega-Alkynyl lipid surrogates for polyunsaturated fatty acids: free radical and enzymatic oxidations. J Am Chem Soc 136: 11529-11539. 19. Yamashita, A., Y. Hayashi, Y. Nemoto-Sasaki, M. Ito, S. Oka, T. Tanikawa, K. Waku, and T. Sugiura. 2014. Acyltransferases and transacylases that determine the fatty acid composition of glycerolipids and the metabolism of bioactive lipid mediators in mammalian cells and model organisms. Prog Lipid Res 53: 18-81. 20. Kramer, R. M., and D. Deykin. 1983. Arachidonoyl transacylase in human platelets. Coenzyme A-independent transfer of arachidonate from phosphatidylcholine to lysoplasmenylethanolamine. J Biol Chem 258: 13806-13811. 21. Fonteh, A. N., and F. H. Chilton. 1992. Rapid remodeling of arachidonate from phosphatidylcholine to phosphatidylethanolamine pools during mast cell activation. J Immunol 148: 1784-1791. 22. Boilard, E., and M. E. Surette. 2001. Anti-CD3 and concanavalin A-induced human T cell proliferation is associated with an increased rate of arachidonate-phospholipid remodeling. Lack of involvement of group IV and group VI phospholipase A2 in

150

remodeling and increased susceptibility of proliferating T cells to CoA-independent transacyclase inhibitor-induced apoptosis. J Biol Chem 276: 17568-17575. 23. Robichaud, P. P., K. Boulay, J. E. Munganyiki, and M. E. Surette. 2013. Fatty acid remodeling in cellular glycerophospholipids following the activation of human T cells. Journal of lipid research 54: 2665-2677. 24. Robichaud, P. P., and M. E. Surette. 2015. Polyunsaturated fatty acid-phospholipid remodeling and inflammation. Curr Opin Endocrinol Diabetes Obes 22: 112-118. 25. Radmark, O., and B. Samuelsson. 2010. Regulation of the activity of 5-lipoxygenase, a key enzyme in leukotriene biosynthesis. Biochem Biophys Res Commun 396: 105-110. 26. Smith, W. L., Y. Urade, and P. J. Jakobsson. 2011. Enzymes of the cyclooxygenase pathways of prostanoid biosynthesis. Chemical reviews 111: 5821-5865. 27. Dennis, E. A., and P. C. Norris. 2015. Eicosanoid storm in infection and inflammation. Nat Rev Immunol 15: 511-523. 28. Radmark, O., O. Werz, D. Steinhilber, and B. Samuelsson. 2015. 5-Lipoxygenase, a key enzyme for leukotriene biosynthesis in health and disease. Biochim Biophys Acta 1851: 331-339. 29. Boyce, J. A. 2008. Eicosanoids in asthma, allergic inflammation, and host defense. Curr Mol Med 8: 335-349. 30. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37: 911-917. 31. Chilton, F. H. 1990. Separation and characterization of arachidonate-containing phosphoglycerides. Methods Enzymol 187: 157-167. 32. Surette, M. E., I. L. Koumenis, M. B. Edens, K. M. Tramposch, and F. H. Chilton. 2003. Inhibition of leukotriene synthesis, pharmacokinetics, and tolerability of a novel dietary fatty acid formulation in healthy adult subjects. Clin Ther 25: 948-971. 33. Cloutier, N., S. Tan, L. H. Boudreau, C. Cramb, R. Subbaiah, L. Lahey, A. Albert, R. Shnayder, R. Gobezie, P. A. Nigrovic, R. W. Farndale, W. H. Robinson, A. Brisson, D. M. Lee, and E. Boilard. 2013. The exposure of autoantigens by microparticles underlies the formation of potent inflammatory components: the microparticle-associated immune complexes. EMBO Mol Med 5: 235-249. 34. Boyum, A. 1968. Isolation of mononuclear cells and granulocytes from human blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl 97: 77-89. 35. Surette, M. E., E. Krump, S. Picard, and P. Borgeat. 1999. Activation of leukotriene synthesis in human neutrophils by exogenous arachidonic acid: inhibition by adenosine A(2a) receptor agonists and crucial role of autocrine activation by leukotriene B(4). Mol Pharmacol 56: 1055-1062. 36. Boudreau, L. H., J. Bertin, P. P. Robichaud, M. Laflamme, R. J. Ouellette, N. Flamand, and M. E. Surette. 2011. Novel 5-lipoxygenase isoforms affect the biosynthesis of 5-lipoxygenase products. FASEB J 25: 1097-1105. 37. Allain, E. P., L. H. Boudreau, N. Flamand, and M. E. Surette. 2015. The Intracellular Localisation and Phosphorylation Profile of the Human 5-Lipoxygenase Delta13 Isoform Differs from That of Its Full Length Counterpart. PLoS One 10: e0132607. 38. Borgeat, P., S. Picard, P. Vallerand, S. Bourgoin, A. Odeimat, P. Sirois, and P. E. Poubelle. 1990. Automated on-line extraction and profiling of lipoxygenase products of

151

arachidonic acid by high-performance liquid chromatography. Methods Enzymol 187: 98-116. 39. Provost, V., M. C. Larose, A. Langlois, M. Rola-Pleszczynski, N. Flamand, and M. Laviolette. 2013. CCL26/eotaxin-3 is more effective to induce the migration of eosinophils of asthmatics than CCL11/eotaxin-1 and CCL24/eotaxin-2. J Leukoc Biol 94: 213-222. 40. Balsinde, J. 2002. Roles of various phospholipases A2 in providing lysophospholipid acceptors for fatty acid phospholipid incorporation and remodelling. Biochem J 364: 695-702. 41. Hall, E. R., and H. H. Tai. 1981. Purification of thromboxane synthetase and evidence of two distinct mechanisms for the formation of 12-L-hydroxy-5,8,10-heptadecatrienoic acid by porcine lung microsomes. Biochim Biophys Acta 665: 498-503. 42. Wheelan, P., J. A. Zirrolli, and R. C. Murphy. 1993. Low-energy fast atom bombardment tandem mass spectrometry of monohydroxy substituted unsaturated fatty acids. Biol Mass Spectrom 22: 465-473. 43. Fasano, M. B., J. D. Wells, and C. E. McCall. 1998. Human neutrophils express the prostaglandin G/H synthase 2 gene when stimulated with bacterial lipopolysaccharide. Clin Immunol Immunopathol 87: 304-308. 44. Walsh, C. E., B. M. Waite, M. J. Thomas, and L. R. DeChatelet. 1981. Release and metabolism of arachidonic acid in human neutrophils. J Biol Chem 256: 7228-7234. 45. Sud, M., E. Fahy, D. Cotter, A. Brown, E. A. Dennis, C. K. Glass, A. H. Merrill, Jr., R. C. Murphy, C. R. Raetz, D. W. Russell, and S. Subramaniam. 2007. LMSD: LIPID MAPS structure database. Nucleic Acids Res 35: D527-532. 46. Wheelan, P., J. A. Zirrolli, and R. C. Murphy. 1996. Negative ion electrospray tandem mass spectrometric structural characterization of leukotriene B4 (LTB 4) and LTB 4-derived metabolites. J Am Soc Mass Spectrom 7: 129-139. 47. Belkaid, A., S. R. Duguay, R. J. Ouellette, and M. E. Surette. 2015. 17beta-estradiol induces stearoyl-CoA desaturase-1 expression in estrogen receptor-positive breast cancer cells. BMC Cancer 15: 440. 48. Soupene, E., and F. A. Kuypers. 2008. Mammalian long-chain acyl-CoA synthetases. Exp Biol Med (Maywood) 233: 507-521. 49. Abumrad, N., C. Coburn, and A. Ibrahimi. 1999. Membrane proteins implicated in long-chain fatty acid uptake by mammalian cells: CD36, FATP and FABPm. Biochim Biophys Acta 1441: 4-13. 50. Digel, M., R. Ehehalt, W. Stremmel, and J. Fullekrug. 2009. Acyl-CoA synthetases: fatty acid uptake and metabolic channeling. Mol Cell Biochem 326: 23-28. 51. Ellis, J. M., J. L. Frahm, L. O. Li, and R. A. Coleman. 2010. Acyl-coenzyme A synthetases in metabolic control. Curr Opin Lipidol 21: 212-217. 52. Durgan, D. J., J. K. Smith, M. A. Hotze, O. Egbejimi, K. D. Cuthbert, V. G. Zaha, J. R. Dyck, E. D. Abel, and M. E. Young. 2006. Distinct transcriptional regulation of long-chain acyl-CoA synthetase isoforms and cytosolic thioesterase 1 in the rodent heart by fatty acids and insulin. Am J Physiol Heart Circ Physiol 290: H2480-2497. 53. Sugiura, T., O. Katayama, J. Fukui, Y. Nakagawa, and K. Waku. 1984. Mobilization of arachidonic acid between diacyl and ether phospholipids in rabbit alveolar macrophages. FEBS Lett 165: 273-276. 54. Chilton, F. H., A. N. Fonteh, M. E. Surette, M. Triggiani, and J. D. Winkler. 1996. Control of arachidonate levels within inflammatory cells. Biochim Biophys Acta 1299: 1-15.

152

55. Kikuta, Y., E. Kusunose, K. Endo, S. Yamamoto, K. Sogawa, Y. Fujii-Kuriyama, and M. Kusunose. 1993. A novel form of cytochrome P-450 family 4 in human polymorphonuclear leukocytes. cDNA cloning and expression of leukotriene B4 omega-hydroxylase. J Biol Chem 268: 9376-9380. 56. Blobaum, A. L. 2006. Mechanism-based inactivation and reversibility: is there a new trend in the inactivation of cytochrome p450 enzymes? Drug Metab Dispos 34: 1-7. 57. Ford-Hutchinson, A. W., M. A. Bray, M. V. Doig, M. E. Shipley, and M. J. Smith. 1980. Leukotriene B, a potent chemokinetic and aggregating substance released from polymorphonuclear leukocytes. Nature 286: 264-265. 58. Jackson, W. T., R. J. Boyd, L. L. Froelich, B. E. Mallett, and D. M. Gapinski. 1992. Specific inhibition of leukotriene B4-induced neutrophil activation by LY223982. J Pharmacol Exp Ther 263: 1009-1014. 59. Afonso, P. V., M. Janka-Junttila, Y. J. Lee, C. P. McCann, C. M. Oliver, K. A. Aamer, W. Losert, M. T. Cicerone, and C. A. Parent. 2012. LTB4 is a signal-relay molecule during neutrophil chemotaxis. Dev Cell 22: 1079-1091. 60. Chouinard, F., J. S. Lefebvre, P. Navarro, L. Bouchard, C. Ferland, M. Lalancette-Hebert, D. Marsolais, M. Laviolette, and N. Flamand. 2011. The endocannabinoid 2-arachidonoyl-glycerol activates human neutrophils: critical role of its hydrolysis and de novo leukotriene B4 biosynthesis. J Immunol 186: 3188-3196.

153

7. CHAPITRE VII: Polyunsaturated fatty acid–phospholipid

remodeling and inflammation

Philippe Pierre Robichaud and Marc E Surette

Current Opinion in Endocrinology, Diabetes and Obesity. 22(2):112-118, April 2015.


P.P.R. et M.E.S. ont écrit la revue de littérature.

154

7.1. Résumé Le but principal de cette revue est de mettre en évidence les avancements récents sur le

contrôle de la biodisponibilité des acides gras polyinsaturés pour la production de médiateurs

lipidiques chez les cellules inflammatoires ainsi que les aspects qui reste encore inconnus.

Plusieurs enzymes associées avec le contrôle de l’incorporation et du remodelage des acides

gras (AG) polyinsaturés dans les glycérophospholipides (GPL) ainsi que leur libération des

GPL ont récemment été découvertes. Les rôles fonctionnels de chaque enzyme dans le

contrôle de la biodisponibilité des acides gras polyinsaturés pour la production de médiateurs

lipidiques et pour la signalisation cellulaire commencent seulement à être connus.

L’expression de certaines acyl-CoA synthétases, lysophospholipides acyltransférases et

phospholipases A2 a récemment été démontrée pour avoir un impact sur le contenu en AG

polyinsaturés dans les GPL membranaires, sur la production de médiateurs lipidiques et

l’inflammation. Une meilleure compréhension du contrôle de la distribution des AG

polyinsaturés dans les GPL et de leurs biodisponibilités pourrait mener à la découverte de

nouvelles cibles thérapeutiques pour traiter des maladies inflammatoires.

155

7.2. Abstract Purpose of review

To highlight some of the recent advances related to the control of polyunsaturated fatty acid

(PUFA) incorporation and remodeling in membrane glycerophospholipids in inflammatory

cells.

Recent findings

Several enzymes have recently been identified that are associated with the control of PUFA

incorporation and remodeling into membrane phospholipids and their release. The functional

roles of the different enzyme isotypes in the control of PUFA availability for lipid mediator

biosynthesis and for cell signaling are only now being established. The expression of specific

acyl-CoA synthetase, lysophospholipid acyltransferase and phospholipase A2 isotypes has

recently been shown to impact on membrane PUFA content, on the production of lipid

mediators and on inflammation.

Summary

A better understanding of the complex processes associated with the control PUFA

remodeling in membrane phospholipids may lead to the discovery of new therapeutic targets

for the treatment of inflammatory diseases.

156

7.3. Introduction Inflammation is an important cellular response for host defense and for repair of damaged

tissues. However, when this complex process is deregulated and becomes chronic, it can lead

to tissue damage associated with many inflammatory diseases. Several cell types are

sequentially involved in inflammatory responses and they release a wide range of compounds

associated with the recruitment and/or activation of effector cells and the elimination of

pathogens. Metabolites derived from polyunsaturated fatty acids (PUFA) are a particularly

important class of inflammatory mediators since some members of this class of compounds

play important roles in the initial phases of the acute inflammatory response, whereas others

are the principal players in the active resolution phase of inflammation. PUFA are stored as

components of membrane glycerophospholipids (PL) in a dynamic but highly controlled

process where phospholipid biosynthesis and remodeling is orchestrated by a number of

enzymes, many of which have only recently been identified and whose roles in the control

of PUFA availability for lipid mediator biosynthesis and for cell signaling are only now being

established.

PUFA are fatty acids with multiple double bonds and carbon chain lengths of 18 to 22

carbons. These fatty acids from the omega-3 (n-3) and omega-6 (n-6) families are essential

dietary ingredients since they cannot be synthesized de novo by vertebrates. The omega-6

PUFA arachidonic acid (AA, 20:4 n-6) is the precursor of numerous bioactive lipids that

include the leukotrienes, prostaglandins, thromboxanes and epoxyeicosatrienoic acids that

are generally pro-inflammatory lipid mediators, although AA can also be transformed into

the lipoxins that participate in the active resolution of inflammation (1, 2). The omega-3

PUFA eicosapentaenoic acid (EPA, 20:5 n-3) and docosahexaenoic acid (DHA, 22:6 n-3) are

precursors of pro-resolving lipid mediators that include the resolvins, protectins and maresins

(3). The transformation of these PUFA precursors into bioactive lipids involves their release

from membrane phospholipids and their controlled oxygenation catalyzed by lipoxygenases,

cyclooxygenases and cytochrome-450 enzymes, often followed by further enzymatic

transformations by isomerases, hydrolases or transferases.

157

Although the control of the pathways that catalyze the biosynthesis of PUFA-derived lipid

mediators remains an active area of research, the mechanisms associated with the control of

PUFA availability prior to their hydrolysis from membrane PL and transformation into

bioactive lipids are not yet fully elucidated. In this review, we discuss some of the newly

discovered enzymes involved in PUFA incorporation and turnover in PL. The precise control

of PUFA placement in PL molecular species has importance for the generation of appropriate

substrates for certain enzymes involved in cellular signaling, and for the regulation of PUFA

availability for the production of lipid mediators of inflammation. However, the specific role

in these processes of many of the newly identified enzymes that control membrane PUFA

composition is unknown, while that of others is only now being determined.

7.4. Turnover of polyunsatured fatty acids Since PUFA are ultimately derived from dietary lipids, their inclusion in the diet has a direct

impact on tissue content. However, different tissues, cell types and membranes have distinct

capacities to be enriched in particular PUFA indicating that their abundance in any particular

cell or membrane is not only a function of dietary intake but is also governed by the

differential expression of a number of enzymes. Indeed, the expression of enzymes associated

with the incorporation of PUFA into PL molecules, their remodeling between PL molecular

species and their release from membrane PL vary between different cell types and can be

modulated based on a cell’s activation status.

When PL are newly synthesized de novo in the Kennedy pathway, the glycerol-3-phosphate

acyltransferases (GPAT) and lysophosphatidic acid acyltransferases (LPAAT) that

incorporate new fatty acids into the nascent phosphatidic acids generally prefer saturated or

monounsaturated fatty acids (Figure 7.1).

158

Figure 7.1. Schematic representation of glycerophospholipid (PL) biosynthesis,

fatty acid remodeling and lipid mediator production.

During de novo biosynthesis of PL by the Kennedy Pathway, saturated (SFA) and

monounsaturated (MUFA) fatty acids are incorporated in both positions of the newly

synthetized PL by glycerol-3-phosphate acyltransferases (GPAT) and

lysophosphatidic acid acyltransferases (LPAAT). PUFA are incorporated into PL by

Lands Cycle remodeling which is characterized by the hydrolysis of SFA and MUFA

from the sn-2 position of PL by phospholipases A2 (PLA2) followed by a re-acylation

with PUFA catalyzed by lysophospholipid acyl-CoA transferases (LPLAT). Free

PUFA must be activated by acyl-CoA synthetases (ACS) to produce the acyl-CoA

required for its incorporation in the 2-lyso-PL previously produced by PLA2. PUFA

can also be directly transferred between specific PL species by transacylases. Upon

cell stimulation, PLA2 release PUFA from PL and they can be converted into various

159

lipid mediators by cyclooxygenases (COX) and lipoxygenases (LOX). The excess free

PUFA released by PLA2 is activated by ACS and re-incorporated into PL by LPLAT

to avoid lipid mediator overproduction.

However, the fatty acid composition of mature PL found in cellular membranes is much more

diverse. PL are categorized into several classes based on the polar head group (choline,

inositol, serine, ethanolamine) and contain numerous fatty acid combinations including the

significant presence of PUFA, resulting in hundreds of individual molecular species of PL.

This diversity that is created subsequent to PL biosynthesis is explained by a remodeling of

PL, termed the Lands cycle, where the more saturated fatty acids are hydrolyzed from the sn-

2 position of PL by the action of phospholipases A2 (PLA2) and the resulting 2-lyso-

phospholipids are re-acylated with PUFA in reactions catalyzed by lysophospholipid

acyltransferases (LPLAT) (Figure 7.1).

This remodeling is CoA-dependent because free PUFA must first be converted to CoA

intermediates by acyl-CoA synthetases (ACS). Additional transacylation pathways that are

specific to the highly unsaturated PUFA like AA, EPA and DHA, such as the CoA-

independent remodeling pathway, further transfer PUFA between PL molecular species and

contribute to fatty acyl remodeling processes. These remodeling pathways have been

extensively reviewed elsewhere (4). Overall, an outcome of these PL remodeling cycles is

the placement of PUFA into appropriate PL species that assures their proper utilization in

cellular processes. These include contact with proteins whose activity is modulated by

interactions with PUFA-containing PL, or the placement into PL species from which PUFA

are readily available for release by PLA2 in a manner that is in synchrony with the activation

of appropriate oxygenases, ultimately resulting in an orchestrated biosynthesis of lipid

mediators following cell stimulation.

In recent years several distinct ACS, LPLAT and PLA2 isotypes have been discovered and

their differential expression profiles and substrate specificities provide the enzymatic

diversity that was predicted for the Lands cycle several decades ago (5). However, despite

the recent identification of these multiple enzymes and their characterization, the impact of

the individual isotypes on remodeling pathways, on the cellular distribution of specific PUFA

160

and on the availability of PUFA to impact on cellular functions is just beginning to be

elucidated.

A recent report showed that receptor-mediated activation of primary human T cells results in

a notable redistribution of AA within cellular PL species. Indeed, the proportion of AA in

ethanolamine/choline PL species increased from a ratio of 1.0 in resting cells to 3.5 in

stimulated cells, and the content of AA in phosphatidylinositol (PI) doubled (6). These

changes were specific to AA and were not observed for any other fatty acid. This remarkable

targeted remodeling of a large proportion of the cellular AA was accompanied by increased

ACS, lysophosphatidylinositol acyltransferase (LPIAT), lysophophatidylcholine

acyltransferase (LPCAT) and CoA-independent transacylase activities. Although the specific

isotypes responsible for these enhanced enzymatic activities have not yet been elucidated,

the expression of four long chain acyl-CoA synthetases (ACSL), specifically ACSL3,

ACSL4, ACSL5, ACSL6, and the acyltransferases LPCAT2, LPCAT3, LPCAT4 and

LPIAT1 were significantly changed. These are all isotypes known to have specificity for

PUFA in cell free assays. Similarly, the expression of the groups IVA and IVC PLA2, which

are both specific for highly unsaturated PUFA like AA, were greatly increased (6). This was

the first report of significant changes following cell activation in the expression of a number

of enzymes putatively associated with Lands cycle PUFA remodeling, and indicates that cells

will adapt to their requirements vis-à-vis the PUFA composition of membrane PL by

modulating the expression of these remodeling enzymes.

7.5. Acyl-CoA synthetases The incorporation of PUFA into membrane PL requires their prior activation to acyl-CoA by

an ACS. Thirteen ACS are known to prefer fatty acids with carbon chains of 12 carbons or

more, and these are divided into three distinct groups: the ACSL, the very long chain ACS

and the bubblegum ACS (4, 7). However, the specificity of ACS isotypes for different PUFA

and their role in inflammation and in the control of PUFA availability for lipid mediator

production have not been fully described.

161

ACSL4 has a strong preference for AA and EPA and is the most studied ACS enzyme.

Knockdown of ACSL4 significantly decreases IL-1β-induced PGE2 synthesis in human

smooth muscle cells, likely due to a decreased ability to incorporate AA into PL for

subsequent release upon cell stimulation (8). Therefore, ACSL4 appears to play a significant

role in the incorporation of AA into PL in a manner that enables AA availability for

subsequent lipid mediator synthesis. However, short term inhibition of its activity increases

prostaglandin production suggesting that ACSL4 is the ACS isotype that sequesters newly

released free AA into AA-CoA, making it less available for transformation by

cyclooxygenases (8, 9). Thus, ACSL4 also plays a role in the modulation of lipid mediator

production after cell stimulation.

More recently, the ACSL1 isotype has been shown to play an important role in AA turnover

and availability for lipid mediator synthesis in inflammatory macrophages. Indeed,

differentiation of mouse bone marrow-derived macrophages and of human monocytes-

derived macrophages to inflammatory M1 cells greatly increases ACSL1 expression (10).

This was not seen in M2 macrophages. Accordingly, macrophages and monocytes with an

inflammatory phenotype from mouse and human type 1 diabetics exhibit increased

expression of the ACSL1. Importantly, myeloid-selective deletion of ACSL1 in type-1

diabetic mice attenuates the inflammatory phenotype of diabetic monocytes and

macrophages and prevents diabetes-accelerated atherosclerosis (10). This phenotype was

associated with decreases in macrophage AA-CoA levels (but not that of other fatty acyl-

CoAs) and decreased prostaglandin production. Macrophages with attenuated of ACSL1

expression also showed reduced AA remodeling in membrane PL (11) suggesting that the

ACSL1 isotype actively participates in Land’s cycle remodelling of AA and the control of

AA availability for lipid mediator synthesis in inflammatory macrophages. Interestingly,

unlike adipose tissue (12), ACSL1 attenuation does not impact on fatty acyl-CoA oxidation,

strongly suggesting that ACS isotypes possess biological functions that are cell type specific.

Given the large number of ACS enzymes, additional roles of individual isotypes in the control

of PUFA utilisation that are cell type- or cell activation status-specific are likely to be

revealed.

162

7.6. Lysophospholipid acyltransferases The full functional consequences of PUFA remodeling in activated T cells described above

are not known. However, since T cells proliferate upon activation, the concentration of AA

within particular PL species may play a role in cell proliferation. Indeed, PI-phosphate

signalling is important for the control of several cellular processes and the PI cycle enzymes

diacylglycerol kinase epsilon and phosphatidylinositol-4-phosphate-5-kinase I isotypes show

specificity for AA-containing substrates (13, 14). Thus the insertion of AA into the

appropriate PIP species plays a role in the control of cell signalling. Accordingly, LPIAT1

shows specificity for the incorporation of AA into lyso-PI and LPIAT1-/- mice have

diminished AA-containing PI, PIP and PIP2 content (15, 16). Thus the inability to enrich PI

with highly unsaturated PUFA like AA impacts on the synthesis of a number of PI

phosphates. Therefore, a knowledge of the remodelling mechanisms by which cells control

the PUFA composition of PI species will allow for a more complete understanding of the

control of critical cell signalling mechanisms.

A number of recent studies have begun to shed light on some of the other LPLAT isotypes

that are key to the incorporation of highly unsaturated PUFA like AA, EPA and DHA into

membrane PL. Recently, LPCAT3 was the first isotype of this family of enzymes whose

expression was directly linked to the biosynthesis of inflammatory lipid mediators in humans

(17). Indeed, the stimulation of liver X receptors, nuclear receptors that activate several

inflammatory genes in humans, results in a significant increase in LPCAT3 expression in

primary human monocytes. Although this acyltransferase isotype shows activity in vitro for

a number of acyl-CoA substrates, its expression in human monocytes and macrophages was

specifically associated with increased AA in membrane PL but not that of other fatty acids.

Importantly, silencing of LPCAT3 expression not only eliminated the increase in AA content,

but also significantly attenuated the capacity of LXR agonist-treated cells to produce pro-

inflammatory prostaglandins.

Unlike humans, in the mouse LXR agonists attenuate inflammatory responses. However, as

in humans LXR agonists also induce LPCAT3 in mice and its expression is also associated

with increased AA levels in tissue PL. Notably, LPCAT3 expression was recently associated

163

with a protective effect on ER stress in response to saturated fatty acids in vitro, and in mouse

models of metabolic diseases where LPCAT3 expression was directly associated with a

decrease in hepatic inflammation (18). These protective effects of LPCAT3 in obese mouse

models were largely attributed to PUFA-induced modulation of ER stress responses that are

induced by a high content of saturated fatty acids and are postulated to be pathologic factors

in metabolic disorders.

Although the fatty acid specificity of LPLAT expressed in a given tissue can be expected to

predict the tissue’s PL fatty acid composition, a number of other factors are also at play given

that tissue acyl-CoA pools are affected by variations in fatty acid synthesis, intake,

elongation, desaturation, and acyl-CoA synthetases. A recent study investigating acyl-CoA

specificities of LPLAT further complicated this issue since it was found that DHA-containing

phosphatidylcholine species were better correlated to substrate specificities of LPAAT,

whereas AA-containing species correlated with LPCAT specificities (19). The authors

proposed that while the expected Lands cycle remodeling may be important for placing AA

into appropriate PL species, the Kennedy pathway-associated LPAAT could play a more

important role in the incorporation of DHA into appropriate molecular species. This

departure from the established paths associated with PUFA incorporation in membrane PL

was further supported by the recent description of a new LPAAT (LPAAT4) that shows

substrate specificity for DHA and wide tissue expression profiles (20).

Therefore, with the recent discovery of new families of LPLAT (21, 22) and the initial

characterization of their functional roles, a better understanding of the control of tissue fatty

acid compositions is emerging. Moreover, the view that the Kennedy pathway is specific for

saturated and monounsaturated fatty acids, while the Lands pathway is solely responsible for

PUFA incorporation may begin to change. Importantly, with the discovery of the potent

DHA-derived lipid mediators of resolution, these divergent pathways for AA and DHA

incorporation into tissue PL may be a mechanism by which cells can control the availability

of these two PUFA that generally have contrasting roles in inflammation.

164

7.7. Phospholipases A2 PLA2s form a large family of enzymes that, like other enzymes involved in PL remodeling,

have distinct substrate specificities (23). It is generally accepted that the group VIA PLA2

isotype is involved in generating lyso-PLs for Land’s cycle remodeling, however this does

not preclude the involvement of other PLA2 isotypes many of which have poorly-understood

roles. It is also widely accepted that the group IVA cytosolic PLA2 is the most important

isotype responsible for the stimulated release of AA for the biosynthesis of lipid mediators

of inflammation by cells of myeloid origin. It should be kept in mind that in addition to

releasing PUFA, PLA2 activity also generates bioactive lyso-PL.

During the inflammatory reaction a temporal class switch in lipid mediators occurs. In acute

inflammation, PLA2 activity releases AA that permits the initial wave of AA-derived lipid

mediators that include the leukotrienes and prostaglandins that contribute to the recruitment

and activation of effector cells. Eventually, to avoid chronic inflammation and the associated

tissue damage, an active resolution phase occurs that is driven by pro-resolving lipid

mediators that recruit nonphlogistic monocytes, stop PMN influx, and stimulate efferocytosis

and the clearance of cellular debris (3). However, many of the pro-resolving lipid mediators

are derived from the omega-3 PUFA EPA (E-series resolvins) and DHA (D-series resolvins,

protectins and maresins). Therefore, a fundamental question is how the PLA2-mediated

release of PUFA changes over time to allow a switch from AA-derived pro-inflammatory

products, to mainly EPA- and DHA-derived pro-resolving lipid mediators.

Until recently, the identity of the PLA2 associated with lipid mediator class switching was

unknown. However, the first report of a PLA2 enzyme that could elicit anti-inflammatory

lipid mediator synthesis identified the Group 2D secreted PLA2 (PLA2G2D) in a mouse

model of contact hypersensitivity (24). The authors showed that the resolution of DNFB-

induced inflammation in skin and lymph nodes was significantly delayed in PLA2G2D-

deficent mice without affecting inflammatory initiation and propagation. Of pertinence,

lipidomics analyses showed a decreased production of all measured resolving lipid mediators

in PLA2G2D-deficent mice, while AA-derived pro-inflammatory lipid mediators did not

differ from wild-type mice. Surprisingly, AA-derived resolving mediators such as PGD2 and

165

15d-PGJ2 were also decreased in PLA2G2D-deficent mice suggesting that pro-inflammatory

AA-derived mediators were mostly from PLA2G2D-independent pools. Future studies will

likely identify the molecular mechanisms by which PUFA hydrolyzed by PLA2G2D are

shuttled toward the synthesis of resolving lipid mediators, and whether this PLA2 isotype

plays a role in class switch in other models of inflammation. However, these results suggest

that such resolving PLA2s could possess therapeutic potential for the treatment of

inflammatory diseases. Together with the identification of DHA-specific LPAAT isotypes,

these recent studies are clarifying some of the mechanisms that may control substrate

availability for the synthesis of resolving lipid mediators.

7.8. Conclusion It has become apparent that the placement of PUFA into appropriate membrane phospholipid

molecular species represents a complex mechanism that is linked to the control of cell

signaling and communication in inflammatory cells. Over the last decade numerous enzymes

isotypes have been identified whose roles in PUFA-phospholipid remodeling, in the control

of lipid mediator biosynthesis and in the progression of acute and chronic inflammation are

only beginning to be understood. Their expression profiles and roles are likely a function of

the evolving environment, cell types and activation status in inflammatory foci (25). A better

understanding of these complex processes may lead to the discovery of new therapeutic

targets for the treatment of inflammatory diseases.

7.9. Key Points

• PUFA-phospholipid remodeling is a key mechanism by which cells control the production

of lipid mediators of inflammation.

• Several newly identified enzymes have provided new information on the mechanisms by

which cells control the PUFA content of membrane phospholipids.

• The silencing of enzymes associated with PUFA-phospholipid remodeling impacts on the

progression of inflammation in animal models.

166

7.10. Abbreviations PUFA, polyunsaturated fatty acid; PL, glycerophospholipid; AA, arachidonic acid; EPA,

eicosapentaenoic acid; DHA, docosahexaenoic acid; GPAT, glycerol-3-phosphate

acyltransferase; LPAAT, lysophosphatidic acid acyltransferase; ACS, acyl-CoA synthetase;

LPLAT, lysophospholipid acyltransferase; PLA2, phospholipase A2 ; PI phosphatidylinositol;

PIP, phosphatidylinositol phosphate; LPIAT, lysophosphatidylinositol acyltransferase;

LPCAT, lysophophatidylcholine acyltransferase; ACSL, long chain acyl-CoA synthetase;

PGE2, prostaglandin E2; PGD2, prostaglandin D2; PGJ2, prostaglandin J2; LXR, liver X

receptors; ER, endoplasmic reticulum

7.11. Acknowledgements None.

7.12. Financial support and sponsorship M.E.S. is currently receiving grants from the Canadian Institutes of Health Research

(#160550), the Atlantic Innovation Fund (#201211) and the Canadian Breast Cancer

Foundation – Atlantic (#R13F13). He is also supported as a New Brunswick Innovation

ResearchChair in Biosciences. P.P.R. is the recipient of a Doctoral Scholarship from the

Canadian Institutes of Health Research and the New Brunswick Health Research Foundation.

7.13. Conflicts of interest P.P.R has no conflicts of interest.

7.14. References 1. Haeggstrom JZ, Funk CD. Lipoxygenase and leukotriene pathways: biochemistry, biology,

and roles in disease. Chem Rev 2011; 111:5866-5898. 2. Smith WL, Urade Y, Jakobsson PJ. Enzymes of the cyclooxygenase pathways of prostanoid

biosynthesis. Chem Rev 2011; 111:5821-5865. 3. Buckley CD, Gilroy DW, Serhan CN. Proresolving lipid mediators and mechanisms in the

resolution of acute inflammation. Immunity 2014; 40:315-327. 4. Yamashita A, Hayashi Y, Nemoto-Sasaki Y, et al. Acyltransferases and transacylases that

determine the fatty acid composition of glycerolipids and the metabolism of bioactive lipid mediators in mammalian cells and model organisms.

167

Prog Lipid Res 2014; 53:18-81. This paper provides an very comprehensive review of the enzymes and pathways associated with phospholipid biosynthesis and remodeling.

5. Lands WE. Metabolism of glycerolipides; a comparison of lecithin and triglyceride synthesis. J Biol Chem 1958; 231:883-888.

6. Robichaud PP, Boulay K, Munganyiki JE, Surette ME. Fatty acid remodeling in cellular glycerophospholipids following the activation of human T cells. J Lipid Res

2013; 54:2665-2677. This is the first paper to describe a chage in expresion of numerous enzymes associated with Lands cycle remodeling in stimulated primary human cells.

7. Soupene E, Kuypers FA. Mammalian long-chain acyl-CoA synthetases. Exp Biol Med (Maywood) 2008; 233:507-521.

8. Golej DL, Askari B, Kramer F, et al. Long-chain acyl-CoA synthetase 4 modulates prostaglandin E(2) release from human arterial smooth muscle cells. J Lipid Res 2011; 52:782-793.

9. Kuwata H, Yoshimura M, Sasaki Y, et al. Role of long-chain acyl-coenzyme A synthetases in the regulation of arachidonic acid metabolism in interleukin 1beta-stimulated rat fibroblasts. Biochim Biophys Acta 2014; 1841:44-53.

10. Kanter JE, Kramer F, Barnhart S, et al. Diabetes promotes an inflammatory macrophage phenotype and atherosclerosis through acyl-CoA synthetase 1. Proc Natl Acad Sci U S A 2012; 109:E715-724.

11. Rubinow KB, Wall VZ, Nelson J, et al. Acyl-CoA synthetase 1 is induced by Gram-negative bacteria and lipopolysaccharide and is required for phospholipid turnover in stimulated macrophages. J Biol Chem 2013; 288:9957-9970.

12. Ellis JM, Li LO, Wu PC, et al. Adipose acyl-CoA synthetase-1 directs fatty acids toward beta-oxidation and is required for cold thermogenesis. Cell Metab 2010; 12:53-64.

13. D'Souza K, Epand RM. Enrichment of phosphatidylinositols with specific acyl chains. Biochim Biophys Acta 2014; 1838:1501-1508.

14. Shulga YV, Topham MK, Epand RM. Study of arachidonoyl specificity in two enzymes of the PI cycle. J Mol Biol 2011; 409:101-112.

15. Lee HC, Inoue T, Sasaki J, et al. LPIAT1 regulates arachidonic acid content in phosphatidylinositol and is required for cortical lamination in mice. Mol Biol Cell 2012; 23:4689-4700.

16. Anderson KE, Kielkowska A, Durrant TN, et al. Lysophosphatidylinositol-acyltransferase-1 (LPIAT1) is required to maintain physiological levels of PtdIns and PtdInsP(2) in the mouse. PLoS One 2013; 8:e58425.

17. Ishibashi M, Varin A, Filomenko R, et al. Liver x receptor regulates arachidonic acid distribution and eicosanoid release in human macrophages: a key role for lysophosphatidylcholine acyltransferase 3. Arterioscler Thromb Vasc Biol 2013; 33:1171-1179.

18. Rong X, Albert CJ, Hong C, et al. LXRs regulate ER stress and inflammation through dynamic modulation of membrane phospholipid composition. Cell Metab 2013; 18:685-697.

19. Harayama T, Eto M, Shindou H, et al. Lysophospholipid acyltransferases mediate phosphatidylcholine diversification to achieve the physical properties required in

vivo. Cell Metab 2014; 20:295-305. This paper shows that acyltransferase substrate specificity impacts on tissue PUFA composition and that LPAAT contributes to tissue DHA composition.

168

20. Eto M, Shindou H, Shimizu T. A novel lysophosphatidic acid acyltransferase enzyme (LPAAT4) with a possible role for incorporating docosahexaenoic acid into brain glycerophospholipids. Biochem Biophys Res Commun 2014; 443:718-724.

21. Hishikawa D, Hashidate T, Shimizu T, Shindou H. Diversity and function of membrane glycerophospholipids generated by the remodeling pathway in mammalian cells. J Lipid Res 2014; 55:799-807.

22. Hishikawa D, Shindou H, Kobayashi S, et al. Discovery of a lysophospholipid acyltransferase family essential for membrane asymmetry and diversity. Proc Natl Acad Sci U S A 2008; 105:2830-2835.

23. Murakami M, Taketomi Y, Miki Y, et al. Recent progress in phospholipase A(2) research: from cells to animals to humans. Prog Lipid Res 2011; 50:152-192.

24. Miki Y, Yamamoto K, Taketomi Y, et al. Lymphoid tissue phospholipase A2 group IID resolves contact hypersensitivity by driving antiinflammatory lipid mediators. J

Exp Med 2013; 210:1217-1234. This is the first paper to identify a PLA2 that lies upstream of the synthesis of pro-resolving lipid mediators.

25. Norling LV, Perretti M. Control of myeloid cell trafficking in resolution. J Innate Immun 2013; 5:367-376.

169

8. CHAPITRE VIII: Discussion Mise en situation

Les études précédentes ont démontré que le remodelage CoA-indépendant de l’AA est très

rapide chez les lignées cellulaires néoplasiques et chez les lymphocytes T en prolifération

par rapport aux lymphocytes T au repos, et que ce remodelage est une cible thérapeutique

potentielle contre les maladies inflammatoires et prolifératives [52-56, 137, 142, 143].

D’autres études ont démontré que la prolifération des lymphocytes T est associée à une

induction de la biosynthèse des AG et des GPL ainsi que certains changements dans la

distribution des AG dans les GPL [139-141, 144-146], mais il était impossible de lier

l’induction du remodelage de l’AA avec ces changements. En fait, peu était connu sur les

modifications de composition en AG des différentes classes et sous-classes de GPL suite à

l’induction de la prolifération des lymphocytes T et encore moins sur l’identité des enzymes

impliquées.

Plan expérimental et modèles cellulaires

Lors de cette thèse, nous avons mesuré la composition en AG des différentes classes et sous-

classes de GPL et évalué le métabolisme des AG et le remodelage des GPL chez la lignée

lymphocytaire Jurkat et chez les lymphocytes T primaires humains au repos et en

prolifération. Nous avons ensuite tenté d’identifier les enzymes impliquées dans les

changements observés et d’évaluer l’effet de l’atténuation de certains gènes sur la survie et

la prolifération de la lignée lymphocytaire Jurkat. Pour ce faire, nous avons premièrement

isolé les cellules mononuclées du sang périphérique de donneurs sains et induit la

prolifération des lymphocytes T en activant leur récepteur TCR en présence l’IL-2. Après

trois jours d’incubation, la prolifération des lymphocytes T était très évidente

morphologiquement, le compte cellulaire avait plus que doublé et les analyses de

cytofluorométrie ont démontré une importante entrée des cellules dans le cycle cellulaire

(Fig. S3.1).

L’analyse de la masse des AG dans les GPL

Nous avons démontré que la prolifération des lymphocytes T est associée avec une

augmentation significative du contenu en GPL cellulaires, ce qui concorde avec

170

l’augmentation de la taille des cellules et les études précédentes [139, 144]. Les changements

les plus importants que nous avons observés sont une augmentation significative de la masse

des AG saturés et mono-insaturés et une importante redistribution de la masse de l’AA dans

les différentes classes et sous-classes de GPL suite à l’induction de la prolifération. Ce qui

est très intéressant, c’est que la distribution des AG, incluant celle de l’AA, dans les GPL des

lymphocytes T quiescentes qui ont cesser de proliférer ressemblent aux lymphocytes T au

repos, tandis que la lignée Jurkat ressemble beaucoup plus aux lymphocytes T en

prolifération. Ces observations suggèrent que les changements mesurés sont liés à l’état de

prolifération des cellules qui nécessite une biosynthèse et un remodelage des GPL très actifs.

La redistribution de l’AA et le remodelage de l’[3H]AA dans les GPL

La redistribution de la masse de l’AA est caractérisée par une diminution de l’AA dans les

GPC et une augmentation dans les GPE et les GPI/GPS chez les cellules T en prolifération

comparée aux cellules au repos. Nous avons démontré que la redistribution de l’AA des GPC

vers les GPE est étroitement reliée à l’induction du remodelage de l’[3H]AA dans les GPL

chez les cellules T en prolifération telle que démontré par Boilard et Surette en 2001 [137].

L’activité spécifique du remodelage de l’AA, qui compare le transfert de l’[3H]AA des GPC

vers les GPE par rapport à la masse de l’AA, démontre très bien que les cellules T en

prolifération s’approchent de leur équilibre isotopique beaucoup plus rapidement que les

cellules au repos et ce, même si elles ont plus d’AA à transférer avant d’atteindre cet

équilibre. L’AA a aussi subi une importante redistribution au niveau des sous-classes de GPL

caractérisée par une diminution de l’AA dans les 1-acyl-GPC et une augmentation dans les

1-alkyl-GPC et 1-alk-enyl-GPE. Ces résultats démontrent que la redistribution de la masse

de l’AA dans les classes et sous-classes de GPL corrèle très bien avec l’induction du

remodelage de l’[3H]AA chez les lymphocytes T en prolifération. De plus, la spécificité du

remodelage de l’AA envers les GPL donneurs et accepteurs que nous avons observé est en

accord avec les substrats préférentiels de la CoA-IT préalablement décrit dans la littérature

[36, 43-47, 137]. Par contre, comme la CoA-IT n’a jamais été isolée et identifiée dû à une

très grande sensibilité aux détergents, il est très difficile d’étudier son rôle lors de la

prolifération autre que par l’utilisation d’inhibiteurs chimiques qui sont plus ou moins

spécifiques.

171

L’incorporation de l’AA dans les GPL

Lors des expériences de remodelage de l’[3H]AA, nous avons remarqué que l’incorporation

de l’[3H]AA dans les GPL a augmentée d’environ 21 fois chez les lymphocytes T en

prolifération comparativement aux cellules T au repos. De plus, la proportion de l’[3H]AA

initialement incorporé dans les GPI et la masse de l’AA dans les GPI sont augmentées chez

les cellules T en prolifération. Ceci est probablement le résultat d’une induction ou de

l’activation d’ACS et de LPLAT, car la proportion cellulaire des GPI/GPS ne change pas

avec le temps et les lyso-GPI ne sont pas des substrats de la CoA-IT. Nous avons donc évalué

l’activité arachidonoyl-CoA synthétase et les activités LPCAT, LPEAT et LPIAT en utilisant

l’arachidonoyl-CoA et différents lysophospholipides comme substrats chez les lymphocytes

T au repos et en prolifération. Les activités arachidonoyl-CoA synthétase, LPCAT et LPIAT

étaient grandement induites chez les lymphocytes T en prolifération contrairement à l’activité

LPEAT qui est resté très faible. Ces résultats démontrent très bien que l’acylation de l’AA

dans les lyso-GPE nécessite une activité transacylase et que même si la proportion de l’AA

diminue considérablement dans les GPC chez les lymphocytes T en prolifération, l’activité

LPCAT est très induite chez ces cellules pour soutenir un remodelage très rapide.

L’expression des enzymes potentiellement impliquées dans l’incorporation de l’AA

Nous avons ensuite démontré d’importants changements dans l’expression génique et

protéinique de plusieurs ACS et LPLAT potentiellement impliquées dans l’incorporation de

l’AA dans les GPL chez les lymphocytes T en prolifération comparativement aux cellules T

au repos. Les modifications les plus intéressantes sont l’induction de l’expression de

l’ACSL4, de la LPCAT3 et de la LPIAT1 chez les lymphocytes T en prolifération qui corrèle

très bien avec l’augmentation de l’incorporation de l’AA dans les 1-acyl-2-lyso-GPC et 1-

acyl-2-lyso-GPI chez ces cellules, car ces trois enzymes ont une très grande spécificité envers

l’AA [88, 98, 99, 103, 104]. Une autre LPLAT, la LPCAT2, est connue pour avoir une

activité acyltransférase en utilisant les 1-acyl-2-lyso-GPC et l’AA comme substrats [101],

mais nous n’avons pas réussi à détecter la protéine de la LPCAT2 chez les cellules T et chez

les Jurkat.

172

L’expression de l’ACSL4 est induite dans plusieurs cancers et l’atténuation de son expression

affecte grandement la prolifération de cellules du cancer du sein et de la prostate [90, 91, 93-

95, 147]. Il a déjà été démontré que la stimulation des monocytes humains avec le zymozan

active significativement l’incorporation cellulaire de l’AA dans les GPL en induisant

l’expression de la LPCAT3 et que l’atténuation de son expression bloque l’incorporation de

l’AA induite par le zymozan [148]. De plus, la prolifération des cellules HEK293 a été

démontrée d’être affectée par l’atténuation de l’expression de la LPCAT3 en induisant

l’apoptose [149]. Ceci est consistant avec l’induction de l’apoptose suite au blocage de

l’incorporation de l’AA à l’aide d’inhibiteurs d’acyl-CoA synthétases, d’acyltransférases et

de CoA-IT chez plusieurs lignées cellulaires en prolifération [53, 54, 56, 57, 150-152].

La LPIAT1, qui fut préalablement nommé BB1, est surexprimée dans les carcinomes de la

vessie et du sein [153], mais aucune étude a évalué sa nécessité pour la prolifération

cellulaire. Cependant, les GPI sont très important pour la signalisation cellulaire incluant la

signalisation déclenchée par l’activation du récepteur TCR des lymphocytes T. L’inositol des

GPI contient cinq groupement hydroxy qui peuvent être phosphorylés et déphosphorylés par

des kinases et des phosphatases, respectivement. Il est très bien connu que le

phosphatidylinositol(3,4,5)P3 (PI(3,4,5)P3) est très impliqué dans le recrutement de

nombreuses protéines de signalisation cellulaire comme AKT qui est grandement impliqués

dans la survie et la prolifération cellulaire. De plus, le phosphatidylinositol(4,5)P2 (PI(4,5)P2)

peux être hydrolysé par une phospholipases C pour produire le diacylglycérol (DAG) et

l’inositol triphosphate (IP3) qui sont aussi impliqués dans la signalisation cellulaire en

activant la PKC et la libération du Ca++ intracellulaire, respectivement. La présence de l’AA

dans les GPI semble avoir une importance particulière au niveau de la signalisation cellulaire

des GPI, car la diacylglycérol kinases epsilon (DGKε) et la phosphatidylinositol-4-

phosphate-5-kinase I∝ (PIP5K∝) semblent être très spécifique aux GPI contenant l’AA en

position sn-2 [154-156]. De plus, la présence de l’AA en position sn-2 des GPI semble aussi

être très important pour la production de protéines ancrées sur les GPI (GPI-anchored

proteins) et leur migration du réticulum endoplasmique vers la membrane plasmique et

l’appareil de Golgi où l’AA est substitué par un AG saturé pour promouvoir leur association

avec les radeaux lipidiques [157, 158]. Les AG polyinsaturés, incluant l’AA, sont aussi des

173

agonistes des récepteurs nucléaires PPAR (Peroxisome proliferator activated receptors) qui

régulent des facteurs de transcription et donc, modulent l’expression de différents gènes [159,

160].

Les phospholipases A2 et le remodelage de l’AA dans les GPL

Le remodelage de l’AA nécessite aussi l’implication de PLA2 pour la production de lyso-

GPL nécessaire à l’incorporation initiale et au remodelage de l’AA ainsi que pour la

libération de l’AA qui peut ensuite être réincorporé afin que ce remodelage soit un

phénomène continuel et inductible (Figure 6). Le fait que la CoA-IT est calcium-

indépendante et membranaire, certaines PLA2 sont plus intéressantes que d’autres [60], mais

elles peuvent tous être impliquées dans la production de lyso-GPL nécessaire au remodelage

de l’AA ou dans la libération de l’AA. L’expression génique de la PLA2 IVA, qui est très

spécifique pour les GPL contenant l’AA et grandement impliqué dans la libération de l’AA

pour la production de médiateurs lipidiques, est significativement induite chez les

lymphocytes T en prolifération comparativement aux cellules T au repos. Cette induction est

en accord avec la surexpression et la phosphorylation de la PLA2 IVA chez les lymphocytes

T en prolifération démontré par Boilard et Surette en 2001. Par contre, ils ont démontré que

le MAFP, un inhibiteur des PLA2 IV, n’affecte pas le remodelage de l’AA [137]. Nous avons

évalué l’effet d’un autre inhibiteur de la PLA2 IVA, la pyrrophénone, sur le remodelage de

l’AA chez les cellules Jurkat et cet inhibiteur n’a eu aucun effet.

Cependant, le fait que la CoA-IT est calcium-indépendante et membranaire, les PLA2 du

groupe VI et la PLA2 IVC sont des candidates très intéressantes pour être la CoA-IT. Boilard

et Surette ont démontré une importante induction de l’expression protéinique de la iPLA2

VIA, mais ils ont démontré que le bromoenol lactone (BEL), un inhibiteur des PLA2 VIA et

VIB, n’affecte pas le remodelage de l’AA [137]. Pourtant, plusieurs d’études ont démontré

l’implication de ces trois PLA2 au niveau de la progression du cycle cellulaire et de

l’induction de l’apoptose chez plusieurs lignées cellulaires et plusieurs types de cancer [76,

85, 126, 161-163].

174

L’induction significative de la PLA2 IVC est très intéressante, car elle est membranaire,

calcium-indépendante et possède plusieurs activités enzymatiques différentes telles que

lysophospholipase, dismutase (CoA-indépendante transacylase sn-1 vers sn-2) et,

d’importance pour notre étude, des activités PLA2 et CoA-IT spécifiques pour l’AA [71, 72,

164-166]. Plus précisément, il fut démontré qu’en plus d’augmenter l’hydrolyse de l’AA des

GPL, la surexpression stable de la PLA2 IVC chez les cellules HEK293 augmente la quantité

d’AA contenue dans les 1-acyl-GPE, les 1-alkyl-GPE et les 1-alk-1-enyl-GPE, un phénotype

qui appuierait son implication dans le remodelage de l’AA [164]. La surexpression de la

PLA2 IVC dans des levures démontra une importante augmentation de l’acylation CoA-

indépendante de lyso-PAF. Cette activité transacylase, calcium et CoA-indépendante,

transfère l’AA marqué provenant de 1-acyl-2-AA-GPE et 1-acyl-2-AA-GPC vers les 1-alkyl-

2-lyso-GPC et 1-alkenyl-2-lyso-GPE respectivement [71]. Donc la PLA2 IVC est une très

bonne candidate pour être impliquée dans le remodelage de l’AA et possiblement être la

CoA-IT. Il fut proposé que l’expression de la PLA2 IVC au niveau du cœur pourrait jouer un

important rôle dans la protection contre l’ischémie cardiaque en métabolisant les lyso-PL

toxiques, car les conditions hypoxiques associées avec de l’ischémie cardiaque induit

l’activité PLA2 calcium-indépendante produisant ainsi des lyso-PL incluant les

plasmalogènes. Les lyso-PL sont connus pour induire l’arythmie cardiaque et l’activité de

transacylation CoA-indépendante de l’AA éliminerait les 1-alkyl-2-lyso-PL et 1-alkenyl-2-

lyso-PL non-hydrolysables, tandis que les activités lysophospholipases et dismutases de la

PLA2 IVC élimineraient les 1-acyl-2-lyso-GPL [71, 72]. Par contre, aucune étude n’a

démontré la nécessité de l’expression et de l’activité de la PLA2 IVC pour la prolifération

cellulaire.

L’identification des enzymes impliquées dans l’incorporation et le remodelage de l’AA

Lors de cette thèse, nous avons tenté d’atténuer l’expression de plusieurs enzymes

potentiellement impliquées dans l’incorporation et le remodelage de l’AA chez la lignée

lymphocytaire Jurkat en utilisant des siRNA et différents vecteurs shRNA constitutifs et

inductibles sans obtenir d’atténuation significative des protéines ciblées. Nous avons des

doutes sur la qualité des séquences cibles et sur les vecteurs shRNA que nous avons obtenus

commercialement, car les contrôles positifs contre GAPDH et HPRT fournis par les

175

compagnies fonctionnaient chez les Jurkat dans nos conditions de transfection. Nous n’avons

pas été en mesure d’obtenir d’atténuations des enzymes ciblées et ce même après avoir

transfecté les vecteurs shRNA inductibles et constitutifs chez les Jurkat et les HEK293,

sélectionné des populations stables avec des antibiotiques et isolé un très grand nombre de

clones individuels. Sans atténuation efficace, il était impossible d’évaluer l’implication des

enzymes ciblées dans l’incorporation et le remodelage de l’AA, dans la prolifération et la

survie cellulaire ainsi que dans la production de médiateurs lipidiques bioactifs. Il serait

possible de développer des nouvelles séquences d’atténuation pour ces enzymes, mais

l’utilisation de la nouvelle technologie de délétion génique CRISPR (Clustered Regularly

Interspaced Short Palindromic Repeats) pourrait être beaucoup plus efficace et approprié

pour évaluer l’effet de la délétion d’un gène sur la prolifération et survie cellulaire à long

terme. Cependant, il est possible que la délétion d’une des enzymes ciblées soit létale et que

l’obtention d’une population cellulaire n’exprimant pas l’enzyme ciblée soit impossible.

Cependant, nous avons démontré pour la première fois que plusieurs enzymes

potentiellement impliqués dans le cycle de Lands sont induites lorsqu’une cellule entre dans

le cycle cellulaire.

La biosynthèse des AG saturés et mono-insaturés

L’augmentation de la proportion des AG mono-insaturés dans les GPL chez les lymphocytes

T en prolifération est associée avec une importante induction de l’expression de FASN et de

SCD1 comparativement aux cellules T au repos. À notre connaissance, c'est la première

description d'une induction de SCD1 dans un type de cellule non transformé qui accompagne

l'induction de la prolifération cellulaire. Nous avons ensuite démontré une diminution

significative de l’acide palmitoléique (16:1n-7) et vaccénique (18:1n-7) suite à l’atténuation

de la SCD1 chez les Jurkat. L’acide vaccénique (18:1n-7) étant le produit d’élongation de

l’acide palmitoléique (16:1n-7) produit par SCD1 à partir de l’acide palmitique (16:0) (Figure

1.1). L’atténuation de la SCD1 n’a eu aucun effet sur la prolifération et la survie cellulaire

chez les cellules Jurkat. Pourtant, plusieurs études ont démontré que l’inhibition ainsi que

l’atténuation de SCD1 affecte la prolifération cellulaire et induit l’apoptose chez plusieurs

carcinomes [112, 115, 117-119, 167-169]. Cependant, nous avons remarqué que la quantité

de l’autre produit de la SCD1, l’acide oléique (18:1n-9), est resté très similaire même lorsque

176

les cellules ont été cultivé en carence d’AG exogènes. Il est possible que la SCD5 soit

responsable du maintien de l’acide oléique (18:1n-9) cellulaire et de la capacité proliférative

dans ces cellules d’origine lymphoïde. Cependant, la SCD5 est beaucoup moins connue et

on connaît peu sur ses fonctions physiologiques et pathologiques, mais des études récentes

démontrent son implication dans la différenciation neuronale et la malignité des mélanomes

[15, 113, 120]. Deux études ont démontré que la SCD5 préfère plus l’acide stéarique (18:0)

que l’acide palmitique (16:0) comme substrat et donc produit majoritairement l’acide oléique

(18:1n-9) [113, 170]. L’inhibition ou l’atténuation des deux gènes (SCD1 et SCD5)

simultanément pourrait peut-être être une stratégie thérapeutique contre les maladies

prolifératives. Jusqu’à maintenant, il nous a été impossible d’atténuer l’expression de la

SCD5 et aucune étude a démontré quels effets auraient les inhibiteurs de la SCD1 sur son

activité.

Le métabolisme des AG polyinsaturés omega-3 et omega-6

Nous avons démontré que les cellules T en prolifération et les Jurkat ont une très grande

capacité d’élongation et de désaturation des AG polyinsaturés de 18 et 20 carbones omega-3

et omega-6 comparativement aux cellules au repos. Ces résultats sont en accord avec

l’augmentation des activités delta-5 et delta-6 désaturases et de l’élongation de l’AA en 22:4

n-6 qui était préalablement démontrés chez les lymphocytes T stimulés par le PHA [141].

Nous avons ensuite démontré une induction significative de l’expression des désaturases 1 et

2 (FADS1 et FADS2) ainsi que l’élongase 5 (ELOVL5) chez les cellules T en prolifération

comparativement au cellules T au repos. Par contre, l’expression de l’élongase 2 était non

mesurable chez les cellules T humaines primaire et chez les Jurkat tandis que les HepG2

expriment les deux élongases (ELOVL2 et 5). L’atténuation de l’expression de l’ELVOL5

chez les cellules T en prolifération, a significativement bloqué l’élongation des AG 18:3n-6,

18:4n-3, 20:4n-6 et 20:5n-3 qui était induite chez les lymphocytes T en prolifération. Nous

avons obtenu des résultats très semblables chez les cellules Jurkat et HepG2. Cependant, nous

avons aussi remarqué une augmentation significative de la proportion du 16:1n-7 et une

diminution significative de la proportion des AG mon-oinsaturés 18:1n-7, 20:1n-9, 22:1n-9

et 24:1n-9 chez les trois types de cellules, ce qui suggère que l’ELVOL5 est aussi impliquée

177

dans l’élongation des AG mono-insaturés. L’atténuation de l’ELOVL5 n’a cependant eu

aucun effet sur la prolifération et la survie cellulaire des Jurkat.

La plupart des études précédentes, qui ont étudié la spécificité enzymatique des élongases

envers les différents AG, ont procédé à la surexpression des élongases dans d’autres

organismes que l’humain et il a été démontré que lorsque l’ELOVL5 est surexprimée dans

des cellules de poulet, elle n’a pas la même spécificité que dans les autres organismes [19].

Cependant, la majorité des études semblent démontré que l’ELOVL5 est impliquée dans

l’élongation des AG polyinsaturés omega-3 et omega-6 de 18 et 20 carbones tandis que

l’ELOVL2 catalyse l’élongation des AG polyinsaturés omega-3 et omega-6 de 20 carbones

et plus [16-21]. De plus, la surexpression de l’ELOVL5 humaine chez les cellules COS-7

(fibroblastes de rein de singe) augmente l’élongation des AG 14:0, 16:0, 16:1, 18:1, 18:2 et

de l’AA tandis que la surexpression de l’ELOVL2 augmente seulement l’élongation de l’AA

[21], mais ils n’ont pas évalué l’élongation des AG polyinsaturé oméga-3, du 18:3n-6 et des

AG de 22 carbones oméga-3 et 6 [21]. Donc, le fait que les lymphocytes T en prolifération

et les Jurkat expriment seulement l’ELOVL5 est en accord avec la forte capacité d’élongation

des AG polyinsaturés de 18 et 20 carbones, avec l’absence de l’élongation des AG

polyinsaturés de 22 carbones et avec l’impact qu’a l’atténuation de l’expression de

l’ELOVL5 sur le profil des AG mono-insaturés chez ces cellules.

L’utilisation de l’AA-alcyne comme outil de recherche

Les analogues alcyne ou azide de composantes cellulaires, qui peuvent être facilement

couplés à la biotine ou des fluorochromes par la « Click Chemistry », sont de nouveaux outils

très puissants pour étudié des procédés biologiques [171-174]. Ces outils sont aussi utilisés

pour la découverte de nouveaux inhibiteurs ainsi qu’à la découverte de leurs cibles [172, 173,

175]. Le 19-alcyne acide arachidonique (AA-Alk) est un analogue cliquable de l’acide

arachidonique (AA), mais son utilisation comme outils de recherche nécessite une évaluation

afin de s’assurer qu’il agit de la même façon que l’AA. Nous avons démontré que l’utilisation

d’un analogue traçable de l’AA, l’AA-alcyne, comme outils de recherche pour étudier le

remodelage de l’AA et la production de médiateurs lipidiques nécessite la prise de certaines

précautions, car il n’est pas utilisé par les enzymes cellulaires exactement comme l’AA.

178

La lignée cellulaire lymphocytaire T Jurkat incorpore 2x plus d’AA que d’AA alcyne, mais

l’AA alcyne fut significativement plus élongé en 22:4 comparativement à l’AA. Suite à

l’incorporation de l’AA et l’AA alcyne dans les GPL, leur distribution et remodelage dans

les différentes classes de GPL était très similaire indiquant une utilisation équivalente par la

CoA-indépendante transacylase. Cependant, les quantités et les proportions des différents

médiateurs lipidiques produits suite à la stimulation de plaquettes et de neutrophiles humains

en présence d’AA alcyne étaient significativement différentes qu’en présence d’AA. De plus,

l’induction de la boucle autocrine chez les neutrophiles avec l’AA alcyne exogène stimule

significativement moins la production du LTB4 qu’avec l’AA et le LTB4 alcyne est 12x

moins bon pour stimuler la migration des neutrophiles comparativement au LTB4. Ces

observations suggèrent que le LTB4 alcyne est un moins bon agoniste pour le récepteur BLT1

comparativement au LTB4. Ces résultats démontrent que l’utilisation de l’AA alcyne pour

étudier le métabolisme de l’AA nécessite la prise de certaines précautions, car cet analogue

n’est pas utilisé exactement comme l’AA par les enzymes cellulaires.

Le remodelage des AG polyinsaturés et l’inflammation

Enfin, nous avons aussi publié une revue discutant des études récentes portant sur le contrôle

de la biodisponibilité des AG polyinsaturés pour la production de médiateurs lipidiques chez

les cellules inflammatoires ainsi que les aspects de ce contrôle qui restent encore inconnus.

Une meilleure compréhension du contrôle de la distribution des AG polyinsaturés dans les

GPL et de leurs biodisponibilités pourrait mener à la découverte de nouvelles cibles

thérapeutiques pour traiter certaines maladies inflammatoires et prolifératives.

179

9. CHAPITRE IX: Conclusion et perspectives En conclusion, nous avons démontré que plusieurs enzymes peuvent être impliquées dans les

changements de composition et de distribution des AG dans les GPL que nous avons observés

suite à l’induction de la prolifération des lymphocytes T primaires humains. Les changements

majeurs que nous avons observés sont une augmentation significative de la proportion des

AG mono-insaturés et une importante redistribution de l’AA dans les GPL causée par une

induction de l’incorporation et du remodelage CoA-indépendant de l’AA dans les GPL.

Au niveau de la biosynthèse des AG, nous avons démontré une importante induction de

l’expression des enzymes FAS, SCD1, SCD5, FADS1, FADS2 et ELOVL5 chez les cellules

T en prolifération comparativement aux cellules T au repos et que l’atténuation de la SCD1

et de l’ELOVL5 a un impact important sur le métabolisme des AG mono-insaturés et

polyinsaturés, mais aucun effet n’a été décelé sur la prolifération et la survie cellulaire.

Cependant, il serait important d’atténuer l’expression des autres enzymes dont l’expression

était induite pour déterminer leur implication dans le métabolisme des AG mono-insaturés et

polyinsaturés ainsi que sur la prolifération et la survie cellulaire. L’inhibition ou l’atténuation

combinée de certaines de ces enzymes pourrait être une stratégie thérapeutique intéressante

contre les maladies prolifératives.

Nous avons aussi démontré une induction de l’expression de plusieurs enzymes

potentiellement impliquées dans l’incorporation et le remodelage des AG polyinsaturés dans

les GPL chez les lymphocytes T en prolifération, mais nous n’avons pas été en mesure

d’évaluer l’effet de leur atténuation. Jusqu'à maintenant, les enzymes ayant le plus grand

potentiel sont l’ACSL4, la LPCAT3, la LPIAT1 et les PLA2 calcium-indépendantes IVC,

VIA et VIB. Cependant, plusieurs autres PLA2 non ciblées dans cette étude pourrait bien être

la CoA-IT ou être impliquées dans la production de lyso-GPL nécessaires à l’incorporation

et au remodelage de l’AA. Il serait donc nécessaire d’atténuer l’expression des enzymes

ciblées afin de confirmer leur rôle dans les changements de distribution des AG dans les GPL,

dans la capacité de production de médiateurs lipidiques et dans la prolifération et la survie

cellulaire.

180

La continuité de cette étude pourrait mener à l’identification de la transacylase CoA-

indépendante (CoA-IT), ainsi que d’autres enzymes impliquées dans l’incorporation et le

remodelage des AG polyinsaturés dans les GPL, des voies métaboliques qui semblent être

des cibles thérapeutiques intéressante contre les maladies inflammatoires et prolifératives.

Les enzymes impliquées dans le métabolisme des AG saturés, mono-insaturés et

polyinsaturés semblent aussi être des cibles thérapeutiques intéressantes contre les maladies

prolifératives, mais d’autres recherches sont nécessaires afin de bien caractériser la nécessité

de l’expression de ces enzymes pour la survie et la prolifération cellulaire.

181

10. Références

1. Buckley CD, Gilroy DW, Serhan CN: Proresolving lipid mediators and mechanisms in the resolution of acute inflammation. Immunity 2014, 40:315-327.

2. Serhan CN: Treating inflammation and infection in the 21st century: new hints from decoding resolution mediators and mechanisms. FASEB J 2017.

3. Serhan CN, Chiang N, Dalli J, Levy BD: Lipid mediators in the resolution of inflammation. Cold Spring Harb Perspect Biol 2014, 7:a016311.

4. Radmark O, Werz O, Steinhilber D, Samuelsson B: 5-Lipoxygenase, a key enzyme for leukotriene biosynthesis in health and disease. Biochim Biophys Acta 2015, 1851:331-339.

5. Shimizu T: Lipid mediators in health and disease: enzymes and receptors as therapeutic targets for the regulation of immunity and inflammation. Annu Rev Pharmacol Toxicol 2009, 49:123-150.

6. Tapiero H, Ba GN, Couvreur P, Tew KD: Polyunsaturated fatty acids (PUFA) and eicosanoids in human health and pathologies. Biomed Pharmacother 2002, 56:215-222.

7. Greene ER, Huang S, Serhan CN, Panigrahy D: Regulation of inflammation in cancer by eicosanoids. Prostaglandins Other Lipid Mediat 2011, 96:27-36.

8. Scow DT, Luttermoser GK, Dickerson KS: Leukotriene inhibitors in the treatment of allergy and asthma. Am Fam Physician 2007, 75:65-70.

9. Aggarwal BB, Shishodia S, Sandur SK, Pandey MK, Sethi G: Inflammation and cancer: how hot is the link? Biochem Pharmacol 2006, 72:1605-1621.

10. Davidson BC, Cantrill RC: Fatty acid nomenclature. A short review. S Afr Med J 1985, 67:633-634.

11. Jakobsson A, Westerberg R, Jacobsson A: Fatty acid elongases in mammals: their regulation and roles in metabolism. Prog Lipid Res 2006, 45:237-249.

12. Wakil SJ, Stoops JK, Joshi VC: Fatty acid synthesis and its regulation. Annu Rev Biochem 1983, 52:537-579.

13. Nakamura MT, Nara TY: Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. Annu Rev Nutr 2004, 24:345-376.

14. Paton CM, Ntambi JM: Biochemical and physiological function of stearoyl-CoA desaturase. Am J Physiol Endocrinol Metab 2009, 297:E28-37.

15. Wang J, Yu L, Schmidt RE, Su C, Huang X, Gould K, Cao G: Characterization of HSCD5, a novel human stearoyl-CoA desaturase unique to primates. Biochem Biophys Res Commun 2005, 332:735-742.

16. Guillou H, Zadravec D, Martin PG, Jacobsson A: The key roles of elongases and desaturases in mammalian fatty acid metabolism: Insights from transgenic mice. Prog Lipid Res 2010, 49:186-199.

182

17. Zhang JY, Kothapalli KS, Brenna JT: Desaturase and elongase-limiting endogenous long-chain polyunsaturated fatty acid biosynthesis. Curr Opin Clin Nutr Metab Care 2016, 19:103-110.

18. Gregory MK, Gibson RA, Cook-Johnson RJ, Cleland LG, James MJ: Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis. PLoS One 2011, 6:e29662.

19. Gregory MK, Geier MS, Gibson RA, James MJ: Functional characterization of the chicken fatty acid elongases. J Nutr 2013, 143:12-16.

20. Gregory MK, James MJ: Functional characterization of the duck and turkey fatty acyl elongase enzymes ELOVL5 and ELOVL2. J Nutr 2014, 144:1234-1239.

21. Kitazawa H, Miyamoto Y, Shimamura K, Nagumo A, Tokita S: Development of a high-density assay for long-chain fatty acyl-CoA elongases. Lipids 2009, 44:765-773.

22. Greenlee-Wacker MC: Clearance of apoptotic neutrophils and resolution of inflammation. Immunol Rev 2016, 273:357-370.

23. Calder PC: Functional Roles of Fatty Acids and Their Effects on Human Health. JPEN J Parenter Enteral Nutr 2015, 39:18S-32S.

24. Calder PC: Marine omega-3 fatty acids and inflammatory processes: Effects, mechanisms and clinical relevance. Biochim Biophys Acta 2015, 1851:469-484.

25. Peters-Golden M, Henderson WR, Jr.: Leukotrienes. N Engl J Med 2007, 357:1841-1854.

26. Serhan CN, Chiang N, Dalli J: The resolution code of acute inflammation: Novel pro-resolving lipid mediators in resolution. Semin Immunol 2015, 27:200-215.

27. Brock TG, Peters-Golden M: Activation and regulation of cellular eicosanoid biosynthesis. ScientificWorldJournal 2007, 7:1273-1284.

28. Rouzer CA, Marnett LJ: Cyclooxygenases: structural and functional insights. J Lipid Res 2009, 50 Suppl:S29-34.

29. Chandrasekharan NV, Simmons DL: The cyclooxygenases. Genome Biol 2004, 5:241.

30. Chen YF, Jobanputra P, Barton P, Bryan S, Fry-Smith A, Harris G, Taylor RS: Cyclooxygenase-2 selective non-steroidal anti-inflammatory drugs (etodolac, meloxicam, celecoxib, rofecoxib, etoricoxib, valdecoxib and lumiracoxib) for osteoarthritis and rheumatoid arthritis: a systematic review and economic evaluation. Health Technol Assess 2008, 12:1-278, iii.

31. Dennis EA: Phospholipase A2 in eicosanoid generation. Am J Respir Crit Care Med 2000, 161:S32-35.

32. Zhou L, Nilsson A: Sources of eicosanoid precursor fatty acid pools in tissues. J Lipid Res 2001, 42:1521-1542.

33. Flamand N, Picard S, Lemieux L, Pouliot M, Bourgoin SG, Borgeat P: Effects of pyrrophenone, an inhibitor of group IVA phospholipase A2, on eicosanoid and PAF biosynthesis in human neutrophils. Br J Pharmacol 2006, 149:385-392.

183

34. Fahy E, Subramaniam S, Brown HA, Glass CK, Merrill AH, Jr., Murphy RC, Raetz CR, Russell DW, Seyama Y, Shaw W, et al: A comprehensive classification system for lipids. J Lipid Res 2005, 46:839-861.

35. Lands WE, Hart P: Metabolism Of Glycerolipids: V. Metabolism Of Phosphatidic Acid. J Lipid Res 1964, 15:81-87.

36. Yamashita A, Sugiura T, Waku K: Acyltransferases and transacylases involved in fatty acid remodeling of phospholipids and metabolism of bioactive lipids in mammalian cells. J Biochem 1997, 122:1-16.

37. Lands WE, Inoue M, Sugiura Y, Okuyama H: Selective incorporation of polyunsaturated fatty acids into phosphatidylcholine by rat liver microsomes. J Biol Chem 1982, 257:14968-14972.

38. Lands WE, Hart P: The control of fatty acid composition in glycerolipids. J Am Oil Chem Soc 1966, 43:290-295.

39. Lands WE, Hart P: Metabolism Of Glycerolipids. Vi. Specificities Of Acyl Coenzyme A: Phospholipid Acyltransferases. J Biol Chem 1965, 240:1905-1911.

40. Lands WE, Merkl I: Metabolism of glycerolipids. III. Reactivity of various acyl esters of coenzyme A with alpha'-acylglycerophosphorylcholine, and positional specificities in lecithin synthesis. J Biol Chem 1963, 238:898-904.

41. Lands WE: Metabolism of glycerolipids. 2. The enzymatic acylation of lysolecithin. J Biol Chem 1960, 235:2233-2237.

42. Lands WE: Metabolism of glycerolipides;; a comparison of lecithin and triglyceride synthesis. J Biol Chem 1958, 231:883-888.

43. Kramer RM, Deykin D: Arachidonoyl transacylase in human platelets. Coenzyme A-independent transfer of arachidonate from phosphatidylcholine to lysoplasmenylethanolamine. J Biol Chem 1983, 258:13806-13811.

44. Kramer RM, Patton GM, Pritzker CR, Deykin D: Metabolism of platelet-activating factor in human platelets. Transacylase-mediated synthesis of 1-O-alkyl-2-arachidonoyl-sn-glycero-3-phosphocholine. J Biol Chem 1984, 259:13316-13320.

45. Sugiura T, Katayama O, Fukui J, Nakagawa Y, Waku K: Mobilization of arachidonic acid between diacyl and ether phospholipids in rabbit alveolar macrophages. FEBS Lett 1984, 165:273-276.

46. Sugiura T, Masuzawa Y, Nakagawa Y, Waku K: Transacylation of lyso platelet-activating factor and other lysophospholipids by macrophage microsomes. Distinct donor and acceptor selectivities. J Biol Chem 1987, 262:1199-1205.

47. Takayama H, Kroll MH, Gimbrone MA, Jr., Schafer AI: Turnover of eicosanoid precursor fatty acids among phospholipid classes and subclasses of cultured human umbilical vein endothelial cells. Biochem J 1989, 258:427-434.

48. Purdon AD, Smith JB: Turnover of arachidonic acid in the major diacyl and ether phospholipids of human platelets. J Biol Chem 1985, 260:12700-12704.

184

49. Breton M, Colard O: Protein kinase C promotes arachidonate mobilization through enhancement of CoA-independent transacylase activity in platelets. Biochem J 1991, 280 ( Pt 1):93-98.

50. Uemura Y, Lee TC, Snyder F: A coenzyme A-independent transacylase is linked to the formation of platelet-activating factor (PAF) by generating the lyso-PAF intermediate in the remodeling pathway. J Biol Chem 1991, 266:8268-8272.

51. Fonteh AN, Chilton FH: Rapid remodeling of arachidonate from phosphatidylcholine to phosphatidylethanolamine pools during mast cell activation. J Immunol 1992, 148:1784-1791.

52. Chilton FH, Fonteh AN, Sung CM, Hickey DM, Torphy TJ, Mayer RJ, Marshall LA, Heravi JD, Winkler JD: Inhibitors of CoA-independent transacylase block the movement of arachidonate into 1-ether-linked phospholipids of human neutrophils. Biochemistry 1995, 34:5403-5410.

53. Winkler JD, Eris T, Sung CM, Chabot-Fletcher M, Mayer RJ, Surette ME, Chilton FH: Inhibitors of coenzyme A-independent transacylase induce apoptosis in human HL-60 cells. J Pharmacol Exp Ther 1996, 279:956-966.

54. Surette ME, Winkler JD, Fonteh AN, Chilton FH: Relationship between arachidonate--phospholipid remodeling and apoptosis. Biochemistry 1996, 35:9187-9196.

55. Winkler JD, Fonteh AN, Sung CM, Heravi JD, Nixon AB, Chabot-Fletcher M, Griswold D, Marshall LA, Chilton FH: Effects of CoA-independent transacylase inhibitors on the production of lipid inflammatory mediators. J Pharmacol Exp Ther 1995, 274:1338-1347.

56. Surette ME, Fonteh AN, Bernatchez C, Chilton FH: Perturbations in the control of cellular arachidonic acid levels block cell growth and induce apoptosis in HL-60 cells. Carcinogenesis 1999, 20:757-763.

57. Monjazeb AM, High KP, Koumenis C, Chilton FH: Inhibitors of arachidonic acid metabolism act synergistically to signal apoptosis in neoplastic cells. Prostaglandins Leukot Essent Fatty Acids 2005, 73:463-474.

58. Fonteh AN, LaPorte T, Swan D, McAlexander MA: A decrease in remodeling accounts for the accumulation of arachidonic acid in murine mast cells undergoing apoptosis. J Biol Chem 2001, 276:1439-1449.

59. Winkler JD, Sung CM, Chabot-Flecher M, Griswold DE, Marshall LA, Chilton FH, Bondinell W, Mayer RJ: Beta-lactams SB 212047 and SB 216754 are irreversible, time-dependent inhibitors of coenzyme A-independent transacylase. Mol Pharmacol 1998, 53:322-329.

60. Yamashita A, Hayashi Y, Matsumoto N, Nemoto-Sasaki Y, Koizumi T, Inagaki Y, Oka S, Tanikawa T, Sugiura T: Coenzyme-A-Independent Transacylation System;; Possible Involvement of Phospholipase A2 in Transacylation. Biology (Basel) 2017, 6.

61. Balsinde J: Roles of various phospholipases A2 in providing lysophospholipid acceptors for fatty acid phospholipid incorporation and remodelling. Biochem J 2002, 364:695-702.

185

62. Akiba S, Sato T: Cellular function of calcium-independent phospholipase A2. Biol Pharm Bull 2004, 27:1174-1178.

63. Schaloske RH, Dennis EA: The phospholipase A2 superfamily and its group numbering system. Biochim Biophys Acta 2006, 1761:1246-1259.

64. Kudo I, Murakami M: Phospholipase A2 enzymes. Prostaglandins Other Lipid Mediat 2002, 68-69:3-58.

65. Chen JW, Dodia C, Feinstein SI, Jain MK, Fisher AB: 1-Cys peroxiredoxin, a bifunctional enzyme with glutathione peroxidase and phospholipase A2 activities. J Biol Chem 2000, 275:28421-28427.

66. Fisher AB: Peroxiredoxin 6: A bifunctional enzyme with glutathione peroxidase and phospholipase A2 activities. Antioxid Redox Signal.

67. Leslie CC: Regulation of the specific release of arachidonic acid by cytosolic phospholipase A2. Prostaglandins Leukot Essent Fatty Acids 2004, 70:373-376.

68. Lucas KK, Dennis EA: The ABC's of Group IV cytosolic phospholipase A2. Biochim Biophys Acta 2004, 1636:213-218.

69. Ohto T, Uozumi N, Hirabayashi T, Shimizu T: Identification of novel cytosolic phospholipase A(2)s, murine cPLA(2)delta, epsilon, and zeta, which form a gene cluster with cPLA(2)beta. J Biol Chem 2005, 280:24576-24583.

70. Pickard RT, Strifler BA, Kramer RM, Sharp JD: Molecular cloning of two new human paralogs of 85-kDa cytosolic phospholipase A2. J Biol Chem 1999, 274:8823-8831.

71. Yamashita A, Kamata R, Kawagishi N, Nakanishi H, Suzuki H, Sugiura T, Waku K: Roles of C-terminal processing, and involvement in transacylation reaction of human group IVC phospholipase A2 (cPLA2gamma). J Biochem 2005, 137:557-567.

72. Yamashita A, Tanaka K, Kamata R, Kumazawa T, Suzuki N, Koga H, Waku K, Sugiura T: Subcellular localization and lysophospholipase/transacylation activities of human group IVC phospholipase A2 (cPLA2gamma). Biochim Biophys Acta 2009, 1791:1011-1022.

73. Wilson PA, Gardner SD, Lambie NM, Commans SA, Crowther DJ: Characterization of the human patatin-like phospholipase family. J Lipid Res 2006, 47:1940-1949.

74. Larsson PK, Claesson HE, Kennedy BP: Multiple splice variants of the human calcium-independent phospholipase A2 and their effect on enzyme activity. J Biol Chem 1998, 273:207-214.

75. Tang J, Kriz RW, Wolfman N, Shaffer M, Seehra J, Jones SS: A novel cytosolic calcium-independent phospholipase A2 contains eight ankyrin motifs. J Biol Chem 1997, 272:8567-8575.

76. Murakami M, Masuda S, Ueda-Semmyo K, Yoda E, Kuwata H, Takanezawa Y, Aoki J, Arai H, Sumimoto H, Ishikawa Y, et al: Group VIB Ca2+-independent phospholipase A2gamma promotes cellular membrane hydrolysis and prostaglandin production in a manner distinct from other intracellular phospholipases A2. J Biol Chem 2005, 280:14028-14041.

186

77. Balsinde J, Bianco ID, Ackermann EJ, Conde-Frieboes K, Dennis EA: Inhibition of calcium-independent phospholipase A2 prevents arachidonic acid incorporation and phospholipid remodeling in P388D1 macrophages. Proc Natl Acad Sci U S A 1995, 92:8527-8531.

78. Birbes H, Drevet S, Pageaux JF, Lagarde M, Laugier C: Involvement of calcium-independent phospholipase A2 in uterine stromal cell phospholipid remodelling. Eur J Biochem 2000, 267:7118-7127.

79. Jenkins CM, Mancuso DJ, Yan W, Sims HF, Gibson B, Gross RW: Identification, cloning, expression, and purification of three novel human calcium-independent phospholipase A2 family members possessing triacylglycerol lipase and acylglycerol transacylase activities. J Biol Chem 2004, 279:48968-48975.

80. Shayman JA, Kelly R, Kollmeyer J, He Y, Abe A: Group XV phospholipase A(2), a lysosomal phospholipase A(2). Prog Lipid Res 2011, 50:1-13.

81. Balsinde J, Dennis EA: Function and inhibition of intracellular calcium-independent phospholipase A2. J Biol Chem 1997, 272:16069-16072.

82. Diaz BL, Arm JP: Phospholipase A(2). Prostaglandins Leukot Essent Fatty Acids 2003, 69:87-97.

83. Murakami M, Taketomi Y, Miki Y, Sato H, Hirabayashi T, Yamamoto K: Recent progress in phospholipase A research: from cells to animals to humans. Prog Lipid Res, 50:152-192.

84. Yarla NS, Bishayee A, Vadlakonda L, Chintala R, Duddukuri GR, Reddanna P, Dowluru KS: Phospholipase A2 Isoforms as Novel Targets for Prevention and Treatment of Inflammatory and Oncologic Diseases. Curr Drug Targets 2016, 17:1940-1962.

85. Zhang XH, Zhao C, Seleznev K, Song K, Manfredi JJ, Ma ZA: Disruption of G1-phase phospholipid turnover by inhibition of Ca2+-independent phospholipase A2 induces a p53-dependent cell-cycle arrest in G1 phase. J Cell Sci 2006, 119:1005-1015.

86. Grevengoed TJ, Klett EL, Coleman RA: Acyl-CoA metabolism and partitioning. Annu Rev Nutr 2014, 34:1-30.

87. Golej DL, Askari B, Kramer F, Barnhart S, Vivekanandan-Giri A, Pennathur S, Bornfeldt KE: Long-chain acyl-CoA synthetase 4 modulates prostaglandin E(2) release from human arterial smooth muscle cells. J Lipid Res 2011, 52:782-793.

88. Cao Y, Traer E, Zimmerman GA, McIntyre TM, Prescott SM: Cloning, expression, and chromosomal localization of human long-chain fatty acid-CoA ligase 4 (FACL4). Genomics 1998, 49:327-330.

89. Kuwata H, Hara S: Inhibition of long-chain acyl-CoA synthetase 4 facilitates production of 5, 11-dihydroxyeicosatetraenoic acid via the cyclooxygenase-2 pathway. Biochem Biophys Res Commun 2015, 465:528-533.

90. Maloberti PM, Duarte AB, Orlando UD, Pasqualini ME, Solano AR, Lopez-Otin C, Podesta EJ: Functional interaction between acyl-CoA synthetase 4, lipooxygenases and cyclooxygenase-2 in the aggressive phenotype of breast cancer cells. PLoS One 2010, 5:e15540.

187

91. Monaco ME, Creighton CJ, Lee P, Zou X, Topham MK, Stafforini DM: Expression of Long-chain Fatty Acyl-CoA Synthetase 4 in Breast and Prostate Cancers Is Associated with Sex Steroid Hormone Receptor Negativity. Transl Oncol 2010, 3:91-98.

92. Orlando UD, Castillo AF, Dattilo MA, Solano AR, Maloberti PM, Podesta EJ: Acyl-CoA synthetase-4, a new regulator of mTOR and a potential therapeutic target for enhanced estrogen receptor function in receptor-positive and -negative breast cancer. Oncotarget 2015, 6:42632-42650.

93. Orlando UD, Garona J, Ripoll GV, Maloberti PM, Solano AR, Avagnina A, Gomez DE, Alonso DF, Podesta EJ: The functional interaction between Acyl-CoA synthetase 4, 5-lipooxygenase and cyclooxygenase-2 controls tumor growth: a novel therapeutic target. PLoS One 2012, 7:e40794.

94. Wu X, Deng F, Li Y, Daniels G, Du X, Ren Q, Wang J, Wang LH, Yang Y, Zhang V, et al: ACSL4 promotes prostate cancer growth, invasion and hormonal resistance. Oncotarget 2015, 6:44849-44863.

95. Wu X, Li Y, Wang J, Wen X, Marcus MT, Daniels G, Zhang DY, Ye F, Wang LH, Du X, et al: Long chain fatty Acyl-CoA synthetase 4 is a biomarker for and mediator of hormone resistance in human breast cancer. PLoS One 2013, 8:e77060.

96. Yan S, Yang XF, Liu HL, Fu N, Ouyang Y, Qing K: Long-chain acyl-CoA synthetase in fatty acid metabolism involved in liver and other diseases: an update. World J Gastroenterol 2015, 21:3492-3498.

97. Kanter JE, Kramer F, Barnhart S, Averill MM, Vivekanandan-Giri A, Vickery T, Li LO, Becker L, Yuan W, Chait A, et al: Diabetes promotes an inflammatory macrophage phenotype and atherosclerosis through acyl-CoA synthetase 1. Proc Natl Acad Sci U S A 2012, 109:E715-724.

98. Shindou H, Hishikawa D, Harayama T, Yuki K, Shimizu T: Recent progress on acyl CoA: lysophospholipid acyltransferase research. J Lipid Res 2009, 50 Suppl:S46-51.

99. Shindou H, Shimizu T: Acyl-CoA:lysophospholipid acyltransferases. J Biol Chem 2009, 284:1-5.

100. Harayama T, Shindou H, Shimizu T: Biosynthesis of phosphatidylcholine by human lysophosphatidylcholine acyltransferase 1. J Lipid Res 2009, 50:1824-1831.

101. Shindou H, Hishikawa D, Nakanishi H, Harayama T, Ishii S, Taguchi R, Shimizu T: A single enzyme catalyzes both platelet-activating factor production and membrane biogenesis of inflammatory cells. Cloning and characterization of acetyl-CoA:LYSO-PAF acetyltransferase. J Biol Chem 2007, 282:6532-6539.

102. Cao J, Shan D, Revett T, Li D, Wu L, Liu W, Tobin JF, Gimeno RE: Molecular identification of a novel mammalian brain isoform of acyl-CoA:lysophospholipid acyltransferase with prominent ethanolamine lysophospholipid acylating activity, LPEAT2. J Biol Chem 2008, 283:19049-19057.

188

103. Gijon MA, Riekhof WR, Zarini S, Murphy RC, Voelker DR: Lysophospholipid acyltransferases and arachidonate recycling in human neutrophils. J Biol Chem 2008, 283:30235-30245.

104. Hishikawa D, Shindou H, Kobayashi S, Nakanishi H, Taguchi R, Shimizu T: Discovery of a lysophospholipid acyltransferase family essential for membrane asymmetry and diversity. Proc Natl Acad Sci U S A 2008, 105:2830-2835.

105. Currie E, Schulze A, Zechner R, Walther TC, Farese RV, Jr.: Cellular fatty acid metabolism and cancer. Cell Metab 2013, 18:153-161.

106. Daniels VW, Smans K, Royaux I, Chypre M, Swinnen JV, Zaidi N: Cancer cells differentially activate and thrive on de novo lipid synthesis pathways in a low-lipid environment. PLoS One 2014, 9:e106913.

107. Mashima T, Seimiya H, Tsuruo T: De novo fatty-acid synthesis and related pathways as molecular targets for cancer therapy. Br J Cancer 2009, 100:1369-1372.

108. Swinnen JV, Brusselmans K, Verhoeven G: Increased lipogenesis in cancer cells: new players, novel targets. Curr Opin Clin Nutr Metab Care 2006, 9:358-365.

109. Zaidi N, Lupien L, Kuemmerle NB, Kinlaw WB, Swinnen JV, Smans K: Lipogenesis and lipolysis: the pathways exploited by the cancer cells to acquire fatty acids. Prog Lipid Res 2013, 52:585-589.

110. Little JL, Kridel SJ: Fatty acid synthase activity in tumor cells. Subcell Biochem 2008, 49:169-194.

111. Buckley D, Duke G, Heuer TS, O'Farrell M, Wagman AS, McCulloch W, Kemble G: Fatty acid synthase - Modern tumor cell biology insights into a classical oncology target. Pharmacol Ther 2017.

112. Belkaid A, Duguay SR, Ouellette RJ, Surette ME: 17beta-estradiol induces stearoyl-CoA desaturase-1 expression in estrogen receptor-positive breast cancer cells. BMC Cancer 2015, 15:440.

113. Bellenghi M, Puglisi R, Pedini F, De Feo A, Felicetti F, Bottero L, Sangaletti S, Errico MC, Petrini M, Gesumundo C, et al: SCD5-induced oleic acid production reduces melanoma malignancy by intracellular retention of SPARC and cathepsin B. J Pathol 2015, 236:315-325.

114. Chajes V, Joulin V, Clavel-Chapelon F: The fatty acid desaturation index of blood lipids, as a biomarker of hepatic stearoyl-CoA desaturase expression, is a predictive factor of breast cancer risk. Curr Opin Lipidol 2011, 22:6-10.

115. Hess D, Chisholm JW, Igal RA: Inhibition of stearoylCoA desaturase activity blocks cell cycle progression and induces programmed cell death in lung cancer cells. PLoS One 2010, 5:e11394.

116. Holder AM, Gonzalez-Angulo AM, Chen H, Akcakanat A, Do KA, Fraser Symmans W, Pusztai L, Hortobagyi GN, Mills GB, Meric-Bernstam F: High stearoyl-CoA desaturase 1 expression is associated with shorter survival in breast cancer patients. Breast Cancer Res Treat 2013, 137:319-327.

189

117. Igal RA: Stearoyl-CoA desaturase-1: a novel key player in the mechanisms of cell proliferation, programmed cell death and transformation to cancer. Carcinogenesis, 31:1509-1515.

118. Igal RA: Roles of StearoylCoA Desaturase-1 in the Regulation of Cancer Cell Growth, Survival and Tumorigenesis. Cancers (Basel) 2011, 3:2462-2477.

119. Mason P, Liang B, Li L, Fremgen T, Murphy E, Quinn A, Madden SL, Biemann HP, Wang B, Cohen A, et al: SCD1 inhibition causes cancer cell death by depleting mono-unsaturated fatty acids. PLoS One 2012, 7:e33823.

120. Sinner DI, Kim GJ, Henderson GC, Igal RA: StearoylCoA desaturase-5: a novel regulator of neuronal cell proliferation and differentiation. PLoS One 2012, 7:e39787.

121. Wang C, Rajput S, Watabe K, Liao DF, Cao D: Acetyl-CoA carboxylase-a as a novel target for cancer therapy. Front Biosci (Schol Ed) 2010, 2:515-526.

122. Thewke D, Kramer M, Sinensky MS: Transcriptional homeostatic control of membrane lipid composition. Biochem Biophys Res Commun 2000, 273:1-4.

123. Smith AD, Stubbs CD: Modulation of membrane protein function by bilayer lipids. Basic Res Cardiol 1987, 82 Suppl 1:93-97.

124. Spector AA, Yorek MA: Membrane lipid composition and cellular function. J Lipid Res 1985, 26:1015-1035.

125. Stubbs CD, Smith AD: The modification of mammalian membrane polyunsaturated fatty acid composition in relation to membrane fluidity and function. Biochim Biophys Acta 1984, 779:89-137.

126. Scott KF, Sajinovic M, Hein J, Nixdorf S, Galettis P, Liauw W, de Souza P, Dong Q, Graham GG, Russell PJ: Emerging roles for phospholipase A2 enzymes in cancer. Biochimie, 92:601-610.

127. Leslie CC: Cytosolic phospholipase A(2): physiological function and role in disease. J Lipid Res 2015, 56:1386-1402.

128. Ramanadham S, Ali T, Ashley JW, Bone RN, Hancock WD, Lei X: Calcium-independent phospholipases A2 and their roles in biological processes and diseases. J Lipid Res 2015, 56:1643-1668.

129. Male D, Brostoff J, Roth DB, Roitt I: Immunologie. Traduction de la 7e édition anglaise edn: Elsevier;; 2007.

130. Ottensmeier C: The classification of lymphomas and leukemias. Chem Biol Interact 2001, 135-136:653-664.

131. Rasmussen TK: Follicular T helper cells and IL-21 in rheumatic diseases. Dan Med J 2016, 63.

132. Rose T, Dorner T: Drivers of the immunopathogenesis in systemic lupus erythematosus. Best Pract Res Clin Rheumatol 2017, 31:321-333.

133. Swerdlow SH, Campo E, Pileri SA, Harris NL, Stein H, Siebert R, Advani R, Ghielmini M, Salles GA, Zelenetz AD, Jaffe ES: The 2016 revision of the World Health Organization classification of lymphoid neoplasms. Blood 2016, 127:2375-2390.

190

134. Yang SH, Gao CY, Li L, Chang C, Leung PSC, Gershwin ME, Lian ZX: The molecular basis of immune regulation in autoimmunity. Clin Sci (Lond) 2018, 132:43-67.

135. Modiano JF, Mayor J, Ball C, Chitko-McKown CG, Sakata N, Domenico-Hahn J, Lucas JJ, Gelfand EW: Quantitative and qualitative signals determine T-cell cycle entry and progression. Cell Immunol 1999, 197:19-29.

136. Saloga J, Schwinzer R, Renz H, Terada N, Or R, Gelfand EW: Characterization of the progression signal for human T-cell proliferation provided by monoclonal antibodies to the CD3-TCR complex. Clin Immunol Immunopathol 1993, 67:232-239.

137. Boilard E, Surette ME: Anti-CD3 and concanavalin A-induced human T cell proliferation is associated with an increased rate of arachidonate-phospholipid remodeling. Lack of involvement of group IV and group VI phospholipase A2 in remodeling and increased susceptibility of proliferating T cells to CoA-independent transacyclase inhibitor-induced apoptosis. J Biol Chem 2001, 276:17568-17575.

138. Jackowski S: Cell cycle regulation of membrane phospholipid metabolism. J Biol Chem 1996, 271:20219-20222.

139. Anel A, Naval J, Gonzalez B, Torres JM, Mishal Z, Uriel J, Pineiro A: Fatty acid metabolism in human lymphocytes. I. Time-course changes in fatty acid composition and membrane fluidity during blastic transformation of peripheral blood lymphocytes. Biochim Biophys Acta 1990, 1044:323-331.

140. Stulnig TM, Buhler E, Bock G, Kirchebner C, Schonitzer D, Wick G: Altered switch in lipid composition during T-cell blast transformation in the healthy elderly. J Gerontol A Biol Sci Med Sci 1995, 50:B383-390.

141. Anel A, Naval J, Gonzalez B, Uriel J, Pineiro A: Fatty acid metabolism in human lymphocytes. II. Activation of fatty acid desaturase-elongase systems during blastic transformation. Biochim Biophys Acta 1990, 1044:332-339.

142. Chilton FH, Fonteh AN, Surette ME, Triggiani M, Winkler JD: Control of arachidonate levels within inflammatory cells. Biochim Biophys Acta 1996, 1299:1-15.

143. Chilton FH, Surette ME, Winkler JD: Arachidonate-phospholipid remodeling and cell proliferation. Adv Exp Med Biol 1996, 416:169-172.

144. Calder PC, Yaqoob P, Harvey DJ, Watts A, Newsholme EA: Incorporation of fatty acids by concanavalin A-stimulated lymphocytes and the effect on fatty acid composition and membrane fluidity. Biochem J 1994, 300 ( Pt 2):509-518.

145. Kerkhoff C, Gehring L, Habben K, Resch K, Kaever V: The mitogen-induced lysophospholipid:acyl-CoA acyltransferase (LAT) expression in human T-lymphocytes is diminished by hydrocortisone. Biochem Biophys Res Commun 1997, 237:632-638.

146. Shires SE, Kelleher J, Trejdosiewicz LK: Effects of linoleic acid and mitogenic stimulation on the fatty acid composition of human lymphocytes. Biochim Biophys Acta 1989, 1002:74-78.

191

147. Belkaid A, Ouellette RJ, Surette ME: 17beta-estradiol-induced ACSL4 protein expression promotes an invasive phenotype in estrogen receptor positive mammary carcinoma cells. Carcinogenesis 2017, 38:402-410.

148. Perez-Chacon G, Astudillo AM, Ruiperez V, Balboa MA, Balsinde J: Signaling role for lysophosphatidylcholine acyltransferase 3 in receptor-regulated arachidonic acid reacylation reactions in human monocytes. J Immunol 2010, 184:1071-1078.

149. Jain S, Zhang X, Khandelwal PJ, Saunders AJ, Cummings BS, Oelkers P: Characterization of human lysophospholipid acyltransferase 3. J Lipid Res 2009, 50:1563-1570.

150. Perez R, Matabosch X, Llebaria A, Balboa MA, Balsinde J: Blockade of arachidonic acid incorporation into phospholipids induces apoptosis in U937 promonocytic cells. J Lipid Res 2006, 47:484-491.

151. Cao Y, Dave KB, Doan TP, Prescott SM: Fatty acid CoA ligase 4 is up-regulated in colon adenocarcinoma. Cancer Res 2001, 61:8429-8434.

152. Cao Y, Pearman AT, Zimmerman GA, McIntyre TM, Prescott SM: Intracellular unesterified arachidonic acid signals apoptosis. Proc Natl Acad Sci U S A 2000, 97:11280-11285.

153. Fukunaga-Johnson N, Lee SW, Liebert M, Grossman HB: Molecular analysis of a gene, BB1, overexpressed in bladder and breast carcinoma. Anticancer Res 1996, 16:1085-1090.

154. Nakano T, Matsui H, Tanaka T, Hozumi Y, Iseki K, Kawamae K, Goto K: Arachidonoyl-Specific Diacylglycerol Kinase epsilon and the Endoplasmic Reticulum. Front Cell Dev Biol 2016, 4:132.

155. Shulga YV, Topham MK, Epand RM: Study of arachidonoyl specificity in two enzymes of the PI cycle. J Mol Biol, 409:101-112.

156. Shulga YV, Topham MK, Epand RM: Substrate specificity of diacylglycerol kinase-epsilon and the phosphatidylinositol cycle. FEBS Lett 2011, 585:4025-4028.

157. Fujita M, Kinoshita T: GPI-anchor remodeling: potential functions of GPI-anchors in intracellular trafficking and membrane dynamics. Biochim Biophys Acta 2012, 1821:1050-1058.

158. Maeda Y, Tashima Y, Houjou T, Fujita M, Yoko-o T, Jigami Y, Taguchi R, Kinoshita T: Fatty acid remodeling of GPI-anchored proteins is required for their raft association. Mol Biol Cell 2007, 18:1497-1506.

159. Bordoni A, Di Nunzio M, Danesi F, Biagi PL: Polyunsaturated fatty acids: From diet to binding to ppars and other nuclear receptors. Genes Nutr 2006, 1:95-106.

160. Varga T, Czimmerer Z, Nagy L: PPARs are a unique set of fatty acid regulated transcription factors controlling both lipid metabolism and inflammation. Biochim Biophys Acta 2011, 1812:1007-1022.

161. Roshak AK, Capper EA, Stevenson C, Eichman C, Marshall LA: Human calcium-independent phospholipase A2 mediates lymphocyte proliferation. J Biol Chem 2000, 275:35692-35698.

192

162. Lei X, Barbour SE, Ramanadham S: Group VIA Ca2+-independent phospholipase A2 (iPLA2beta) and its role in beta-cell programmed cell death. Biochimie, 92:627-637.

163. Nicotera TM, Schuster DP, Bourhim M, Chadha K, Klaich G, Corral DA: Regulation of PSA secretion and survival signaling by calcium-independent phopholipase A(2)beta in prostate cancer cells. Prostate 2009, 69:1270-1280.

164. Asai K, Hirabayashi T, Houjou T, Uozumi N, Taguchi R, Shimizu T: Human group IVC phospholipase A2 (cPLA2gamma). Roles in the membrane remodeling and activation induced by oxidative stress. J Biol Chem 2003, 278:8809-8814.

165. Stewart A, Ghosh M, Spencer DM, Leslie CC: Enzymatic properties of human cytosolic phospholipase A(2)gamma. J Biol Chem 2002, 277:29526-29536.

166. Underwood KW, Song C, Kriz RW, Chang XJ, Knopf JL, Lin LL: A novel calcium-independent phospholipase A2, cPLA2-gamma, that is prenylated and contains homology to cPLA2. J Biol Chem 1998, 273:21926-21932.

167. Minville-Walz M, Pierre AS, Pichon L, Bellenger S, Fevre C, Bellenger J, Tessier C, Narce M, Rialland M: Inhibition of stearoyl-CoA desaturase 1 expression induces CHOP-dependent cell death in human cancer cells. PLoS One, 5:e14363.

168. Scaglia N, Igal RA: Stearoyl-CoA desaturase is involved in the control of proliferation, anchorage-independent growth, and survival in human transformed cells. J Biol Chem 2005, 280:25339-25349.

169. Scaglia N, Igal RA: Inhibition of Stearoyl-CoA Desaturase 1 expression in human lung adenocarcinoma cells impairs tumorigenesis. Int J Oncol 2008, 33:839-850.

170. Burhans MS, Flowers MT, Harrington KR, Bond LM, Guo CA, Anderson RM, Ntambi JM: Hepatic oleate regulates adipose tissue lipogenesis and fatty acid oxidation. J Lipid Res 2015, 56:304-318.

171. Best MD: Click chemistry and bioorthogonal reactions: unprecedented selectivity in the labeling of biological molecules. Biochemistry 2009, 48:6571-6584.

172. Cravatt BF, Wright AT, Kozarich JW: Activity-based protein profiling: from enzyme chemistry to proteomic chemistry. Annu Rev Biochem 2008, 77:383-414.

173. Kolb HC, Sharpless KB: The growing impact of click chemistry on drug discovery. Drug Discov Today 2003, 8:1128-1137.

174. Nwe K, Brechbiel MW: Growing applications of "click chemistry" for bioconjugation in contemporary biomedical research. Cancer Biother Radiopharm 2009, 24:289-302.

175. Niphakis MJ, Cravatt BF: Enzyme inhibitor discovery by activity-based protein profiling. Annu Rev Biochem 2014, 83:341-377.

le métabolisme des acides gras et des ... · potentiellement impliquées dans la biosynthèse des...

Documents