diversité microbienne associée au cycle du méthane dans les … · 2020. 7. 30. · cependant,...
Post on 01-Apr-2021
3 Views
Preview:
TRANSCRIPT
Diversité microbienne associée au cycle du méthane
dans les mares de fonte du pergélisol subarctique
Thèse
Sophie Crevecoeur
Doctorat en biologie
Philosophiae doctor (Ph. D.)
Québec, Canada
© Sophie Crevecoeur, 2016
Diversité microbienne associée au cycle du méthane
dans les mares de fonte du pergélisol subarctique
Thèse
Sophie Crevecoeur
Sous la direction de :
Warwick F. Vincent, directeur de recherche
Connie Lovejoy, codirectrice de recherche
iii
Résumé
La fonte et l’effondrement du pergélisol riche en glace dans la région subarctique du
Québec ont donné lieu à la formation de petits lacs (mares de thermokarst) qui émettent des gaz à
effet de serre dans l’atmosphère tels que du dioxyde de carbone et du méthane. Pourtant, la
composition de la communauté microbienne qui est à la base des processus biogéochimiques dans
les mares de fonte a été très peu étudiée, particulièrement en ce qui concerne la diversité et l’activité
des micro-organismes impliqués dans le cycle du méthane. L’objectif de cette thèse est donc
d’étudier la diversité phylogénétique et fonctionnelle des micro-organismes dans les mares de fonte
subarctiques en lien avec les caractéristiques de l’environnement et les émissions de méthane. Pour
ce faire, une dizaine de mares ont été échantillonnées dans quatre vallées situées à travers un
gradient de fonte du pergélisol, et disposant de différentes propriétés physico-chimiques. Selon les
vallées, les mares peuvent être issues de la fonte de palses (buttes de tourbe, à dominance
organique) ou de lithalses (buttes de sol à dominance minérale) ce qui influence la nature du
carbone organique disponible pour la reminéralisation microbienne. Durant l’été, les mares étaient
fortement stratifiées; il y avait un fort gradient physico-chimique au sein de la colonne d’eau, avec
une couche d’eau supérieure oxique et une couche d’eau profonde pauvre en oxygène ou anoxique.
Pour identifier les facteurs qui influencent les communautés microbiennes, des techniques de
séquençage à haut débit ont été utilisées ciblant les transcrits des gènes de l’ARNr 16S et des gènes
impliqués dans le cycle du méthane : mcrA pour la méthanogenèse et pmoA pour la méthanotrophie.
Pour évaluer l’activité des micro-organismes, la concentration des transcrits des gènes fonctionnels
a aussi été mesurée avec des PCR quantitatives (qPCR). Les résultats montrent une forte dominance
de micro-organismes impliqués dans le cycle du méthane, c’est-à-dire des archées méthanogènes et
des bactéries méthanotrophes. L’analyse du gène pmoA indique que les bactéries méthanotrophes
n’étaient pas seulement actives à la surface, mais aussi dans le fond de la mare où les concentrations
en oxygène étaient minimales; ce qui est inattendu compte tenu de leur besoin en oxygène pour
consommer le méthane. En général, la composition des communautés microbiennes était
principalement influencée par l’origine de la mare (palse ou lithalse), et moins par le gradient de
dégradation du pergélisol. Des variables environnementales clefs comme le pH, le phosphore et le
carbone organique dissous, contribuent à la distinction des communautés microbiennes entre les
mares issues de palses ou de lithalses. Avec l’intensification des effets du réchauffement climatique,
ces communautés microbiennes vont faire face à des changements de conditions qui risquent de
modifier leur composition taxonomique, et leurs réponses aux changements seront probablement
différentes selon le type de mares. De plus, dans le futur les conditions d’oxygénation au sein des
iv
mares seront soumises à des modifications majeures associées avec un changement dans la durée
des périodes de fonte de glace et de stratification. Ce type de changement aura un impact sur
l’équilibre entre la méthanogenèse et la méthanotrophie, et affectera ainsi les taux d’émissions de
méthane. Cependant, les résultats obtenus dans cette thèse indiquent que les archées méthanogènes
et les bactéries méthanotrophes peuvent développer des stratégies pour survivre et rester actives au-
delà des limites de leurs conditions d’oxygène habituelles.
v
Abstract
The thawing and collapse of ice-rich permafrost in the subarctic region of Quebec has given
rise to thaw ponds (thermokarst ponds) that emit the greenhouse gases carbon dioxide and methane
to the atmosphere. However, the microbial community composition that underlies biogeochemical
processes in thaw ponds has been little investigated, particularly concerning the diversity and
activity of micro-organisms involved in the methane cycle. The objective of this thesis study was to
determine the phylogenetic and functional diversity of micro-organisms in subarctic thaw ponds,
and the relationships with environmental properties and methane emission. To that aim, we sampled
ten thaw ponds in four different valleys located across a permafrost degradation gradient with
distinct physico-chemical properties. Depending on valley, the ponds were derived either from the
thawing of a palsa (peat-mound) or lithalsa (mineral-mound), which influenced the nature of
organic carbon available for microbial remineralization. During summer, the ponds were observed
to be well-stratified; there were with strong physico-chemical gradients down the water column,
with an upper oxic layer and a bottom low oxygen or anoxic layer. To identify the factors
influencing microbial community composition, we used high throughput sequencing techniques
targeting transcripts of 16S rRNA gene, and additionally targeted genes involved in the methane
cycle: mcrA for methanogenesis and pmoA for methanotrophy. As a proxy of microbial activity, we
also measured the concentration of functional gene transcripts using with quantitative PCR (qPCR).
The results showed a striking dominance of micro-organisms involved in the methane cycle, namely
methanogenic Archaea and methanotrophic Bacteria. The pmoA analyses implied that
methanotrophic Bacteria were not only active in the surface, but also in the bottom waters where
oxygen concentrations were minimal; this was unexpected given their need for oxygen in methane
consumption. In general, the microbial community properties were largely determined by the origin
of the ponds (palsa versus lithalsa), and much less so by the extent of permafrost degradation. The
key environmental variables pH, phosphorus and dissolved organic carbon likely contributed to the
differentiation of microbial community between the palsa and lithalsa valleys. With intensification
of climate warming, these microbial communities will face changing conditions that are likely to
modify their taxonomic composition, and these responses are likely to differ between ponds in the
two landscape types. Oxygenation of the ponds will likely be subject to major shifts in the future
associated with changes in the duration of the ice-free season and the extent of stratification. Such
changes will impact the balance between methanogenesis and methanotrophy, and thereby affect
the net rates of methane emission. However, the results obtained here indicate that methanogenic
vi
Archaea and methanotrophic Bacteria have strategies to survive and remain active beyond the limit
of their usual oxygen preferences.
vii
Table des matières
Résumé ............................................................................................................................................... iii
Abstract ............................................................................................................................................... v
Table des matières ............................................................................................................................. vii
Liste des tableaux ................................................................................................................................ x
Liste des figures ................................................................................................................................. xi
Liste des abréviations et des sigles ................................................................................................... xiii
Remerciements ................................................................................................................................ xvii
Avant-propos .................................................................................................................................. xviii
Chapitre 1. Introduction ................................................................................................................. 1
1.1. Le pergélisol en Arctique .................................................................................................... 2
1.2. Les mares de fonte du pergélisol ......................................................................................... 3
1.2.1. Formation .................................................................................................................... 4
1.2.2. Caractéristiques limnologiques ................................................................................... 4
1.2.3. Implication dans les émissions de gaz à effet de serre ................................................ 6
1.3. Les micro-organismes dans les milieux aquatiques ............................................................ 6
1.3.1. Processus microbiens .................................................................................................. 7
1.3.2. Micro-organismes impliqués dans le cycle du méthane .............................................. 8
1.3.3. Approches pour étudier les micro-organismes .......................................................... 10
1.4. Organisation de la thèse .................................................................................................... 12
1.4.1. Objectifs et hypothèses des chapitres de thèse .......................................................... 12
1.4.2. Sites d’études............................................................................................................. 13
Chapitre 2. Bacterial community structure across environmental gradients in permafrost thaw
ponds: methanotroph-rich ecosystems .............................................................................................. 15
Résumé .......................................................................................................................................... 15
Abstract ......................................................................................................................................... 16
2.1. Introduction ....................................................................................................................... 17
2.2. Materials and methods ...................................................................................................... 19
2.2.1. Study sites and sampling ........................................................................................... 19
2.2.2. Physico-chemical analysis ......................................................................................... 21
2.2.3. RNA collection and extraction .................................................................................. 22
2.2.4. High throughput multiplex tag sequencing ............................................................... 23
2.2.5. Sequence processing and statistics ............................................................................ 23
2.3. Results ............................................................................................................................... 24
2.3.1. Limnological conditions ............................................................................................ 24
2.3.2. Bacterial alpha-diversity ........................................................................................... 25
viii
2.3.3. Bacterial beta-diversity and community composition ............................................... 26
2.3.4. Bacterial dominants and high abundance of methanotrophs ..................................... 27
2.3.5. Bacterial community structure as a function of environmental gradients ................. 30
2.4. Discussion ......................................................................................................................... 32
2.4.1. Bacterial alpha-diversity ........................................................................................... 32
2.4.2. Bacterial dominants ................................................................................................... 34
2.4.3. Attached and free-living Bacteria.............................................................................. 36
2.4.4. Depth gradients and bacterial community composition ............................................ 36
2.4.5. Spatial variation and landscape gradients ................................................................. 37
2.5. Conclusions ....................................................................................................................... 38
2.6. Acknowledgements ........................................................................................................... 39
Chapitre 3. Diversity and activity of methanotrophs in low-oxygen permafrost thaw ponds ...... 40
Résumé .......................................................................................................................................... 40
Abstract ......................................................................................................................................... 41
3.1. Introduction ....................................................................................................................... 42
3.2. Materials and Methods ...................................................................................................... 44
3.2.1. Study site and sampling ............................................................................................. 44
3.2.2. Sampling and physico-chemical measurements ........................................................ 44
3.2.3. RNA sample preparation and sequencing ................................................................. 44
3.2.4. Sample processing for qPCR ..................................................................................... 45
3.2.5. Sequence processing and analysis¸ ............................................................................ 46
3.3. Results ............................................................................................................................... 47
3.3.1. Physico-chemical parameters .................................................................................... 47
3.3.2. Community arrangement and composition ............................................................... 48
3.3.3. Methanotrophic activity ............................................................................................ 50
3.4. Discussion ......................................................................................................................... 53
3.4.1. Physico-chemical parameters .................................................................................... 53
3.4.2. Community composition and arrangement ............................................................... 53
3.4.3. Methanotrophic activity ............................................................................................ 54
3.5. Acknowledgements ........................................................................................................... 57
Chapitre 4. Environmental selection of planktonic methanogens in permafrost thaw ponds ...... 58
Résumé .......................................................................................................................................... 58
Abstract ......................................................................................................................................... 59
4.1. Introduction ....................................................................................................................... 60
4.2. Results ............................................................................................................................... 62
4.2.1. Limnological conditions ............................................................................................ 62
4.2.2. Archaeal alpha-diversity ........................................................................................... 62
ix
4.2.3. Archaeal community dissimilarities and composition .............................................. 64
4.2.4. Methanogens inferred from the mcrA versus 16S rRNA analyses ............................ 66
4.2.5. Environmental variables and archaeal community clustering ................................... 67
4.3. Discussion ......................................................................................................................... 68
4.4. Methods ............................................................................................................................. 71
4.4.1. Study site and sampling ............................................................................................. 71
4.4.2. Physico-chemical and molecular analysis ................................................................. 72
4.4.3. Bioinformatic analysis ............................................................................................... 72
4.5. Acknowledgements ........................................................................................................... 74
Chapitre 5. Conclusion générale .................................................................................................. 75
5.1. Dominance des micro-organismes impliqués dans le cycle du méthane .......................... 75
5.2. Influence de l’origine des mares et du gradient de fonte du pergélisol ............................. 77
5.3. Influence des facteurs environnementaux ......................................................................... 78
5.4. Implication scientifique ..................................................................................................... 79
5.5. Perspectives ....................................................................................................................... 81
Bibliographie ..................................................................................................................................... 84
Annexes ........................................................................................................................................... 104
x
Liste des tableaux
Table 2-1. Limnological properties of the sampled thaw ponds: dissolved oxygen (DO),
conductivity (Cond), chlorophyll a (Chl a), dissolved organic carbon (DOC), total suspended solids
(TSS), soluble reactive phosphorus (SRP), and total nitrogen (TN). The surface samples correspond
to 0 m and bottom samples to the second depth for each pond. ........................................................ 21 Table 2-2. Sequencing and diversity statistics for samples grouped according to valley, depth or size
fraction. Values are means (n=3 to 14) with CV (SD as % mean) in parentheses. ........................... 26 Table 2-3. Identity of the 10 most abundant OTUs (defined at a level of 97% similarity) in each
valley following the SILVA taxonomy. Following a BLASTn search, nearest matches and the
providence of representative reads in GenBank were identified. Several groups appear multiple
times because different OTUs match the same group. See Figure 2-5B for their distribution. ........ 28 Table 3-1. Concentrations of pmoA transcripts oxygen and methane in the sampled thaw ponds. -:
no data. .............................................................................................................................................. 51 Table 4-1. Limnological properties of the bottom water (0.5 m above the sediment) for the sampled
thaw ponds. Temperature (T°C), dissolved oxygen (O2), dissolved organic carbon (DOC), total
suspended solids (TSS) and total phosphorus (TP). .......................................................................... 62 Table 4-2. Identity of the 5 most abundant OTUs (defined at a level of 97% similarity) for each
valley following the lowest taxonomic level of the SILVA modified database (Lovejoy et al., 2015).
The group Euryarchaeota, Miscellaneous Euryarchaeotic Group (MEG) and Thermoplasmatales
could not be further assigned. Percent (%) represents the proportion of those single OTUs in the
community for each valley. ............................................................................................................... 66
xi
Liste des figures
Figure 1-1. Distribution du pergélisol en Arctique. Les deux nuances de violet plus foncées
représentent le pergélisol de continu à discontinu tandis que les deux nuances de violet plus claires
le pergélisol de sporadique à isolé (Brown et al., 1997) ..................................................................... 3 Figure 1-2. Un exemple de paysage du pergélisol avec des mares de fonte, montrant la diversité des
couleurs (site BGR, Nunavik; image : CEN/ArcticNet) ..................................................................... 5 Figure 1-3. Processus microbiens tels que ayant lieu dans les mares de fontes du pergélisol. MOD
désigne la matière organique dissoute. ................................................................................................ 8 Figure 1-4. Schéma simplifié des processus de méthanogénèse et méthanotrophie. ........................ 10 Figure 2-1. Location of the three sampling valleys in Nunavik, subarctic Québec, Canada. ........... 20 Figure 2-2. Profiles of temperature (A), dissolved oxygen (B) and pH (C) as a function of the depth
for the 7 studied ponds. ..................................................................................................................... 25 Figure 2-3. Relative abundance of the different phyla. The samples were from the surface (-S) and
bottom (-B) of ponds in the three valleys. The small fraction (left) is for samples in the size range
0.2 to 3 µm, and the large fraction is for 3 to 20 µm. Phyla that were less than 1% of total
abundance are combined under “Other phyla”. ................................................................................. 27 Figure 2-4. Relative abundance of methanotrophic Bacteria. The samples were from the surface (-S)
and bottom (-B) of ponds in the three valleys. The small fraction (left) is for samples in the size
range 0.2 to 3 µm, and the large fraction is for 3 to 20 µm. The taxa are labelled according to the
highest taxonomical level; genera that represented less than 1% of total abundance were grouped
together and labelled by their shared order. ...................................................................................... 29 Figure 2-5. (A) Bray-Curtis dissimilarity cluster analysis with the community data matrix (OTUs
clustering at >97% of identity) for the study ponds. Surface samples are represented by triangles
and bottom samples by circles, either filled (small fraction) or open (large fraction). (B) The
bacterial dominants in each sample identified by their lowest taxonomical level either found on
GenBank or SILVA (see Table 2-3); the size of the filled circle is proportional to their relative
abundance. ......................................................................................................................................... 30 Figure 2-6. Distance-based redundancy analysis ordination plot showing selected environmental
variables that were significantly correlated with sample distribution. Abbreviations for the
environmental variables are given in Table 2-1. ............................................................................... 32 Figure 3-1. Principal component analysis of the environmental variables: temperature (T), dissolved
oxygen (O2), pH, total phosphorus (TP), total suspended solid (TSS), conductivity (Cond),
Chlorophyll a (Chla), total nitrogen (TN) and dissolved organic carbon (DOC) for the 9 sampled
ponds. Colors indicate the different valleys; surface samples are represented by a triangle and
bottom by a circle. ............................................................................................................................. 48 Figure 3-2. Bray-Curtis dissimilarity cluster analysis of the methanotrophic communities. Surface
samples are represented by triangles and bottom samples by circles, either filled (small fraction) or
open (large fraction). Heatmap shows the methanotrophic community composition. ...................... 49 Figure 3-3. Correlation plot of the PLS analysis to see influence of the environmental variables and
methanotrophic genera on the activity of methanotrophs. Chosen environmental variables were
conductivity (Cond), total phosphorus (TP), total suspended solid (TSS), Chlorophyll a (Chla),
soluble reactive phosphorus (SRP), total nitrogen (TN), carbon dioxide concentration (CO2),
methane concentration (CH4), dissolved organic carbon (DOC), oxygen concentration (O2),
temperature (T°C) and pH. ................................................................................................................ 52 Figure 3-4. Concentration of pmoA transcript as a function of methane concentration for bottom and
surface samples (left panel), and for bottom only (right panel). Shading represents ± 95%
confidence intervals. ......................................................................................................................... 52 Figure 4-1. Alpha-diversity measures for the three sampled valleys. Shannon diversity index and
Chao1 species richness index for the BGR, KWK and SAS valleys. The line in each box plot
xii
indicates the median, the box delimits the 25th and 75th percentile, and the whisker is the range.
Diversity indices for SAS valley differed significantly from the two other valleys (p=0.02 for the
Chao1 and p=0.01 for the Shannon index). ....................................................................................... 63 Figure 4-2. UniFrac clustering and composition of archaeal community. Upper dendrogram
representing the phylogenetic unweighted UniFrac distance of the archaeal community for the study
ponds. Filled or open diamond represent respectively small and large fraction. First letter of sample
name correspond to the valley name: S for SAS, K for KWK and B for BGR. The following number
or combination of letter and number indicate the name of the pond. Bubble plot show the relative
abundance of the different archaeal lineages with notably Miscellaneous Euryarchaeotic Group
(MEG), Miscellaneous Crenarcheotic Groups (MCG) and Deep Euryarcheotic Sea Group (DESG).
........................................................................................................................................................... 64 Figure 4-3. Comparison of the relative abundance of the methanogens in the mcrA community and
the 16S rRNA community. The left plot shows the entire methanogenic community and plot on the
right shows the groups representing less than 1% of the reads. The SAS sample is the large fraction
(3-20µm) of the SAS2B ponds and the KWK sample is the small fraction (0.2-3µm) of the KWK23
pond. .................................................................................................................................................. 67 Figure 4-4. Non metric multidimensional scaling (NMDS) of the community composition.
Phylogenetic Unifrac distances are overlaid with environmental variables; (a) dissolved organic
carbon, (b) total phosphorus and (c) pH. ........................................................................................... 68
xiii
Liste des abréviations et des sigles
16S : Petite sous unité ribosomique des bactéries et archées
ADN ou DNA : Acides désoxyribonucléiques ou Deoxyribonucleic acid
ADNc ou cDNA : ADN complémentaire ou complementary DNA
ANOVA : Analysis of variance
ARN ou RNA : Acides ribonucléiques ou Ribonucleic acid
ARNr ou rRNA : Acides ribonucléiques ribosomiques ou ribosomal RNA
BGR : Bundesanstalt für Geowissenschaften und Rohstoffe
BLAST : Basic local alignment search tool
BSA : Bovin serum albumin
CDOM : Coloured dissolved organic matter
CEN : Centre d’études nordiques
CH4 : Méthane
Chl a : Chlorophylle a
CHUL : Centre hospitalier de l'Université Laval
CO2 : Carbon dioxyde
Cond : Conductivity
dATPs : Deoxyadenosine triphosphate
dbRDA : Distance-based redundancy analysis
DMSO : Dimethylsulfoxide
dNTP : Deoxynucleotide triphosphate
DO : Dissolved oxygen
DOC : Carbone organique dissous ou dissolved organic carbon
DOM : Matière organique dissoute ou dissolved organic matter
DSEG : Deep Sea Euryarchaeotic Group
GES : Gaz à effet de serre
GF/F : Glass microfibre filter
H2 : Dihydrogen
H2S : Hydrogen sulfide
H2SO4 : Sulfuric acid
HMM : Hidden Markov Models
HSD : Honest significant difference
IBIS : Institut de Biologie Intégrative et des Systèmes
xiv
KWK : Rivière Kwakwatanikapistikw
LBA : Luria-Bertani agar
MCG : Miscellaneous Crenarchaeotic Group
mcrA : Sous-unité alpha de la méthyl coenzyme M reductase ou alpha subunit of the methyl-
coenzyme M reductase
MEG : Miscellaneous Euryarchaeotic Group
MES : Matière en suspension
mRNA : Messenger RNA
NAS : Rivière Nastapoka
NCBI : National Center for Biotechnology Information
NEB : New England Biolabs
NMDS : Non-metric multidimensional scaling
nt : Nucleotides
O2 : Oxygen
OTU : Operational taxonomic units
pb : Base pair (nucleotide)
PCA : Principal component analysis
PCR : Réaction en chaine par polymérase ou polymerase chain reaction
pH : Potentiel hydrogène
PLFA : Acides gras dérivés des phospholipides ou Phospholipid-derived fatty acids
PLS : Partial least squares
pMMO : Méthane mono-oxygénase soluble
pmoA : Sous-unité alpha de la méthane mono-oxygénase particulaire ou α subunit of the particulate
methane mono-oxygenase
PVP : Polyvinylpyrrolidone
QIIME : Quantitative insights into microbial ecology
qPCR : PCR quantitative
RDP : Ribosomal Database Project
SAS : Rivière Sasapimakwananisikw
SIP : Marquage par isotopes stable ou stable-isotope probing
sMMO : Méthane mono-oxygénase particulaire
SOC : Super Optimal broth with catabolite repression
SRP : Soluble reactive phosphorus
TN : Total nitrogen
xv
TP : Total phosphorus
TSS : Total suspended solid
UTO : Unité taxonomique opérationnelle
V6-V8 : Région hypervariable de l'ARN ribosomique 16S ou hypervariable region of 16S rRNA
gene
VIF : Variance inflation factors
xvi
À ma famille
xvii
Remerciements
Tout d’abord, je tiens à remercier chaleureusement mon directeur Warwick Vincent et ma
codirectrice de thèse Connie Lovejoy. Tout au long du parcours à embûches que constitue le
doctorat, ils m’ont toujours montré un soutien sans faille et aussi une confiance en mon travail qui
dépassait souvent la mienne. J’ai particulièrement apprécié la sagesse, la patience et la gentillesse
de Warwick, qui a toujours vu le côté positif dans toutes les situations, ainsi que le franc-parler,
l’humour et l’attention bienveillante de Connie. Merci à Steve Charette et Jean-Éric Tremblay pour
leurs commentaires très constructifs durant les réunions de comité. Merci aussi à Philippe Constant
d’avoir accepté de faire partie de mon jury. Ensuite je voudrais adresser un merci spécial à Jérôme
Comte, qui a été très présent et disponible tout au long de ma thèse. Ses critiques et conseils
toujours justes m’ont grandement aidée à bâtir une confiance en moi et une maturité scientifique.
Merci à Marianne Potvin pour son aide précieuse au laboratoire et la mise en place de protocoles
adaptés à mes échantillons. Ce doctorat n’aura pas été le même sans le temps passé avec tous les
formidables collègues des labos Vincent et Lovejoy. Dans chacun d’eux, j’ai trouvé des qualités qui
m’ont et continueront de m’inspirer pour devenir une meilleure scientifique. Merci à Paschale,
Bethany et Mary dont l’amitié représente beaucoup pour moi en plus des dîners partagés ensemble
et discussions motivantes. Enfin, j’ai eu la grande chance de partager un bureau avec deux
personnes remarquables : Nathalie et Deo, avec qui l’entraide, le soutien, les débats et discussions
stimulantes ont fait partie du quotidien. Une passion commune pour les soirées karaoké a contribué
à établir un lien fort entre nous dont je serai toujours nostalgique.
Un tout grand merci chargé d’affection à ma famille, Papa, Maman, Isa, Ol, Fred, Julie et
les petits bouts Manon et William pour leur soutien et amour inconditionnel. Merci à mes parents de
toujours me soutenir dans mes choix, même si ça implique le déchirement de vivre éloignés. Merci
à ma Maman et à Antoine d’avoir pris le temps de relire les parties de ma thèse en français. Merci à
ma grande sœur et mon grand frère d’avoir été de si bons modèles dans ma vie de m’avoir toujours
encouragé en plus de me donner de précieux conseils sur la vie universitaire.
Merci à tous mes amis de la Belgique au Canada. Sachez que tous les moments passés
ensemble à s’amuser et à refaire le monde sont autant d’encouragements qui m’ont aidée à
recharger mes batteries pour garder la motivation de continuer mon travail jusqu’au bout. Enfin, je
remercie Antoine de remplir chaque jour de ma vie avec de la joie et des rires. Si j’ai pu mener à
bien cette thèse comme je le voulais, c’est parce que j’ai toujours pu compter sur toi, sur tes conseils
et quoiqu’il arrive, tu as inlassablement continué à me soutenir et à croire en moi.
xviii
Avant-propos
Cette thèse de doctorat dans le programme de biologie est présentée en cinq parties
principales. Tout d’abord, une introduction explique le concept de mare de fonte du pergélisol et
l’importance des micro-organismes impliqués dans ces milieux aquatiques, en particulier dans le
cycle du méthane. Ensuite, les trois chapitres qui constituent le corps de la thèse sont des articles
scientifiques rédigés en anglais dans le but d’être publiés dans des revues scientifiques révisées par
des paires. Enfin, une conclusion générale résume et explore les implications des résultats obtenus
pour les trois articles scientifiques. Les échantillons traités dans cette thèse ont tous été récoltés
dans des mares de fonte du pergélisol dans la région subarctique du Québec dans le but de
caractériser les communautés microbiennes de ces systèmes. Un intérêt particulier a été porté aux
micro-organismes impliqués dans le cycle du méthane afin de mieux cerner leur diversité et activité.
Pour chaque chapitre de thèse, j’ai contribué à la conception et la planification de la problématique
ciblée avec l’aide de Warwick Vincent et de Connie Lovejoy, j’ai effectué la prise d’échantillons
sur le terrain avec l’aide de Warwick Vincent, de Jérôme Comte et d’Alex Matveev, j’ai procédé à
l’analyse en laboratoire et l’analyse bio-informatique avec l’aide de Jérôme Comte et de Connie
Lovejoy et enfin j’ai rédigé tous les chapitres de thèse en tenant compte des contributions des
coauteurs au niveau de l’apport de l’expertise scientifique, des corrections et commentaires. Les
détails des articles scientifiques destinés à la publication se trouvent ci-dessous :
Chapitre 2. Bacterial community structure across environmental gradients in permafrost thaw
ponds: methanotroph-rich ecosystems
Auteurs : Sophie Crevecoeur, Warwick F. Vincent, Jérôme Comte et Connie Lovejoy.
Publié le 18 mars 2015 dans Frontiers in Microbiology, 2015.
Chapitre 3. Diversity and activity of methanotrophs in low-oxygen permafrost thaw ponds
Auteurs : Sophie Crevecoeur, Warwick F. Vincent, Jérôme Comte, Alex Matveev et Connie
Lovejoy
En préparation, destiné à être soumis à un journal scientifique.
Chapitre 4. Environmental selection of planktonic methanogens in permafrost thaw ponds.
xix
Auteurs : Sophie Crevecoeur, Warwick F. Vincent et Connie Lovejoy
Soumis au journal Scientific Reports le 12 février 2016, présentement sous évaluation.
Les résultats de cette thèse ont également été présentés pendant plusieurs conférences
internationales telles que la rencontre "Joint Aquatic Science Meeting" qui inclut la rencontre
annuelle de l’"Association for the Sciences of Limnology and Oceanography" (ASLO), la rencontre
ArcticNet "Arctic Change" et la conférence Embo "Aquatic Microbial Ecology SAME 14". De plus,
des présentations orales ont été effectuées pour présenter les résultats de cette thèse dans plusieurs
colloques prenant place à l’Université Laval comme lors du 81e congrès de l’association
francophone pour le savoir (ACFAS), du colloque annuel de l’institut Hydro-Québec en
environnement, développement et société et du colloque du département de biologie. J’ai
personnellement conçu et présenté chacun de ces exposés oraux et et affiches dont les détails sont
donnés ci-dessous, en tenant compte de la contribution des coauteurs.
Crevecoeur, S., Vincent, W. F., Lovejoy, C. 2015. Methanotrophic Bacteria in permafrost thaw
ponds: potential for reduction of net methane emissions. Affiche présentée à la conférence Embo
“Aquatic Microbial Ecology SAME 14”, Uppsala, Suède.
Crevecoeur, S. 2015. Détection des méthanogènes et méthanotrophes dans les mares de fonte du
pergélisol. Présentation au colloque de biologie de l’Université Laval, Québec.
Crevecoeur, S. 2015. Biodiversité du Grand Nord en pleine mutation. Présentation au colloque
annuel de l’institut Hydro-Québec en environnement, développement et société, Université Laval,
Québec.
Crevecoeur, S., Vincent, W. F., Comte, J., Lovejoy, C. 2014. Molecular detection of methanogens
and methanotrophs in permafrost thaw ponds: implication for greenhouse gas emissions from
subarctic waters. Affiche présentée à la conférence ArcticNet “Arctic Change”, Ottawa.
Crevecoeur, S., Comte, J., Lovejoy, C., Vincent, W.F. 2014. RNA analysis of Bacteria in
permafrost thaw lakes: implications for greenhouse gas emission. Affiche présentée à la conférence
ASLO “Joint Aquatic Science Meeting”, Portland, Oregon, USA.
xx
Crevecoeur, S., Comte, J., Lovejoy, C., Vincent, W. F. 2013. Impact de la fonte du pergélisol dans
la région subarctique du Québec et micro-organismes impliqués. Présentation au 81e congrès de
l’association francophone pour le savoir (ACFAS) et symposium du centre d’étude nordique,
Université Laval, Québec.
1
Chapitre 1. Introduction
Le réchauffement climatique est devenu un des enjeux majeurs de notre époque en raison de
ses impacts et de son intensification. En effet, les émissions anthropogéniques de gaz à effet de
serre venant des combustibles fossiles n’ont cessé d’augmenter depuis les années 1900 (IPCC,
2013). Parmi les conséquences du réchauffement global, on note une accumulation de chaleur dans
les océans (Riser et al., 2016) et une augmentation anormale de la température des eaux profondes
(Purkey et Johnson, 2010; Meehl et al., 2011), une forte diminution du couvert de glace notamment
dans l’océan Arctique (Krishfield et al., 2014) et une fonte globale du pergélisol (Grosse et al.,
2016). Ces changements risquent de s’amplifier dans le futur car les modèles développés pour
l’instant prévoient des augmentations de température allant de 1 à 4°C d’ici 2100 (IPCC, 2013).
Les effets du réchauffement climatique sont en réalité plus intenses dans les régions
nordiques car même de faibles augmentations de température peuvent avoir un impact important sur
la fonte de la neige, de la glace et du pergélisol. En plus, une augmentation globale de la
température de 2°C, qui représente un scénario moyen, correspondrait à une augmentation
d’environ 8°C dans le Nord à cause notamment de différents effets de rétroaction positive comme la
réduction de l’albédo, l’augmentation de l’humidité dans l’air (IPCC, 2013) et la libération de gaz à
effet de serre provenant de la fonte du pergélisol (Vincent et al., 2013).
Ces effets présents et futurs ont attiré l’attention des scientifiques sur les lacs situés dans les
régions nordiques car ces derniers constituent une des caractéristiques majeures du paysage
(Grosse et al., 2013). Il y a de plus en plus d’évidences que ces lacs sont le théâtre d’activités
biogéochimiques intenses, en particulier en ce qui concerne le cycle du méthane, un gaz avec un
potentiel d’effet de serre environ 23 fois plus élevé que le dioxyde de carbone (Bastviken, 2009).
Les lacs et mares arctiques sont parmi les principales sources de libération de méthane dans
l’atmosphère (Wik et al., 2016). En effet, la fonte du pergélisol qui constitue le bassin versant des
lacs nordiques résulte en un plus fort apport de matières organiques qui augmente l’activité
microbienne à l’origine de la synthèse de gaz à effet de serre (Vincent et al., 2013). D’ici la fin du
21ème siècle, et en supposant une augmentation de la période libre de glace, on estime que les
émissions de gaz à effet de serre depuis les lacs et mares nordiques augmenteront de 20 à 54% (Wik
et al., 2016). Plus particulièrement, les mares qui sont formées par la fonte, l’érosion et
l’effondrement du pergélisol riche en glace (processus thermokarstique), représentent un type de
milieu aquatique très biogéochimiquement actif.
2
Cette thèse porte sur l'étude de la composition de la communauté microbienne dans les
mares de thermokarst (mares de fonte) en lien avec les processus biogéochimiques de
l'environnement, plus particulièrement les micro-organismes impliqués dans le cycle du méthane.
Ce chapitre d'introduction commence par la répartition du pergélisol en Arctique et explique les
différentes caractéristiques de mares de fonte. Ensuite, plus de détails sont donnés à propos du rôle
des micro-organismes dans les milieux aquatiques, que ce soit le recyclage de la matière organique
ou leur implication dans les cycles biogéochimiques. Enfin, l'introduction se termine avec
l'organisation de la thèse et la description des sites à l'étude. Cette recherche a eu lieu dans la zone
subarctique du Québec, où une forte augmentation du réchauffement a été observée depuis les vingt
dernières années, et où on constate des changements majeurs dans le paysage, incluant la
dégradation du pergélisol et l’expansion et l’augmentation du nombre de mares de thermokarst
(Bhiry et al., 2011).
1.1. Le pergélisol en Arctique
Le pergélisol, qui se définit comme un sol qui reste gelé (T°C ≤ 0) pendant au moins deux
années consécutives (Dobinski, 2011), recouvre un quart des terres de l’hémisphère nord (Brown et
al., 1998) (Figure 1-1). Le pergélisol contient aussi bien du sol riche en carbone comme de la tourbe
ou du sol riche en minéraux (Vonk et al., 2015). Le pergélisol peut être continu (90-100% du
territoire), discontinu (50-90%), sporadique (10-50%) ou isolé (2-10%) (Brown et al., 1998).
Au Canada, jusqu’à 50% du territoire contient du pergélisol (Smith et Riseborough, 2002).
Dans le nord du Québec (région du Nunavik), tous les types de pergélisol sont présents et suivent un
gradient, en partant du pergélisol continu au nord du 57e parallèle jusqu’au pergélisol sporadique
(défini comme moins de 2% du territoire par Allard et Seguin, 1987) au niveau du 54e parallèle
(Allard et Seguin, 1987). Cependant, avec l’intensification du réchauffement climatique, le
pergélisol est soumis à une fonte estivale plus intense et la limite Sud du pergélisol remonte vers le
Nord d’année en année (Halsey et al., 1995).
3
Figure 1-1. Distribution du pergélisol en Arctique. Les deux nuances de violet plus foncées représentent le
pergélisol de continu à discontinu tandis que les deux nuances de violet plus claires le pergélisol de sporadique à
isolé (Brown et al., 1997)
L’étude de l’impact de la fonte du pergélisol est un enjeu crucial puisque ce milieu
constitue une réserve de carbone globale. En effet, la quantité de carbone organique stockée dans le
pergélisol est pour l’instant deux fois supérieure à celle contenue dans l’atmosphère sous forme de
dioxyde de carbone (Tarnocai et al., 2009). La fonte du pergélisol entraînerait donc une
augmentation considérable de la concentration des gaz à effet de serre dans l’atmosphère avec
comme conséquence une intensification accablante des effets du réchauffement climatique.
1.2. Les mares de fonte du pergélisol
Durant l’été, on peut constater l’apparition de mares de fonte de pergélisol (aussi appelées
mares de thermokarst, voir Jansson et Taş, 2014). Au Canada, ces mares sont si nombreuses
qu’elles constituent le type d’écosystème aquatique le plus répandu dans ses régions arctiques et
subarctiques (Pienitz et al., 2008). En général, les mares de fonte rapetissent et/ou finissent par être
drainées peu de temps après leur formation à cause de l’évaporation et de la dégradation du
pergélisol (Smith et al. 2005; Riordan et al. 2006; Sannel et Kuhry 2011; Andresen et Lougheed
2015). Cependant, la région subarctique du Québec fait exception, car les mares de fonte persistent
d’une année à l’autre (Smith et al., 2005). Ce phénomène s’explique par la présence de limon
imperméable dans le sol, ancien bassin de la mer de Tyrrell présente il y a 8000 ans (Bhiry et al.,
2011).
4
1.2.1. Formation
Dans les régions Arctiques où le pergélisol est continu, les mares de fonte se développent
dans le centre de polygones et des ruisseaux se forment dans les coins de glace (Breton et al. 2009).
Dans les régions subarctiques par contre, les mares sont issues de buttes de pergélisol (Calmels et
al. 2008). Ces buttes sont appelées palses ou lithalses selon la composition de leur sol,
respectivement à dominance organique ou minérale (Bhiry et Robert 2006; Calmels et al. 2008). De
manière générale, les palses sont plus abondantes dans le pergélisol discontinu que les lithalses car
les conditions climatiques propices à la formation de lithalses sont beaucoup plus restreintes par
rapport aux palses. En effet, des conditions plus froides sont requises pour la formation de lithalses
contrairement aux palses. Dans le nord du Québec, les conditions plus froides le long de la baie
d’Hudson sont propices à la formation de lithalses alors que les conditions plus chaudes à l’intérieur
des terres sont plus propices à la formation de palses, si bien que la majorité des zones de pergélisol
discontinu dans le nord du Québec est dominée par des palses (Pissart 2000; Pissart 2002).
1.2.2. Caractéristiques limnologiques
Dans le nord du Québec, le gradient de fonte du pergélisol influence les caractéristiques du
paysage, la géomorphologie des mares (Bouchard et al., 2014) et crée un gradient de concentration
de la quantité de carbone allochtone contenue dans les mares. En effet, certaines mares de fonte sont
entourées de pergélisol complètement dégradé alors que pour d’autres, environ 50% du pergélisol
environnant est encore gelé. Ce phénomène crée une variation géographique des propriétés
limnologiques des mares le long du gradient de fonte du pergélisol.
À l’échelle d’une vallée, des mares situées à quelques mètres les unes des autres présentent
une grande variabilité de couleurs, reflétant leur diversité limnologique (Figure 1-2). L’étude de
Watanabe et al. (2011) a montré que ces variations étaient dues en majeure partie au rapport entre
les concentrations de carbone organique dissous, qui vient du pergélisol, et de matière en
suspension, qui vient du sol environnant souvent riche en argile et limon, c’est-à-dire des particules
en suspension qui ne sont pas d’origine algale. En outre, la concentration en nutriments et en
chlorophylle a peut être très variable d’une mare à l’autre (Rossi et al. 2013). En général, les mares
de fonte contiennent des concentrations élevées en nutriments allant de 6.2 à 91 µg L-1 pour le
phosphore ce qui correspond aux statuts mésotrophes et eutrophes (Brown et Simpson, 2001). Par
contre, les données de chlorophylle indiquent souvent une faible productivité primaire à cause du
contenu élevé en matière en suspension (MES) qui cause une grande turbidité et diminue donc
l’efficacité de la photosynthèse. Néanmoins, l’abondance du bactérioplancton est assez élevée pour
correspondre à des données propres aux lacs eutrophes (Breton et al., 2009; Laurion et al., 2010).
5
Figure 1-2. Un exemple de paysage du pergélisol avec des mares de fonte, montrant la diversité des couleurs (site
BGR, Nunavik; image : CEN/ArcticNet)
Enfin, durant l’été, les MES absorbent les rayons du soleil ce qui réchauffe la couche
supérieure de la colonne d’eau (épilimnion), créant une stratification thermique qui laisse la couche
d’eau de fond (hypolimnion) plus froide. Même si les mares sont très peu profondes (entre 1 et 3
mètres de profondeur), la stratification reste très stable durant l’été et il n’y a pas de mélange entre
l’épilimnion et l’hypolimnion (Laurion et al., 2010). Le brassage de la colonne d’eau a seulement
lieu au printemps et à l’automne. Ces périodes de brassage peuvent même parfois être incomplètes
et laisser l’hypolimnion isolé des couches d’eaux supérieures (Laurion et al. 2010; Deshpande et al.
2015). Cette forte stratification crée un gradient physico-chimique pendant l’été, car l’hypolimnion
devient hypoxique à anoxique dû à la respiration bactérienne qui consomme presque tout l’oxygène
présent dans la colonne d’eau et aucun brassage ne vient oxygéner l’hypolimnion isolé de
l’atmosphère. Ce gradient physico-chimique a des conséquences pour les formes de vie au sein de la
mare, car il crée des conditions propices au métabolisme anaérobie.
En résumé, les mares de fonte dans la région subarctique du Québec constituent un
environnement hautement variable à différents niveaux, ce qui, d’un point de vue biologique, en fait
6
un système de choix pour étudier la biogéographie ou l’effet d’un gradient physico-chimique sur la
composition des communautés planctoniques.
1.2.3. Implication dans les émissions de gaz à effet de serre
Depuis quelques années, l’attention des scientifiques pour les écosystèmes de mare de fonte
s’est accrue en raison de leur contribution aux émissions de gaz à effet de serre (GES). En effet, le
carbone resté prisonnier dans le sol pendant plusieurs centaines d’années devient alors disponible,
avec la fonte, pour la reminéralisation microbienne. Les émanations de GES depuis les mares de
fonte ne sont habituellement pas incluses dans les bilans globaux de budget de carbone puisque leur
petite taille les rend invisibles aux outils de télédétection (Tranvik et al., 2009). Pourtant, leur
contribution au cycle du carbone est considérable, surtout en ce qui concerne le méthane (Walter et
al., 2007; Sepulveda-Jauregui et al., 2015) qui a environ 23 fois plus de potentiel en terme d’effet de
serre que le dioxyde de carbone (Bastviken, 2009). Une estimation récente évalue la contribution
des lacs et mares nordiques (au-delà du 50e parallèle) à environ 16 Tg de méthane par année (Wik et
al., 2016). Avec l’effet de l’accélération de la fonte du pergélisol, cette contribution peut augmenter
considérablement. En effet, une étude de Walter et al. (2007) a estimé que la fonte totale du
pergélisol sibérien entraînerait l’émission de 49 000 Tg de méthane dans l’atmosphère. Les
émissions de GES depuis les mares de fonte constituent donc une rétroaction positive au
réchauffement climatique (Walter et al. 2006).
Les mares de fonte dans la région subarctique du Québec ont des taux d’émission de GES
très variables (Laurion et al., 2010). De manière générale, le dioxyde de carbone et le méthane
s’accumulent dans le fond des mares avec des concentrations respectivement 8 à 16 fois et 2 à 125
fois plus élevées dans l’hypolimnion qu’à la surface (Breton et al. 2009). Le méthane peut
s’échapper dans l’atmosphère par diffusion ou ébullition. Dans les mares de fonte situées en Alaska
et en Sibérie, le processus d’ébullition est dominant pour le relargage de méthane dans l’atmosphère
(Walter et al., 2008) et le flux diffusif ne représente que 6% des émissions de méthane de mares de
fonte situées en Sibérie (Walter et al., 2006; Par contre, dans les mares de fonte située dans le nord
du Québec, le méthane est émis principalement par diffusion (Matveev et al., 2016).Enfin, le
mélange saisonnier permet la libération d’une grande partie du méthane accumulé dans
l’hypolimnion (Bastviken, 2009).
1.3. Les micro-organismes dans les milieux aquatiques
Les micro-organismes dans les milieux aquatiques sont à la base des processus
biogéochimiques de l’environnement. Dans cette thèse, la diversité des bactéries et des archées a été
7
étudiée. Ces deux domaines de la vie, malgré leur morphologie similaire, sont phylogénétiquement
et physiologiquement distincts (Woese, 1996). Bien que l’écologie bactérienne soit connue depuis
des siècles, les archées ont seulement été classifiées comme un domaine à part entière en 1990
(Woese et al. 1990). À cette époque, la connaissance de leur écologie se limitait aux
environnements extrêmes. Cependant, les travaux de Delong (1998) notamment ont montré
l’existence d’archées non extrémophiles. Il est maintenant reconnu que les archées sont présentes
dans une grande variété d’environnements (Auguet et al., 2010) mais restent néanmoins plus
difficiles à étudier en raison de leur faible abondance, comme c’est le cas dans les milieux
aquatiques (Sievert et al., 2000; Chan et al., 2005).
1.3.1. Processus microbiens
Un des rôles majeurs du plancton microbien dans les écosystèmes d’eau douce est le
recyclage de la matière organique dissoute. Ce procédé est appelé « boucle microbienne », terme
utilisé pour la première fois par Azam et Graf (1983) pour caractériser le rôle des microbes dans
l’océan. Ce terme est maintenant largement utilisé pour les milieux d’eau douce également. Le
principe de ce processus microbien est que les microbes planctoniques (bactéries et archées)
consomment la matière organique dissoute autochtone (excrétion par le phytoplancton ou produit de
la lyse virale) ainsi que la matière organique allochtone venant du bassin versant (figure 1-3). Au
lieu de sédimenter, cette matière organique se trouve ainsi réintroduite dans la chaîne trophique par
le biais du broutage des bactéries par les eucaryotes microbiens hétérotrophes ou mixotrophes. Les
microbes ont donc un rôle prépondérant dans le recyclage de la matière organique dans les milieux
aquatiques (Cotner et Biddanda, 2002; Fenchel, 2008). Les produits finaux de dégradation de la
matière organique amènent à la formation de dioxyde de carbone dans des eaux oxiques, mais
peuvent également mener à la synthèse de méthane en milieu anoxique.
8
Figure 1-3. Processus microbiens tels que ayant lieu dans les mares de fontes du pergélisol. MOD désigne la
matière organique dissoute.
1.3.2. Micro-organismes impliqués dans le cycle du méthane
Environ 75% du méthane contenu dans l’atmosphère est d’origine biogénique (Chen et
Prinn, 2005). Dans l’est de l’Arctique canadien, le méthane peut être d’origine moderne ou vieux de
jusqu’à 4500 ans (Bouchard et al., 2015). Avec la fonte du pergélisol, une partie du méthane ancien
resté prisonnier dans le sol gelé peut s’échapper dans l’atmosphère, tandis qu'une autre partie du
méthane est moderne et nouvellement synthétisé par les archées méthanogènes, stimulées par la
disponibilité en substrat venant de la fonte du sol. Les archées méthanogènes utilisent les substrats
issus de la dégradation anaérobie de la matière organique comme l’acétate, les groupements
méthyle, l’hydrogène et le dioxyde de carbone (Bapteste et al., 2005) pour synthétiser du méthane
en milieu strictement anoxique (Thauer et al., 2008). L’utilisation de ces différents substrats
détermine chez les archées l’utilisation de différentes voies métaboliques. En effet, les archées
méthanogènes peuvent être acétotrophiques, méthylotrophiques ou hydrogénotrophiques selon les
substrats qu’elles utilisent pour procéder à la méthanogenèse. On distingue sept ordres d’archées
méthanogènes (Borrel et al., 2013) appartenant à deux lignées phylogénétiquement distinctes qui
disposent d’un ancêtre commun, mais dont les descendants ne sont pas tous méthanogéniques
(Bapteste et al., 2005). Cette distinction phylogénétique n’est pas liée à une différence de
métabolisme, car tous les ordres de méthanogènes sont capables de procéder à la méthanogenèse
hydrogénotrophique, mais seulement un ordre est capable d’utiliser les trois voies métaboliques
(Bapteste et al., 2005).
9
En général, les archées méthanogènes peuvent être retrouvées dans différents types
d’environnements, entre autres, les rizières (Wu et al., 2009), les tourbières (Yavitt et al., 2011), le
pergélisol de la toundra (Barbier et al., 2012) ainsi que le pergélisol discontinu (Liebner et al.,
2015). Dans les écosystèmes d’eau douce, les méthanogènes sont plus souvent associés avec les
sédiments (Briée et al., 2007; Ye et al., 2009), comme c’est le cas pour les mares de fonte de l’est
de l’Arctique canadien (Negandhi et al., 2013). La présence d’archées méthanogènes dans la
colonne d’eau est moins sûre étant donnée la présence plus probable d’oxygène. Cependant, dû à la
forte stratification et l’établissement d’un gradient physico-chimique, l’hypolimnion des mares de
fonte peut disposer de conditions propices à la méthanogenèse en plus de fournir un apport riche en
substrat venant de la fonte du sol (Laurion et al., 2010).
Une grande partie des flux diffusif de méthane vers l’atmosphère peut être oxydée par des
bactéries méthanotrophes en entrant dans la couche oxique de la colonne d’eau. Ces bactéries ont la
capacité d’utiliser le méthane comme seule source de carbone et d’énergie (Hanson et Hanson
1996). Les bactéries méthanotrophes sont historiquement connues comme appartenant aux branches
alpha et gamma des protéobactéries (Bowman, 2006). Plus récemment, des nouveaux types de
méthanotrophes ont été découverts, comme ceux appartenant au phylum des Verrucomicrobia qui
ont la particularité de croître dans des conditions très acides (Dunfield et al., 2007) ou le phylum
NC10 capable de coupler l’oxydation de méthane avec la dénitrification (Ettwig et al., 2009), se
dispensant de ce fait du besoin d’oxygène comme accepteur d’électrons. Comme les méthanogènes,
les méthanotrophes ne constituent donc pas un groupe monophylétique et l’apparition de ce trait
semble s’être produite plusieurs fois au cours de l’histoire évolutive des bactéries.
Dans les lacs, les bactéries méthanotrophes peuvent consommer entre 30 et 99% du
méthane (Bastviken et al., 2008). Par exemple, dans un lac boréal en Finlande, les méthanotrophes
consommeraient 80% du méthane produit annuellement, qui se diffuse depuis les sédiments dans la
colonne d’eau (Kankaala et al., 2006). Les méthanotrophes ont donc un rôle très important dans la
régulation du climat en réduisant une forte proportion du méthane qui pourrait être émis dans
l’atmosphère.
En résumé, l’équilibre entre l’activité des méthanogènes et des méthanotrophes détermine le
bilan de carbone global et la quantité de méthane émise dans l’atmosphère. Cependant, des
conditions très différentes sont requises pour la réalisation de l’un ou l’autre processus. Alors que
l’oxygène inhibe la méthanogenèse (Bastviken, 2009), il est nécessaire à la méthanotrophie (Hanson
et Hanson, 1996). Les mares de fonte ont la particularité de disposer d’environnements anoxiques et
10
oxiques au sein de la même colonne d’eau, les rendant particulièrement propices au développement
des micro-organismes impliqués dans les processus de synthèse et de consommation du méthane
(Figure 1-4).
Figure 1-4. Schéma simplifié des processus de méthanogénèse et méthanotrophie.
1.3.3. Approches pour étudier les micro-organismes
Depuis les 25 dernières années, le domaine de l’écologie microbienne a été révolutionné par
le développement des techniques moléculaires (Dorigo et al., 2005; Pedrós-Alió, 2006). La
première forme de technique de séquençage a été introduite par Sanger et al. (1977) et permet
d’obtenir jusqu’à 1000 séquences d’un échantillon donné. Plus récemment, les techniques de
séquençage à haut débit ont permis d’augmenter considérablement le nombre de séquences par
échantillon. Par exemple, le pyroséquençage 454 permet d’obtenir de 1x105 à 1x106 séquences par
cycle et le séquençage illumina de 7x106 à 6x109 (Shokralla et al., 2012). Ces techniques passent
par la réalisation d’une PCR, ce qui peut occasionner des biais, mais nécessite aussi de cibler des
gènes à amplifier pour répondre aux questions écologiques. Le gène le plus fréquemment utilisé
pour étudier la diversité des bactéries et des archées est le gène 16S de l’ARN ribosomique (ARNr
16S) qui offre des résultats précis pour l’identification de la diversité microbienne avec les
techniques de séquençage à haut débit (Liu et al., 2007). Cette approche, qui est adéquate pour
étudier la diversité taxonomique des micro-organismes, ne suffit néanmoins pas pour évaluer leur
diversité fonctionnelle. Pour se faire, il est nécessaire d’amplifier des gènes fonctionnels qui
permettent de répondre à des questions concernant l’activité des micro-organismes. L’étude des
gènes fonctionnels permet de relier la diversité microbienne associée aux processus
biogéochimiques de l’environnement (Zak et al., 2006).
11
En ce qui concerne le cycle du méthane, plusieurs gènes ont été étudiés en lien avec les
processus de synthèse et de consommation du méthane, ce qui facilite l’étude moléculaire des
micro-organismes impliqués dans ce cycle. Au niveau du processus de synthèse, la méthyle
coenzyme réductase catalyse l’étape finale de la formation du méthane (Ellermann et al., 1988) et le
gène qui code pour cette enzyme (mcrA) est donc utilisé comme proxy pour étudier les archées
méthanogènes (Luton et al., 2002). En ce qui concerne l’oxydation du méthane, l’enzyme méthane
monooxygénase impliquée dans la première étape de cette réaction existe sous deux différentes
formes : une enzyme particulaire (pMMO), qui est présente chez presque tous les méthanotrophes,
et une enzyme soluble (sMMO) qui est seulement présente chez certains types de méthanotrophes
(Murrell et al., 1998; Kolb et al., 2003). Le gène qui code pour la sous-unité alpha de la pMMO
(pmoA) est plus particulièrement utilisé comme proxy pour étudier les bactéries méthanotrophes
(Kolb et al., 2003). Cependant, à cause du caractère fortement paraphylétique de la méthanotrophie,
il est impossible de disposer d’une séquence d’amorce permettant d’amplifier tous les types de
pmoA (Sharp et al., 2012). La diversité des méthanotrophes au sein d’une même étude est donc
souvent limitée à l’un ou l’autre groupe phylogénétique pour des raisons logistiques. Ces deux
gènes marqueurs ont l’avantage de présenter une phylogénie cohérente avec celle obtenue grâce au
gène 16S.
Au niveau moléculaire, il est possible de cibler l’ADN ou l’ARN du 16S et des gènes
fonctionnels. Le choix d’utiliser une des deux ou les deux molécules dépend de la question de
recherche. Que ce soit pour le 16S ou pour les gènes fonctionnels, le choix d’utiliser l’ADN permet
d’étudier la composition de la communauté et la diversité des bactéries, des archées ou d’un groupe
fonctionnel particulier. L’ADN permet de détecter non seulement les cellules vivantes, mais aussi
les cellules mortes ainsi que des molécules libres d’ADN qui peuvent rester intactes dans des
conditions froides ou anoxiques (voir Charvet et al., 2012). L’ARN permet aussi d’étudier la
composition de la communauté et la diversité des micro-organismes, mais reflète par contre une
communauté potentiellement active (Blazewicz et al., 2013), car les gènes sont à l’état de transcrits
(Paul, 2001). L’étude de l’ARN requiert l’exécution d’une étape supplémentaire en laboratoire de
transformation de l’ARN en ADN complémentaire (ADNc). En ce qui concerne les gènes
fonctionnels, l’amplification de transcrits fournit une indication plus précise sur la présence de
cellules métaboliquement actives (Juottonen et al., 2008). Bien que les techniques de séquençage
évoquées au début de ce paragraphe permettent d’identifier une large portion de la communauté
microbienne, ces approches restent semi-quantitatives. Pour mesurer le nombre de gènes ou de
transcrits dans un échantillon, il faut procéder à une PCR quantitative (qPCR). Dans le cas de cette
12
thèse, la qPCR sur les transcrits de gènes fonctionnels a été utilisée comme technique pour évaluer
quantitativement l’activité des groupes impliqués dans le cycle du méthane (Tuomivirta et al., 2009;
Wilkins et al., 2015).
1.4. Organisation de la thèse
L’objectif général de cette thèse est de comprendre quels sont les facteurs qui influencent la
composition de la communauté microbienne dans les mares de fonte de pergélisol ainsi que de
connaître l’identité des micro-organismes impliqués dans le cycle du méthane. Les trois prochains
chapitres, qui correspondent à des articles scientifiques, se concentrent sur la réalisation de ces
objectifs.
1.4.1. Objectifs et hypothèses des chapitres de thèse
Chapitre 2 (article 1): "Bacterial community structure across environmental gradients in
permafrost thaw ponds: methanotroph-rich ecosystems".
La forte stratification estivale crée un gradient de conditions physico-chimiques à travers la
colonne d’eau des mares de fonte qui influence le métabolisme des micro-organismes et peut
donner lieu à une séparation des communautés bactériennes. De plus, le gradient de fonte et de
dégradation du pergélisol influence la quantité de matière organique allochtone présente dans les
mares, ce qui a aussi un impact sur la composition de la communauté. L’objectif de ce chapitre est
donc de comprendre les facteurs qui influencent la répartition de la communauté bactérienne et
d’identifier plus particulièrement les bactéries méthanotrophes. Plus précisément les hypothèses
suivantes ont été posées : (1) la communauté bactérienne qui se développe dans l’eau de surface des
mares de fonte est différente de la communauté présente dans l’eau de fond à cause du fort gradient
physico-chimique au sein de la colonne d’eau. (2) La composition de la communauté bactérienne
varie en fonction du gradient de fonte et de dégradation du pergélisol. (3) Étant donné les fortes
concentrations en méthane dans l’eau des mares de fonte, les bactéries méthanotrophes représentent
en forte proportion de la communauté bactérienne.
Chapitre 3 (article 2): "Unexpected diversity and activity of methanotrophs in low-oxygen
permafrost thaw ponds".
Le chapitre 3 a permis d’identifier une forte abondance de bactéries méthanotrophes à la
surface et dans le fond des mares de fonte, mais les techniques utilisées dans le chapitre précédent
ne permettent pas de savoir si ces bactéries participent activement à l’oxydation du méthane. Ce
13
chapitre-ci se concentre donc sur l’étude de la diversité fonctionnelle et l’activité des
méthanotrophes pour mieux comprendre leur implication dans le cycle du méthane. L’objectif de ce
chapitre est donc d’étudier la diversité fonctionnelle et l’activité des méthanotrophes ainsi que les
facteurs qui les influencent comme l’origine de la mare ou le gradient de fonte du pergélisol. Ce
chapitre se base sur les trois hypothèses suivantes : (1) la composition de la communauté des
bactéries méthanotrophes dans les mares de fonte est déterminée par l’origine de la mare (fonte
d’une palse ou lithalse) ainsi que par leur localisation au sein du gradient de fonte du pergélisol. (2)
L’activité des méthanotrophes dépend de la composition de la communauté et est régulée par la
disponibilité en oxygène au sein de la colonne d’eau. (3) Les bactéries méthanotrophes ont le
potentiel de réduire les émissions nettes de méthane dans l’atmosphère.
Chapitre 4 (article 3): "Environmental selection of planktonic methanogens in permafrost
thaw ponds".
Après avoir évalué la diversité et l’activité des méthanotrophes dans les chapitres
précédents, ce chapitre se concentre sur les archées méthanogènes. Dans les écosystèmes lacustres,
les conditions propices aux archées méthanogènes, c’est-à-dire l’absence d’oxygène, sont plus
souvent retrouvées dans les sédiments que dans la colonne d’eau. Cependant, dans le cas des mares
de fonte, l’eau du fond de la mare peut devenir hypoxique voir anoxique ce qui crée des conditions
favorables pour la méthanogenèse. De plus, la fonte du pergélisol fournit un apport de substrat qui
peut stimuler l’activité des méthanogènes. Ce chapitre a pour but d’étudier la diversité des
méthanogènes planctoniques ainsi que les facteurs qui l’influencent comme l’origine de la mare ou
le gradient de fonte du pergélisol. Plus particulièrement ce chapitre se base sur trois hypothèses : (1)
l’eau de fond des mares de fonte constitue un habitat favorable pour les archées méthanogènes. (2)
La composition de la communauté des archées dans les mares de fonte dépend de l’origine de la
mare (fonte d’une palse ou d’une lithalse) et de leur localisation à travers le gradient de fonte du
pergélisol. (3) Les mares issues de palses, qui sont plus riches en carbone, favorisent le
développement d’une communauté d’archées plus diverse comparée aux mares issues de lithalse.
1.4.2. Sites d’études
Pour atteindre les objectifs et tester les hypothèses posées dans cette thèse, des mares de
fonte situées dans quatre vallées différentes ont été échantillonnées. Ces vallées sont situées dans la
région subarctique du Québec (Nunavik) à travers un gradient de fonte du pergélisol. Les deux
vallées les plus au nord, se situent près du village inuit d’Umiujaq alors que les deux vallées les plus
14
au sud se trouvent près du village Kuujjuarapik où se côtoient les communautés Cris et Inuits.
Plusieurs mares ont été échantillonnées dans chaque vallée en août 2012 et 2013.
1.4.2.1. Vallée de la rivière Kwakwatanikapistikw (KWK)
La vallée KWK se trouve à 12 km à l’est du village de Kuujjuarapik dans une zone de
pergélisol sporadique (Bhiry et al., 2011). Dans cette vallée, la fonte des lithalses a donné lieu à la
formation de mares de fonte qui recouvrent plus de la moitié de la surface du sol, témoignant de
l’état avancé de dégradation du pergélisol (Bhiry et Robert, 2006).
1.4.2.2. Vallée de la rivière Sasapimakwananisikw (SAS)
La vallée SAS se trouve aussi dans la zone de pergélisol sporadique, à 8 km au sud de
Kuujjuarapik. Cette vallée abrite une tourbière ombrotrophe, c’est-à-dire que l’eau qui l’alimente ne
vient que des précipitations et est donc souvent acide et pauvre et nutriments. Dans cette vallée, le
pergélisol est très dégradé et l’effondrement de palses donne naissance aux mares de fonte (Arlen-
Pouliot et Bhiry, 2005).
1.4.2.3. Vallée “Bundesanstalt für Geowissenschaften und Rohstoffe” (BGR)
La vallée BGR se situe plus au nord à environ 20 km à l’est d’Umiujaq, dans une zone de
pergélisol discontinu et répandu, c’est-à-dire que plus de 50% du territoire est composé de
pergélisol. Cette vallée est recouverte de limon marin postglaciaire et de tourbe, par conséquent les
mares y sont issues de palses et de lithalses (Calmels et Allard, 2004; Calmels et al., 2008). Dans le
cadre de cette étude et pour des raisons logistiques, seules les mares issues de lithalses ont été
échantillonnées dans cette vallée.
1.4.2.4. Vallée de la rivière Nastapoka (NAS)
La vallée NAS représente la vallée la plus au nord échantillonnée pour cette thèse. Elle se
situe dans une zone de pergélisol discontinu et répandu à environ 30 km au nord d’Umiujaq. Les
mares de fonte dans cette vallée ont encore été très peu étudiées. Les mares échantillonnées dans la
vallée NAS dans le cadre de cette étude proviennent de la fonte de lithalses (Seguin et Allard,
1984).
15
Chapitre 2. Bacterial community structure across
environmental gradients in permafrost thaw ponds:
methanotroph-rich ecosystems1
Résumé
La fonte du pergélisol mène à la formation de mares de thermokarst qui émettent
potentiellement du CO2 et du CH4 dans l’atmosphère. Dans la région subarctique du Nunavik (Nord
du Québec, Canada), ces nombreuses mares peu profondes deviennent fortement stratifiées pendant
l’été. Cela crée un gradient physico-chimique de température et d’oxygène, avec une couche d’eau
de surface oxique et une couche d’eau de fond pauvre en oxygène ou anoxique. Notre objectif était
de déterminer l’influence de la stratification ainsi que des propriétés limnologiques et du paysage
sur la structure des communautés bactériennes potentiellement actives dans ces eaux. Les
échantillons pour l’analyse ARN ont été pris dans des mares situées dans trois vallées différentes à
travers un gradient de fonte du pergélisol. Un total de 1296 unités taxonomiques opérationnelles a
été identifié par séquençage d’amplicons à haut débit, ciblant l’ARNs 16S bactérien, préalablement
retrotranscrit en ADNc. Les betaproteobactéries étaient le groupe dominant dans toutes les mares,
avec la plus forte représentation par les genres Variovorax et Polynucleobacter. Les
méthanotrophes étaient aussi parmi les séquences les plus abondantes pour la plupart des sites. Ils
comptaient même pour 27% du total des séquences (médiane de 4.9% pour tous les échantillons),
indiquant l’importance du méthane comme source d’énergie bactérienne dans ces eaux. Des
phototrophes oxygéniques (Cyanobactéries) et anoxygéniques (Chlorobi) étaient aussi fortement
représentés, ces derniers dans les eaux de fond pauvres en oxygène. Des analyses d’ordination ont
montré que les communautés se regroupaient en fonction des vallées et de la profondeur, avec un
effet significatif attribué à l’oxygène, au pH, au carbone organique dissous et aux matières en
suspension. Ces résultats indiquent que les assemblages bactériens dans les mares de fonte du
pergélisol sont filtrés par les gradients environnementaux, et représentent des associations
complexes de taxons fonctionnellement divers qui ont de grandes chances d’affecter la composition
ainsi que la magnitude des émissions de gaz à effet de serre depuis ces abondants plans d’eaux.
1 Citation : Crevecoeur S, Vincent WF, Comte J and Lovejoy C (2015). Bacterial community structure across
environmental gradients in permafrost thaw ponds: methanotroph-rich ecosystems. Front. Microbiol. 6:192.
doi: 10.3389/fmicb.2015.00192
16
Abstract
Permafrost thawing leads to the formation of thermokarst ponds that potentially emit CO2
and CH4 to the atmosphere. In the Nunavik subarctic region (northern Québec, Canada), these
numerous, shallow ponds become well-stratified during summer. This creates a physico-chemical
gradient of temperature and oxygen, with an upper oxic layer and a bottom low oxygen or anoxic
layer. Our objective was to determine the influence of stratification and related limnological and
landscape properties on the community structure of potentially active Bacteria in these waters.
Samples for RNA analysis were taken from ponds in three contrasting valleys across a gradient of
permafrost degradation. A total of 1296 operational taxonomic units were identified by high
throughput amplicon sequencing, targeting bacterial 16S rRNA that was reverse transcribed to
cDNA. Βetaproteobacteria were the dominant group in all ponds, with highest representation by the
genera Variovorax and Polynucleobacter. Methanotrophs were also among the most abundant
sequences at most sites. They accounted for up to 27% of the total sequences (median of 4.9% for
all samples), indicating the importance of methane as a bacterial energy source in these waters.
Both oxygenic (cyanobacteria) and anoxygenic (Chlorobi) phototrophs were also well-represented,
the latter in the low oxygen bottom waters. Ordination analyses showed that the communities
clustered according to valley and depth, with significant effects attributed to dissolved oxygen, pH,
dissolved organic carbon, and total suspended solids. These results indicate that the bacterial
assemblages of permafrost thaw ponds are filtered by environmental gradients, and are complex
consortia of functionally diverse taxa that likely affect the composition as well as magnitude of
greenhouse gas emissions from these abundant waters.
17
2.1. Introduction
One of the impacts of ongoing climate change is the northward migration of the limit of
permafrost soils in subarctic landscapes, and this is leading to changes in the distribution and
abundance of lakes and ponds caused by permafrost thawing and erosion (Vincent et al., 2013b).
These so called thaw ponds (thermokarst lakes and ponds) represent the most widespread aquatic
ecosystem type in the circumpolar Arctic and Subarctic (Pienitz et al., 2008; Koch et al., 2014). In
some northern regions of the Arctic, thaw lakes are disappearing as a result of evaporation and
drainage (Smith et al., 2005), whereas in some southern locations such as subarctic Québec,
Canada, permafrost lakes are expanding in size and numbers through increased permafrost thawing
and erosion (Payette, 2004). Thaw lakes show cycles of expansion, erosion, drainage and
reformation (van Huissteden et al., 2011) that will likely accelerate under warmer climate
conditions (Vincent et al., 2013b).
Thawing permafrost has global implications for carbon biogeochemical cycling, since
carbon that has been sequestered for thousands of years becomes available for microbial
degradation (Tranvik et al., 2009), resulting in the production of greenhouse gases, especially
carbon dioxide and methane. Despite this potential, greenhouse gas emissions from northern lakes
and thaw ponds are often ignored in regional and global carbon budgets. These open waters
potentially represent a source of around 24 Tg of methane emission per year (Walter et al., 2007).
Methane is primarily produced by a few archaeal clades under anoxic conditions (Sower, 2009),
although methanogenesis has also been observed in oxic water columns (Grossart et al., 2011;
Bogard et al., 2014). This biologically generated methane is available to aerobic methanotrophic
Bacteria that occur in the oxic zone or at oxic/anoxic boundaries (Borrel et al., 2011), and this
methane oxidation activity may regulate net greenhouse gas emissions (Trotsenko and Khmelenina,
2005; Bodelier et al., 2013). For example, methanotrophy consumed up to 80% of the methane
produced in a boreal Finnish lake (Kankaala et al., 2006). Thaw ponds can be either sources of
greenhouse gas emissions (Walter et al., 2007; Laurion et al., 2010; Negandhi et al., 2013), or sinks
for carbon sedimentation and storage (Walter et al., 2014), but reasons for these differences are
poorly understood. Conditions that favor methanotrophy will have the net effect of decreasing
methane release to the atmosphere, however little is known about such processes in the abundant
lakes and ponds on degrading permafrost landscapes.
Bacterial communities vary among lakes as a result of differences in physico-chemical and
biological properties such as pH (Lindström et al., 2005), productivity and dissolved organic carbon
(DOC) availability (Lindström and Leskinen, 2002; Yannarell and Triplett, 2004). For this reason
18
even neighboring lakes in the same region may differ in their bacterial community structure
(Casamayor et al., 2000; Gucht et al., 2001). In addition, catchment and underlying soil properties
vary, resulting in differences in the quantity and composition of organic matter entering lakes,
which in turn may affect their bacterial communities (Judd et al., 2006; Kritzberg et al., 2006).
Bacterial community composition in lakes also changes with depth (Shade et al., 2008; Garcia et al.,
2013), especially in meromictic lakes where temperature, salinity and oxygen gradients select for
distinct communities down the water column (Hollibaugh et al., 2001; Comeau et al., 2012).
Notably, a clone library study by Rossi et al. (2013) found distinct bacterial communities in surface
and bottom waters of thaw ponds in Northern Québec.
Arctic and sub-arctic ponds occur across a range of conditions that could select for
particular bacterial taxa. For example, in Northern Quebec varied combinations of dissolved
organic matter and suspended particles result in striking differences in the optical properties of
neighboring thaw ponds (Watanabe et al., 2011) and characteristic bacterial communities could be
associated with the particular optical properties of individual ponds. The extent and stage of
thawing of the surrounding permafrost could also potentially affect bacterial community structure;
some thaw ponds occur in highly degraded permafrost while others are surrounded by more than
50% of intact permafrost. These different stages of permafrost thaw influence the landscape
characteristics (e.g. vegetation cover, open water extent) and the geomorphology of the ponds
(Bouchard et al., 2014), creating a gradient in concentrations of allochthonous dissolved organic
matter (DOM). With thawing more pronounced at the southern limits of permafrost,
bacterioplankton in these regions would have greater access to this external supply of organic
matter. Since microbial communities control biogeochemical processes such as methane balance,
understanding factors that influence bacterial community composition is central for predicting net
greenhouse gas emissions from the thawing landscape. Clone library analysis of four Northern
Quebec ponds reported the presence of methanotrophs (Rossi et al., 2013), but little is known about
how communities might vary over a range of permafrost conditions.
In addition, bacterial alpha-diversity (number of taxa per lake) could be influenced by local
conditions such as depth, light availability, and pond productivity. For example, diversity is
expected to be lower where low oxygen and light conditions select for a few specialist taxa (Shade
et al., 2008). Lower primary productivity has also been linked with a lower diversity (Cardinale et
al., 2006; Ptacnik et al., 2008), and light and nutrient limitation would therefore influence diversity.
On a landscape scale, the diversity of animals and plants decreases at higher latitudes (Rahbek,
1995; Falge et al., 2002). However Fierer and Jackson (2006), found that for soil microbes alpha-
19
diversity is independent of latitude but more related to soil properties, for example pH. If this were
the case for thaw ponds then inherent properties of the landscape could also influence the alpha-
diversity.
The goal of the present study was to investigate the diversity and distribution of potentially
active bacterial communities in subarctic thaw ponds across a gradient of limnological conditions
and permafrost, from discontinuous permafrost in the North to sporadic permafrost in the South. We
applied high throughput sequencing, targeting the V6-V8 hypervariable region of 16S rRNA. The
use of this hypervariable region enabled us to identify community assemblages in three
geographically separate valleys that differed in their underlying stage of permafrost degradation.
Specifically we tested the hypotheses that: (1) different bacterial communities develop at the
surface and bottom of each thaw pond because of the strong physico-chemical gradient through the
water column; (2) bacterial community composition varies across the gradient of permafrost
thawing and degradation; and (3) given the known high concentrations of methane in these waters
(Laurion et al., 2010), methanotrophic Bacteria are well represented in thaw pond bacterial
assemblages.
2.2. Materials and methods
2.2.1. Study sites and sampling
Samples were collected from 1 to 13 of August 2012 from three different subarctic valleys
(Figure 2-1), which were chosen to represent a gradient of thawing permafrost. Ponds from these
valleys have been investigated since 2006 and nomenclature follows that of earlier studies (Calmels
et al., 2008; Breton et al., 2009; Laurion et al., 2010).
20
Figure 2-1. Location of the three sampling valleys in Nunavik, subarctic Québec, Canada.
The ponds were designated with a three letter prefix and a unique number or number letter
combination. The KWK (55°16’N, 77°46’W) and SAS (55°13’N; 77°42’W) ponds are in two
separate river valleys close to the village of Whapmagoostui-Kuujjuarapik in the sporadic
permafrost zone, while the BGR ponds (56°37′N; 76°13′W) are in the Sheldrake River valley close
to the village of Umiujaq, Québec, in the discontinuous permafrost region. The ponds have formed
in thawing permafrost mounds that are primarily organic (peat) or mineral; the term palsa refers to
organic mounds and lithalsa to mineral mounds (Gurney, 2001; Calmels et al., 2008). KWK and
BGR ponds originated from the thawing of lithalsas and SAS ponds from palsas. BGR and KWK
ponds are surrounded by shrubs (Salix planifolia and Betula glandulosa) and sparse trees (Picea
mariana, Picea glauca, Larix laricina) (Calmels et al., 2008; Breton et al., 2009). The SAS valley
vegetation, in contrast, is dominated by Carex and Sphagnum (Arlen-Pouliot and Bhiry, 2005;
Bhiry et al., 2011). Two ponds were selected from the BGR valley (1 and 2), three from the KWK
valley (1, 6 and 23) and 2 from the SAS valley (1B and 2A) (Table 2-1). Ponds were sampled from
an inflatable boat held near the center of the ponds using ropes tethered to the shore. Temperature,
21
conductivity, dissolved oxygen and pH profiles were taken using a 600R multiparametric probe
(Yellow Spring Instrument). Surface water samples were collected directly into submerged acid and
sample rinsed 4-L Cubitainers and near-bottom samples were collected using a horizontally
mounted Van Dorn bottle (Wilco) and immediately transferred to 4-L Cubitainers. Care was taken
to overfill the Cubitainers when sampling the bottom water and all the Cubitainers were capped to
minimize exchange with the atmosphere. The filled Cubitainers were then transported back to the
laboratory by helicopter and processed within 2 h.
Table 2-1. Limnological properties of the sampled thaw ponds: dissolved oxygen (DO), conductivity (Cond),
chlorophyll a (Chl a), dissolved organic carbon (DOC), total suspended solids (TSS), soluble reactive phosphorus
(SRP), and total nitrogen (TN). The surface samples correspond to 0 m and bottom samples to the second depth for
each pond.
2.2.2. Physico-chemical analysis
Water samples for dissolved organic carbon (DOC), soluble reactive phosphorus (SRP),
major ion analysis were filtered through a MilliQ™ water pre-rinsed 47-mm diameter 0.22-µm pore
size acetate filters (Whatman). DOC concentrations were analysed using a Shimadzu TOC-5000A
carbon analyzer calibrated with potassium biphthalate. Three blank filters of Milli-Q water passed
through the filters were also analysed along with the samples and these small background values
were subtracted. Water samples for total phosphorus (TP) and total nitrogen (TN) were preserved
with H2SO4 (0.15% final concentration) and analysed using standard methods (Stainton et al., 1977)
Pond Depth (m)
DO (mg
L-1)
DO
(%satu-
ration)
pH Cond (µS
cm-1)
Chl
a (µg
L-1)
DOC (mg
L-1)
TSS (mg
L-1)
SRP (µg
L-1)
TN (mg
L-1)
SAS1B 0
1
6.37
1.54
63
15
6.0
5.63
93
212
4.9
2.9
15.5
16.2
27
33
2.7
3
0.9
1.8
SAS2A 0
2.4
5.75
0.26
64
2
6.2
5.58
97
300
1.7
18.1
14.9
18.9
2.6
16
3.1
4.1
0.7
1.6
KWK1 0
1.8
9.69
0.50
101
4.2
6.66
6.22
63
150
10.9
10.3
12
12
26
141
3.7
12.6
0.6
1.0
KWK6 0
3
9.94
1.82
97
17
6.36
6.35
82
112
3.3
27.1
5.2
5.2
8.2
16
1.3
1
0.4
0.7
KWK23 0
3.2
9.8
0.36
97
2.7
6.44
6.09
29
259
1.9
7.2
7.8
10.9
8.3
74
5.5
133.6
0.4
2.7
BGR1 0
3.2
10.0
4.06
101
37
7.38
7.56
168
190
0.9
1.1
3.5
3.3
2.4
3.8
2.4
2.2
0.2
0.4
BGR2 0
1
9.43
3.47
94
34
7.31
7.17
209
387
2.4
3.8
9.3
8.7
13
57
3.4
4.5
0.4
1.2
22
at Institut National de la Recherche Scientifique (Quebec City, QC, Canada). Total suspended solids
were collected by filtration onto preweighed 47 mm GF/F filters (Whatman) that had been
precombusted at 500°C for 4 h. The GF/F filters were then oven dried for 2 h at 60°C and
reweighed. Samples for chlorophyll a (Chl a) were filtered onto a GF/F 25 mm filters (Whatman)
and stored at -80°C. Chl-a concentrations were determined using high performance liquid
chromatography (ProStar HPLC system, Varian, Palo Alto, CA, USA) following the protocol of
Bonilla et al., (2005).
2.2.3. RNA collection and extraction
Water samples were first prefiltered through a 20-µm mesh to remove larger organisms and
then filtered sequentially through a 3-µm pore size, 47-mm diameter polycarbonate filter (DHI lab
product) and a 0.2 µm Sterivex unit (Millipore) with a peristaltic pump. From 100 to 600 mL of
water were filtered and the filtration was stopped after 2 hours to minimize RNA degradation. The
size fractionation was employed to distinguish between particle-attached Bacteria on the 3-µm filter
and free living Bacteria on the 0.2-µm filter (Crump et al., 1999; Galand et al., 2008; Mohit et al.,
2014). Both filters were preserved in RNAlater (Life Technologies) and the filters were stored at
-80°C until processed. The PowerWater Sterivex DNA Isolation Kit was used for extracting the
RNA from the Sterivex units for the BGR1, KWK6 surface, KWK23 surface and SAS1B surface.
The large fraction for the same samples was extracted using the PowerWater DNA Isolation kit
(MoBio). Protocols were adapted for RNA analysis by adding 1% to 2% (final concentration) of
beta-mercaptoethanol as a preliminary step. The extraction column was loaded with 50% ethanol
(final concentration) to fix the RNA to the column. RNase-free water was used for the final elution
step. The co-extracted DNA was then digested with the RTS DNase Kit (MoBio). Following
problems with potential polyphenol contamination in some samples, the remaining samples were
extracted with the AllPrep DNA/RNA Mini Kit (Qiagen). This protocol was modified by the
addition of cross-linked polyvinylpyrrolidone (PVP, Alfa Aesar) to a final concentration of 10%
before loading the samples onto the lysate homogenization column. Prior to use, the PVP was
sterilized with UV light and was then added as a reagent to remove potential contaminating organic
matter (humic acids and polyphenols). For all samples, the extracted RNA was converted to cDNA
immediately with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems-
Ambion). The concentrations and quality of cDNA were checked on a 1% agarose gel; cDNA was
not detected from the large fractions of KWK23 and the two SAS ponds, and these samples were
therefore not further processed. All cDNA was stored at -80°C until analysis.
23
2.2.4. High throughput multiplex tag sequencing
The V6-V8 region of the bacterial 16S rRNA that had been converted to cDNA was
amplified using the 454 primers as described in Comeau et al. (2011). PCR was carried out in a total
volume of 20 µL, the mixture contained HF buffer 1X (NEB), 0.25 µM of each primer, 200 µM of
each dNTPs (Life Technology), 0.4 mg mL-1 BSA (NEB), 1 U of Phusion High-Fidelity DNA
polymerase (NEB) and 1 µL of template cDNA. Two more reactions with 5X and 10X diluted
template were also carried out for each sample, to minimize potential primer bias. Thermal cycling
began with an initial denaturation at 98°C for 30 s, followed by 25 cycles of denaturation at 95°C
for 10 s, annealing at 50°C for 30 s, extension at 72°C for 30 s and a final extension at 72°C for 420
s. The three dilution reactions were pooled and purified with a magnetic bead kit Agencourt
AMPure XP (Beckman Coulter) and then quantified spectrophotometrically with the Nanodrop
1000 (Thermo Fisher Scientific). The amplicons were sequenced on two 1/8 plates of the Roche 454
GS-FLX using the “PLUS” chemistry at the IBIS/Laval University, plate-forme d’analyses
Génomiques (Québec, QC). Raw 454 sequences have been deposited in the NCBI database under
accession number SRP050189.
2.2.5. Sequence processing and statistics
Sequences were analysed using the UPARSE pipeline (Edgar, 2013). For quality filtering,
the sequences were truncated at 340 and 300 bp for the first and second 1/8 plate runs to keep 75%
of the reads at the 0.5 expected error rate. Singletons as well as chimeras were then removed and
operational taxonomic units (OTUs) were determined at the ≥97% similarity level. Taxonomic
assignment of these OTUs was performed using the Mothur classifier (Schloss et al., 2009) with a
0.8 confidence threshold based on the SILVA reference database (Pruesse et al., 2007) modified to
include sequences from our in-house, curated northern 16S rRNA gene sequence database.
Shannon, Simpson and Chao1 diversity indexes were estimated for each sample using Quantitative
Insights Into Microbial Ecology (QIIME) pipeline (Caporaso et al., 2010) by creating multiple
rarefaction statistics. Species richness and evenness were estimated with Shannon and Simpson
indexes while the Chao1 index provides an estimate of true richness (Colwell, 2012). Three-way
analysis of variance (three-way ANOVA) was used to assess differences in the diversity indices
between valleys, fractions and depths. As the Simpson index is a proportion, the data were arcsin
transformed to achieve normality. An a posteriori Tukey HSD test was run to identify differences
between valleys.
Beta-diversity analysis was used as a means of comparing ponds; for this analysis the
dataset was re-sampled to ensure the same number of reads per sample (3071), which corresponded
24
to the sample with the fewest number of sequences. beta-diversity was derived using the command
multiple_rarefaction_even_depth.py in QIIME. The rarefaction curve for OTUs reached a plateau
between 2000 and 4000 reads, indicating that our selection of 3071 reads provided a reasonable
representation of the community.
Downstream statistical analyses were performed in R (version 3.0.1) using the package
Vegan (Oksanen et al., 2013). The community data matrix was square root transformed before
running the statistical analyses. Beta-diversity was assessed by the use of Bray-Curtis dissimilarity
to estimate compositional difference among sampling sites. Distance-based redundancy analysis
(dbRDA) was performed to test and identify the influence of environmental variables on the
composition matrix. For the latter analysis, explanatory variables were selected via a forward
selection and highly correlated variables were removed from the analysis to ensure that collinearity
would not reduce analysis quality. The variance inflation factors (VIF) were calculated for each
variable and none of the coefficients exceeded the value of 5, we note that multicollinearity should
be examined when the VIF exceeds 10 (Borcard et al., 2011). Compositional differences among
valleys, depths and fraction were tested with permutation tests (999 permutations) on the Bray-
Curtis metric using the function Adonis in the Vegan package (Oksanen et al., 2013).
We defined ‘bacterial dominants’ as the ten most abundant OTUs from each valley. Each
OTU was submitted to a separate BLASTn search in NCBI GenBank
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) to identify the nearest match. In some cases a single OTU
corresponded to two separate genera. We constructed a reference tree using longer sequences from
clone libraries (S. Crevecoeur, unpublished data) and GenBank to resolve these uncertainties. The
short reads were mapped onto the reference tree using the ParInsert command available in QIIME.
In many cases, several different OTUs had matches to a single genus.
2.3. Results
2.3.1. Limnological conditions
Temperatures decreased down the water column, with markedly colder bottom waters in all
of ponds (Figure 2-2A). The surface waters were well oxygenated except for the SAS sites, which
had only 5 to 6 mg L-1 of dissolved oxygen (DO) at the surface (Table 2-1, Figure 2-2B). DO
concentrations fell to lower values with depth (Figure 2-2B). Ponds were hypoxic (<2 mg L-1) at the
near-bottom sampling depths, with the exception of the bottom of the BGR ponds where dissolved
oxygen levels were around 3-4 mg L-1 (Table 2-1). There was a pH gradient across the three valleys:
25
the SAS valley ponds were the most acidic with pH values from 5.3 to 6.2, while those in the KWK
valley ranged from 6.0 to 6.7 and in the valley from 7.1 to 7.5. In all ponds, pH decreased slightly
with the depth (Figure 2-2C). The other measured limnological variables also showed large
differences between valleys, ponds and depths (Table 2-1). Conductivity was higher in the bottom
waters, by up to an order of magnitude in KWK23. DOC concentrations varied from <4 mg L-1 in
the blue-green colored surface waters of BGR1 to >15 mg L-1 in the black SAS ponds. The total
suspended solids varied by up to an order of magnitude, even among ponds from the same valley;
(for example, SAS1B versus SAS2A and BGR1 versus BGR2), and concentrations increased with
depth in all ponds. The indicators of trophic state (Chl a, SRP and TN) were mostly in the
oligotrophic to mesotrophic range, with higher values near the bottom of some the ponds, notably
KWK23 (SRP and TN), and SAS2A and KWK6 (Chl a).
Figure 2-2. Profiles of temperature (A), dissolved oxygen (B) and pH (C) as a function of the depth for the 7 studied
ponds.
2.3.2. Bacterial alpha-diversity
The sequencing statistics for individual ponds are given in Annex 1. For the overall study,
112,479 sequences (reads) were obtained, yielding a total of 1296 OTUs (excluding singletons,
defined as OTUs that only occurred once in the entire data set). Three-way ANOVA for the
different sample groupings (Table 2-2) showed that there was no significant difference in alpha-
diversity as estimated by either the Shannon or Simpson indices between depths, size fractions or
valleys. However, the Chao1 index showed significant differences between valleys (p=0.018) and
fraction (p=0.004), and a significant interaction between valleys and depth (p=0.01). The mean
26
species richness of the KWK ponds was 32 % higher than in the BGR ponds, and the Tukey HSD
test showed that the significant difference between valleys was only between KWK and BGR
(p=0.015). The mean Chao1 index for the large fraction was 22% greater than for the small fraction
(Table 2-2).
Table 2-2. Sequencing and diversity statistics for samples grouped according to valley, depth or size fraction.
Values are means (n=3 to 14) with CV (SD as % mean) in parentheses.
Sample group OTUsa Shannona Simpsona Chao1a
SAS 183 (11)
4.35 (13) 0.88 (4) 210 (8)
KWK 211 (27) 5.09 (10) 0.91 (8) 224 (23)
BGR 156 (39) 4.58 (16) 0.89 (6) 170 (38)
Surface 176 (26) 4.98 (14) 0.92 (5) 194 (25)
Bottom 196 (34) 4.56 (13) 0.87 (7) 210 (31)
Small 169 (34) 4.66 (14) 0.90 (7) 187 (30)
Large 216 (21) 4.96 (13) 0.92 (7) 229 (22) aCalculated with an OTU definition of 97% similarity.
2.3.3. Bacterial beta-diversity and community composition
All ponds were dominated by Proteobacteria followed by Bacteroidetes, Verrucomicrobia,
and Actinobacteria (Figure 2-3). The maximum Proteobacteria representation (80% of reads) was in
the SAS2A surface community. Within the Proteobacteria, Betaproteobacteria was the dominant
class, except at the bottom of KWK23 where Gammaproteobacteria dominated. Chlorobi dominated
the bottom of KWK1 and SAS2A. Gemmatimonas, Lentisphaerae and Spirochaetes were found in
low abundance (about 1% of the community) within the KWK valley. There was little difference
between the small and large fractions, with the exception of the BGR1 bottom community that had
a high proportion (25% of reads) of cyanobacteria in the large fraction only.
27
Figure 2-3. Relative abundance of the different phyla. The samples were from the surface (-S) and bottom (-B) of
ponds in the three valleys. The small fraction (left) is for samples in the size range 0.2 to 3 µm, and the large
fraction is for 3 to 20 µm. Phyla that were less than 1% of total abundance are combined under “Other phyla”.
2.3.4. Bacterial dominants and high abundance of methanotrophs
A total of 21 separate taxa were found in the top ten OTUs from each valley (Table 2-3),
which accounted for 38% of the total number of reads. The two most abundant OTUs corresponded
to two Betaproteobacteria, Variovorax and Polynucleobacter. These two taxa were in all samples,
and accounted for up to 30% of the community reads in each sample. Another OTU in the family
Puniceicoccaceae (Verrucomicrobia) was more abundant at the BGR valley and represented up to
40% of the reads in the surface large fraction of BGR2. One OTU of Pelodictyon (Chlorobiaceae)
represented up to 50% of the bottom community reads for KWK1 and another OTU of Pelodictyon
was the most abundant taxon in the bottom of SAS2A.
28
Table 2-3. Identity of the 10 most abundant OTUs (defined at a level of 97% similarity) in each valley following the
SILVA taxonomy. Following a BLASTn search, nearest matches and the providence of representative reads in
GenBank were identified. Several groups appear multiple times because different OTUs match the same group.
See Figure 2-5B for their distribution.
Number of
reads
Silva taxonomy %
Identity
Isolation
source
Accession
number
Genbank
taxonomy
7461 Comamonadaceae 100 Wheat
phyllosphere
KF054966 Variovorax soli
6253 Polynucleobacter 100 Lake Grosse
Fuchskuhle
KC702668 Polynucleobacter
5757 Puniceicoccaceae 100 Yellowstone
Lake
HM856500 Opitutae
3748 Pelodictyon 99 Lake
chemocline
AM086645 Pelodictyon
clathratiforme
2454 Methylobacter 99 Thaw pond
hypolimnion
JN656724 uncultured gamma
proteobacterium
1881 Rhodoferax 100 Soil GQ421098 uncultured
Rhodoferax
1539 Rubrivivax 99 Foodplain FM886868 Rubrivivax
gelatinosus
1317
Comamonadaceae 99 Waterfall KM035968 Curvibacter
1275 ACK-M1 100 Irrigation
water
JX657295 uncultured
actinobacterium
1260 Nostocaceae 99 Eutrophic
pond
FN691914 Dolichospermum
curvum
1256 Sediminibacterium 99 Yellowstone
Lake
HM856392 uncultured
Sediminibacterium
1250 Sediminibacterium 100 Lake
epilimnion
HQ532649 uncultured
Bacteroidetes
1137 Pelodictyon 97 Lake
chemocline
AM086645 Pelodictyon
clathratiforme
1085 Limnohabitans 99 Daphnia
Digestive
tract
HM561466 uncultured
Limnohabitans
1003 Sediminibacterium 99 Yellowstone
Lake
HM856387 uncultured
Sediminibacterium
947 Methylotenera 99 Biodeteriora-
ted wood
KC172609 uncultured
Methylophilaceae
761 Chitinophagaceae 99 Lake
epilimnion
HQ532140 uncultured
Bacteroidetes
739 Synechococcales 99 Meromictic
lake
AB610891 Synechococcus
637 Methylobacter
100 Thaw pond
hypolimnion
JN656784 uncultured gamma
proteobacterium
477 Methylococcaceae 96 Landfill
cover soil
HF565143 Methylobacter
450 Polaromonas 99 stems KF385223 uncultured
Polaromonas
29
Finer taxonomic analysis revealed the presence of methanotrophic bacterial groups at all sites
(Figure 2-4), with 0.1 to 27% of OTUs matching Methylobacter (5% on average per site). Other
methanotrophic Bacteria belonging to the family Methylococcales (Methylocaldum, Methylomonas,
Crenothrix, or unknown Methylococcales) were found in all ponds, although sometimes in low
proportions (<1%). An exception was in the bottom waters of SAS1B where methanotrophs
accounted for 23% of the sequences, more than half of which were in the Methylococcales.
Sequences corresponding to a newly discovered order of methanotrophic Bacteria,
Methylacidiphilales (Verrucomicrobia), were found at the KWK and SAS valleys, in smaller
proportions compared to other methanotrophs; for example, 1-6% of the total reads in the KWK6
surface samples. Amongst the dominant OTUs, methanotroph sequences were relatively abundant
in most samples (Figures 2-4, 2-5), with a median representation of 4.9% of total reads per sample,
and a maximum of 25% for one single Methylobacter OTUs in the KWK23 bottom community
reads. Another OTU corresponding also to Methylobacter was present at the BGR valley along with
the OTU belonging to the order Methylococcaceae.
Figure 2-4. Relative abundance of methanotrophic Bacteria. The samples were from the surface (-S) and bottom (-
B) of ponds in the three valleys. The small fraction (left) is for samples in the size range 0.2 to 3 µm, and the large
fraction is for 3 to 20 µm. The taxa are labelled according to the highest taxonomical level; genera that represented
less than 1% of total abundance were grouped together and labelled by their shared order.
30
Figure 2-5. (A) Bray-Curtis dissimilarity cluster analysis with the community data matrix (OTUs clustering at
>97% of identity) for the study ponds. Surface samples are represented by triangles and bottom samples by circles,
either filled (small fraction) or open (large fraction). (B) The bacterial dominants in each sample identified by their
lowest taxonomical level either found on GenBank or SILVA (see Table 2-3); the size of the filled circle is
proportional to their relative abundance.
Some of the most abundant OTUs matching genera Rhodoferax, Rubrivivax,
Limnohabitans, Curvibacter, the Actinobacteria ACK-M1, the three Sediminibacterium OTUs and
the methylotrophic genus Methylotenera were distributed evenly across samples. The filamentous
cyanobacterium Dolichospermum was highly abundant only in the surface of KWK1 and KWK6
where it contributed 20% of the community. Finally, OTUs matching Synechococcus, Polaromonas
and a taxon in the Chitinophagaceae (Bacteroidetes) were more abundant in samples from the BGR
and KWK valleys (Figure 2-5B).
2.3.5. Bacterial community structure as a function of environmental gradients
Community structure mostly followed a regional pattern as ponds from the same valley
clustered together in the Bray-Curtis dissimilarity dendrogram (Figure 2-5). There were some
31
exceptions, with the bottom of KWK1 and 23 clustering closer to the SAS sites and apart from the
other KWK samples. Within the BGR cluster, surface and bottom communities clustered separately
while the two depths clustered together at the SAS sites. In terms of community composition, with
the exception of the more aerobic BGR waters, the bottom communities were strikingly different
from those at the surface because of the presence of anoxygenic phototrophs, specifically
Chloroflexi and Chlorobi. Small and large fractions from the same sample always clustered
together. A permutation test was used to test for differences between valleys, depth and size fraction
and indicated significant differences in community composition according to valley (p=0.001) and
depth (p=0.009) as well as a significant interaction between valleys and depth (p=0.011), indicating
that the difference between surface and bottom communities depended on valley location. Pairwise
comparison indicated that amongst the significant differences between sites, communities in the
KWK valley were significantly different from those in the BGR and SAS valleys (p=0.001 and
p=0.015) but BGR and SAS were not significantly different. Permutation tests were carried out to
compare surface versus bottom communities, and all four dominant phyla (Proteobacteria,
Bacteroidetes, Verrucomicrobia and Actinobacteria) showed significant differences between depths
(p<0.05). There were no significant differences between fractions (p=0.5).
The dbRDA ordination (Figure 2-6) explained 64% of the variation and confirmed the
regional pattern. The first horizontal axis was significantly correlated with pH, DO, TSS and DOC
while the vertical axis was significantly correlated with chl a and conductivity. KWK samples were
more dispersed compared to the SAS and BGR samples. The distribution of the BGR sites was
mostly explained by the higher pH in this valley. The BGR sites and all of the surface KWK
samples were separated from the other samples including bottom layers from KWK ponds and
appeared associated with the higher concentrations of dissolved oxygen, while the bottom of KWK1
and 23, the SAS sites and the bottom of KWK6 were at the low end of the oxygen gradient. The
SAS valley was differentiated by its higher DOC, and the bottom samples from KWK1 and
KWK23 by their higher concentrations of TSS and SRP. The surface of the KWK sites and KWK6
bottom were characterised by lower conductivity and higher chl a.
32
Figure 2-6. Distance-based redundancy analysis ordination plot showing selected environmental variables that
were significantly correlated with sample distribution. Abbreviations for the environmental variables are given in
Table 2-1.
2.4. Discussion
2.4.1. Bacterial alpha-diversity
The subarctic thaw ponds at all sites were thermally stratified, consistent with previous
observations in summer (Laurion et al., 2010). There were large vertical gradients in chemical
properties, with a surface oxic layer (epilimnion) overlying low oxygen bottom waters
(hypolimnion). These gradients provided a wide range of potential bacterial habitats within a single
pond. The ponds contained diverse bacterial assemblages, with the number of OTUs (99-307 per
sample) overlapping that reported for much deeper, stratified water bodies. For example, 280-425
OTUs were reported from a meromictic lake in the High Arctic using the same primers for tag
pyrosequencing the 16S rRNA gene (Comeau et al., 2012), and 67-223 OTUs were reported for
thermally stratified German lakes (Garcia et al., 2013). The Shannon and Simpson diversity indices
in the thaw ponds were greater than those reported form German lakes, which were all less than 4.1
33
for the Shannon index and 0.36 for the Simpson index (Garcia et al., 2013). However, the
taxonomic richness of these thaw pond communities was much lower than that in soils. For
example, 4781-6231 OTUs were reported in 10 g samples of German grassland soils (Will et al.,
2010) and 1496-1857 OTUs in the same quantity of High Arctic soil crusts (Steven et al., 2013;
singletons excluded). Previous studies have documented this large disparity between lakes and soils
(Lozupone and Knight, 2007; Tamames et al., 2010), suggesting fundamental difference in
microhabitats in the highly structured matrix of soils relative to aqueous planktonic environments.
Given the large potential input of soil particles and their associated Bacteria from permafrost
degradation, higher levels of diversity and species richness might have been expected in these
waters. However the total number of OTUs (1296) for our entire study including all 22 samples was
17% of that observed in the High Arctic soil crust study (7432), and within the range for other
aquatic ecosystems.
The Shannon and Simpson diversity indices showed that all samples were equally diverse,
with no significant differences among valleys, depths or size fractions. Steven et al. (2013) similarly
observed in their soil crust analyses of 6 sites in the High Arctic that differences in diversity indices
among sites were small relative to comparisons with other systems, including Antarctic soils. It
would be of great interest to compare bacterial diversity in these northern thaw ponds with the
shallow ponds of Antarctica, but to our knowledge such data are lacking. The significant difference
of Chao 1 index between KWK and BGR valleys indicated that species richness was higher at the
lower latitude site. Species richness values for the surface waters were the same order of magnitude
for the three valleys, however there was a significant interaction of species richness between sites
and depth with species richness of bottom water increasing from BGR to KWK and SAS. This also
corresponds to a gradient in DOC, with highest concentrations in the SAS ponds, and may reflect
differences in bacterial productivity.
RNA vs DNA templates have been used to distinguish between active and inactive cells
(Jones and Lennon, 2010) and to assess potential growth rates (Campbell and Kirchman, 2013). 16S
rRNA is thought to provide an estimate of ‘potentially active Bacteria’ (Blazewicz et al., 2013),
which would be a subset of the community represented in the environmental DNA. The latter may
include dead cells, spores and even free DNA that remains intact in the dark, cold, polar
environment (e.g., Charvet et al., 2012). For this reason it is thought that the use of DNA can lead to
overestimation of diversity, while rRNA may provide a more conservative and accurate estimation
of diversity.
34
2.4.2. Bacterial dominants
For the overall data set, the dominant phylum was Proteobacteria and Betaproteobacteria
the dominant Class, as in many freshwater ecosystems (Newton et al., 2011). Two genera within
that Class were particularly abundant, each on average representing around 10% of the total number
of reads: Polynucleobacter and Variovorax. Both have attributes that make them well-suited to the
heterogeneous combination of allochthonous (terrestrial) and autochthonous (aquatic) organic
carbon compounds that are likely to occur in these waters. Polynucleobacter is a cosmopolitan
genus that often dominates planktonic freshwater communities. It produces extremely small cells
that are capable of growing aerobically on a wide range of complex media (Hahn, 2003), although
genomic analyses of free-living and symbiotic strains of P. necessarius indicate a small genome
size and the absence of certain functions, including an inability to use sugars as a carbon and energy
source (Boscaro et al., 2013).
Variovorax includes taxa with diverse nutritional and energy acquisition strategies,
including the ability to break-down and use a wide variety of plant-derived molecules, as well as
denitrification, sulfate reduction and autotrophic CO2 fixation. Genomic analysis of a plant-
associated V. paradoxus strain has shown that it has a remarkable combination of features for both
heterotrophic and autotrophic lifestyles, and although it lacks the genes for methane
monooxygenase, it is known to enhance the activity of methanotrophs in consortia (Han et al., 2011;
and references therein). This strain also has three genes encoding aerobic carbon monoxide
dehydrogenase, which could be of value given that high levels of carbon monoxide are known to be
produced by photochemical reactions in high latitude, DOC-rich waters (Xie et al., 2009).
Subarctic thaw ponds emit methane (Laurion et al., 2010), and the presence and diversity of
methanotrophic Bacteria is of particular interest. Consistent with our hypothesis, methanotrophs
were found in all samples, and included three of the most abundant OTUs: two strains of
Methylobacter, and one OTU with affinities to the family Methyloccocaceae. The methanotrophic
Bacteria all belonged to Type I methanotrophs which are in the Gammaproteobacteria and the
Verrucomicrobia. No Bacteria belonging to Type II methanotrophs in the Alphaproteobacteria were
identified. Methanotrophic communities are known to be sensitive to temperature, with Type I
methanotrophs developing under low temperature conditions (Wartiainen et al., 2003; Börjesson et
al., 2004; Wagner et al., 2005; Graef et al., 2011) and Type II under higher temperatures (Mohanty
et al., 2007). The absence of Type II methanotrophs from even the warmer surface waters of the
thaw ponds in summer implies selection by the low temperature conditions that prevail throughout
the water column during most of the year.
35
Methanotrophs contributed a relatively high percentage of the total number of sequences in the thaw
ponds, with a median of 4.9%, and a maximum of 27% in the bottom waters of KWK23. This is
particularly high relative to other lakes, for example up to 2% in a meromictic lake in the High
Arctic (Comeau et al., 2012) and only up to 3% of sequences in the plankton of eutrophic Lake
Plusssee in Germany (Eller et al., 2005). This high relative abundance is closer to that observed in
tundra soils (Vecherskaya et al., 1993) and anoxic lake sediments (Costello and Lidstrom, 1999),
indicating the biogeochemically distinct nature of thaw pond ecosystems, with continuously high
inputs of methane as a bacterial energy source.
Two groups of bacterial phototrophs were conspicuous members of the thaw pond
assemblages: Cyanobacteria and Chlorobi. The presence and abundance of sequences for these taxa
varied among the samples, in part associated with depth and valley specific characteristics (see
below). Cyanobacteria are often dominants of high latitude aquatic ecosystems, especially mat-
forming Oscillatoriales and picoplanktonic taxa in the genus Synechococcus (Vincent, 2000). In the
thaw pond data set, Oscillatoriales were little represented (with the exception of the bottom of
SAS1B), as might be expected in a planktonic environment, which was in contrast to High Arctic
soil crusts where Oscillatoriales are among the dominants. Mat-forming taxa are unlikely to thrive
on the sediments of the subarctic thaw ponds given their high turbidity and the poor penetration of
photosynthetically active radiation to the bottom (Watanabe et al., 2011). The picocyanobacterial
group Synechococcales was represented in many of the ponds, although accounted for only 0.7% of
the total bacterial reads. A surprisingly more abundant cyanobacterial group in two of the ponds
was the Nostocaceae, with strong affinities (>99%) to the nitrogen fixing taxon Dolichospermum
curvum (formerly known as Anabaena curvum). Colonial cyanobacteria are largely absent from the
plankton in other waters of the north and south polar regions (Vincent, 2000), again underscoring
the distinctive properties of permafrost thaw ponds as an ecosystem type.
Pelodictyon was the fourth most abundant OTU in the overall data set, accounting for 3.3%
of all sequences. This green sulfur Bacterium (Chlorobi) is often observed under anoxic conditions
in stratified freshwater lakes at depths where there is sufficient light for photosynthesis as well as
high concentrations of its electron donor hydrogen sulfide. Chlorobi were earlier reported from 16S
rRNA gene clone libraries of the KWK valley (Rossi et al., 2013), and their importance in the deep
low-oxygen waters in many of the lakes suggest that anaerobic photosynthesis likely contributes
significantly to the production of these subarctic ecosystems.
36
2.4.3. Attached and free-living Bacteria
In a wide range of marine systems, particle-attached and free-living bacterial communities
are morphologically and phylogenetically distinct (e.g., Crump et al., 1999; Lapoussière et al.,
2011; Mohit et al., 2014). Similarly in some freshwaters, for example Lake Erie (Mou et al., 2013)
and Lake Bourget (Parveen et al., 2011) differences in attached and free-living bacterial
communities have been reported. Here we found little difference between the communities from our
large and small fractions, which should have selected for attached and free-living bacterial
communities respectively. The lack of difference in some of the samples may have been due to
extremely small particulates in some of these ponds (ca. 1 µm; Watanabe et al., 2011) that would
have passed through the 3-µm filter along with their attached bacterial flora, masking any
differences. However, Chao1 diversity was significantly greater in the >3 µm size class and this
would be more consistent with the >3-µm filters retaining both attached and many free living
bacteria if the filters became blocked. Our inability to filter more than 500 mL of sample suggest
this latter explanation is more likely, and it is also consistent with the presence of picocyanobacteria
(Synechococcales) in some of the large fraction samples, notably from BGR1 (Figure 2-5).
Irrespective of the cause, more detailed size fractionation or a microscopy approach would be
needed to accurately resolve the difference between particle-attached and free-living bacteria in
these highly turbid ponds.
2.4.4. Depth gradients and bacterial community composition
The thaw ponds were stratified with pronounced gradients in temperature and oxygen.
Although the ponds are shallow, the high concentrations of CDOM and small wind fetch mean that
they stratify early in spring and remain so over the summer (Watanabe et al., 2011). In fact, there is
evidence that some ponds may not mix to the bottom at all in some years (Laurion et al., 2010).
Within valleys, surface and bottom communities clustered well apart from each other, with the
exception of the SAS site where surface waters were depleted in oxygen compared to the other sites
(Figure 2-5, Table 2-1). In terms of community composition, Actinobacteria were often poorly
represented at the bottom of all ponds, consistent with their preference for more oxygenated waters
(Allgaier and Grossart, 2006; Taipale et al., 2009). Anaerobic sulphate reducers, including the
Deltaproteobacteria Geobacter, Anaeromyxobacter and Desulfovibrio, were found in small
proportions in the bottom of ponds. Other bacterial dominants with matches to the family
Chitinophagaceae (Bacteroidetes) including Sediminibacterium have the ability to produce H2S (Qu
and Yuan, 2008), consistent with an active sulfur cycle and anaerobic conditions.
37
Some of the largest depth-dependent differences were for the phototrophic taxa, in keeping
with the rapid attenuation of photosynthetically available radiation in these waters (Watanabe et al.,
2011), as well as the depth variations in chemical properties of the ponds. The anoxygenic
phototroph Pelodictyon was one of the most abundant OTUs, but was restricted to low oxygen
bottom waters, as expected, and was absent from the more oxygenated BGR sites. This
photosynthetic sulfur Bacterium is adapted to low light and anoxic, H2S-containing waters (Gich et
al., 2001). Cyanobacteria in contrast, tended to be in the upper euphotic zone, with the KWK sites
especially having a greater relative representation of cyanobacteria in the surface compared to the
bottom of the ponds. The most striking difference was in the surface waters of KWK6 where
Nostocaceae were the dominant cyanobacterial group, indicating the likely growth of colonial,
potentially nitrogen-fixing species in these surface waters. However, for other ponds the large
fraction of BGR1 bottom sample was dominated by Synechococcales, possibly indicating the
growth of smaller celled cyanobacteria able to maintain populations in the better illuminated bottom
waters of BGR1, where concentrations of light-attenuating materials (Chl-a, DOC, TSS) were less
than most of the other ponds. Oscillatoriales, which are filamentous, were found in the bottom of
another pond, SAS1B, possibly indicating the sedimentation of aggregates of filaments or sections
of mat from shallower depths.
In the KWK and SAS waters, methanotrophs were more abundant in the bottom waters,
consistent with the earlier reported profiles of methane in the ponds. For example in KWK23,
where the difference between surface and bottom samples was particularly striking, methane
concentrations increase sharply at the bottom of the pond by several orders of magnitude (Laurion
et al., 2010). Methanotrophs are aerobic and unable to sustain growth under completely anoxic
conditions (Chowdhury and Dick, 2013), and our observations imply that the deep pond habitat
provides a favourable combination of high methane and adequate oxygen. Interestingly, in the BGR
ponds where there was less difference between surface and bottom oxygen, there was a higher
proportional abundance of methanotrophs in the surface waters; this might suggest dependence on
methane production from decomposition of macrophytes in the littoral zone, or via plant-microbe
interactions in this region (Laanbroek, 2010).
2.4.5. Spatial variation and landscape gradients
Our results showed a clustering of ponds according to the individual valleys (Figure 2-5),
implying environmental filtering of community composition based on landscape related properties
(Figure 2-6). The distance based redundancy analysis pointed to DOC concentrations and pH as
controlling factors, both of which are known to influence bacterial community structure (e.g.,
38
Lindström et al., 2005; Fierer and Jackson, 2006). The higher pH in the BGR ponds separated them
from the ponds in the other two valleys, although not all microbial groups followed expected
relationships. Verrucomicrobia have been associated with low pH conditions (Lindström et al.,
2005), but this group was relatively abundant in the BGR pond with the highest pH, and poorly
represented in the SAS pond with the lowest pH. However the pH range in this study was narrower
than in Lindström et al. (2005).
Dissolved organic matter origin and source has been reported to influence bacterial
community structure and function (Kritzberg et al., 2006). DOC had the greatest influence on
community composition at the SAS site, where the ponds originated from organic palsas and DOC
concentrations were higher and likely different in composition from the DOC at the other two
valleys, where the ponds were formed by lithalsa thawing. The permafrost thaw gradient was also
associated with the availability of DOC. The BGR valley is surrounded by discontinuous permafrost
and >50% of the soil carbon would be frozen, and not available for degradation. In contrast, the
southern, more degraded KWK and SAS valleys, ponds would be influenced by the eroding
permafrost (Bouchard et al., 2014), and the input of allochthonous DOC would be more substantial.
Photochemical breakdown of some of the more recalcitrant soil organic materials to lower
molecular weight compounds (Laurion and Mladenov, 2013) may additionally enhance substrate
availability in these waters.
2.5. Conclusions
Permafrost thaw lakes and ponds are a prominent feature of the northern landscape and are
strong emitters of greenhouse gases. Because of their abundance on the landscape and wide
distribution they are also useful for investigating the influence of large scale versus small scale
environmental gradients. We found that permafrost gradients influenced the landscape properties, in
turn driving bacterial community composition. Within, a pond the physico-chemical stratification
creates oxygen gradients that favor different microbes. In permafrost thaw lakes, the variety of
allochthonous substrates derived from terrestrial vegetation and soils, and autochthonous sources
including oxygenic photosynthesis by cyanobacteria, microalgae and macrophytes and anoxygenic
photosynthesis by green sulfur Bacteria, likely provide a heterogeneous range of organic substrates
available to diverse heterotrophic taxa. Methanotrophs were among the most abundant sequences at
most sites, indicating the potential importance of methane as a bacterial energy source in these
waters. Their activities likely reduce the net emission of methane, in the process contributing to the
CO2 efflux from these ecosystems. The functionally diverse bacterial taxa in these abundant
‘biogeochemical hot spots’ across the subarctic landscape likely have a strong effect on the net
39
emission of both greenhouse gases, as the result of their metabolism of organic carbon from
multiple sources. Ancient permafrost soils are now being increasingly thawed, eroded and
mobilised as a result of the rapid warming of the North. The diverse bacterial communities
identified here will likely assure that at least part of these new transfers from land to water are
ultimately converted to CO2 and released to the atmosphere.
2.6. Acknowledgements
We acknowledge the Natural Sciences and Engineering Research Council of Canada
(NSERC) funding for Discovery Grants to WFV and CL, the Discovery Frontiers grant ADAPT
and Canada Research Chair support to WFV, the Network of Centres of Excellence ArcticNet
support for WFV and CL, and the Fonds de recherche du Québec-Nature et technologies (FRQNT)
for funding for the Centre d’études nordiques (CEN). Computing support was provided by
CLUMEQ/Compute Canada.
We are also grateful to Claude Tremblay at the Whapmagoostui-Kuujjuarapik CEN station,
the pilots of Canadian Helicopter Ltd., Anna Przytulska-Bartosiewicz, Bethany Deshpande,
Paschale Noël Bégin and Alex Matveev for help in the field, Marianne Potvin for laboratory
assistance and the development of protocols, Adam Monier for aid with bioinformatics advice,
Marie-Josée Martineau for pigment analysis, and two anonymous reviewers and the editor for their
valuable comments on previous versions of the manuscript.
40
Chapitre 3. Diversity and activity of methanotrophs in
low-oxygen permafrost thaw ponds
Résumé
Les lacs et mares dérivés de la fonte du pergélisol sont de forts émetteurs de dioxyde de
carbone et de méthane dans l’atmosphère, mais on en connait peu sur les processus d’oxydation du
méthane dans ces eaux. Dans cette étude, nous avons examiné la distribution et l’activité des
bactéries méthanotrophes dans les mares de fonte provenant de l’érosion de deux types de
pergélisol : dominé par la tourbe ou minéral. Nous avons émis l’hypothèse que la composition de la
communauté est influencée par le type de pergélisol, et que l’activité des méthanotrophes dépend de
la disponibilité en oxygène. Nos analyses des transcrits du gène pmoA par séquençage Illumina et
PCR quantitative ont montré que les communautés étaient composées de lignées diverses et
potentiellement actives. Les méthanotrophes de Type I, particulièrement le genre Methylobacter,
dominait toutes les communautés, mais il y avait cependant une séparation taxonomique claire entre
les deux types de pergélisols, ce qui indique un contrôle environnemental de la structure des
communautés. L’activité des méthanotrophes mesurée avec la concentration en transcrits de pmoA
est corrélée avec la conductivité, le phosphore et les matières totales en suspension. L’activité des
méthanotrophes a aussi été détectée dans les eaux de fond pauvres en oxygène, où elle était
négativement corrélée avec la concentration en méthane, ce qui suggère une déplétion du méthane
par les méthanotrophes. Le réchauffement climatique en cours pourrait induire une plus longue
période de fonte de la glace dans les mares de fontes et changer l’oxygénation, ce qui pourrait
altérer l’activité méthanotrophique et les émissions de méthane dans l’atmosphère.
41
Abstract
Lakes and ponds derived from thawing permafrost are strong emitters of carbon dioxide and
methane to the atmosphere, but little is known about the methane oxidation processes in these
waters. Here we investigated the distribution and activity of methanotrophic Bacteria in thaw ponds
in two types of eroding permafrost landscapes in subarctic Québec: peatlands and mineral soils. We
hypothesized that community composition is influenced by the surrounding landscape, and that
methanotrophic activity is a function of oxygen conditions. Our analysis of pmoA transcripts by
Illumina amplicon sequencing and quantitative PCR showed that the communities were composed
of diverse and potentially active lineages. Type I methanotrophs, particularly Methylobacter,
dominated all communities, however there was a clear taxonomic separation between the two
landscape types, indicating environmental control of community structure. Methanotrophic activity
as measured by pmoA transcript concentrations was correlated with conductivity, phosphorus and
total suspended solids. Methanotrophic activity was also detected in low-oxygen bottom waters,
where it was inversely correlated with methane concentrations, suggesting methane depletion by
methanotrophs. Ongoing warming may induce a longer ice-free season and changes in oxygenation
that could alter methanotrophic activity and methane emissions to the atmosphere.
42
3.1. Introduction
Climate warming has resulted in the thawing and collapse of permafrost landscapes
(thermokarst erosion), producing changes in the frequency and size of the resultant thaw lakes. In
some areas, permafrost thaw lakes are draining and infilling, while in other northern regions they
are expanding (Wrona et al., 2016 and references therein). Northern lakes and ponds are strong
emitters of methane (Walter et al., 2008; Wik et al., 2016), and emission rates are especially high
from small thermokarst water bodies in subarctic permafrost peatlands (Matveev et al., 2016). Many
of these waters are known to become highly stratified during summer, with marked gradients of
temperature and oxygen down through the water column (Breton et al.,2009). This stratification is
likely to have an impact on methane production (methanogenesis) and loss processes
(methanotrophy) that are both dependent on temperature and oxygen availability.
Methane emissions to the atmosphere are the net result of microbial methanogenesis and
methanotrophy, and in many environments, the activity of methanotrophic Bacteria may impose a
strong control on emission flux rates. Methanotrophs have the distinctive ability to use methane as
their sole source of carbon and energy (Hanson and Hanson, 1996) and have the capacity to oxidize
up to 60% of the yearly methane produced at a global scale (Reeburgh et al., 1993). In rice fields,
for example, the proportion of methane oxidized by methanotrophs varies from 20% to 90% (Epp
and Chanton, 1993; Gilbert and Frenzel, 1995; Khalil et al., 1998). In soil and freshwater
ecosystem, up to 95% of the methane produced is consumed by oxidation (Frenzel et al., 1990; Le
Mer and Roger, 2001; Bastviken et al., 2008). For example, in a boreal humic lake, 80% of the
methane produced in the sediments was estimated to be consumed by methanotrophs in the water
column (Kankaala et al., 2006).
Less is known about the importance of methanotrophy in Arctic and Subarctic ecosystems.
In the Arctic Ocean, a ‘methane filter’ of aerobic and anaerobic methane oxidizers in the sediments
is thought to substantially moderate the current fluxes of methane to the water column and
atmosphere, and methanotrophs may be an increasingly important source of biomass for Arctic
benthic food webs in the future (James et al., 2016). In High Arctic soils, Type II methanotrophs in
the upper soil profile appear to be sufficiently active to fully consume all the methane, and the soils
are net methane sinks (Stackhouse et al., 2015). This contrast with northern lakes, which in general
appear to be net sources of methane (Wik et al., 2016). Although permafrost thaw lakes in the North
are particularly well known for their high production rates of methane, little attention has been
given to their methane oxidation potential.
43
The advent of molecular techniques has provided the means to identify micro-organisms in
many habitats, and has revealed a remarkable diversity of microbial taxa in all domains of life
(Pedrós-Alió, 2006). The application of functional genomics is now allowing links to be drawn
between microbial diversity and biogeochemical processes (Zak et al., 2006), including for
microbes involved in the methane cycle. The functional gene coding for one of the enzyme proteins
involved in bacterial methane oxidation, specifically the alpha-subunit of particulate methane
mono-oxygenase (pmoA), is increasingly used as a phylogenetic marker to study methanotroph
community composition and activity (McDonald and Murrell, 1997; Degelmann et al., 2010). Due
to phylogenetic and metabolic differences, methanotrophs are commonly separated into two types
(Bowman, 2006). Type I methanotrophs (Gammaproteobacteria) use the ribulose monophosphate
(RuMP) pathway for carbon assimilation while Type II methanotrophs (Alphaproteobacteria) uses
the serine pathway. Type I taxa are sometimes further divided into Type Ia (Methylobacter-related)
and Type Ib (Methylococcus-related) depending on their phylogenetic affiliation (McDonald et al.,
2008). Recently, new groups of methanotrophs have been discovered that are phylogenetically
distant from Type I and II; for example, the genus Crenothrix, which belongs to the
Gammaproteobacteria but has a phylogenetically divergent pmoA (Stoecker et al., 2006); the
verrucomicrobial order Methylacidiphilales (Dunfield et al., 2007); and the NC10 phylum that has
the ability to couple methane oxidation with denitrification (Ettwig et al., 2009).
Our goal in the present study was to identify factors that control the community structure
and activity of methanotrophic Bacteria in permafrost thaw ponds, and to address this goal by way
of phylogenetic and quantitative PCR (qPCR) analysis of pmoA transcripts. We conducted this
research in ponds that lie in two types of permafrost landscape types in subarctic Québec: peatlands
with raised mounds of organic material (palsas) and shrub-tundra landscapes with raised mounds of
inorganic soils (lithalsas). These landscapes lie at the southern end of the permafrost range, and the
ice-rich mounds are thawing and degrading rapidly, giving rise to palsa- and lithalsa-derived
thermokarst lakes that differ in their limnological properties such as dissolved organic carbon
concentrations (Przytulska et al., 2016). We hypothesized that the lakes in the two landscape types
would also differ in their methanotroph community structure. Additionally we tested the hypothesis
that active methanotrophy (as measured by pmoA transcripts) would be a feature of all of these
lakes, with the potential to reduce net methane emissions, and that the distribution of
methanotrophic activity down the water column would be determined by oxygen availability.
44
3.2. Materials and Methods
3.2.1. Study site and sampling
Samples were collected during two field visits, 1 to 13 August 2012 and 31 July to 19
August 2013, from four subarctic valleys in northern Québec. The KWK (55°16’N; 77°46’W) and
SAS (55°13’N; 77°42’W) valleys are located in the sporadic permafrost region, where permafrost
covers less than 2% of the soil. The nearest village is Whapmagoostui-Kuujjuarapik. BGR
(56°37’N; 76°13’W) and NAS (56°55’N, 76°22W) valleys are situated 100 km north of the two
other valleys, in the discontinuous permafrost region, close to the village of Umiujaq, Quebec
(details in Crevecoeur et al. 2015). The SAS valley ponds are the result of thawing of palsas, peat-
rich permafrost mounds (Bhiry and Robert 2006) while NAS, BGR and KWK ponds originated
from thawing of lithalsa, mineral permafrost mounds (Lajeunesse and Allard 2003; Calmels et al.,
2008; Bhiry et al., 2011).
3.2.2. Sampling and physico-chemical measurements
Profiles of temperature, dissolved oxygen (DO), and pH were taken with a 600R
multiparametric probe (Yellow Spring Instrument). Detection limit for dissolved oxygen with the
probe is 0.2 mg L-1. Bottom samples were collected using a horizontally mounted Van Dorn bottle
(Wilco) and immediately transferred to acid washed 4-L Cubitainers that were rinsed with sample
water prior to filling. Cubitainers™ were overfilled placed in coolers and brought back to the
laboratory. Methane concentrations were measured with the headspace technique as described in
Matveev et al. (2016). Water samples for physico-chemical analysis (DOC, TSS and TP) were
processed as in Crevecoeur et al. (2015).
3.2.3. RNA sample preparation and sequencing
The water for RNA analysis was prefiltered through a 20 µm Nitex screen and then
sequentially filtered through a 3 µm Nuclepore™ polycarbonate (PC) filter and a 0.2 µm Sterivex™
unit (Millipore) to separate large (particle-attached) and small fraction (free-living) of planktonic
micro-organisms. Filter were conserved in RNAlater (Life Technologies) and stored at -80 ºC
before extraction. RNA was extracted with the AllPrep DNA/RNAMini Kit (Qiagen) modified to
include an additional step using polyvinylpyrrolidone (PVP, Alfa Aesar) to minimize potential PCR
inhibition. RNA was converted to cDNA using the High Capacity cDNA Reverse Transcription Kit
(Applied Biosystems-Ambion). The quantity and quality of cDNA was checked on a 1% agarose
gel; samples with adequate cDNA for further processing (Annex 2) were stored at -80° C.
45
Amplification of pmoA was performed with a two-step dual-indexed PCR approach
modified for Illumina instruments with two consecutive sets of primers (Annex 3). In the first step,
the gene specific portion was fused to the Illumina TruSeq sequencing primers and PCR was carried
out in a total volume of 25 µL that contained HF buffer 1X (NEB), 0.25 µM of each primer, 200
µM of each dNTPs (Life Technology), dimethylsulfoxide (DMSO, NEB) at a final concentration of
3 %, 1 U of Phusion High-Fidelity DNA polymerase (NEB) and 1 µL of template cDNA. To
minimise primer bias, two more reactions with 5 and 10 fold diluted template were also carried out
for each sample. Temperature and duration of thermal cycling were started with an initial
denaturation at 98°C for 30 s followed by 35 cycles of denaturation at 98°C for 10 s, annealing at
56°C for 30 s, extension at 72°C for 30s and a final extension at 72°C for 300 s. The three dilution
reactions were pooled together and purified using the Axygen PCR cleanup kit (Axygen). Quality
and quantity of the purified PCR product were checked on a 1% agarose gel. Fifty to 100 fold
dilution of this purified product was used as a template for a second PCR step with the goal of
adding barcodes (dual-indexed) and missing sequence required for Illumina sequencing. This
second PCR was done in triplicates under the same conditions as the first PCR but with 15 cycles.
Triplicates were pooled together and purified as above and then quantified spectrophotometrically
with the Nanodrop 1000 (Thermo Fisher Scientific). Barcoded amplicons were pooled in equimolar
concentration for sequencing on the Ilumina MiSeq at the Plateforme d’Analyses Génomiques
(IBIS, Université Laval, Québec, Canada), using primers that contain Illumina-specific sequences
protected by intellectual property law (Oligonucleotide sequences © 2007-2013 Illumina, Inc.). The
raw Illumina sequences have been deposited in the Short Read Archive database under the
bioproject PRJNA317391.
3.2.4. Sample processing for qPCR
Standards were prepared from PCR product produced under the same conditions as the first
reaction PCR of the dual-indexed PCR for Illumina. Triplicate samples of PCR product were
purified with a Feldan PCR purification kit. Amplicons were cloned using a Stratagene cloning kit
following the manufacturer’s instructions, with the following modifications: a polyA tail was added
to the amplicons using Feldan polymerase and buffer and dATPs (final concentration 0.175 nM)
and 26 to 30 ng were used for the ligation reaction. Transformed cells were incubated 1 h in SOC at
37°C for recovery before plating on agar plates. Positive clones were incubated again in LB media
containing 7% glycerol for 16h at 37°C. To verify that the target gene was amplified, the T3/T7
PCR reaction was performed on the grown clones and 11 of them were sent to sequencing facilities
at the Sequencing Center of Laval University Hospital Center (CHUL; Quebec City, QC, Canada).
46
Standards were then prepared by amplifying a positive clone with T3 and T7 primers. Amplicons
were checked on a 1% agarose gel and the band corresponding to the length of the amplicon
(around 700 pb) was cut and purified with a gel purification kit (Qiagen). Another T3/T7 PCR was
performed on the purified amplicon and was purified with a PCR purification kit (Feldan).
Concentrations were measured on a NanoDrop™ spectrometer. Each reaction (standard and
samples) was run in triplicate. Standards for the calibration were diluted 10 times to cover measures
from 107 to 101 copies µL-1. Potential inhibition was checked by running 10 and 100 fold dilutions
of the sample, which covered the expected copy number range. QPCR reactions for standards and
samples were performed in 20 µL reactions containing 5 µL of template, 500 µM of each primer
(PmoA169F and PmoA661r), 1 X Ssofast EvaGreen™ supermix and nuclease free water on a
Chromo4 thermal cycler (Bio-Rad) with the following steps: initial denaturation (30 s at 95°C) and
then 40 cycles of denaturation (5 s at 95°C), annealing (30 s at 55°C) and elongation (20 s at 72°C).
3.2.5. Sequence processing and analysis¸
PmoA reads from the Illumina amplicon sequencing were analyzed using the FunGene
pipeline (Fish et al., 2013). Reads shorter than 400 pb were discarded and chimera were checked
and removed with UCHIME. Sequences were translated to amino acid and compared to the pmoA
reference sequence with FrameBot for detecting frameshift errors and sequences with inframe
STOP codons, which were removed. Remaining high quality sequences were aligned with
HMMER3 and then clustered at 93% similarity. A custom pmoA database was constructed by
downloading pmoA sequences from the Functional Gene Repository v.8.0. Reference sequences
were checked against the NCBI nr database and the reference database was manually inspected to
ensure all types of known methanotrophs were represented. Taxonomic affiliation of the
representative sequences of pmoA OTUs were done in Qiime using the assing_taxonomy.py
command (Caporaso et al., 2010). For unassigned sequences, a Neighbour Joining 1000 bootstraps
tree following the Poisson model was constructed to allow assignation of sequences to type Ia, Type
Ib or type II methanotrophs by phylogenetic affiliations. Rarefaction curves were of OTUs were
based on 93% similarity using the command alpha_rarefaction.py available in Qiime. The dataset
was re-sampled 100 times to ensure the 37000 reads per sample, which was the minimum number
of reads per a sample less 10%, using the command multiple_rarefaction_even_depth.py in Qiime.
The community data matrix was square root transformed before running the Bray-Curtis
dissimilarity measurement. The Ward method was used for clustering and Bray-Curtis distances
were squared as recommended in Murtagh and Legendre (2014). A principal component analysis
(PCA) was carried out on the environmental variables with the function rda in the Vegan package
47
(Oksanen et al., 2013). Variables that were not normally distributed were log transformed in order
to meet test assumptions.
Testing for differences in the qPCR data required a non-parametric test since the values
could not meet normality assumptions even after log transformation. The Kruskal-Wallis test was
then used to assess differences in methanotrophic activity between valleys, depth and fraction. Only
the samples with corresponding read data were taken into account in this analysis and surface
samples that fell below limit of detection for the qPCR measurements were considered as missing
data. To evaluate which environmental variables and groups of methanotrophs (X-variable)
contributed to the activity of methanotrophs (Y-variable) we used a partial least squares regression
approach (PLS) available in the R package mixOmics (Lê Cao et al., 2009; González et al., 2011),
and that transform X into latent variables to explain to maximum variance of Y. For this analysis,
OTUs were binned into phylogenetic groups, i.e. genera, and unclassified Methylococcaceae were
phylogenetically assigned to Type Ia and Type Ib following their placement in the phylogenetic
tree. The PLS analysis has the advantage of remaining robust in the face of collinearity and missing
data (Wold et al., 2001). The missing values in X were replaced by values from model prediction
using the NIPALS algorithm. Prior to analysis, environmental data that were not normally
distributed were log transformed as well as the Y variable. Methanotroph data that were zero
inflated were fourth root transformed as recommended in Wold et al. (2001). The result of the PLS
were then plotted on a correlation plot to identify variables correlated with the expression of the
pmoA. The relationship between the qPCR data (the two fractions summed to estimate the global
methanotrophic potential of the surface or bottom of the pond) and CH4 concentration was assessed
for the bottom samples. qPCR data were square root transformed to meet normality assumption.
Pearson correlation values were then calculated using the Vegan package in R (Oksanen et al.,
2013).
3.3. Results
3.3.1. Physico-chemical parameters
Surface waters of the ponds were warmer with higher oxygen concentrations (Figure 3-1)
compared to bottom waters. All the ponds were thermally stratified at the time of sampling and
oxygen was depleted in the bottom. Surface and bottom BGR1 and 2 were oxic (DO > 3 mg L-1) all
the way to the bottom while the other pond bottoms were hypoxic to anoxic (See Annex 4). Ponds
from the northern BGR and NAS valley had higher pH values (from 7 to 8), while pH was more
acidic in the southern valleys (from 5 to 6). The bottom waters of the ponds in the KWK and SAS
48
valleys had higher nutrient concentrations, with highest concentrations of total nitrogen and
phosphorus in the bottom of KWK23; 2.74 mg N L-1 and 170.5 µg P L-1 for the phosphorus. The
TSS values followed the same trend, with the highest value at the bottom of the KWK1 pond of
140.77 mg L-1. Ponds from the SAS valley contained higher DOC concentrations, which ranged
from 15.5 mg L-1 at the surface of SAS 1B to 21.5 mg L-1 for the bottom of SAS2B (Figure 3-1,
Annex 4).
Figure 3-1. Principal component analysis of the environmental variables: temperature (T), dissolved oxygen (O2),
pH, total phosphorus (TP), total suspended solid (TSS), conductivity (Cond), Chlorophyll a (Chla), total nitrogen
(TN) and dissolved organic carbon (DOC) for the 9 sampled ponds. Colors indicate the different valleys; surface
samples are represented by a triangle and bottom by a circle.
3.3.2. Community arrangement and composition
A total of 1,850,808 reads were retained after quality control and cleaning, these
corresponded to a total of 985 OTUs at 93% similarity. The semi-parabolic profile of the rarefaction
curve suggested a good representation of the methanotroph diversity within each valley. SAS and
49
KWK valleys reached plateaus at higher level that compared to the BGR and NAS valleys. On
average, SAS valley samples plateaued above 300 OTUs and KWK valley around 200. BGR and
NAS valley followed with plateau around 200 and 150 OTUs (see Annex 5). There was no
significant difference in alpha-diversity Shannon and Choa1 indices between the valleys.
The methanotrophic community differed between landscape type, that is between palsa and
lithalsa valleys (Figure 3-2); a test based on 9999 permutations showed that the community
structure differed significantly among the different valleys (p=0.001). There was no significant
difference between the two depths of sampling or between the two size fractions (p>0.05).
Figure 3-2. Bray-Curtis dissimilarity cluster analysis of the methanotrophic communities. Surface samples are
represented by triangles and bottom samples by circles, either filled (small fraction) or open (large fraction).
Heatmap shows the methanotrophic community composition.
All the pond communities were dominated by type I methanotrophs. The most abundant
genus was Methylobacter, which accounted for up to 92% of the reads in the small fraction of
bottom of SAS2B (Figure 3-2). The group ‘unclassified’ and other Methyloccocaceae contained
sequences phylogenetically assigned to Type Ia (above 1% of the reads at all sites) and Type Ib
(below 1% of the reads for most sites) and other genera such as Methylovulum, Methylosoma and
Methylococcus that represented less than 1% of reads in each sample and were then grouped with
unclassified and other Methylococcaceae. The genus Methylomonas was in low abundance in the
50
lithalsa ponds, more represented in the palsa ponds and abundant in the surface of SAS2B small and
large fraction (87% and 41% of the reads, respectively). The genus Methylomicrobium was present
in each sample, ranging from less than 1% in the large fraction of BGR2 bottom to 11% of the reads
in the large fraction of SAS1B bottom. Unlike Methylomonas, the genus Methylosarcina was more
represented in the lithalsa sites and reached its highest abundance in the small and large fraction of
the bottom of the NASH ponds (5% and 4% of the reads, respectively). Compared to the type I, the
type II methanotrophs were low in terms of abundance and of diversity. Only three genera of type II
methanotrophs were identified. Methylocystis was in highest abundance (5 % of the reads) in the
large fraction of SAS1B bottom and was absent from several samples in the palsa and lithalsa
valley. Methylosinus was present in even lower abundance and reached a maximum of 2%
abundance in the small fraction of SAS2B surface. Finally, Methylocapsa was only found in
SAS1B, SAS2A and SAS2B where it represented less than 1% of the reads.
3.3.3. Methanotrophic activity
The activity of the methanotrophic community was inferred by the concentration of pmoA
transcripts per ml (Table 3-1). Regression coefficients of the calibration curves were between 0.991
and 0.999, qPCR efficiency was between 82 and 115% and the limit of detection was 10 pmoA
transcript copies. Number of pmoA transcripts per volume varied from 2.2 x 102 for the surface
small fraction of BGR1 to 7.6 x 106 for the bottom large fraction of SAS1B. The Kruskal-Wallis test
did not detect any pattern of influence of number of pmoA transcript in function of the valley or the
fraction. However, there was a clear trend that measurements were higher in 2012 compared to
2013. The results showed potential methanotrophic activity not only in oxygenated surface waters
but also in the hypoxic to anoxic bottom waters of the ponds. This included the bottom waters
SAS2B and SAS2A where oxygen concentrations were below our limit of detection (0.2 mg L-1).
51
Table 3-1. Concentrations of pmoA transcripts oxygen and methane in the sampled thaw ponds. -: no data.
Pond Depth Year pmoA transcripts mL-1 Oxygen
Methane
Small Large (µM) (µM)
-
BGR1 Surface 2013 2.2 x 102 4.3 x 103 617 -
BGR1 Bottom 2013 5.2 x 103 3.4 x 103 188 -
BGR2 Surface 2012 4.4 x 106 3.8 x 105 589 20
BGR2 Bottom 2012 1.6 x 106 9.4 x 104 217 229
NASH Bottom 2012 1.6 x 103 1.6 x 104 123 -
KWK1 Bottom 2012 1.0 x 106 2.1 x 105 31 -
KWK6 Bottom 2012 6.4 x 105 3.6 x 105 114 -
KWK12* Bottom 2013 6.1 x 102 - 17 351
KWK23 Bottom 2012 1.3 x 106 4.3 x 105 22 -
SAS1A Surface 2013 1.6 x 103 3.9 x 102 - -
SAS1A Bottom 2013 4.1 x 102 4.9 x 102 - -
SAS1B Bottom 2012 2.6 x 105 7.6 x 106 103 -
SAS2A Surface 2012 2.8 x 104 2.2 x 106 359 3
SAS2A Bottom 2012 1.3 x 106 5.9 x 106 16 102
SAS2A* Surface 2013 6.6 x 103 5.0 x 103 135 -
SAS2A* Bottom 2013 1.5 x 103 2.5 x 104 12 323
SAS2B Surface 2013 3.1 x 103 1.4 x 104 326 3
SAS2B Bottom 2013 2.8 x 104 2.6 x 105 12 292
*no Illumina data
The influence of environmental variables and community composition on the activity of
methanotrophs was evaluated by way of PLS analysis. The first two latent variables of the PLS
analysis explained cumulatively 61% of the variation (Figure 3-3). The concentration of pmoA was
mostly related to conductivity, total phosphorus, total suspended solids and the abundance (number
of reads) of Methylocystis. There was no linear relationship between CH4 concentration and
methanotrophic activity. However, there was a strong, negative, nonlinear relationship between
these two variables in the bottom waters: for the square root of pmoA transcript concentrations and
CH4 concentration, R2=0.996, p<0.001(Figure 3-4).
52
Figure 3-3. Correlation plot of the PLS analysis to see influence of the environmental variables and
methanotrophic genera on the activity of methanotrophs. Chosen environmental variables were conductivity
(Cond), total phosphorus (TP), total suspended solid (TSS), Chlorophyll a (Chla), soluble reactive phosphorus
(SRP), total nitrogen (TN), carbon dioxide concentration (CO2), methane concentration (CH4), dissolved organic
carbon (DOC), oxygen concentration (O2), temperature (T°C) and pH.
Figure 3-4. Concentration of pmoA transcript as a function of methane concentration for bottom and surface
samples (left panel), and for bottom only (right panel). Shading represents ± 95% confidence intervals.
53
3.4. Discussion
3.4.1. Physico-chemical parameters
The subarctic permafrost thaw ponds sampled here were highly heterogeneous in their
limnological properties, with large differences even among ponds located in a same valley. All the
ponds showed physico-chemical gradients down their water columns associated with the summer
stratification. These ponds are known to go through two periods of mixing during the year: in early
spring (May) and during the fall (September). However, that mixing does not always extend
through the entire water column (Laurion et al., 2010; Deshpande et al., 2015). During the summer,
the mixed layer of the ponds is restricted to the epilimnion and venting of gases is not observed
from the bottom of the ponds (Laurion et al., 2010). For the KWK valley, for which we have the
longest record, conditions were hypoxic to anoxic during the summers 2006 (Laurion et al., 2010),
2007 and 2009 (Rossi et al., 2013), and again in 2011. The strong summer stratification and lack of
oxygen in the bottom waters suggest that the ponds in both the KWK and SAS valleys are
favourable environments for methane production by microbial action. Although BGR1 bottom was
anoxic in 2005 (Breton et al., 2009) and 2011, bottom waters were not hypoxic in 2012 and 2013,
suggesting more interannual variation in the BGR valley. However, anoxic conditions are persistent
during winter for BGR1 (Deshpande et al., 2015). The limnological properties of the ponds were
consistent with their origins either palsa or lithalsa with the influence of the DOC on the highly
organic SAS valley ponds and also the more acidic pH due to the high amount of organic acid.
3.4.2. Community composition and arrangement
Our results strongly indicate that the main driver of methanotroph community composition
in permafrost thaw ponds was the origin of pond formation (i.e., from palsas or lithalsas) more than
the depth or the extent of permafrost thawing. For example, the methanotrophic communities
retrieved from the KWK valley that lies in sporadic permafrost were more similar to those found
hundreds of km away in the BGR and NAS valleys that lie in discontinuous and widespread
permafrost than the communities in SAS (sporadic permafrost). However, the link between the
composition of methanotrophic community and the composition of dissolved carbon needs to be
more extensively investigated.
In this study, the size fractionation had no effect on the methanotrophic community
composition, while in seawater environments the same size fractionation protocol revealed distinct
microbial communities (Galand et al., 2008; Mohit et al., 2014). Our results may be due to similar
communities in the free living and particle associated fractions, perhaps because the permafrost
54
waters are rich in particles. It may also reflect methodological limitations, however, with the
clogging of the 3 µm filters due to the high concentration of suspended materials, thereby retaining
some of the free-living cells.
The methanotrophic community in all of the thaw ponds was dominated by type I
methanotrophs. In general, type I methanotrophs are the dominant group in colder environments
(Graef et al., 2011), with some species described as psychrotolerant such as Methylobacter
tundripalidum (Wartiainen et al., 2006; Martineau et al., 2010) and some truly psychrophilic taxa
such as Methylobacter psychrophilus (Omelchenko et al., 1996). Previous studies in soils and
sediments have shown that type II methanotrophs are to be more abundant and more active when
temperature raise around 20°C (Mohanty et al., 2007; Urmann et al., 2009) while type I
methanotophs are active in colder environments (Börjesson et al., 2004; Graef et al., 2011). He et al.
(2012) recorded a shift from type I to type II methanotrophs with increasing temperature of Arctic
lake sediments, and also a shift in the community composition of within each type. Methanotrophic
Bacteria are likely to be positively influenced by increased temperatures. The intensification of
global warming has the potential create a shift of the methanotrophic community since higher
temperature will favour type II methanotrophs over type I.
The primer chosen for the pmoA transcripts would have specifically targeted the Gamma-
and Alpha-proteobacteria methanotrophs, and other methanotrophs possessing a distinct pmoA
enzyme such as the Verrucomicrobia genus Methylacidiphilum (Dunfield et al., 2007; Op den Camp
et al., 2009), the Gammaproteobacteria genus Crenothrix (Stoecker et al., 2006) and the denitrifying
methanotrophs belonging to the NC10 phylum (Ettwig et al., 2009; Luesken et al., 2011) were not
detected. A previous study on bacterial community in permafrost thaw ponds targeting the 16S
rRNA indicated the presence of methanotrophs Verrucomicrobia in relatively high abundance (from
1 to 6% of the reads) in the KWK and SAS valley as well as one Crenothrix OTU in low abundance
in the BGR, KWK and SAS valley (Crevecoeur et al., 2015). The current study then does not take
into account the presence of those latter groups. No members of the phylum NC10 have been
identified to date in the thaw ponds via either RNA (this study, Crevecoeur et al., 2015) or DNA
analysis (Comte et al., 2016).
3.4.3. Methanotrophic activity
Few other studies have assessed the number of pmoA transcript in lakes. One such study in
a methane-rich environment, Lake Kivu based on DNA found from 1.1 x 103 to 2.9 x 104 copies of
pmoA ml-1 (İnceoğlu et al., 2015). Studies analysing the concentration of pmoA transcripts have
55
mostly targeted soil or semi-aquatic ecosystems. A study on a Tibetan wetland measured around 106
copies of pmoA g-1 of dry weight of soil (Yun et al., 2010), while a study on a boreal peatland found
pmoA transcript numbers from 105 to 107 per gram of soil (Freitag et al., 2006), within the same
range that we found in thaw ponds.
There was no obvious relationship between the diversity and the activity of methanotophs.
This difference between valleys and the origin of the ponds (palsa or lithalsa) does not influence
methanotrophic activity as it does diversity. This decoupling between diversity and activity might
be explained by a high level of functional redundancy within the community. Other studies showed
that rate of functional redundancy in bacterial communities can be high and that gene expression
strongly depends on environmental variables (Comte et al., 2013; Trimmer et al., 2015). However,
functional redundancy for methanotrophs was not supported by another study using PLFA-SIP that
found a link between activity and community composition (Bengtson et al., 2009), in contrast to the
present study.
Contrary to our initial hypothesis, the presence or absence of oxygen did not seem to
influence methanotrophic activity estimated by transcripts. High concentrations of transcripts of
pmoA were recorded in the low-oxygen (hypoxic or anoxic) bottom waters of the ponds, in addition
to in the surface waters. There is increasing evidence that methanotrophs are micro-aerobic. Blees et
al. (2014) evaluated the vertical distribution of methanotrophs through the water column of an
alpine lake and found methanotrophs way below the oxycline where the lake is supposedly anoxic.
They also still measured methane consumption at this depth, implying that methanotrophs can
survive and even grow during periods of prolonged anoxia. Idea concept is emerging that a
consortium of micro-organisms may allow aerobic methanotrophs to sustain their activity in anoxic
water. Methanotrophs could be for example coupled with phototrophs (Milucka et al., 2015; Oswald
et al., 2015), or denitrifiers (Beck et al., 2013; Liu et al., 2014). All the latter studies that reported
methanotrophic activity under anoxic conditions were based on incubation experiments, which do
not accurately reproduce in situ conditions (Radajewski et al., 2003). Here, we provided evidence
from in situ sampling that methanotrophs could stay active in waters that contain as little as 1 or 2%
oxygen. Their presence in the bottom could be a compromise to avoid grazing and be closer to the
methane source, since methane increases by orders of magnitude down the water column in many of
these ponds (Matveev et al., 2016). Furthermore, a small amount of oxygen can possibly diffuse to
the bottom from time to time when mixing of the epilimnion creates a supply of oxygen close to the
thermocline, and when internal waves propagate across the oxycline, as observed in these waters
(Deshpande et al., 2015).
56
Only the year of sampling had a significant effect on methanotrophic activity. This
interannual variation in methanotrophic activity indicates the need for seasonal and multi-year
monitoring of limnological properties and their effect on methanotrophic activity. Contrary to our
second hypothesis, methanotrophic activity did not follow the beta-diversity patterns and was little
influenced by oxygen availability.
Other factors that more strongly influenced the methanotrophic community composition
were identified by the PLS analysis: phosphorus, conductivity and total suspended solids.
Phosphorus has been shown to have an effect of enhancing microbial CH4 oxidation in soil (Zhang
et al., 2011). Phosphorus could increase methanotrophic potential by the enhancement of microbial
biomass (Liu et al., 2012) which is substantial in thaw ponds since up to 27% of the bacterial
community is composed by methanotrophs in some ponds (Crevecoeur et al., 2015). The link with
the TSS suggests that methanotrophic activity would be related by the presence of particles. In
general, sinking particles are considered to be microbial hot-spots (Grossart and Simon, 1998). An
oxic/anoxic interface can develop at the surface of sinking particles (Reiche et al., 2011) that is a
favourable environment for methanotrophy.
PLS analysis suggested that the methanotroph genus that was the most related to pmoA
expression was Methylocystis. This genus represented a small fraction of the reads (no more than
5%), which contrasted with the most abundant genus Methylobacter that did not seem to relate to
the methanotrophic activity. This highlights the potential importance of the “rare biosphere”, as
described in an increasing number of studies (Galand et al., 2009; Logares et al., 2009; Pedrós-Alió,
2012). Suweis et al. (2013) found by way of a modelling approach that rare species were positively
correlated with ecosystem resilience. Hence the disappearance of a rare species, which by definition
is more sensitive to extinction, can result in decreased ecosystem stability. In the thaw ponds, our
results suggest that methane consumption is driven by rare taxa that may be vulnerable to
perturbation by ecosystem change. Methylocystis is rare in the thaw pond ecosystems, but has been
found in high abundance in a Japanese wetland (Narihiro et al., 2011) and a sphagnum peatland
(Kip et al., 2011). The acid tolerance of Methylocystis may be the reason why it was more abundant
in the acidic SAS peatland valley. Another reason that might explain the influence of Methylocystis
on pmoA transcription is the fact that some Methylocystis are able to develop a parallel fermentative
metabolism in low oxygen conditions and so may be more adapted to those conditions
(Vecherskaya et al., 2009). The link between methanotrophic activity and methane concentration
was influenced by the depth of sampling. While no clear trend was observed for the surface, a
negative relationship was found for the bottom samples. This means that methanotrophs could have
57
the potential to reduce net methane emission from the ponds, but may also imply that where the
concentration of methane is high; the conditions are not propitious for pmoA transcription. A
negative relationship between CH4 fluxes and number of pmoA transcripts has also been found at a
peatland site (Freitag et al., 2010). In contrast, Kankaala et al. (2006) showed a positive linear
relationship between methanotrophic activity and CH4 concentration, suggesting that is this boreal
lake, methanotrophs are limited by CH4 availability. Hence the factors that influence the
relationship between methanotrophic activity and methane concentration are still not fully
understood and may vary among lake types.
In conclusion, our results show that the methanotrophic communities of subarctic thaw
ponds are mainly influenced by landscape type (organic palsa versus mineral lithalsa), and that they
are dominated by Type I methanotrophs that are characteristic of low-temperature environments.
Ongoing climate warming may disturb this community composition and favour methanotrophs
adapted to higher temperature, but the extent of change in the community is likely to depend on the
origin of the pond. Higher temperature will lead to stronger stratification and longer periods of
hypoxic and anoxic conditions in the bottom of thaw ponds, but also to longer periods of ice-free
conditions and mixing in spring and fall. The distribution and detection of methanotrophic activity
at the bottom of the ponds suggests they have strategies for maintaining activity even under low
oxygen conditions. Changes in temperature, mixing, oxygenation and nutrient supply will likely
affect the activity of methanotrophs in the future, and thereby alter the net emission of methane
from these waters to the atmosphere.
3.5. Acknowledgements
We acknowledge the Natural Sciences and Engineering Research Council of Canada
(NSERC) funding for Discovery Grants, the Discovery Frontiers grant ADAPT, Canada Research
Chair program, the Network of Centres of Excellence ArcticNet, and the Fonds de Recherche du
Québec-Nature et Technologies (FRQNT) for funding for the Centre d’Études Nordiques (CEN).
Computing support was provided by CLUMEQ/Compute Canada. We thank Marianne Potvin for
laboratory assistance and the development of protocols. We are also grateful to Claude Tremblay at
the Whapmagoostui-Kuujjuarapik CEN station, the pilots of Canadian Helicopter Ltd., and Anna
Przytulska-Bartosiewicz, Bethany Deshpande and Paschale Noël Bégin for help in the field.
58
Chapitre 4. Environmental selection of planktonic
methanogens in permafrost thaw ponds
Résumé
Le réchauffement et l’érosion thermique du pergélisol riche en glace résultent en la
formation de mares de fonte qui peuvent devenir des importants émetteurs de méthane dans
l’atmosphère. Ici nous avons examiné les méthanogènes et les autres archées, dans deux types de
mares de fonte qui sont formées soit par l’effondrement de buttes de pergélisol dominé par la tourbe
(palses) ou des buttes de sol minérales (lithalses) dans le Québec subarctique, Canada. En utilisant
des techniques de séquençage à haut débit à partir de la région hypervariable de l’ARNr 16S, nous
avons déterminé la structure taxonomique et la diversité des communautés d’archées dans l’eau près
du fond, et analysé les transcrits du gènes mcrA dans deux sites. Les mares de tous les sites étaient
fortement stratifiées, avec des eaux de fond hypoxiques à anoxiques. La communauté des archées
étaient dominées par les Euryarchaeota, plus particulièrement les taxons méthanogéniques
Methanomicrobiales et Methanosarcinales, indiquant une communauté de méthanogènes
planctoniques potentiellement active. L’ordre des Methanomicrobiales comptait pour la plupart des
transcrits du gène mcrA dans les deux mares. La communauté des archées différait de manière
significative entre les mares issues de lithalses ou de palses, avec une plus forte diversité alpha dans
les mares de palses riches en carbone organique, et une différence prononcée dans la structure des
communautés. Ces résultats indiquent la présence largement répandue des archées produisant du
méthane dans les mares de fonte, avec une sélection environnementale de taxons en fonction du
type de pergélisol.
59
Abstract
The warming and thermal erosion of ice-containing permafrost results in thaw ponds that
can be strong emitters of methane to the atmosphere. Here we examined methanogens and other
Archaea, in two types of thaw ponds that are formed by the collapse of either permafrost peat
mounds (palsas) or mineral soil mounds (lithalsas) in subarctic Quebec, Canada. Using high-
throughput sequencing of a hypervariable region of 16S rRNA, we determined the taxonomic
structure and diversity of archaeal communities in near-bottom water samples, and analyzed the
mcrA gene transcripts from two sites. The ponds at all sites were well stratified, with hypoxic or
anoxic bottom waters. Their archaeal communities were dominated by Euryarchaeota, specifically
taxa from the methanogenic orders Methanomicrobiales and Methanosarcinales, indicating a
potentially active community of planktonic methanogens. The order Methanomicrobiales accounted
for most of the mcrA transcripts in the two ponds. The archaeal communities differed significantly
between the lithalsa and palsa ponds, with higher alpha diversity in the organic-rich palsa ponds,
and pronounced differences in community structure. These results indicate the widespread
occurrence of planktonic, methane-producing Archaea in thaw ponds, with environmental selection
of taxa according to permafrost landscape type.
60
4.1. Introduction
Archaea are widely distributed throughout the biosphere and play key roles in
biogeochemical cycling processes, including methane production (Jarrell et al., 2011).
Methanogenic Archaea are responsible for a large fraction of organic carbon decomposition under
anaerobic conditions (Kuntz et al., 2015), and their metabolic activities in lakes and natural
wetlands may account for more than 30% of total methane emissions to the atmosphere (Kirschke et
al., 2013). In high latitude northern regions, diverse archaeal communities have been reported in
soils (Jansson and Taş, 2014), wetlands (Juottonen et al., 2008), lakes (Pouliot et al., 2009), rivers
(Galand et al., 2008), and marine environments (Galand et al., 2009; Comeau et al., 2011).
Permafrost landscapes in many parts of the Arctic contain abundant lakes and ponds that have been
formed by thawing and collapse of ice-rich soils, and these so-called thaw or thermokarst lakes
(Jansson and Taş, 2014) are strong emission sources of both CH4 and CO2 (Walter et al., 2007).
With ongoing climate warming in northern regions, the thawing of permafrost soils may lead to
increased mobilisation and transfer of ancient carbon reserves into such thaw ponds, where some of
this organic material would be available for decomposition by methanogens (Vonk et al., 2015). To
date, studies of archaeal communities in permafrost aquatic ecosystems have focused on pond
sediments in the High Arctic (Negandhi et al., 2013) and wetland soils in the Subarctic (Liebner et
al., 2015), while the presence, diversity, and substrate preferences of methanogens in the water
column have been little explored.
Methanogenic Archaea use different pathways for methanogenesis that depend on the
carbon substrate and electron donor. The two substrates that are the most commonly used are
H2/CO2 and acetate through hydrogenotrophic and acetoclastic methanogenesis, respectively. A
third, less common methylotrophic pathway requires the use of a methyl group as substrate
(Bapteste et al., 2005). The hydrogenotrophic pathway is found in almost all orders of methanogens
(Methanococcales, Methanopyrales, Methanobacteriales, Methanosarcinales, Methanomicrobiales,
Methanocellales and the recently discovered Methanomassiliicoccales (Bapteste et al., 2005; Borrel
et al., 2013), while the genus Methanosaeta in the order Methanosarcinales is an obligate acetotroph
(Barber et al., 2011). Only the order Methanosarcinales has been shown to contain genera or species
able to use the three different pathways (Bapteste et al., 2005). Both hydrogenotrophic and
acetotrophic taxa of Archaea have been detected in the soil of Subarctic wetlands (Liebner et al.,
2015) and High Arctic thaw ponds (Negandhi et al., 2013).
In the Hudson Bay region of subarctic Québec, thermokarst lakes and ponds have been
increasing in size and number over the last three decades in response to rapid warming (Bhiry et al.,
61
2011). These thaw ponds emit CH4 to the atmosphere (Laurion et al., 2010), implying active
methanogenic communities. Although there is some evidence of methanogenesis in oxic waters
(Grossart et al., 2011; Bogard et al., 2014), methanogenesis by Archaea usually occurs under anoxic
conditions (Thauer et al., 2008), and is especially likely in anoxic sediments. However, the bottom
waters of Quebec subarctic thaw ponds are generally hypoxic and sometimes anoxic during summer
(Laurion et al., 2010; Breton et al., 2009; Rossi et al., 2013), providing conditions for methanogenic
activity. In addition prolonged anoxia occurs throughout the water column during winter when the
ponds are ice covered (Deshpande et al., 2015). Episodic mixing events occur especially during
autumn prior to freeze-up, but also in spring and occasionally during summer (Laurion et al., 2010).
These mixing events are likely to accelerate the ventilation of CH4 into the atmosphere and
oxygenate the water column (Deshpande et al., 2015), which would disrupt the redox conditions
conducive to anaerobic methanogenesis. The sensitivity to these ponds to mixing raises the question
of whether methanogens are active members in the microbial water column plankton.
The substrates available for methanogens in thaw ponds may vary depending on the
landscape characteristics of the surrounding catchment. The extent of thawing and associated
permafrost erosion will influence the quantity of allochthonous organic matter, while soil properties
will influence the nature and lability of the organic matter. In the Quebec Subarctic region, most
thaw ponds originate from one of two different types of permafrost landscapes either from peat
covered palsa mounds or mineral lithalsa mounds (Gurney, 2001; Calmels et al., 2008). Eroding,
carbon-rich palsa soils are likely to release large amounts of organic matter (Kiikkilä et al., 2014),
some of which can be biologically or photochemically broken down (Laurion and Mladenov, 2013)
into substrates that may stimulate microbial activity including archaeal methanogenesis.
The aims of the present study were to determine the diversity and any environmental
partitioning of archaeal communities in subarctic thaw ponds. Specifically, we evaluated the
following hypotheses: 1) the bottom waters of these ponds provide a suitable habitat for
methanogenic Archaea; 2) permafrost landscape type (palsa versus lithalsa) and the extent
permafrost degradation, affects archaeal community structure; and 3), the carbon enriched
conditions of the palsa catchments favors greater archaeal diversity compared to lithalsa dominated
catchments. We tested these hypotheses using microbial plankton samples taken from ponds in
three different permafrost valleys in subarctic Quebec, and the communities were identified using
high-throughput sequencing (Illumina MiSeq) of the V6-V8 hypervariable region of archaeal 16S
rRNA. We further examined the potential metabolic diversity of methanogenic Archaea by high
throughput sequencing of mRNA transcripts of the mcrA gene. This gene codes for subunit A of the
62
methyl-coenzyme M reductase and has been used as a proxy for studying taxonomic richness and
community composition of methanogens, including across a palsa wetland gradient in subarctic
Norway (Liebner et al., 2015). Given that many of these thaw ponds contain high concentrations of
suspended sediments (Laurion et al., 2010), we also tested for differences in archaeal taxonomic
structure between particle-attached and free-living communities.
4.2. Results
4.2.1. Limnological conditions
All the ponds were thermally stratified during the period of sampling, with low or near zero
values of dissolved oxygen at the bottom (Table 4-1). Ponds from the KWK (lithalsa) and SAS
(palsa) valleys were hypoxic to anoxic at the bottom. Values for pH were higher in the BGR
(lithalsa) valley, followed by the KWK valley and then the SAS valley, where the waters were
slightly acidic. DOC values tended to be higher for ponds from the SAS valley, although KWK1
and KWK23 also had relatively high concentrations of DOC. The highest TSS values were recorded
from KWK1 and KWK23 followed by BGR2. Total phosphorus concentrations were the highest in
the KWK ponds and in BGR2.
Table 4-1. Limnological properties of the bottom water (0.5 m above the sediment) for the sampled thaw ponds.
Temperature (T°C), dissolved oxygen (O2), dissolved organic carbon (DOC), total suspended solids (TSS) and total
phosphorus (TP).
Pond Year T°C O2
(mg.L-1)
O2
(% sat.)
pH DOC
(mg L-1)
TSS
(mg L-1)
TP
(µg L−1)
BGR1 2013 9.7 3 37.1 7.3 2.7 10.4 19.3
BGR2 2012 11 3.5 32.7 7.2 8.7 57.4 148.9
KWK1 2012 6.4 0.5 4.2 6.2 12 140.8 87.8
KWK6 2012 8.2 1.8 17.5 6.3 5.2 16 99.9
KWK23 2012 4.4 0.4 2.7 6.1 10.9 73.6 170.5
SAS1B 2013 11.7 1 14.2 6.2 16.2 18.4 26.1
SAS2A 2012 4.6 0.3 2 5.6 18.9 16.2 41.5
SAS2B 2012 5.7 0.5 3.8 4.5 21.5 7.7 25.8
4.2.2. Archaeal alpha-diversity
The surface water samples yielded archaeal 16S rRNA sequences from only 3 of the 16
pond samples (SAS2A, SAS2B and BGR2; see Annex 6), and no mcrA transcripts could be
amplified from any of these surface samples. We therefore focused our subsequent analyses
exclusively on 16 bottom water samples (8 ponds, two fractions). These yielded a total of 747,149
reads after quality filtering and removal of singletons, and corresponded to 473 OTUs. The cDNA
63
for mcrA was successfully amplified and sequenced from two bottom samples: the small (<3-µm)
fraction of KWK23 and the large (>3-µm) fraction of SAS2B. The mcrA transcripts yielded
112,320 reads corresponding to 142 OTUs. The 16S rRNA rarefaction curve plateau was higher in
the SAS than the BGR and KWK ponds, with 200 and 250 OTUs on average for the SAS valley and
100 and 150 OTUs on average for the BGR and KWK valleys (see Annex 7). Some individual SAS
samples did not reach a plateau above 250 OTUs, suggesting that these communities may have been
under-sampled. ANOVA analysis showed Chao1 (P=0.020) and Shannon (P=0.0125) indices
differed significantly among valleys. Tukey HSD tests showed that SAS differed from BGR
(P=0.04 for the Shannon index and P=0.027 for the Chao1 index) and KWK (P=0.003 for the
Shannon index and P=0.01 for the Chao1 index), with no significant difference between KWK and
BGR. For the Shannon index, the median in the SAS valley was 5.7 with a range from 4.7 to 6.4,
while the medians for BGR and KWK valley were 4.3 and 4.0 respectively, with ranges from 3.5 to
5 and 3.2 to 4.5. For the Chao1 index, the median in the SAS valley was 318 and ranged from 290
to 339. The medians for the BGR and KWK valleys were 182 and 185 respectively, with ranges
from 98 to 213 and 80 to 230. So the SAS ponds had higher archaeal diversity and species richness
than those in the two other valleys (Figure 4-1).
Figure 4-1. Alpha-diversity measures for the three sampled valleys. Shannon diversity index and Chao1 species
richness index for the BGR, KWK and SAS valleys. The line in each box plot indicates the median, the box delimits
the 25th and 75th percentile, and the whisker is the range. Diversity indices for SAS valley differed significantly
from the two other valleys (p=0.02 for the Chao1 and p=0.01 for the Shannon index).
64
4.2.3. Archaeal community dissimilarities and composition
An unweighted UniFrac distance analysis of the bottom water 16S rRNA data showed that
the SAS palsa valley clustered apart from the lithalsa valleys KWK and BGR (Figure 4-2). A
permutation test (9999 permutations) showed that the difference between communities was
significant for valleys only (P=0.001). There were no significant differences between the small and
the large fractions and or between the different years of sampling. Pairwise comparisons confirmed
that SAS was significantly different from KWK (P=0.003) and BGR (P=0.001), while KWK and
BGR were not significantly different from each other.
Figure 4-2. UniFrac clustering and composition of archaeal community. Upper dendrogram representing the
phylogenetic unweighted UniFrac distance of the archaeal community for the study ponds. Filled or open diamond
represent respectively small and large fraction. First letter of sample name correspond to the valley name: S for
SAS, K for KWK and B for BGR. The following number or combination of letter and number indicate the name of
the pond. Bubble plot show the relative abundance of the different archaeal lineages with notably Miscellaneous
Euryarchaeotic Group (MEG), Miscellaneous Crenarcheotic Groups (MCG) and Deep Euryarcheotic Sea Group
(DESG).
65
The overall archaeal community composition was mostly composed of methanogens and
other Euryarchaeota (Figure 4-2). Methanogens were represented mainly by the order
Methanomicrobiales, which composed 13 to 69% of the reads for the large fraction of KWK1. The
second dominant group of methanogens was the Methanosarcinales, with a greatest relative
abundance of 39% of reads in the large fraction of SAS2B. Two other orders of methanogens
(Methanocellales and Methanobacteriales) represented less than 1% of the relative abundance of the
total community, with the Methanocellales only found in the SAS valley. The two dominant orders
of methanogens, Methanomicrobiales and Methanosarcinales, constituted on average 55% of the
KWK valley community, followed by the 45% of the SAS valley community and then 38% of the
BGR valley community. In general there were more methanogens in the large fraction than in the
small fraction, except for KWK23 and BGR1 where Methanomicrobiales were more abundant in
the small fraction. The 16S rRNA sequences for the small number of surface water samples
similarly contained a high percentage of representatives from the Methanomicrobiales and
Methanosarcinales, in both the large and small fractions (Annex 6).
In addition to the putative methanogenic groups mentioned above, other Euryarchaeota in
bottom waters included a large proportion of unclassified Euryarchaea and the Miscellaneous
Euryarchaeotic Group (MEG), which accounted for from 6% in the large fraction of SAS2B to 69%
of reads in the small fraction of BGR2. In the KWK samples Thermoplasmata were relatively more
abundant and represented up to 10% of the reads in the large fraction of KWK1. Finally,
Halobacteriales and the Deep Sea Euryarchaeotic Group (DSEG) were found in almost all samples,
but represented less than 1% of the reads. Crenarchaeota were also recovered and included the
Miscellaneous Crenarchaeotic Group (MCG), which was more common in the SAS valley and
represented up to 13 % of the reads in the large fraction of SAS2A. Other Crenarchaeota groups
(group C3, Thermoprotei and Crenarchaeotic Marine Benthic Group B) were <1% of all reads but
were present in all three valleys. Finally, the phylum Thaumarchaeota was present in the two BGR
valley ponds, one KWK and one SAS sample. Unclassified Archaea ranged from <1% in the small
fraction of KWK23 to 7% of reads for the small fraction of SAS1B (Figure 4-2).
Methanogenic Archaea were consistently among the five most abundant OTUs (defined at a
level of 97% similarity) for each valley. The two most abundant OTUs across all bottom water
samples were Methanoregula and Methanosaeta (Table 4-2). The KWK and SAS valleys shared
another abundant OTU of Methanoregula and the two other of the most abundant OTUs in the SAS
valley were also in the genus Methanoregula. The five most abundant OTUs in the SAS valley were
exclusively methanogenic Archaea. Other abundant OTUs in KWK and BGR valleys belonged to
66
the MEG and had high identity percentages with sequences isolated from a petroleum hydrocarbon-
contaminated aquifer. Other OTUs in the top five were either unclassified Euryarchaeota (BGR) or
Thermoplasmatales (KWK). The most abundant OTUs in the valleys showed no specificity to a
particular habitat type with high homology with sequences isolated from diverse freshwater and
marine environments.
Table 4-2. Identity of the 5 most abundant OTUs (defined at a level of 97% similarity) for each valley following the
lowest taxonomic level of the SILVA modified database (Lovejoy et al., 2015). The group Euryarchaeota,
Miscellaneous Euryarchaeotic Group (MEG) and Thermoplasmatales could not be further assigned. Percent (%)
represents the proportion of those single OTUs in the community for each valley.
Number
of reads
Valley Silva taxonomy %
identity
Accession
number
Genbank
taxonomy
Isolation source
68710
KWK
(22%)
BGR (14%)
SAS (11%)
Methanoregula 100 GU224062 uncultured
archaeon
lake water
44091 SAS(12%)
KWK(8%)
BGR(6%)
Methanosaeta
100 LN626810
uncultured
archaeon
Marine bioreactor
24882 KWK(8%)
SAS (3%)
Methanoregula 99 JN397914 uncultured
archaeon
spring pit
22248 KWK
(10%)
BGR (9%)
MEG
99 AY294412 uncultured
archaeon
hydrocarbon-
contaminated aquifer
20494
BGR(14%)
MEG
98 AY294414 uncultured
archaeon
hydrocarbon-
contaminated aquifer
19308
SAS(4%)
Methanoregula 98 KJ955705 uncultured
Methanoregula
hydrocarbon-
contaminated sediment
17934
BGR(8%)
Euryarchaeota
90 AB019748 uncultured
archaeon
deep-sea hydrothermal
vent
10585 SAS(3%) Methanoregula
98 JF304133 uncultured
archaeon
outfall sediment
9430 KWK (6%)
Thermoplasmatales 93 EU910624 uncultured
euryarchaeote
sediment
4.2.4. Methanogens inferred from the mcrA versus 16S rRNA analyses
The mcrA reads were strongly dominated by the Methanomicrobiales and contained a much
lower proportion of other methanogenic groups compared to the 16S rRNA community (Figure 4-
3). Methanomicrobiales accounted for 70% of mcrA reads versus 40% of the 16S rRNA reads in the
SAS sample, and 99% of mcrA reads versus 89% of 16S rRNA reads in the KWK sample.
Conversely, the proportion of Methanosarcinales was lower in the mcrA sequences with 30% of
mcrA versus 58% of 16S rRNA for the SAS sample and 0.3% of the mcrA versus 11% of 16S rRNA
reads for the KWK sample. The Methanobacteriales and Methanocellales that were recovered at
67
low relative abundance in the 16S rRNA reads were below 1% of reads in the mcrA results. The
order Methanomassiliicoccales was not detected in the 16S rRNA sequences but was found in the
mcrA community, with 0.3% of reads for the SAS sample and 0.03% of reads for the KWK samples
(Figure 4-3).
Figure 4-3. Comparison of the relative abundance of the methanogens in the mcrA community and the 16S rRNA
community. The left plot shows the entire methanogenic community and plot on the right shows the groups
representing less than 1% of the reads. The SAS sample is the large fraction (3-20µm) of the SAS2B ponds and the
KWK sample is the small fraction (0.2-3µm) of the KWK23 pond.
4.2.5. Environmental variables and archaeal community clustering
NMDS ordination based on the unweighted UniFrac phylogenetic distance was carried out
to determine how the measured environmental variables may have influenced archaeal community
structure. The two dimensional NMDS had a stress value of 0.085, which indicated good
representation of the community arrangement. The ordination of the bottom water communities was
significantly correlated with three environmental variables: TP (P=0.006), DOC (P=0.008) and pH
68
(P=0.006). The ordination was consistent with the community dendrogram analysis (Figure 4-2),
with the SAS valley communities being phylogenetically distinct relative to the two other valleys
(Figure 4-4). Clustering followed the isopleths of three variables; higher DOC (Figure 4-4a) and
lower TP (Figure 4-4b) and lower pH (Figure 4-4c) contributed to the separation of the SAS valley
from the other two valleys.
Figure 4-4. Non metric multidimensional scaling (NMDS) of the community composition. Phylogenetic Unifrac
distances are overlaid with environmental variables; (a) dissolved organic carbon, (b) total phosphorus and (c) pH.
4.3. Discussion
The bottom waters of all of the thaw ponds sampled in the present study harbored Archaea,
with a major fraction of the 16S rRNA reads (up to 60%) assigned to methanogenic taxa. These
results imply that archaeal methane-producers are likely to occur at relatively high concentration in
the microbial plankton and would contribute to the extreme accumulation of methane reported from
these ponds. For example, Laurion et al. (2010) measured up to 100 µmol CH4 L-1 at the bottom of
KWK23. In our study, Methanomicrobiales and Methanosarcinales dominated both 16S rRNA and
the mcrA transcripts. Both orders are widely reported from planktonic environments (see Auguet et
al., 2010), including boreal lakes (Jurgens et al., 2000). The two orders have also been found in
northern peatland soils (Jansson and Taş, 2014) and wetlands (Liebner et al., 2015), implying
habitat plasticity.
The putative high concentrations of methanogens based on the relative abundance of reads
would be consistent with the highly stratified water columns that create conditions for the
persistence of hypoxia or anoxia in the hypolimnion of the shallow ponds. Although the ponds were
thermally stratified at the time of sampling in summer, there is seasonal and interannual variability
in pond oxygen tensions, ranging from prolonged anoxia during the 6 months of winter ice-cover, to
69
full water column oxygenation during autumn mixing (Deshpande et al., 2015). There is evidence
that Methanomicrobiales in Arctic and peatland soils may be tolerant of variable redox conditions
(Hoj et al., 2006), which may contribute towards their occurrence and success in these subarctic
thaw ponds. This group of hydrogenotrophic methanogens may also be favored by the high
concentrations of CO2 that accumulate in the bottom waters of these lakes, for example up to 500
µmol CO2 L-1 in the anoxic bottom waters of KWK23 (Laurion et al., 2010). Extreme low
temperature environments are reported to favor acetotrophic methanogens over hydrogenotrophic
taxa, in sediments (Nozhevnikova et al., 1997) and soils (Metje and Frenzel, 2007), however at least
in summer, temperatures in the ponds were within the range that would favor the hydogenotrophic
taxa.
In the present study we used RNA as a template and amplified 16S rRNA rather than using
DNA, which would amplify the gene only. The rational was that the 16S rRNA would be a better
target the Archaea that were actively growing and producing proteins. There are reported
inconsistencies, however, between ribosomes (rRNA content) and growth rates and our RNA
approach only provides a measure of potentially active cells (Blazewicz et al., 2013). In the present
study, the mRNA of mcrA and 16S rRNA from the BGR ponds were inconsistent, with high
proportions of Methanomicrobiales 16S rRNA reads and no success in the amplification of the
transcripts of mcrA, which would indicate a higher probability of active methanogenesis (Juottonen
et al., 2008). The lack of successful amplification of the mcrA may be the result of methodological
problems, for example the delay between sampling and filtration because of the remoteness of the
BGR valley, and degradation of the messenger RNA. Alternatively it may indicate that viable
methanogens were present but that their methane-producing activity was suppressed at the
transcriptional level, for example by the ambient oxygen levels that were higher than in the other
ponds. Similarly, our detection of 16S rRNA reads for methanogens in the surface samples from a
small number of the ponds and the absence of mcrA transcripts in these samples would be consistent
with evidence from elsewhere that methanogens remain viable in oxygenated waters, but that such
conditions inhibit methanogenesis (Bastviken, 2009).
There was a clear effect of permafrost landscape type (palsa versus lithalsa) on archaeal
diversity and community structure. The permutation test on the UniFrac matrix showed that there
were no significant differences in archaeal community structure between the two lithalsa valleys
that differed in extent of permafrost degradation, from sporadic permafrost in the south (KWK) to
discontinuous permafrost in the north (BGR), but that SAS significantly differed from them both.
The thawing of an organic-rich palsa would release both particulate and dissolved organic carbon
70
into the pond water, and the SAS communities were well separated, clustering at the upper end of
the DOC gradient (Figure 4-4a). Soil archaeal communities are strongly shaped by carbon
availability and composition (Hansel et al., 2008), and methanogenic activity is related to organic
matter quantity and quality (Borrel et al., 2011). The degradation of the SAS palsas may result in a
not only more carbon but also a greater variety of organic substrates for methanogens compared to
the more mineral lithalsa soils. The greater variety of substrates could potentially support the more
diverse communities, and the greater proportion of Methanosarcinales. The five most abundant
OTUs for the SAS valleys were all methanogenic Archaea, but with different carbon strategies,
from the hydrogenotrophic genus Methanoregula (Borrel et al., 2011) to the obligate acetotrophic
genus Methanosaeta (Smith and Ingram-Smith, 2007). The newly discovered methanogenic order
Methanomasiliicoccales was detected in both ponds by the mcrA analysis, but at an order of
magnitude higher proportional abundance in the SAS sample.
The subarctic thaw lakes sampled here contained variable, often high concentrations of
suspended solids (Table 4-1). In systems elsewhere, such particles may influence community
structure. For example using the same fractionation protocol as in the present study, Galand et al.
(2008) reported greater diversity of Archaea in the particle-rich waters of an Arctic river and its
receiving coastal waters compared to the adjacent, more oligotrophic marine system. Here, we
failed to detect any systematic difference between the two fractions, in either diversity or
community structure. This may be due to methodological limitations, with the clogging of the 3 µm
filters and retention of the free-living fraction, or may simply reflect a lack of partitioning as a
function of particle size. In the more aerobic BGR ponds, particles may offer a refuge to anaerobic
methanogens as may occur in the ocean (Marty, 1993), but there was no evidence of methanogenic
enrichment in this fraction.
Other environmental variables that may select for specific archaeal taxa are pH and
inorganic nutrients. Archaeal diversity in soil can decrease with increasing pH (Tripathi et al.,
2013), in our water samples the SAS valley also had the lowest pH, consistent with such a pattern,
despite the narrow pH range between our ponds and sites. Phosphorus availability may also
influence diversity or select for certain groups. A study on rice roots indicated that high phosphate
concentrations inhibit members of the family Methanosarcinaceae and favored
Methanobacteriaceae (Lu et al., 2005), but the latter group was present only in low abundance in the
thaw ponds.
71
In conclusion, Euryarchaeota, were found in the microbial plankton of thaw ponds and had
a high proportion of the methanogenic orders Methanobacteriales and Methanosarcinales. The mcrA
reads indicated that the Methanomicrobiales dominated, and pointed to the importance of the
hydrogenotrophic pathway for methanogenesis in these waters. There was a distinct separation
between palsa and lithalsa sites, suggesting that the greater supply and diversity of carbon substrates
in the palsa ponds selected for a significantly different, more diverse archaeal community than in
the lithalsa ponds. These results imply that permafrost landscape type exerts a strong environmental
filtering effect on archaeal community structure in these northern aquatic environments.
4.4. Methods
4.4.1. Study site and sampling
Samples were collected 1 to 13 August 2012 and 31 July to 19 August 2013 from three
different valleys on the eastern side of Hudson Bay, in northern Quebec, Canada. The KWK
(55◦16’N; 77◦46’W) and SAS (55◦13’N; 77◦42’W) valleys are located near the village of
Whapmagoostui-Kuujjuarapik, in a region of sporadic permafrost where permafrost covers less than
2% of the landscape. The BGR valley (56◦37’N; 76◦13’W) is situated 100 km north of the two other
valleys, in the discontinuous permafrost region, close to the village of Umiujaq. The SAS valley is
covered in peatland and ponds from the thawing of organic palsas (Bhiry and Robert, 2006), while
BGR and KWK ponds originated from lithalsas (Calmels et al., 2008). Two to three ponds were
selected from each valley: BGR1 and BGR2, KWK1, 6, 23 and SAS1B, 2A and 2B. Pond number
and names were chosen to be consistent with previous literature for this region (Laurion et al., 2010;
Breton et al., 2009; Calmels et al., 2008; Crevecoeur et al., 2015; Comte et al., 2015). All of the sites
were accessed by helicopter and the ponds were sampled from an inflatable boat positioned over the
central region of maximum depth. Profiles of temperature, dissolved oxygen (DO), and pH were
taken with a 600R multiparametric probe (Yellow Spring Instrument). Bottom samples of the
microbial plankton communities were collected using a horizontally mounted Van Dorn bottle
(Wilco) positioned 0.5 m above the sediments. The water was immediately transferred to acid-
washed, 4-L Cubitainers® that were rinsed three times with sample water prior to filling, and were
overfilled to avoid oxygenation Surface samples were also collected in rinsed Cubitainers, held 0.2
m beneath the pond surface. All Cubitainers were capped and placed in coolers after filling, and
were returned to the laboratory by helicopter for immediate filtration.
72
4.4.2. Physico-chemical and molecular analysis
Water samples for physico-chemical analysis (DOC, TSS and TP) and for molecular
analysis (RNA) were processed as in Crevecoeur et al. (2015). The samples for nucleic acids were
extracted with the AllPrep DNA/RNAMini Kit (Qiagen) modified to include an additional step
using polyvinylpyrrolidone (PVP, Alfa Aesar) to minimize potential PCR inhibition. RNA was
converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied
Biosystems-Ambion). Amplification of the V6-V8 region of 16S rRNA and mcrA was performed
using the sequence specific regions described respectively in Comeau et al. (2011) and Luton et al.
(2002) using a two-step dual-indexed PCR approach modified for Illumina instruments. In a first
step, the gene specific portion was fused to the Illumina TruSeq sequencing primers (Annex 8) and
PCR was carried out in a total volume of 25 µL that contained HF buffer 1X (NEB), 0.25 µM of
each primer, 200 µM of each dNTPs (Life Technology), dimethylsulfoxide (DMSO, NEB) at a final
concentration of 3 %, 1 U of Phusion High-Fidelity DNA polymerase (NEB) and 1 µL of template
cDNA. To decrease potential primer bias, two more reactions with 5 and 10 fold diluted template
were also carried out for each sample. Temperature and duration of thermal cycling were started
with an initial denaturation at 98°C for 30 s followed by 40 cycles of denaturation at 98°C for 10 s,
annealing at 55°C for 10 s, extension at 72°C for 30 s and a final extension at 72°C for 300 s. The
three dilutions reaction were pooled together and purified using the Axygen PCR cleanup kit
(Axygen). Quality and quantity of the purified PCR product were checked on a 1% agarose gel.
Fifty to 100 fold dilution of this purified product was used as a template for a second PCR step with
the goal of adding barcodes (dual-indexed) and missing sequence required for Illumina sequencing
(Annex 8). This second PCR was done in triplicates under the same conditions as the first PCR but
with 13 cycles. Triplicates were pooled together and purified as above and then quantified
spectrophotometrically with the Nanodrop 1000 (Thermo Fisher Scientific). Barcoded amplicons
were pooled in equimolar concentration for sequencing on the Ilumina MiSeq at the Plateforme
d’Analyses Génomiques (IBIS, Université Laval, Québec, Canada). Please note that primers used in
this work contain Illumina specific sequences protected by intellectual property (Oligonucleotide
sequences © 2007-2013 Illumina, Inc.). The raw Illumina sequences have been deposited in the
Short Read Archive database under the accession number SRP069874.
4.4.3. Bioinformatic analysis
Sequences of 16S rRNA were analysed using the UPARSE pipeline for Illumina paired-end
reads (Edgar, 2013) involving merging pair-ends, quality filtering with a 1.0 expected error rate,
dereplication of sequences, sorting sequences by size, removing singletons, clustering OTUs at
73
≥97%, discarding chimeras, indexing OTUs names and creating OTU tables. The downstream
analyses were done within the Qiime pipeline (Caporaso et al., 2010). Taxonomic assignment of
these OTUs was performed using the mothur classifier (Schloss et al., 2009) with a 0.8 confidence
threshold based on the SILVA reference database (Pruesse et al., 2007) modified to include
sequences from our curated 16S rRNA gene sequence database (Lovejoy et al., 2015). Amplicons
of mcrA were analysed with the FunGene pipeline of RDP server
(http://fungene.cme.msu.edu/FunGenePipeline/) (Fish et al., 2013). Reads shorter than 150 nt were
discarded and chimeras were checked and removed with UCHIME. Sequences were translated and
compared to the mcrA reference sequence with FrameBot for correcting frameshift errors,
sequences having in-frame stop codons were discarded. Amino acid sequences were aligned with
HMMER3 and then clustered at 84% similarity that corresponds to OTU level of 97% for 16S
rRNA (Yang et al., 2014). A custom mcrA database was constructed by downloading mcrA
sequences from the Functional Gene Repository v.8.0 with score no lower than the HMM training
sequences. Reference sequences were checked against the NCBI nr database and the in house
database was manually curated to ensure all families of methanogens were represented. Taxonomic
affiliation of the representative sequences of mcrA OTUs was defined by alignment with the
reference database using the BLASTp algorithm. A Neighbour Joining (1000 bootstrap) tree
following the Poisson model was constructed to assign taxonomy to sequences hitting uncultured
methanogens.
Shannon and Chao1 diversity indexes for the 16S rRNA were estimated using the command
alpha_diversity.py available in Qiime. Data were tested for normal distribution using the Shapiro-
Wilk test and homoscedasticity with the Bartlett test. Three-way analysis of variance (three-way
ANOVA) was used to assess differences in diversity indexes between valleys, fractions, and year.
An a posteriori Tukey HSD test was run to identify differences between valleys. For beta-diversity
analyses, OTU tables were subsampled 100 times at 22,200 reads for 16S rRNA and 30,800 reads
for mcrA. This number of reads corresponds each time to the smallest number of reads per sample
minus 10%. A tree for the 16S rRNA was constructed in Qiime using the method Fasttree in order
to calculate the unweigthed Unifrac phylogenetic distance (Lozupone and Knight, 2005) using the
command beta_diversity.py.
Further statistical analyses were done with R (R Core Team, 2013) (version 3.0.1) and
Qiime. A non-metric multidimensional scaling (NMDS) with the UniFrac distance was also used to
visualize the influence of the environmental variables on the community. The NMDS was
performed in R using the function monoMDS with a principal coordinates analysis done with the
74
function wcmdscale as a starting configuration. Correlations between the environmental variables
and the ordination were tested in R with the envfit function. The selected significant environmental
variables were then plotted on the ordination using the ordisurf function. These functions were
employed via the vegan package (Oksanen et al. (2013). Vegan: Community Ecology Package. R
package version 2.0-8. http://CRAN.R-project.org/package=vegan; last accessed January 2016).
Statistical significance of difference between communities was assessed using permutation test
adonis on the UniFrac distance matrix under the function compare_category.py. Pairwise
comparisons were then processed using the function make_distance_boxplot.py. The resulting p-
values were corrected with Bonferroni. Both of these commands are available in Qiime (Caporaso
et al., 2010). The five most abundant OTUs for each valley were subsequently submitted to a
BLASTn against the GenBank nr database to assess identification and isolation source of the closest
matches.
4.5. Acknowledgements
We acknowledge the Natural Sciences and Engineering Research Council of Canada
(NSERC) funding for Discovery Grants to WFV and CL, the Discovery Frontiers grant ADAPT
and Canada Research Chair support to WFV, the Network of Centres of Excellence ArcticNet
support for WV and CL, and the Fonds de Recherche du Québec-Nature et Technologies (FRQNT)
for funding for the Centre d’Études Nordiques (CEN). Computing support was provided by
CLUMEQ/Compute Canada. We thank Jérôme Comte and Adam Monier for help in bioinformatics
and statistic. We are also grateful to Claude Tremblay at the Whapmagoostui-Kuujjuarapik CEN
station, the pilots of Canadian Helicopter Ltd., Anna Przytulska-Bartosiewicz, Bethany Deshpande,
Paschale Noël Bégin, and Alex Matveev for aid in the field, Marianne Potvin for laboratory
assistance and the development of protocols.
75
Chapitre 5. Conclusion générale
Cette thèse a permis de mieux comprendre l’organisation des communautés microbiennes
dans les mares de fonte en plus de mettre en lumière des résultats inédits sur la présence et l’activité
des micro-organismes planctoniques impliqués dans le cycle du méthane. Les principales
contributions de cette thèse ainsi que les perspectives qu’elle ouvre pour de futures recherches sont
détaillées dans cette conclusion générale. Même si les observations rapportées ici sont spécifiques
au nord du Québec, les mares de thermokarst sont extrêmement abondantes à travers tout l’Arctique
(Grosse et al., 2013). Les découvertes faites dans le cadre de ce travail suggèrent l’existence de
caractéristiques générales qui peuvent être appliquées à ce type d’écosystème d’eau douce
prédominant dans le Nord.
5.1. Dominance des micro-organismes impliqués dans le cycle du
méthane
Pour les deux domaines de la vie étudiés ici, on voit une forte dominance dans la
communauté de micro-organismes impliqués dans le cycle du méthane, c’est-à-dire les bactéries
méthanotrophes et les archées méthanogènes. Tout d’abord, en ce qui concerne les méthanotrophes,
leur présence a été attestée dans tous les échantillons en très grande proportion (jusqu’à 27% de la
communauté dans certains échantillons) et seulement des méthanotrophes de Type I ont été
identifiés avec le gène 16S. Cette proportion est très élevée si on la compare avec d’autres
écosystèmes aquatiques où les méthanotrophes représentent environ 2 à 3% de la communauté
planctonique (Eller et al., 2005; Comeau et al., 2012). Les proportions que l’on retrouve dans les
mares de fonte s’apparentent donc plutôt à ce qui a été observé dans les sédiments du lac
Washington (environ 15% de la communauté) (Costello et Lidstrom, 1999), dans la tourbe (environ
6%) (Serkebaeva et al., 2013) ou dans le sol de la toundra (de 1 à 23%) (Vecherskaya et al., 1993).
Les méthanotrophes font aussi partie des unités taxonomiques opérationnelles (UTOs) les plus
abondantes, plus particulièrement le genre Methylobacter.
Ensuite, l’amplification du transcrit du gène fonctionnel pmoA dans la plupart des
échantillons au chapitre 3 confirme l’activité métabolique des méthanotrophes détectés avec le
transcrit du gène 16S au chapitre 2. La composition de la communauté obtenue avec les deux gènes
est assez similaire, car dans les deux cas, la communauté est composée presque essentiellement de
méthanotrophes de Type I avec une dominance prononcée du genre Methylobacter. Cependant,
l’analyse de la communauté à partir des transcrits du gène pmoA permet aussi de détecter la
présence de méthanotrophes de Type II en très faible abondance. Ici le gène fonctionnel permet
76
d’avoir des résultats plus complets sur la composition de la communauté des méthanotrophes, mais
ces résultats peuvent aussi être dus au fait que deux techniques de séquençage différentes ont été
utilisées. En effet, le pyroséquençage 454 utilisé au chapitre 2 offre une moins grande profondeur
de séquençage que le séquençage Illumina MiSeq utilisé au chapitre 3 (Shokralla et al., 2012).
Enfin, les archées méthanogènes sont aussi retrouvées en forte abondance dans tous les
échantillons de fond (et quelques échantillons de surface). Cela souligne l’importance des
méthanogènes planctoniques dans les mares de fonte subarctiques contrairement aux mares de fonte
arctiques où les méthanogènes ont surtout été trouvés dans les sédiments (Negandhi et al., 2013).
Dans nos échantillons, la proportion des archées méthanogènes peut atteindre environ 70% de la
communauté, alors que dans les autres écosystèmes d’eau douce les méthanogènes ne représentent
en général pas plus de 30% (Auguet et al., 2010). La forte proportion que l’on observe ici
correspond plutôt à celle trouvée dans le sol des rizières (entre 37 et 88%) (Lee et al., 2015) ou dans
la couche supérieure des sédiments d’un lac méromictique (jusqu’à 90%) (Borrel et al., 2012). Les
méthanogènes sont en général plutôt retrouvés dans les sédiments ou le sol, bien que le groupe
Methanomicrobiales, qui fait partie d’un des groupes les plus abondants dans nos échantillons, est
considéré comme prédominant dans les écosystèmes d’eau douce (Auguet et al., 2010). Les archées
méthanogènes font aussi partie des UTOs les plus abondantes dans les mares de fontes surtout en ce
qui concerne les genres Methanoregula et Methanosaeta qui disposent de métabolismes différents,
respectivement hydrogénotrophe et acétotrophe obligatoire.
Contrairement aux méthanotrophes, il n’a pas été possible d’amplifier le transcrit du gène
fonctionnel mcrA pour tous les échantillons et de mesurer l’activité des méthanogènes avec la
qPCR. Il est donc difficile de savoir si les méthanogènes identifiés dans le fond des mares de fonte
sont vraiment actifs. Néanmoins, l’amplification du transcrit du gène mcrA dans deux échantillons
permet de supposer que les méthanogènes peuvent être actifs au moins dans ces deux mares-là. En
comparant les communautés identifiées avec les transcrits du gène 16S rARN et du gène mcrA, on
remarque une composition de la communauté assez similaire, mais les proportions de
Methanomicrobiales augmentent avec le mcrA, ce qui suppose que ce groupe participe plus
activement à la méthanogenèse et donc que la voie métabolique dominante pour la synthèse de
méthane est hydrogénotrophique. De nouveau, l’analyse de la communauté à l’aide du gène
fonctionnel amène la détection d’un groupe qui n’était pas reporté avec le 16S rARN, c’est-à-dire
les Méthanomassiliicoccales. Cette fois, cette différence n’est pas due à une limitation technique
puisque les deux transcrits de gènes ont été séquencés avec la plate-forme Illumina MiSeq.
77
Les micro-organismes impliqués dans le cycle du méthane représentent donc une forte proportion
de la communauté microbienne planctonique dans les mares de fonte. L’identification des micro-
organismes par le biais de l’analyse des gènes fonctionnels est compatible avec l’analyse du gène
16S rARN, mais semble permettre l’identification d’une plus grande diversité de micro-organismes
impliqués dans le cycle du méthane.
5.2. Influence de l’origine des mares et du gradient de fonte du
pergélisol
Les compositions des différentes communautés microbiennes étudiées dans cette thèse sont
principalement influencées par la vallée d’échantillonnage. À plus grande échelle, on voit une
distinction assez claire entre les communautés de mares issues de palses (à dominance organique)
ou de lithalses (à dominance minérale). Par contre, l’influence du gradient de fonte du pergélisol est
beaucoup moins marquée. En effet, les communautés microbiennes de la vallée KWK semblent
structurellement et phylogénétiquement plus proches des communautés des vallées BGR et NAS,
alors que ces dernières ne se trouvent pas dans la même zone de dégradation du pergélisol. La
nature du carbone plutôt que la quantité de l’apport du carbone allochtone a donc plus d’influence
sur la communauté. Pour la communauté des archées, le riche apport en carbone organique
allochtone favorise même une plus grande diversité telle qu'observée dans la vallée SAS. Ce type de
relation a déjà été remarqué pour le bactérioplancton (Landa et al., 2013) et l’archéoplancton
(Galand et al., 2008) et dépend de la diversité de la matière organique dissoute disponible pour la
dégradation microbienne. En effet, le carbone organique dissous peut prendre différentes formes (de
labile à récalcitrant). Le carbone organique labile stimule le bactérioplancton métaboliquement actif
et, une fois ce substrat dégradé, les matières organiques semi-labiles et récalcitrantes peuvent être
décomposées par des taxons spécialistes, ce qui augmente la diversité microbienne dans son
ensemble (Li et al., 2012; Nelson et Wear, 2014). En résumé, la diversité de substrat de la matière
organique et non sa quantité, mène à une plus grande diversité microbienne (Galand et al., 2008;
Hansel et al., 2008). Dans le contexte de fonte du pergélisol, il est difficile de savoir comment la
réactivité de la matière organique dissoute va évoluer, mais la labilité du carbone est censée
augmenter avec la fonte (Hodgkins et al., 2014).
Dans l’ensemble, la composition des communautés microbiennes étudiées dans cette thèse
est principalement influencée par l’origine de la formation des mares plutôt que par le gradient de
dégradation du pergélisol. Cela reflète l’interdépendance entre la communauté microbienne et la
nature du carbone disponible pour la dégradation alors que la quantité du carbone relargué dans les
mares semble avoir moins d’impact sur les communautés microbiennes.
78
5.3. Influence des facteurs environnementaux
Les différences de communautés entre les mares issues de palses et de lithalses sont aussi
liées à des variables environnementales clefs. En effet, les mares issues de palses sont en général
plus acides et moins productives (plus faible concentration en phosphore total et en chlorophylle a)
et plus riches en carbone organique dissous que les mares issues de lithalses. Ces variables sont déjà
reconnues dans la littérature pour leur forte influence sur les communautés microbiennes. Tout
d’abord, l’origine allochtone ou autochtone du carbone organique dissous influence la composition
des communautés microbiennes (Kritzberg et al., 2006). Ensuite, le pH est un élément essentiel
pour la caractérisation des communautés microbiennes et a été identifié comme le facteur qui
explique le mieux la distribution biogéographique des communautés bactériennes dans le sol (Fierer
et Jackson, 2006) et dans les lacs (Lindström et al., 2005). Enfin, le phosphore est souvent un
élément limitant pour la croissance des microbes dans les écosystèmes d’eau douce (Vadstein,
2000) et l’apport de phosphore combiné à d’autres nutriments a le potentiel de modifier la
composition de la communauté (Newton et McMahon, 2011). Dans la vallée SAS, les
concentrations en phosphore sont moins élevées que dans les autres vallées. Le phosphore est
d’ailleurs en général un élément limitant dans les tourbières où la dégradation du carbone est
contrôlée par la disponibilité en phosphore (Lin et al., 2014). L’apport en phosphore stimule aussi le
potentiel d’oxydation du méthane (Liu et al., 2012) et a été identifié ici comme un des facteurs qui
influence l’activité des méthanotrophes mesurée à partir du nombre de transcrits de pmoA. L’effet
stimulant du phosphore sur l’activité bactérienne en général se répercute donc sur les
méthanotrophes qui constituent une forte proportion de la communauté microbienne des mares de
fonte. Les matières en suspension semblent aussi être impliquées dans l’activité des méthanotrophes
alors que ce facteur a très peu d’impact sur la composition des communautés microbiennes (pas de
différence de composition de la communauté entre les fractions de taille). Il est possible qu’un
assemblage complexe de microbes soit associé aux particules (Grossart et Simon, 1998) où des
archées méthanogènes profiteraient de microzones anoxiques au sein des particules pour produire
du méthane (Marty, 1993), qui serait ensuite directement oxydé par des bactéries méthanotrophes à
la surface des particules. Dans le cas de cette étude, l’activité des méthanotrophes ne suit pas le
même patron que la composition de la communauté. L’absence de lien apparent entre la diversité et
la fonction des bactéries méthanotrophes peut s’expliquer par le concept de redondance
fonctionnelle, où différentes espèces détiennent le même rôle dans l’environnement les rendant
interchangeables (Rosenfeld, 2002).
79
En bref, certaines variables environnementales clefs comme la concentration en carbone
organique dissous, la concentration en phosphore et le pH, contribuent à la distinction des
communautés microbiennes entre les mares issues de palses et de lithalses. À l’exception du
phosphore, des variables différentes influencent l’activité des méthanotrophes comme les particules
en suspension et la conductivité, ce qui illustre un découplage entre la diversité et la fonction des
bactéries méthanotrophes. Il n’est donc pas possible de tirer des conclusions sur l’expression d’un
trait microbien en se basant uniquement sur la diversité de sa communauté.
5.4. Implication scientifique
Les effets du réchauffement climatique sont ressentis de manière beaucoup plus intense
dans les régions arctiques et subarctiques. Si la tendance se maintient, le réchauffement pourrait
contribuer à une augmentation de 30% des taux d’émission de méthane des lacs et mares nordiques
(Wik et al., 2016). Dans la région de Kuujjuarapik, des anomalies de températures sept fois plus
élevées que la moyenne ont été mesurées durant les dernières années (Bhiry et al., 2011). Ces
augmentations de températures peuvent avoir plusieurs conséquences. Par exemple, la stratification
thermique observée durant l’été dans les mares de fonte risque d’être renforcée par des températures
atmosphériques plus chaudes et de s’établir pendant plus longtemps. Ce renforcement de la
stratification peut mener aussi à un gradient physico-chimique plus intense au sein de la colonne
d’eau, où les conditions anoxiques vont prévaloir dans le fond (Vincent, 2009). Pour l’instant,
l’anoxie n’était pas systématiquement présente dans le fond des mares échantillonnées durant l’été.
Les mares plus au nord des vallées BGR et NAS, bien que stratifiées, étaient oxiques dans le fond
de la colonne d’eau au moment de l’échantillonnage. À l’avenir, on peut donc s’attendre au
développement de conditions hypoxiques à anoxiques dans le fond des mares des vallées situées
plus au nord ainsi qu'à un renforcement et une expansion de la zone anoxique pour les mares des
vallées situées plus au sud. Ces changements de conditions vont perturber les communautés
microbiennes et favoriser l’établissement de microbes au métabolisme anaérobie comme le groupe
des Chlorobi, déjà présent en forte abondance dans les fonds des mares des vallées KWK et SAS.
Au vu des résultats obtenus dans cette thèse, ce changement de communauté sera aussi influencé
par l’origine des mares, c’est-à-dire palse ou lithalse.
Les effets du changement climatique vont donc amener des conditions plus propices pour la
synthèse de méthane dans la colonne d’eau des mares de fonte. Les archées méthanogènes qui
constituent déjà le groupe d’archées dominant dans ces mares aura alors le potentiel de s’activer.
Pour l’instant, l’absence d’amplification du transcrit du gène fonctionnel mcrA dans la plupart des
échantillons ne nous permet pas de supposer que la forte proportion d’archées méthanogènes
80
présente dans le fond des mares participe activement à la synthèse de méthane au moment de
l’échantillonnage. Dans ce cas, le méthane émis depuis les mares peut provenir de méthanogènes
qui seraient plutôt actifs dans les sédiments, comme cela a été observé pour les mares de fonte de
l’Arctique canadien (Negandhi et al., 2013) ou résulter du dégazage du vieux méthane resté
prisonnier dans le sol gelé (Bouchard et al., 2015). Si les méthanogènes planctoniques deviennent
actifs, il y a donc un très fort potentiel pour une augmentation de la synthèse de méthane et donc
une libération d’une plus grande quantité de méthane dans l’atmosphère.
Au final, la quantité de méthane qui s’échappe des mares dans l’atmosphère dépend de
l’équilibre entre l’activité des méthanogènes et des méthanotrophes. Dû à leur métabolisme aérobie,
les méthanotrophes doivent trouver un compromis entre la disponibilité en méthane et en oxygène,
mais les seuils de concentration de ces gaz à partir desquels les méthanotrophes deviennent actifs
sont méconnus. De plus en plus d’évidences amènent à penser que les bactéries méthanotrophes
sont en fait microaérobiques (Vecherskaya et al., 2009; Blees et al., 2014) et peuvent tenir leur
apport en oxygène via des associations avec d’autres types d’organismes comme des phototrophes
(Milucka et al., 2015; Oswald et al., 2015) ou des dénitrificateurs (Beck et al., 2013; Liu et al.,
2014) pour rester actives même dans des conditions très pauvres en oxygène. De plus, la pression de
broutage par les protistes étant moins forte dans les eaux hypoxiques, les méthanotrophes peuvent
ainsi éviter la prédation. Seulement, avec l’intensification du réchauffement climatique, les mares
de fonte vont faire face à une augmentation de la durée des périodes de fontes des glaces et de
stratification, ce qui perturbera les conditions d’oxygénation. Alors qu’une plus forte oxygénation
pourrait avantager les bactéries méthanotrophes par rapport aux archées méthanogènes, des plus
fortes conditions de stratification pourraient au contraire altérer les processus d’oxydation du
méthane et en favoriser la synthèse par les archées méthanogènes. Les résultats de cette thèse
permettent cependant de conclure que les micro-organismes impliqués dans le cycle du méthane
sont capables de développer des stratégies pour rester présents et actifs jusqu’aux limites de leurs
conditions optimales en oxygène. En somme, les écosystèmes de mares de fonte sont au centre des
perturbations que subit l’environnement à cause du réchauffement global. Les communautés
microbiennes risquent de subir des changements dans leur composition qui vont dépendre en grande
partie de l’origine de la mare (palse ou lithalse). De plus, l’équilibre entre la méthanogenèse et la
méthanotrophie risque d’être perturbé par l’impact du réchauffement climatique favorisant
potentiellement la méthanogenèse par rapport à la méthanotrophie. Les méthanotrophes semblent
néanmoins disposer de stratégies pour rester actifs dans des eaux très faibles en oxygène.
81
5.5. Perspectives
Tout au long de cette thèse, les fractions de tailles utilisées pour distinguer les
communautés de micro-organismes libres ou attachés aux particules ont mené à l’identification de
communautés semblables. Pourtant, dans la littérature, ces fractions de tailles ont été utilisées avec
succès pour différencier les communautés libres et attachées (Crump et al., 1999; Galand et al.,
2008; Mohit et al., 2014). Dans cette thèse, la composition des deux communautés est restée
similaire pour les bactéries, les archées et les méthanotrophes. Par contre, la richesse spécifique de
la communauté bactérienne était plus élevée dans la grande fraction, ce qui suppose que des
bactéries libres se sont retrouvées sur les filtres de 3 µm, augmentant ainsi la diversité et masquant
les différences de composition entre les deux communautés. En effet, les mares de fonte contiennent
énormément de grosses particules en suspension de 10 µm à 1 cm de diamètre qui peuvent
rapidement boucher le filtre de 3 µm et ainsi retenir toute la communauté libre ou attachée sur ce
filtre (Deshpande et al., 2016). La présence de particules plus petites que 3 µm (Watanabe et al.,
2011) peut aussi amener à la présence de bactéries attachées aux particules sur le filtre de 0.22 µm.
Dans le futur, il serait souhaitable de définir de nouvelles fractions de tailles adaptées aux systèmes
riches en matière en suspension comme les mares de fonte. La caractérisation de la composition des
communautés microbiennes à partir du gène ARNr 16S est une technique largement utilisée pour
laquelle des outils bio-informatiques et bases de données complètes facilitent l’analyse. Néanmoins,
ces techniques demandent de passer par une étape de PCR qui peut initier des biais dans la
composition de la communauté microbienne selon le choix des amorces (Hong et al., 2009) et sur
l’estimation de l’abondance totale et relative des OTUs (Engelbrektson et al., 2010). En outre,
l’utilisation de gènes fonctionnels amène à l’identification d’une plus grande diversité fonctionnelle
qui n’est pas toujours détectée avec l’ARN 16S. Pour avoir un meilleur aperçu de la diversité
taxonomique et fonctionnelle dans les mares de fonte, il serait approprié d’utiliser les techniques de
métagénomique et métatranscriptomique, qui permettent de séquencer la quasi-totalité des gènes ou
transcrits présents dans l’échantillon (Thomas et al., 2012; Logares et al., 2014). Ces deux
techniques ont déjà révélé un potentiel de découverte de nouveaux organismes non repérés par les
techniques de séquençage d’amplicons (Gilbert et al., 2008).
À l’avenir, il serait crucial de mieux comprendre quels sont les seuils d’activité des
méthanogènes et des méthanotrophes. Mesurer l’activité des micro-organismes est une tâche assez
difficile. Dans cette thèse, l’approche qui a été utilisée est la mesure des transcrits, donc l’étape
précédant la traduction de l’ARN messager en protéine. L’information concernant la régulation des
gènes fonctionnels mcrA et pmoA dans les cellules est assez méconnue. L’analyse des mécanismes
82
de régulation de la transcription et de la traduction du gène pmoA en laboratoire représente un défi,
car il n’est pas possible de le cloner entièrement puisque certaines parties sont toxiques pour la
bactérie Escherichia coli. La concentration en cuivre semble être un des principaux facteurs qui
régule l’expression du gène pmoA (Gilbert et al., 2000; Knapp et al., 2007). L’étude des transcrits
permet donc de savoir si la cellule est métaboliquement active et prête à synthétiser la protéine
nécessaire à la réaction, mais dans notre cas il n’est pas possible de savoir si le méthane est
vraiment synthétisé ou consommé par les micro-organismes. Une autre approche pour évaluer
l’activité des micro-organismes consiste à mesurer le processus de synthèse ou de consommation du
méthane en aval. Par exemple, pour mesurer le taux de production du méthane, il est possible
d’incuber un substrat et ensuite de mesurer les rendements de production de méthane en fonction du
temps comme dans les études de Metje et Frenzel (2007), Grossart et al. (2011) et Wilkins et al.
(2015). Les deux dernières références combinent ces résultats avec des approches moléculaires.
Wilkins et al. (2015) trouvent même une corrélation positive entre le nombre de transcrits de mcrA
et le taux de production du méthane et supposent donc que l’on peut déduire l’un à partir de l’autre.
Pour la méthanotrophie, beaucoup d’études utilisent l’approche des isotopes stables ("stable-isotope
probing", SIP), qui implique de fournir aux méthanotrophes un substrat marqué par un isotope
stable (13C) et de détecter la présence de cet isotope dans l’ARN ou les acides gras dérivés des
phospholipides (PLFAs). La technique du PLFAs-SIP est plus efficace pour détecter l’oxydation de
méthane par les méthanotrophes, car la limite de détection de carbone marqué dans les acides gras
est un ordre de grandeur plus bas que dans l’ARN (Bengtson et al., 2009). Ces techniques
permettent de confirmer si le méthane a bien été consommé et incorporé dans les structures
bactériennes. Cependant, l’application de ces techniques demande la mise en place d’expériences
d’incubation qui ne reflètent pas exactement les conditions in situ, mais correspond plutôt à un
potentiel de méthanotrophie pour le milieu (Radajewski et al., 2003). La combinaison des
techniques de SIP et la mesure moléculaire des transcrits du gène permettrait donc d’avoir une
image plus complète des processus métaboliques avant et après leur réalisation. Il serait aussi
nécessaire d’investiguer de manière plus complète les facteurs qui influencent l’activité des micro-
organismes. En effet, dans cette thèse, l’activité des méthanotrophes est seulement partiellement
expliquée par les variables environnementales mesurées, ce qui met en lumière l’importance
potentielle d’autres types de variables pour expliquer l’activité des méthanotrophes comme, par
exemple, le contrôle descendant ("top-down") du broutage par les protistes ou le contrôle ascendant
("bottom-up") de la lyse virale.
83
Aussi, la composition et la fonction des communautés microbiennes restent encore
inconnues durant les autres périodes de l’années, notamment pendant les événements de mélange
automnaux et printaniers ainsi que durant la période de stratification inverse qui s’établit pendant
l’hiver. Les conditions de brassage de la colonne d’eau risque de perturber les communautés de
méthanogènes et méthanotrophes, ainsi que d’induire une possible ventilation du méthane vers
l’atmosphère sans que les méthanotrophes ne puissent efficacement le consomer. Par contre, durant
les conditions de stratification hivernale, l’entièreté de la colonne d’eau de certaines mares peut
alors devenir anoxique (Deshpande et al., 2015) ce qui contibue à l’établissement de condition plus
favorables pour les méthanogènes, bien que la diminution de la température peut aussi amener une
diminution de la production de méthane (Yvon-Durocher et al., 2014). Ces conditions risque d’être
moins optimale pour les méthanotrophes étant donné l’absence d’oxygènes, et les changements de
température pourrait amener à l’établissement d’une communauté de méthanotrophes différente
plus adaptés aux froid comme les méthanotrophes de Type II (He et al., 2012).
En résumé, de futures recherches sur les mares de fonte devraient s’orienter vers
l’utilisation de techniques de séquençage plus complètes comme la métagénomique et la
métatranscriptomique pour mieux identifier la diversité phylogénétique et fonctionnelle de la
communauté microbienne. L’étude moléculaire de l’activité des micro-organismes impliqués dans
le cycle du méthane devrait aussi être couplée à des expériences d’incubation d’isotopes stables afin
d’avoir une vue d’ensemble plus exhaustive de l’activité métabolique de méthanotrophes et
méthanogènes. Il serait aussi intéressant d’appliquer les approches utilisées dans cette étude à une
plus grande gamme de conditions géographiques dans les régions Subarctique et Arctique, et
d’étendre ce travail tout au long de l’année pour étudier le cycle du méthane durant les autres
saisons.
84
Bibliographie
Allard, M., and Seguin, M. K. (1987). Le pergélisol au Québec nordique : bilan et perspectives.
Géographie Phys. Quat. 41, 141–152. doi:10.7202/032671ar.
Allgaier, M., and Grossart, H. (2006). Diversity and seasonal dynamics of actinobacteria
populations in four lakes in northeastern germany. Appl. Environ. Microbiol. 72, 3489–3497.
doi:10.1128/AEM.72.5.3489.
Andresen, C. G., and Lougheed, V. L. (2015). Disappearing Arctic tundra ponds: Fine-scale
analysis of surface hydrology in drained thaw lake basins over a 65 year period (1948-2013).
J. Geophys. Res. Biogeosciences 120, 466–479. doi:10.1002/2014JG002778.
Arlen-Pouliot, Y., and Bhiry, N. (2005). Palaeoecology of a palsa and a filled thermokarst pond in a
permafrost peatland, subarctic Québec, Canada. The Holocene 15, 408–419.
doi:10.1191/0959683605hl818rp.
Auguet, J.-C., Barberan, A., and Casamayor, E. O. (2010). Global ecological patterns in uncultured
Archaea. ISME J. 4, 182–190. doi:10.1038/ismej.2009.109.
Azam, F., and Graf, J. S. (1983). The ecological role of water-column microbes in the sea. Mar.
Ecol. Prog. Ser. 10, 257–263.
Bapteste, E., Brochier, C., and Boucher, Y. (2005). Higher-level classification of the Archaea:
evolution of methanogenesis and methanogens. Archaea 1, 353–363.
doi:10.1155/2005/859728.
Barber, R. D., Zhang, L., Harnack, M., Olson, M. V, Kaul, R., Ingram-Smith, C., and Smith, K. S.
(2011). Complete genome sequence of Methanosaeta concilii, a specialist in aceticlastic
methanogenesis. J. Bacteriol. 193, 3668–3669. doi:10.1128/JB.05031-11.
Barbier, B. A., Dziduch, I., Liebner, S., Ganzert, L., Lantuit, H., Pollard, W., and Wagner, D.
(2012). Methane-cycling communities in a permafrost-affected soil on Herschel Island,
Western Canadian Arctic: active layer profiling of mcrA and pmoA genes. FEMS Microbiol.
Ecol. 82, 287–302. doi:10.1111/j.1574-6941.2012.01332.x.
Bastviken, D. (2009). “Methane,” in Encyclopedia of Inland Waters, ed. G. Likens (Oxford:
Elsevier), 783–805.
Bastviken, D., Cole, J. J., Pace, M. L., and Van de Bogert, M. C. (2008). Fates of methane from
different lake habitats: Connecting whole-lake budgets and CH4 emissions. J. Geophys. Res.
113, G02024. doi:10.1029/2007JG000608.
Beck, D. A. C., Kalyuzhnaya, M. G., Malfatti, S., Tringe, S. G., Glavina Del Rio, T., Ivanova, N.,
Lidstrom, M. E., and Chistoserdova, L. (2013). A metagenomic insight into freshwater
methane-utilizing communities and evidence for cooperation between the Methylococcaceae
and the Methylophilaceae. PeerJ 1, e23. doi:10.7717/peerj.23.
Bengtson, P., Basiliko, N., Dumont, M. G., Hills, M., Murrell, J. C., Roy, R., and Grayston, S. J.
(2009). Links between methanotroph community composition and CH4 oxidation in a pine
forest soil. FEMS Microbiol. Ecol. 70, 356–366. doi:10.1111/j.1574-6941.2009.00751.x.
85
Bhiry, N., Delwaide, A., Allard, M., Bégin, Y., Filion, L., Lavoie, M., Nozais, C., Payette, S.,
Pienitz, R., Saulnier-Talbot, É., and Vincent, W. F. (2011). Environmental change in the Great
Whale River region, Hudson Bay: five decades of multidisciplinary research by Centre
d’études nordiques (CEN). Ecoscience 18, 182–203. doi:10.2980/18-3-3469.
Bhiry, N., and Robert, C. (2006). Reconstruction of changes in vegetation and trophic conditions of
a palsa in a permafrost peatland, subarctic Québec, Canada. Ecoscience 13, 56–65.
doi:10.2980/1195-6860(2006)13[56:ROCIVA]2.0.CO;2.
Blazewicz, S. J., Barnard, R. L., Daly, R. A., and Firestone, M. K. (2013). Evaluating rRNA as an
indicator of microbial activity in environmental communities: limitations and uses. ISME J. 7,
2061–2068. doi:10.1038/ismej.2013.102.
Blees, J., Niemann, H., Wenk, C. B., Zopfi, J., Schubert, C. J., Kirf, M. K., Veronesi, M. L., Hitz,
C., and Lehmann, M. F. (2014). Micro-aerobic bacterial methane oxidation in the chemocline
and anoxic water column of deep south-Alpine Lake Lugano (Switzerland). Limnol.
Oceanogr. 59, 311–324. doi:10.4319/lo.2014.59.2.0311.
Bodelier, P. Le, Meima-Franke, M., Hordijk, C. A., Steenbergh, A. K., Hefting, M. M., Bodrossy,
L., von Bergen, M., and Seifert, J. (2013). Microbial minorities modulate methane
consumption through niche partitioning. ISME J. 7, 2214–2228. doi:10.1038/ismej.2013.99.
Bogard, M. J., Del Giorgio, P. A., Boutet, L., Chaves, M. C. G., Prairie, Y. T., Merante, A., and
Derry, A. M. (2014). Oxic water column methanogenesis as a major component of aquatic
CH4 fluxes. Nat. Commun. 5, 5350. doi:10.1038/ncomms6350.
Bonilla, S., Villeneuve, V., and Vincent, W. F. (2005). Benthic and planktonic algal communities in
a High Arctic Lake: pigment structure and contrasting responses to nutrient enrichment. J.
Phycol. 41, 1120–1130. doi:10.1111/j.1529-8817.2005.00154.x.
Borcard, D., Gillet, F., and Legendre, P. (2011). Numerical Ecology with R. Springer. New York
doi:10.1007/978-1-4419-7976-6.
Börjesson, G., Sundh, I., and Svensson, B. (2004). Microbial oxidation of CH4 at different
temperatures in landfill cover soils. FEMS Microbiol. Ecol. 48, 305–312.
doi:10.1016/j.femsec.2004.02.006.
Borrel, G., Jézéquel, D., Biderre-Petit, C., Morel-Desrosiers, N., Morel, J.-P., Peyret, P., Fonty, G.,
and Lehours, A.-C. (2011). Production and consumption of methane in freshwater lake
ecosystems. Res. Microbiol. 162, 832–847. doi:10.1016/j.resmic.2011.06.004.
Borrel, G., Lehours, A.-C., Crouzet, O., Jézéquel, D., Rockne, K., Kulczak, A., Duffaud, E., Joblin,
K., and Fonty, G. (2012). Stratification of Archaea in the deep sediments of a freshwater
meromictic lake: vertical shift from methanogenic to uncultured archaeal lineages. PLoS One
7, e43346. doi:10.1371/journal.pone.0043346.
Borrel, G., O’Toole, P. W., Harris, H. M. B., Peyret, P., Brugère, J.-F., and Gribaldo, S. (2013).
Phylogenomic data support a seventh order of methylotrophic methanogens and provide
insights into the evolution of methanogenesis. Genome Biol. Evol. 5, 1769–1780.
doi:10.1093/gbe/evt128.
Boscaro, V., Felletti, M., Vannini, C., Ackerman, M. S., Chain, P. S. G., Malfatti, S., Vergez, L. M.,
86
Shin, M., Doak, T. G., Lynch, M., and Petroni, G. (2013). Polynucleobacter necessarius, a
model for genome reduction in both free-living and symbiotic bacteria. Proc. Natl. Acad. Sci.
U. S. A. 110, 18590–5. doi:10.1073/pnas.1316687110.
Bouchard, F., Francus, P., Pienitz, R., and Laurion, I. (2014). Subarctic thermokarst ponds :
investigating recent landscape evolution and sediment dynamics in thawed permafrost of
northern Québec (Canada). Arctic, Antarct. Alp. Res. 46, 251–271.
doi:http://dx.doi.org/10.1657/1938-4246-46.1.251.
Bouchard, F., Laurion, I., Preskienis, V., Fortier, D., Xu, X., and Whiticar, M. J. (2015). Modern to
millennium-old greenhouse gases emitted from freshwater ecosystems of the eastern Canadian
Arctic. Biogeosciences 12, 11661–11705. doi:10.5194/bgd-12-11661-2015.
Bowman, J. (2006). “The methanotrophs—the families Methylococcaceae and Methylocystaceae.,”
in The Prokaryotes, eds. M. Dworkin, S. Falkow, E. Rosenberg, K. H. Schleifer, and E.
Strackebrandt (Springer, New York.), 266–289.
Breton, J., Vallières, C., and Laurion, I. (2009). Limnological properties of permafrost thaw ponds
in northeastern Canada. Can. J. Fish. Aquat. Sci. 66, 1635–1648. doi:10.1139/F09-108.
Briée, C., Moreira, D., and López-García, P. (2007). Archaeal and bacterial community
composition of sediment and plankton from a suboxic freshwater pond. Res. Microbiol. 158,
213–27. doi:10.1016/j.resmic.2006.12.012.
Brown, J., Ferrians, Jr., O. J., Heginbottom, J. A., and Melnikov, E. S. (1997). Circum-Arctic map
of permafrost and ground-ice conditions. Washington, DC: U.S. Geological Survey in
Cooperation with the Circum-Pacific Council for Energy and Mineral Resources. Circum-
Pacific Map Series CP-45, scale 1:10,000,000, 1 sheet.
Brown, J., and Ferrians, O.J., Heginbottom, J.A. Melnikov, E. S. (1998, revised February 2001).
Circum-arctic map of permafrost and ground ice conditions. Boulder, CO Natl. Snow Ice
Data Center. Digit. Media.
Brown, T., and Simpson, J. (2001). Managing phosphorus inputs to urban lakes I . Determining the
trophic state of your lake. Urban Lake Manag. 3, 771–781.
Calmels, F., and Allard, M. (2004). Ice segregation and gas distribution in permafrost using
tomodensitometric analysis. Permafr. Periglac. Process. 15, 367–378. doi:10.1002/ppp.508.
Calmels, F., Allard, M., and Delisle, G. (2008). Development and decay of a lithalsa in Northern
Québec: A geomorphological history. Geomorphology 97, 287–299.
doi:10.1016/j.geomorph.2007.08.013.
Campbell, B. J., and Kirchman, D. L. (2013). Bacterial diversity, community structure and potential
growth rates along an estuarine salinity gradient. ISME J. 7, 210–20.
doi:10.1038/ismej.2012.93.
Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F. D., Costello, E. K., Fierer,
N., Peña, A. G., Goodrich, K., Gordon, J. I., Huttley, G. A., Kelley, S. T., Knights, D., Jeremy,
E., Ley, R. E., Lozupone, C. A., Mcdonald, D., Muegge, B. D., Reeder, J., Sevinsky, J. R.,
Turnbaugh, P. J., and Walters, W. A. (2010). QIIME allows analysis of high-throughput
community sequencing data. Nat. Methods 7, 335–336. doi:10.1038/nmeth.f.303.QIIME.
87
Cardinale, B. J., Srivastava, D. S., Duffy, J. E., Wright, J. P., Downing, A. L., Sankaran, M., and
Jouseau, C. (2006). Effects of biodiversity on the functioning of trophic groups and
ecosystems. Nature 443, 989–992. doi:10.1038/nature05202.
Casamayor, E. O., Schäfer, H., Bañeras, L., Pedrós-Alió, C., and Muyzer, G. (2000). Identification
of and spatio-temporal differences between microbial assemblages from two neighboring
sulfurous lakes: comparison by microscopy and denaturing gradient gel electrophoresis. Appl.
Environ. Microbiol. 66, 499–508. doi:0099-2240/00/$04.00?0.
Chan, O. C., Claus, P., Casper, P., Ulrich, A., Lueders, T., and Conrad, R. (2005). Vertical
distribution of structure and function of the methanogenic archaeal community in Lake Dagow
sediment. Environ. Microbiol. 7, 1139–1149. doi:10.1111/j.1462-2920.2005.00790.x.
Charvet, S., Vincent, W. F., Comeau, A., and Lovejoy, C. (2012). Pyrosequencing analysis of the
protist communities in a High Arctic meromictic lake: DNA preservation and change. Front.
Microbiol. 3, 422. doi:10.3389/fmicb.2012.00422.
Chen, Y. H., and Prinn, R. G. (2005). Atmospheric modeling of high- and low-frequency methane
observations: Importance of interannually varying transport. J. Geophys. Res. 110, 1–27.
doi:10.1029/2004JD005542.
Chowdhury, T. R., and Dick, R. P. (2013). Ecology of aerobic methanotrophs in controlling
methane fluxes from wetlands. Appl. Soil Ecol. 65, 8–22. doi:10.1016/j.apsoil.2012.12.014.
Colwell, R. K. (2012). “Biodiversity: concepts, patterns, and measurement,” in The Princeton
Guide to Ecology, ed. S. A. Levin (Princeton, NJ), 257–263.
Comeau, A. M., Harding, T., Galand, P. E., Vincent, W. F., and Lovejoy, C. (2012). Vertical
distribution of microbial communities in a perennially stratified Arctic lake with saline, anoxic
bottom waters. Sci. Rep. 2, 604. doi:10.1038/srep00604.
Comeau, A. M., Li, W. K. W., Tremblay, J.-É., Carmack, E. C., and Lovejoy, C. (2011). Arctic
Ocean microbial community structure before and after the 2007 record sea ice minimum.
PLoS One 6, e27492. doi:10.1371/journal.pone.0027492.
Comte, J., Fauteux, L., and del Giorgio, P. A. (2013). Links between metabolic plasticity and
functional redundancy in freshwater bacterioplankton communities. Front. Microbiol. 4, 112.
doi:10.3389/fmicb.2013.00112.
Comte, J., Lovejoy, C., Crevecoeur, S., and Vincent, W. F. (2016). Co-occurrence patterns in
aquatic bacterial communities. Biogeosciences 12, 10233–10269. doi:10.5194/bgd-12-10233-
2015.
Comte, J., Monier, A., Crevecoeur, S., Lovejoy, C., and Vincent, W. F. (2015). Microbial
biogeography of permafrost thaw ponds across the changing northern landscape. Ecography
38, 001–010. doi:10.1111/ecog.01667.
Costello, A. M., and Lidstrom, M. E. (1999). Molecular characterization of functional and
phylogenetic genes from natural populations of methanotrophs in lake sediments. 65, 5066–
5074. doi:0099-2240/99/$04.00+0.
Cotner, J. B., and Biddanda, B. A. (2002). Small players, large role: microbial influence on
88
biogeochemical processes in pelagic aquatic ecosystems. Ecosystems 5, 105–121.
doi:10.1007/s10021-001-0059-3.
Crevecoeur, S., Vincent, W. F., Comte, J., and Lovejoy, C. (2015). Bacterial community structure
across environmental gradients in permafrost thaw ponds: methanotroph-rich ecosystems.
Front. Microbiol. 6, 192. doi:10.3389/fmicb.2015.00192.
Crump, B. C., Armbrust, E. V., and Baross, J. A. (1999). Phylogenetic analysis of particle-attached
and free-living bacterial communities in the columbia river, its estuary, and the adjacent
coastal ocean. Appl. Environ. Microbiol. 65, 3192–3204. doi:0099-2240/99/$04.00?0.
Degelmann, D. M., Borken, W., Drake, H. L., and Kolb, S. (2010). Different atmospheric methane-
oxidizing communities in European beech and Norway spruce soils. Appl. Environ. Microbiol.
76, 3228–35. doi:10.1128/AEM.02730-09.
Delong, E. F. (1998). Everything in moderation : Archaea as “non-extremophiles.” Curr. Opin.
Genet. Dev. 8, 649–654. doi:10.1016/S0959-437X(98)80032-4.
Deshpande, B. N., Crevecoeur, S., Matveev, A., and Vincent, W. F. (2016). Bacterial production in
subarctic peatland lakes enriched by thawing permafrost. Biogeosciences Discuss. 32, 1–49.
doi:10.5194/bg-2016-32.
Deshpande, B. N., MacIntyre, S., Matveev, A., and Vincent, W. F. (2015). Oxygen dynamics in
permafrost thaw lakes: Anaerobic bioreactors in the Canadian subarctic. Limnol. Oceanogr.
60, 1656–1670. doi:10.1002/lno.10126.
Dobinski, W. (2011). Permafrost. Earth-Science Rev. 108, 158–169.
doi:10.1016/j.earscirev.2011.06.007.
Dorigo, U., Volatier, L., and Humbert, J.-F. (2005). Molecular approaches to the assessment of
biodiversity in aquatic microbial communities. Water Res. 39, 2207–18.
doi:10.1016/j.watres.2005.04.007.
Dunfield, P. F., Yuryev, A., Senin, P., Smirnova, A. V, Stott, M. B., Hou, S., Ly, B., Saw, J. H.,
Zhou, Z., Ren, Y., Wang, J., Mountain, B. W., Crowe, M. A., Weatherby, T. M., Bodelier, P.
L. E., Liesack, W., Feng, L., Wang, L., and Alam, M. (2007). Methane oxidation by an
extremely acidophilic bacterium of the phylum Verrucomicrobia. Nature 450, 879–882.
doi:10.1038/nature06411.
Edgar, R. C. (2013). UPARSE: highly accurate OTU sequences from microbial amplicon reads.
Nat. Methods 10, 996–998. doi:10.1038/nmeth.2604.
Eller, G., Känel, L., Krüger, M., Eller, G., Ka, L., and Kru, M. (2005). Cooccurrence of aerobic and
anaerobic methane oxidation in the water column of Lake Plußsee. Appl. Environ. Microbiol.
71, 8925–8928. doi:10.1128/AEM.71.12.8925.
Ellermann, J., Hedderich, R., Böcher, R., and Thauer, R. K. (1988). The final step in methane
formation. Eur. J. Biochem. 172, 669–677. doi:10.1111/j.1432-1033.1988.tb13941.x.
Engelbrektson, A., Kunin, V., Wrighton, K. C., Zvenigorodsky, N., Chen, F., Ochman, H., and
Hugenholtz, P. (2010). Experimental factors affecting PCR-based estimates of microbial
species richness and evenness. ISME J. 4, 642–647. doi:10.1038/ismej.2009.153.
89
Epp, M. A., and Chanton, J. P. (1993). Rhizospheric methane oxidation determined via the methyl
fluoride inhibition technique. J. Geophys. Res. 98, 18413–18422. doi:10.1029/93JD01667.
Ettwig, K. F., van Alen, T., van de Pas-Schoonen, K. T., Jetten, M. S. M., and Strous, M. (2009).
Enrichment and molecular detection of denitrifying methanotrophic bacteria of the NC10
phylum. Appl. Environ. Microbiol. 75, 3656–62. doi:10.1128/AEM.00067-09.
Falge, E., Baldocchi, D., Tenhunen, J., Aubinet, M., Bakwin, P., Berbigier, P., Bernhofer, C.,
Burba, G., Clement, R., Davis, K., Elbers, J., Goldstein, A., Grelle, A., Granier, A.,
Guomundsson, J., Hollinger, D., Kowalski, A., Katul, G., Law, B., Malhi, Y., Meyers, T.,
Monson, R., Munger, J., Oechel, W., Paw, K., Pilegaard, K., Rannik, U., Rebmann, C.,
Suyker, A., Valentini, R., Wilson, K., and Wofsy, S. (2002). Seasonality of ecosystem
respiration and gross primary production as derived from FLUXNET measurements. Agric.
For. Meteorol. 113, 53–74. doi:10.1016/S0168-1923(02)00102-8.
Fenchel, T. (2008). The microbial loop – 25 years later. J. Exp. Mar. Bio. Ecol. 366, 99–103.
doi:10.1016/j.jembe.2008.07.013.
Fierer, N., and Jackson, R. B. (2006). The diversity and biogeography of soil bacterial communities.
Proc. Natl. Acad. Sci. U. S. A. 103, 626–31. doi:10.1073/pnas.0507535103.
Fish, J. A., Chai, B., Wang, Q., Sun, Y., Brown, C. T., Tiedje, J. M., and Cole, J. R. (2013).
FunGene: the functional gene pipeline and repository. Front. Microbiol. 4, 291.
doi:10.3389/fmicb.2013.00291.
Freitag, T. E., Chang, L., and Prosser, J. I. (2006). Changes in the community structure and activity
of betaproteobacterial ammonia-oxidizing sediment bacteria along a freshwater-marine
gradient. Environ. Microbiol. 8, 684–696. doi:10.1111/j.1462-2920.2005.00947.x.
Freitag, T. E., Toet, S., Ineson, P., and Prosser, J. I. (2010). Links between methane flux and
transcriptional activities of methanogens and methane oxidizers in a blanket peat bog. FEMS
Microbiol. Ecol. 73, 157–165. doi:10.1111/j.1574-6941.2010.00871.x.
Frenzel, P., Thebrath, B., and Conrad, R. (1990). Oxidation of methane in the oxic surface-layer of
a deep lake sediment (Lake Constance). FEMS Microbiol. Ecol. 73, 149–158.
doi:10.1111/j.1574-6968.1990.tb03935.x.
Galand, P. E., Casamayor, E. O., Kirchman, D. L., and Lovejoy, C. (2009). Ecology of the rare
microbial biosphere of the Arctic Ocean. Proc. Natl. Acad. Sci. U. S. A. 106, 22427–22432.
doi:10.1073/pnas.0908284106.
Galand, P. E., Lovejoy, C., Pouliot, J., and Vincent, W. F. (2008). Heterogeneous archaeal
communities in the particle-rich environment of an arctic shelf ecosystem. J. Mar. Syst. 74,
774–782. doi:10.1016/j.jmarsys.2007.12.001.
Garcia, S. L., Salka, I., Grossart, H.-P., and Warnecke, F. (2013). Depth-discrete profiles of
bacterial communities reveal pronounced spatio-temporal dynamics related to lake
stratification. Environ. Microbiol. Rep. 5, 549–55. doi:10.1111/1758-2229.12044.
Gich, F. B., Borrego, C. M., Martinez-Planells, A., Steensgaard, D. B., Garcia-Gil, J., and
Holzwarth, A. R. (2001). Variability of the photosynthetic antenna of a Pelodictyon
clathratiforme population from a freshwater holomictic pond. FEMS Microbiol. Ecol. 37, 11–
90
19. doi:10.1111/j.1574-6941.2001.tb00848.x.
Gilbert, B., and Frenzel, P. (1995). Methanotrophic bacteria in the rhizosphere of rice microcosms
and their effect on porewater methane concentration and methane emission. Biol. Fertil. Soils
20, 93–100. doi:10.1007/BF00336586.
Gilbert, B., McDonald, I. R., Finch, R., Stafford, G. P., Nielsen, A. K., and Murrell, J. C. (2000).
Molecular analysis of the pmo (particulate methane monooxygenase) operons from two type II
methanotrophs. Appl. Environ. Microbiol. 66, 966–975. doi:0099-2240/00/$04.00?0.
Gilbert, J. A., Field, D., Huang, Y., Edwards, R., Li, W., Gilna, P., and Joint, I. (2008). Detection of
large numbers of novel sequences in the metatranscriptomes of complex marine microbial
communities. PLoS One 3, e3042. doi:10.1371/journal.pone.0003042.
González, I., Lé Cao, K.-A., and Déjean, S. (2011). mixOmics: Omics data integration project.
Available at: http://www.mixomics.org.
Graef, C., Hestnes, A. G., Svenning, M. M., and Frenzel, P. (2011). The active methanotrophic
community in a wetland from the High Arctic. Environ. Microbiol. Rep. 3, 466–472.
doi:10.1111/j.1758-2229.2010.00237.x.
Grossart, H. P., and Simon, M. (1998). Bacterial colonization and microbial decomposition of
limnetic organic aggregates (Lake snow). Aquat. Microb. Ecol. 15, 127–140.
doi:10.3354/ame015127.
Grossart, H.-P., Frindte, K., Dziallas, C., Eckert, W., and Tang, K. W. (2011). Microbial methane
production in oxygenated water column of an oligotrophic lake. Proc. Natl. Acad. Sci. U. S. A.
108, 19657–19661. doi:10.1073/pnas.1110716108.
Grosse, G., Goetz, S., McGuire, A. D., Romanovsky, V. E., and Schuur, E. A. G. (2016). Changing
permafrost in a warming world and feedbacks to the Earth system. Environ. Res. Lett. 11,
040201. doi:10.1088/1748-9326/11/4/040201.
Grosse, G., Jones, B., and Arp, C. (2013). “Thermokarst lakes, drainage, and drained basins,” in
Treatise on Geomorphology, ed. J. F. Shroder (San Diego), 325–353.
Gucht, K. Van Der, Sabbe, K., De Meester, L., Vloemans, N., Zwart, G., Gillis, M., and Vyverman,
W. (2001). Contrasting bacterioplankton community composition and seasonal dynamics in
two neighbouring hypertrophic freshwater lakes. 3, 680–690. doi:10.1046/j.1462-
2920.2001.00242.x.
Gurney, S. D. (2001). Aspects of the genesis, geomorphology and terminology of palsas: perennial
cryogenic mounds. Prog. Phys. Geogr. 25, 249–260. doi:10.1177/030913330102500205.
Hahn, M. W. (2003). Isolation of strains belonging to the cosmopolitan Polynucleobacter
necessarius cluster from freshwater habitats located in three climatic zones. Appl. Environ.
Microbiol. 69, 5248–5254. doi:10.1128/AEM.69.9.5248.
Halsey, L. A., Vitt, D. H., and Zoltai, S. C. (1995). Disequilibrium response of permafrost in boreal
continental western Canada to climate change. Clim. Change 30, 57–73.
doi:10.1007/BF01093225.
91
Han, J. I., Choi, H. K., Lee, S. W., Orwin, P. M., Kim, J., LaRoe, S. L., Kim, T. G., O’Neil, J.,
Leadbetter, J. R., Lee, S. Y., Hur, C. G., Spain, J. C., Ovchinnikova, G., Goodwin, L., and
Han, C. (2011). Complete genome sequence of the metabolically versatile plant growth-
promoting endophyte Variovorax paradoxus S110. J. Bacteriol. 193, 1183–1190.
doi:10.1128/JB.00925-10.
Hansel, C. M., Fendorf, S., Jardine, P. M., and Francis, C. A. (2008). Changes in bacterial and
archaeal community structure and functional diversity along a geochemically variable soil
profile. Appl. Environ. Microbiol. 74, 1620–1633. doi:10.1128/AEM.01787-07.
Hanson, R. S., and Hanson, T. E. (1996). Methanotrophic bacteria. Microbiol. Mol. Biol. Rev. 60,
439–471. doi:0146-0749/96/$04.00?0.
He, R., Wooller, M. J., Pohlman, J. W., Quensen, J., Tiedje, J. M., and Leigh, M. B. (2012). Shifts
in identity and activity of methanotrophs in arctic lake sediments in response to temperature
changes. Appl. Environ. Microbiol. 78, 4715–4723. doi:10.1128/AEM.00853-12.
Hodgkins, S. B., Tfaily, M. M., McCalley, C. K., Logan, T. A., Crill, P. M., Saleska, S. R., Rich, V.
I., and Chanton, J. P. (2014). Changes in peat chemistry associated with permafrost thaw
increase greenhouse gas production. Proc. Natl. Acad. Sci. U. S. A. 111, 5819–5824.
doi:10.1073/pnas.1314641111.
Hoj, L., Rusten, M., Haugen, L. E., Olsen, R. A., and Torsvik, V. L. (2006). Effects of water regime
on archaeal community composition in Arctic soils. Environ. Microbiol. 8, 984–996.
doi:10.1111/j.1462-2920.2005.00982.x.
Hollibaugh, J. T., Wong, P. S., Bano, N., Pak, S. K., Prager, E. M., and Orrego, C. (2001).
Stratification of microbial assemblages in Mono Lake, California, and response to a mixing
event. Hydrobiologia 466, 45–60. doi:10.1023/A:1014505131859.
Hong, S., Bunge, J., Leslin, C., Jeon, S., and Epstein, S. S. (2009). Polymerase chain reaction
primers miss half of rRNA microbial diversity. ISME J. 3, 1365–1373.
doi:10.1038/ismej.2009.89.
van Huissteden, J., Berrittella, C., Parmentier, F. J. W., Mi, Y., Maximov, T. C., and Dolman, A. J.
(2011). Methane emissions from permafrost thaw lakes limited by lake drainage. Nat. Clim.
Chang. 1, 119–123. doi:10.1038/nclimate1101.
İnceoğlu, Ö., Llirós, M., Crowe, S. A., García-Armisen, T., Morana, C., Darchambeau, F., Borges,
A. V., Descy, J.-P., and Servais, P. (2015). Vertical distribution of functional potential and
active microbial communities in meromictic Lake Kivu. Microb. Ecol. 70, 596–611.
doi:10.1007/s00248-015-0612-9.
IPCC (2013). Climate Change 2013: The Physical Science Basis. Contribution of Working Group I
to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change.
Cambridge, eds. T. F. Stocker, D. Qin, G.-K. Plattner, M. Tignor, S. K. Allen, J. Boschung, A.
Nauels, Y. Xia, V. Bex, and P. M. Midgley Cambridge, United Kingdom and New York, NY,
USA doi:10.1017/ CBO9781107415324.005.
James, R. H., Bousquet, P., Bussmann, I., Haeckel, M., Kipfer, R., Leifer, I., Niemann, H.,
Ostrovsky, I., Piskozub, J., Rehder, G., Treude, T., Vielstädte, L., and Greinert, J. (2016).
92
Effects of climate change on methane emissions from seafloor sediments in the Arctic Ocean:
A review. Limnol. Oceanogr., in press.
Jansson, J. K., and Taş, N. (2014). The microbial ecology of permafrost. Nat. Rev. Microbiol. 12,
414–425. doi:10.1038/nrmicro3262.
Jarrell, K. F., Walters, A. D., Bochiwal, C., Borgia, J. M., Dickinson, T., and Chong, J. P. J. (2011).
Major players on the microbial stage: why Archaea are important. Microbiology 157, 919–
936. doi:10.1099/mic.0.047837-0.
Judd, K. E., Crump, B. C., and Kling, G. W. (2006). Variation in dissolved organic matter controls
bacterial production and community composition. Ecology 87, 2068–79. doi:10.1890/0012-
9658(2006)87[2068:VIDOMC]2.0.CO;2.
Juottonen, H., Tuittila, E.-S., Juutinen, S., Fritze, H., and Yrjälä, K. (2008). Seasonality of rDNA-
and rRNA-derived archaeal communities and methanogenic potential in a boreal mire. ISME
J. 2, 1157–1168. doi:10.1038/ismej.2008.66.
Jurgens, G., Glöckner, F. O., Amann, R., Saano, A., Montonen, L., Likolammi, M., and Münster, U.
(2000). Identification of novel Archaea in bacterioplankton of a boreal forest lake by
phylogenetic analysis and fluorescent in situ hybridization. FEMS Microbiol. Ecol. 34, 45–56.
doi:10.1016/S0168-6496(00)00073-8.
Kankaala, P., Huotari, J., Peltomaa, E., Saloranta, T., and Ojala, A. (2006). Methanotrophic activity
in relation to methane efflux and total heterotrophic bacterial production in a stratified, humic,
boreal lake. Limnol. Oceanogr. 51, 1195–1204. doi:10.4319/lo.2006.51.2.1195.
Khalil, M. A. K., Rasmussen, R. A., and Shearer, M. J. (1998). Effects of production and oxidation
processes on methane emissions from rice fields. J. Geophys. Res. 103, 25233–25239.
doi:10.1029/98JD01116.
Kiikkilä, O., Smolander, A., and Ukonmaanaho, L. (2014). Properties of dissolved organic matter in
peatland: implications for water quality after harvest. Vadose Zo. J. 13.
doi:10.2136/vzj2013.08.0155.
Kip, N., Ouyang, W., van Winden, J., Raghoebarsing, A., van Niftrik, L., Pol, A., Pan, Y.,
Bodrossy, L., van Donselaar, E. G., Reichart, G.-J., Jetten, M. S. M., Damsté, J. S. S., and Op
den Camp, H. J. M. (2011). Detection, isolation, and characterization of acidophilic
methanotrophs from Sphagnum mosses. Appl Env. Microbiol 77, 5643–54.
doi:10.1128/AEM.05017-11.
Kirschke, S., Bousquet, P., Ciais, P., Saunois, M., Canadell, J. G., Dlugokencky, E. J.,
Bergamaschi, P., Bergmann, D., Blake, D. R., Bruhwiler, L., Cameron-Smith, P., Castaldi, S.,
Chevallier, F., Feng, L., Fraser, A., Heimann, M., Hodson, E. L., Houweling, S., Josse, B.,
Fraser, P. J., Krummel, P. B., Lamarque, J.-F., Langenfelds, R. L., Le Quéré, C., Naik, V.,
O’Doherty, S., Palmer, P. I., Pison, I., Plummer, D., Poulter, B., Prinn, R. G., Rigby, M.,
Ringeval, B., Santini, M., Schmidt, M., Shindell, D. T., Simpson, I. J., Spahni, R., Steele, L.
P., Strode, S. A., Sudo, K., Szopa, S., van der Werf, G. R., Voulgarakis, A., van Weele, M.,
Weiss, R. F., Williams, J. E., and Zeng, G. (2013). Three decades of global methane sources
and sinks. Nat. Geosci. 6, 813–823. doi:10.1038/ngeo1955.
93
Knapp, C. W., Fowle, D. A., Kulczycki, E., Roberts, J. A., and Graham, D. W. (2007). Methane
monooxygenase gene expression mediated by methanobactin in the presence of mineral
copper sources. Proc. Natl. Acad. Sci. U. S. A. 104, 12040–12045.
doi:10.1073/pnas.0702879104.
Koch, J. C., Gurney, K., and Wipfli, M. S. (2014). Morphology-dependent water budgets and
nutrient fluxes in Arctic thaw ponds. Permafr. Periglac. Process. 25, 79–93.
doi:10.1002/ppp.1804.
Kolb, S., Knief, C., Stubner, S., and Conrad, R. (2003). Quantitative detection of methanotrophs in
soil by novel pmoA-targeted real-time PCR assays. Appl. Environ. Microbiol. 69, 2423–2429.
doi:10.1128/AEM.69.5.2423.
Krishfield, R. A., Proshutinsky, A., Tateyama, K., Williams, W. J., Carmack, E. C., McLaughlin, F.
A., and Timmermans, M.-L. (2014). Deterioration of perennial sea ice in the Beaufort Gyre
from 2003 to 2012 and its impact on the oceanic freshwater cycle. J. Geophys. Res. Ocean.
119, 1271–1305. doi:10.1002/2014JC010192.Received.
Kritzberg, E. S., Langenheder, S., and Lindström, E. S. (2006). Influence of dissolved organic
matter source on lake bacterioplankton structure and function--implications for seasonal
dynamics of community composition. FEMS Microbiol. Ecol. 56, 406–417.
doi:10.1111/j.1574-6941.2006.00084.x.
Kuntz, L. B., Laakso, T. A., Schrag, D. P., and Crowe, S. A. (2015). Modeling the carbon cycle in
Lake Matano. Geobiology 13, 454–461. doi:10.1111/gbi.12141.
Laanbroek, H. J. (2010). Methane emission from natural wetlands: Interplay between emergent
macrophytes and soil microbial processes. A mini-review. Ann. Bot. 105, 141–153.
doi:10.1093/aob/mcp201.
Lajeunesse, P., and Allard, M. (2003). The Nastapoka drift belt, eastern Hudson Bay: implications
of a stillstand of the Quebec-Labrador ice margin in the Tyrrell Sea at 8 ka BP. Can. J. Earth
Sci. 40, 65–76. doi:10.1139/e02-085.
Landa, M., Cottrell, M., Kirchman, D., Blain, S., and Obernosterer, I. (2013). Changes in bacterial
diversity in response to dissolved organic matter supply in a continuous culture experiment.
Aquat. Microb. Ecol. 69, 157–168. doi:10.3354/ame01632.
Lapoussière, A., Michel, C., Starr, M., Gosselin, M., and Poulin, M. (2011). Role of free-living and
particle-attached bacteria in the recycling and export of organic material in the Hudson Bay
system. J. Mar. Syst. 88, 434–445. doi:10.1016/j.jmarsys.2010.12.003.
Laurion, I., and Mladenov, N. (2013). Dissolved organic matter photolysis in Canadian arctic thaw
ponds. Environ. Res. Lett. 8, 035026. doi:10.1088/1748-9326/8/3/035026.
Laurion, I., Vincent, W. F., MacIntyre, S., Retamal, L., Dupont, C., Francus, P., and Pienitz, R.
(2010). Variability in greenhouse gas emissions from permafrost thaw ponds. Limnol.
Oceanogr. 55, 115–133. doi:10.4319/lo.2010.55.1.0115.
Lê Cao, K. A., González, I., and Déjean, S. (2009). IntegrOmics: An R package to unravel
relationships between two omics datasets. Bioinformatics 25, 2855–2856.
doi:10.1093/bioinformatics/btp515.
94
Lee, H. J., Jeong, S. E., Kim, P. J., Madsen, E. L., and Jeon, C. O. (2015). High resolution depth
distribution of Bacteria, Archaea, methanotrophs, and methanogens in the bulk and
rhizosphere soils of a flooded rice paddy. Front. Microbiol. 6, 639.
doi:10.3389/fmicb.2015.00639.
Li, D., Sharp, J. O., Saikaly, P. E., Ali, S., Alidina, M., Alarawi, M. S., Keller, S., Hoppe-Jones, C.,
and Drewes, J. E. (2012). Dissolved organic carbon influences microbial community
composition and diversity in managed aquifer recharge systems. Appl. Environ. Microbiol. 78,
6819–6828. doi:10.1128/AEM.01223-12.
Liebner, S., Ganzert, L., Kiss, A., Yang, S., Wagner, D., and Svenning, M. M. (2015). Shifts in
methanogenic community composition and methane fluxes along the degradation of
discontinuous permafrost. Front. Microbiol. 6, 356. doi:10.3389/fmicb.2015.00356.
Lin, X., Tfaily, M. M., Green, S. J., Steinweg, J. M., Chanton, P., Imvittaya, A., Chanton, J. P.,
Cooper, W., Schadt, C., and Kostka, J. E. (2014). Microbial metabolic potential for carbon
degradation and nutrient (nitrogen and phosphorus) acquisition in an ombrotrophic peatland.
Appl. Environ. Microbiol. 80, 3531–40. doi:10.1128/AEM.00206-14.
Lindström, E. S., Agterveld, M. P. K., and Zwart, G. (2005). Distribution of typical freshwater
bacterial groups is associated with pH, temperature, and lake water retention time. Appl.
Environ. Microbiol. 71, 8201–8206. doi:10.1128/AEM.71.12.8201.
Lindström, E. S., and Leskinen, E. (2002). Do neighboring lakes share common taxa of
bacterioplankton? Comparison of 16S rDNA fingerprints and sequences from three geographic
regions. Microb. Ecol. 44, 1–9. doi:10.1007/s00248-002-0007-6.
Liu, J., Sun, F., Wang, L., Ju, X., Wu, W., and Chen, Y. (2014). Molecular characterization of a
microbial consortium involved in methane oxidation coupled to denitrification under micro-
aerobic conditions. Microb. Biotechnol. 7, 64–76. doi:10.1111/1751-7915.12097.
Liu, L., Gundersen, P., Zhang, T., and Mo, J. (2012). Effects of phosphorus addition on soil
microbial biomass and community composition in three forest types in tropical China. Soil
Biol. Biochem. 44, 31–38. doi:10.1016/j.soilbio.2011.08.017.
Liu, Z., Lozupone, C., Hamady, M., Bushman, F. D., and Knight, R. (2007). Short pyrosequencing
reads suffice for accurate microbial community analysis. Nucleic Acids Res. 35, e120.
doi:10.1093/nar/gkm541.
Logares, R., Bråte, J., Bertilsson, S., Clasen, J. L., Shalchian-Tabrizi, K., and Rengefors, K. (2009).
Infrequent marine-freshwater transitions in the microbial world. Trends Microbiol. 17, 414–
422. doi:10.1016/j.tim.2009.05.010.
Logares, R., Sunagawa, S., Salazar, G., Cornejo-Castillo, F. M., Ferrera, I., Sarmento, H., Hingamp,
P., Ogata, H., de Vargas, C., Lima-Mendez, G., Raes, J., Poulain, J., Jaillon, O., Wincker, P.,
Kandels-Lewis, S., Karsenti, E., Bork, P., and Acinas, S. G. (2014). Metagenomic 16S rDNA
Illumina tags are a powerful alternative to amplicon sequencing to explore diversity and
structure of microbial communities. Environ. Microbiol. 16, 2659–2671. doi:10.1111/1462-
2920.12250.
Lovejoy, C., Comeau, A., and Thaler, M. (2015). Curated reference database of SSU rRNA for
95
northern marine and freshwater communities of Archaea, Bacteria and microbial eukaryotes.
Nordicana D23.
Lozupone, C. A., and Knight, R. (2007). Global patterns in bacterial diversity. Proc. Natl. Acad.
Sci. U. S. A. 104, 11436–11440. doi:10.1073/pnas.0611525104.
Lozupone, C., and Knight, R. (2005). UniFrac : a new phylogenetic method for comparing
microbial communities. Appl. Environ. Microbiol. 71, 8228–8235.
doi:10.1128/AEM.71.12.8228.
Lu, Y., Lueders, T., Friedrich, M. W., and Conrad, R. (2005). Detecting active methanogenic
populations on rice roots using stable isotope probing. Environ. Microbiol. 7, 326–336.
doi:10.1111/j.1462-2920.2004.00697.x.
Luesken, F. A., Zhu, B., van Alen, T. A., Butler, M. K., Diaz, M. R., Song, B., Op den Camp, H. J.
M., Jetten, M. S. M., and Ettwig, K. F. (2011). pmoA primers for detection of anaerobic
methanotrophs. Appl. Environ. Microbiol. 77, 3877–80. doi:10.1128/AEM.02960-10.
Luton, P. E., Wayne, J. M., Sharp, R. J., and Riley, P. W. (2002). The mcrA gene as an alternative
to 16S rRNA in the phylogenetic analysis of methanogen populations in landfill. Microbiology
148, 3521–3530. doi:10.1099/00221287-148-11-3521.
Martineau, C., Whyte, L. G., and Greer, C. W. (2010). Stable isotope probing analysis of the
diversity and activity of methanotrophic bacteria in soils from the Canadian high Arctic. Appl.
Environ. Microbiol. 76, 5773–84. doi:10.1128/AEM.03094-09.
Marty, D. G. (1993). Methanogenic bacteria in seawater. Limnol. Oceanogr. 38, 452–456.
doi:10.4319/lo.1993.38.2.0452.
Matveev, A., Laurion, I., Deshpande, B. N., Bhiry, N., and Vincent, W. F. (2016). High methane
emissions from thermokarst lakes in subarctic peatlands. Limnol. Oceanogr., in press.
McDonald, I. R., Bodrossy, L., Chen, Y., and Murrell, J. C. (2008). Molecular ecology techniques
for the study of aerobic methanotrophs. Appl. Environ. Microbiol. 74, 1305–15.
doi:10.1128/AEM.02233-07.
McDonald, I. R., and Murrell, J. C. (1997). The particulate methane monooxygenase gene pmoA
and its use as a functional gene probe for methanotrophs. FEMS Microbiol. Lett. 156, 205–
210. doi:http://dx.doi.org/10.1111/j.1574-6968.1997.tb12728.x.
Meehl, G. A., Arblaster, J. M., Fasullo, J. T., Hu, A., and Trenberth, K. E. (2011). Model-based
evidence of deep-ocean heat uptake during surface-temperature hiatus periods. Nat. Clim.
Chang. 1, 360–364. doi:10.1038/nclimate1229.
Le Mer, J., and Roger, P. (2001). Production, oxidation, emission and consumption of methane by
soils: a review. Eur. J. Soil Biol. 37, 25–50. doi:10.1016/S1164-5563(01)01067-6.
Metje, M., and Frenzel, P. (2007). Methanogenesis and methanogenic pathways in a peat from
subarctic permafrost. Environ. Microbiol. 9, 954–964. doi:10.1111/j.1462-2920.2006.01217.x.
Milucka, J., Kirf, M., Lu, L., Krupke, A., Lam, P., Littmann, S., Kuypers, M. M., and Schubert, C.
J. (2015). Methane oxidation coupled to oxygenic photosynthesis in anoxic waters. ISME J.,
96
1–12. doi:10.1038/ismej.2015.12.
Mohanty, S. R., Bodelier, P. L. E., and Conrad, R. (2007). Effect of temperature on composition of
the methanotrophic community in rice field and forest soil. 62, 24–31. doi:10.1111/j.1574-
6941.2007.00370.x.
Mohit, V., Archambault, P., Toupoint, N., and Lovejoy, C. (2014). Phylogenetic differences in
summer attached and free-living bacterial communities in a temperate coastal lagoon, revealed
via high throughput 16S rRNA gene sequencing. Appl. Environ. Microbiol. 80, 2071–2083.
doi:10.1128/AEM.02916-13.
Mou, X., Jacob, J., Lu, X., Robbins, S., Sun, S., and Ortiz, J. D. (2013). Diversity and distribution
of free-living and particle-associated bacterioplankton in Sandusky Bay and adjacent waters of
Lake Erie Western Basin. J. Great Lakes Res. 39, 352–357. doi:10.1016/j.jglr.2013.03.014.
Murrell, J. C., Mcdonald, I. R., and Bourne, D. G. (1998). Molecular methods for the study of
methanotroph ecology. FEMS Microbiol. Ecol. 27, 103–114. doi:10.1016/S0168-
6496(98)00063-4.
Murtagh, F., and Legendre, P. (2014). Ward’s hierarchical agglomerative clustering method: which
algorithms implement Ward’s criterion? J. Classif. 31, 274–295. doi:10.1007/s00357-014-
9161-z.
Narihiro, T., Hori, T., Nagata, O., Hoshino, T., Yumoto, I., and Kamagata, Y. (2011). The impact of
aridification and vegetation type on changes in the community structure of methane-cycling
microorganisms in Japanese wetland soils. Biosci. Biotechnol. Biochem. 75, 1727–1734.
doi:10.1271/bbb.110265.
Negandhi, K., Laurion, I., Whiticar, M. J., Galand, P. E., Xu, X., and Lovejoy, C. (2013). Small
thaw ponds: an unaccounted source of methane in the Canadian High Arctic. PLoS One 8,
e78204. doi:10.1371/journal.pone.0078204.
Nelson, C. E., and Wear, E. K. (2014). Microbial diversity and the lability of dissolved organic
carbon. Proc. Natl. Acad. Sci. U. S. A. 111, 7166–7167. doi:10.1073/pnas.1405751111.
Newton, R. J., Jones, S. E., Eiler, A., McMahon, K. D., and Bertilsson, S. (2011). A guide to the
natural history of freshwater lake bacteria. Microbiol. Mol. Biol. Rev. 75, 14–49.
doi:10.1128/MMBR.00028-10.
Newton, R. J., and McMahon, K. D. (2011). Seasonal differences in bacterial community
composition following nutrient additions in a eutrophic lake. Environ. Microbiol. 13, 887–
899. doi:10.1111/j.1462-2920.2010.02387.x.
Nozhevnikova, A. N., Holliger, C., Ammann, A., and Zehnder, A. J. B. (1997). Methanogenesis in
sediments from deep lakes at different temperatures (2–70°C). Water Sci. Technol. 36, 57–64.
doi:10.1016/S0273-1223(97)00507-6.
Oksanen, J., Blanchet, G. F., Kindt, R., Legendre, P., Minchin, P., O’Hara, R. B., Simpson, G. L.,
Solymos, P., Stevens, H. H., and Wagner, H. M. (2013). Vegan: Community Ecology Package. Version 2.0-10. Available at: http://vegan.r-forge.r-project.org
Omelchenko, M. V., Vasileva, L. V., Zavarzin, G. A., Saveleva, N. D., Lysenko, A. M., and
97
Mityushina, L.L., Kamelenina, V.N., Trotsenko, Y. A. (1996). A novel psychrophilic
methanotroph of the genus Methylobacter. Microbiology 65, 339–343.
Op den Camp, H. J. M., Islam, T., Stott, M. B., Harhangi, H. R., Hynes, A., Schouten, S., Jetten, M.
S. M., Birkeland, N.-K., Pol, A., and Dunfield, P. F. (2009). Environmental, genomic and
taxonomic perspectives on methanotrophic Verrucomicrobia. Environ. Microbiol. Rep. 1,
293–306. doi:10.1111/j.1758-2229.2009.00022.x.
Oswald, K., Milucka, J., Brand, A., Littmann, S., Wehrli, B., Kuypers, M. M. M., and Schubert, C.
J. (2015). Light-dependent aerobic methane oxidation reduces methane emissions from
seasonally stratified lakes. PLoS One 10, e0132574. doi:10.1371/journal.pone.0132574.
Parveen, B., Reveilliez, J.-P., Mary, I., Ravet, V., Bronner, G., Mangot, J.-F., Domaizon, I., and
Debroas, D. (2011). Diversity and dynamics of free-living and particle-associated
Betaproteobacteria and Actinobacteria in relation to phytoplankton and zooplankton
communities. FEMS Microbiol. Ecol. 77, 461–76. doi:10.1111/j.1574-6941.2011.01130.x.
Paul, J. H. (2001). Gene expression by mRNA analysis. Methods Microbiol. 30, 395–408.
doi:10.1016/S0580-9517(01)30055-7.
Payette, S. (2004). Accelerated thawing of subarctic peatland permafrost over the last 50 years.
Geophys. Res. Lett. 31, 1–4. doi:10.1029/2004GL020358.
Pedrós-Alió, C. (2006). Marine microbial diversity: can it be determined? Trends Microbiol. 14,
257–263. doi:10.1016/j.tim.2006.04.007.
Pedrós-Alió, C. (2012). The rare bacterial biosphere. Ann. Rev. Mar. Sci. 4, 449–466.
doi:10.1146/annurev-marine-120710-100948.
Pienitz, R., Doran, P. T., and Lamoureux, S. F. (2008). “Origin and geomorphology of lakes in the
polar regions,” in Polar Lakes and Rivers: Limnology of Arctic and Antarctic Aquatic
Ecosystems, eds. W. F. Vincent and J. Laybourn-Parry (Oxford: Oxford University Press), 25–
41.
Pissart, A. (2000). Remnants of lithalsas of the Hautes Fagnes , Belgium : A summary of present-
day knowledge. Permafr. Periglac. Process. 11, 327–355. doi:10.1002/1099-
1530(200012)11:4<327::AID-PPP370>3.0.CO;2-Q.
Pissart, A. (2002). Palsas , lithalsas and remnants of these periglacial mounds. A progress report.
Prog. Phys. Geogr. 4, 605–621. doi:10.1191/0309133302pp354ra.
Pouliot, J., Galand, P. E., Lovejoy, C., and Vincent, W. F. (2009). Vertical structure of archaeal
communities and the distribution of ammonia monooxygenase A gene variants in two
meromictic High Arctic lakes. Environ. Microbiol. 11, 687–699. doi:10.1111/j.1462-
2920.2008.01846.x.
Pruesse, E., Quast, C., Knittel, K., Fuchs, B. M., Ludwig, W., Peplies, J., and Glockner, F. O.
(2007). SILVA: a comprehensive online resource for quality checked and aligned ribosomal
RNA sequence data compatible with ARB. Nucleic Acids Res. 35, 7188–7196.
doi:10.1093/nar/gkm864.
Przytulska, A., Comte, J., Crevecoeur, S., Lovejoy, C., Laurion, I., and Vincent, W. F. (2016).
98
Phototrophic pigment diversity and picophytoplankton abundance in permafrost thaw lakes.
Biogeosciences 13, 13–26. doi:10.5194/bgd-12-12121-2015.
Ptacnik, R., Solimini, A. G., Andersen, T., Tamminen, T., Brettum, P., Lepisto, L., Willen, E., and
Rekolainen, S. (2008). Diversity predicts stability and resource use efficiency in natural
phytoplankton communities. Proc. Natl. Acad. Sci. 105, 5134–5138.
doi:10.1073/pnas.0708328105.
Purkey, S. G., and Johnson, G. C. (2010). Warming of global abyssal and deep Southern Ocean
waters between the 1990s and 2000s: Contributions to global heat and sea level rise budgets.
J. Clim. 23, 6336–6351. doi:10.1175/2010JCLI3682.1.
Qu, J.-H., and Yuan, H.-L. (2008). Sediminibacterium salmoneum gen. nov., sp. nov., a member of
the phylum Bacteroidetes isolated from sediment of a eutrophic reservoir. Int. J. Syst. Evol.
Microbiol. 58, 2191–2194. doi:10.1099/ijs.0.65514-0.
R Core Team (2013). R: A language and environment for statistical computing. R Foundation for
Statistical Computing, Vienna. Available at: http://www.R-project.org/
Radajewski, S., McDonald, I. R., and Murrell, J. C. (2003). Stable-isotope probing of nucleic acids:
A window to the function of uncultured microorganisms. Curr. Opin. Biotechnol. 14, 296–
302. doi:10.1016/S0958-1669(03)00064-8.
Rahbek, C. (1995). The elevational gradient of species richness: a uniform pattern? Ecography 2,
200–205. doi:10.1111/j.1600-0587.1995.tb00341.x.
Reeburgh, W. S., Whalen, S. C., and Alperin., M. J. (1993). “The role of methylotrophy in the
global methane budget,” in Microbial growth on C1 compounds, eds. J. C. Murrell and D. P.
Kelly (Intercept, Andover, United Kingdom), 1–14.
Reiche, M., Lu, S., Ciobota, V., Neu, T. R., Nietzsche, S., Rösch, P., Popp, J., and Küsel, K. (2011).
Pelagic boundary conditions affect the biological formation of iron-rich particles (iron snow)
and their microbial communities. Limnol. Oceanogr. 56, 1386–1398.
doi:10.4319/lo.2011.56.4.1386.
Riordan, B., Verbyla, D., and McGuire, A. D. (2006). Shrinking ponds in subarctic Alaska based on
1950-2002 remotely sensed images. J. Geophys. Res. Biogeosciences 111, G04002.
doi:10.1029/2005JG000150.
Riser, S. C., Freeland, H. J., Roemmich, D., Wijffels, S., Troisi, A., Belbéoch, M., Gilbert, D., Xu,
J., Pouliquen, S., Thresher, A., Le Traon, P.-Y., Maze, G., Klein, B., Ravichandran, M., Grant,
F., Poulain, P.-M., Suga, T., Lim, B., Sterl, A., Sutton, P., Mork, K.-A., Vélez-Belchí, P. J.,
Ansorge, I., King, B., Turton, J., Baringer, M., and Jayne, S. R. (2016). Fifteen years of ocean
observations with the global Argo array. Nat. Clim. Chang. 6, 145–153.
doi:10.1038/nclimate2872.
Rosenfeld, J. S. (2002). Functional redundancy in ecology and conservation. Oikos 98, 156–162.
doi:10.1034/j.1600-0706.2002.980116.x.
Rossi, P., Laurion, I., and Lovejoy, C. (2013). Distribution and identity of Bacteria in subarctic
permafrost thaw ponds. Aquat. Microb. Ecol. 69, 231–245. doi:10.3354/ame01634.
99
Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating
inhibitors. Proc. Natl. Acad. Sci. U. S. A. 74, 5463–7. doi:10.1073/pnas.74.12.5463.
Sannel, A. B. K., and Kuhry, P. (2011). Warming-induced destabilization of peat
plateau/thermokarst lake complexes. J. Geophys. Res. Biogeosciences 116, G03035.
doi:10.1029/2010JG001635.
Schloss, P. D., Westcott, S. L., Ryabin, T., Hall, J. R., Hartmann, M., Hollister, E. B., Lesniewski,
R. A., Oakley, B. B., Parks, D. H., Robinson, C. J., Sahl, J. W., Stres, B., Thallinger, G. G.,
Van Horn, D. J., and Weber, C. F. (2009). Introducing mothur: open-source, platform-
independent, community-supported software for describing and comparing microbial
communities. Appl. Environ. Microbiol. 75, 7537–7541. doi:10.1128/AEM.01541-09.
Seguin, M. K., and Allard, M. (1984). Le pergélisol et les processus thermokarstiques de la région
de la rivière Nastapoca, Nouveau-Québec. Géographie Phys. Quat. 38, 11–25.
doi:10.7202/032532ar.
Sepulveda-Jauregui, A., Walter Anthony, K. M., Martinez-Cruz, K., Greene, S., and Thalasso, F.
(2015). Methane and carbon dioxide emissions from 40 lakes along a north–south latitudinal
transect in Alaska. Biogeosciences 12, 3197–3223. doi:10.5194/bg-12-3197-2015.
Serkebaeva, Y. M., Kim, Y., Liesack, W., and Dedysh, S. N. (2013). Pyrosequencing-based
assessment of the bacteria diversity in surface and subsurface peat layers of a northern
wetland, with focus on poorly studied phyla and candidate divisions. PLoS One 8, e63994.
doi:10.1371/journal.pone.0063994.
Shade, A., Jones, S. E., and McMahon, K. D. (2008). The influence of habitat heterogeneity on
freshwater bacterial community composition and dynamics. Environ. Microbiol. 10, 1057–67.
doi:10.1111/j.1462-2920.2007.01527.x.
Sharp, C. E., Stott, M. B., and Dunfield, P. F. (2012). Detection of autotrophic verrucomicrobial
methanotrophs in a geothermal environment using stable isotope probing. Front. Microbiol. 3,
303. doi:10.3389/fmicb.2012.00303.
Shokralla, S., Spall, J. L., Gibson, J. F., and Hajibabaei, M. (2012). Next-generation sequencing
technologies for environmental DNA research. Mol. Ecol. 21, 1794–1805. doi:10.1111/j.1365-
294X.2012.05538.x.
Sievert, S. M., Ziebis, W., Kuever, J., and Sahm, K. (2000). Relative abundance of Archaea and
Bacteria along a thermal gradient of a shallow-water hydrothermal vent quantified by rRNA
slot-blot hybridization. Microbiology 146, 1287–1293. doi:10.1099/00221287-146-6-1287.
Smith, K. S., and Ingram-Smith, C. (2007). Methanosaeta , the forgotten methanogen ? Trends
Microbiol. 15, 150–155. doi:10.1016/j.tim.2007.02.002.
Smith, L. C., Sheng, Y., MacDonald, G. M., and Hinzman, L. D. (2005). Disappearing Arctic lakes.
Science 308, 1429.
Smith, M. W., and Riseborough, D. W. (2002). Climate and the limits of permafrost: A zonal
analysis. Permafr. Periglac. Process. 13, 1–15. doi:10.1002/ppp.410.
Sower, K. R. (2009). “Methanogenesis,” in Encyclopedia of Microbiology, ed. M. Schaechter (San
100
Diego, CA), 265–286.
Stackhouse, B. T., Vishnivetskaya, T. A., Layton, A., Chauhan, A., Pfiffner, S., Mykytczuk, N. C.,
Sanders, R., Whyte, L. G., Hedin, L., Saad, N., Myneni, M., and Onstott, T. C. (2015). Effects
of simulated spring thaw of permafrost from mineral cryosol on CO2 emissions and
atmospheric CH4 uptake. J. Geophys. Res. Biogeosciences 120, 1764–1784.
doi:10.1002/2014JG002802.Received.
Stainton, M., Capel, M. J., and Armstrong, F. A. (1977). The Chemical Analysis of Fresh Water.
Winnipeg: Canadian Fisheries and Marine Service. Special Publication 25, 1-168.
Steven, B., Lionard, M., Kuske, C. R., and Vincent, W. F. (2013). High bacterial diversity of
biological soil crusts in water tracks over permafrost in the high arctic polar desert. PLoS One
8, e71489. doi:10.1371/journal.pone.0071489.
Stoecker, K., Bendinger, B., Schöning, B., Nielsen, P. H., Nielsen, J. L., Baranyi, C., Toenshoff, E.
R., Daims, H., and Wagner, M. (2006). Cohn’s Crenothrix is a filamentous methane oxidizer
with an unusual methane monooxygenase. PNAS 103, 2363–7. doi:10.1073/pnas.0506361103.
Suweis, S., Simini, F., Banavar, J. R., and Maritan, A. (2013). Emergence of structural and
dynamical properties of ecological mutualistic networks. Nature 500, 449–452.
doi:10.1038/nature12438.
Taipale, S., Jones, R., and Tiirola, M. (2009). Vertical diversity of bacteria in an oxygen-stratified
humic lake, evaluated using DNA and phospholipid analyses. Aquat. Microb. Ecol. 55, 1–16.
doi:10.3354/ame01277.
Tamames, J., Abellán, J. J., Pignatelli, M., Camacho, A., and Moya, A. (2010). Environmental
distribution of prokaryotic taxa. BMC Microbiol. 10, 85. doi:10.1186/1471-2180-10-85.
Tarnocai, C., Canadell, J. G., Schuur, E. A. G., Kuhry, P., Mazhitova, G., and Zimov, S. (2009).
Soil organic carbon pools in the northern circumpolar permafrost region. Global Biogeochem.
Cycles 23, 1–11. doi:10.1029/2008GB003327.
Thauer, R. K., Kaster, A.-K., Seedorf, H., Buckel, W., and Hedderich, R. (2008). Methanogenic
Archaea: ecologically relevant differences in energy conservation. Nat. Rev. Microbiol. 6,
579–591. doi:10.1038/nrmicro1931.
Thomas, T., Gilbert, J., and Meyer, F. (2012). Metagenomics - a guide from sampling to data
analysis. Microb. Inform. Exp. 2, 3. doi:10.1186/2042-5783-2-3.
Tranvik, L. J., Downing, J. A., Cotner, J. B., Loiselle, S. A., Striegl, R. G., Ballatore, T. J., Dillon,
P., Finlay, K., Fortino, K., Knoll, L. B., Kortelainen, P. L., Kutser, T., Larsen, S., Laurion, I.,
Leech, D. M., Mccallister, S. L., Mcknight, D. M., Melack, J. M., Overholt, E., Porter, J. A.,
Prairie, Y., Renwick, W. H., Roland, F., Sherman, B. S., Schindler, D. W., Sobek, S.,
Tremblay, A., Vanni, M. J., Verschoor, A. M., Wachenfeldt, E. Von, and Weyhenmeyer, G.
A. (2009). Lakes and reservoirs as regulators of carbon cycling and climate. Limnol.
Oceanogr. 54, 2298–2314. doi:10.4319/lo.2009.54.6_part_2.2298.
Trimmer, M., Shelley, F. C., Purdy, K. J., Maanoja, S. T., Chronopoulou, P.-M., and Grey, J.
(2015). Riverbed methanotrophy sustained by high carbon conversion efficiency. ISME J. 9,
2304–2314. doi:10.1038/ismej.2015.98.
101
Tripathi, B. M., Kim, M., Lai-Hoe, A., Shukor, N. A. A., Rahim, R. A., Go, R., and Adams, J. M.
(2013). pH dominates variation in tropical soil archaeal diversity and community structure.
FEMS Microbiol. Ecol. 86, 303–311. doi:10.1111/1574-6941.12163.
Trotsenko, Y. A., and Khmelenina, V. N. (2005). Aerobic methanotrophic bacteria of cold
ecosystems. FEMS Microbiol. Ecol. 53, 15–26. doi:10.1016/j.femsec.2005.02.010.
Tuomivirta, T. T., Yrjälä, K., and Fritze, H. (2009). Quantitative PCR of pmoA using a novel
reverse primer correlates with potential methane oxidation in Finnish fen. Res. Microbiol. 160,
751–756. doi:10.1016/j.resmic.2009.09.008.
Urmann, K., Lazzaro, A., Gandolfi, I., Schroth, M. H., and Zeyer, J. (2009). Response of
methanotrophic activity and community structure to temperature changes in a diffusive
CH4/O2 counter gradient in an unsaturated porous medium. FEMS Microbiol. Ecol. 69, 202–
212. doi:10.1111/j.1574-6941.2009.00708.x.
Vadstein, O. (2000). Heterotrophic, planktonic bacteria and cycling of phosphorus. Adv. Microb.
Ecol. 16, 115–167. doi:10.1007/978-1-4615-4187-5_4.
Vecherskaya, M., Dijkema, C., Saad, H. R., and Stams, A. J. M. (2009). Microaerobic and
anaerobic metabolism of a Methylocystis parvus strain isolated from a denitrifying bioreactor.
Environ. Microbiol. Rep. 1, 442–449. doi:10.1111/j.1758-2229.2009.00069.x.
Vecherskaya, M. S., Galchenko, V. F., Sokolova, E. N., and Samarkin, V. A. (1993). Activity and
species composition of aerobic methanotrophic communities in tundra soils. Curr. Microbiol.
27, 181–184. doi:10.1007/BF01576018.
Vincent, W. F. (2000). “Cyanobacterial dominance in the polar regions,” in The Ecology of
Cyanobacteria, eds. B. A. Whitton and M. Potts (Dordrecht : Kluwer Academic Publisher),
321–340.
Vincent, W. F. (2009). “Effects of Climate Change on Lakes,” in Encyclopedia of Inland Waters,
ed. G. E. Likens (Oxford : Elsevier), 55–60.
Vincent, W. F., Laurion, I., Pienitz, R., and Walter Anthony, K. M. (2013a). “Climate impacts on
Arctic Lake ecosystems,” in Climatic Change and Global Warming of Inland Waters: Impacts
and Mitigation for Ecosystems and Societies, eds. C. R. Goldman, M. Kumagai, and R. D.
Robarts, 27–42.
Vincent, W. F., Lemay, M., Allard, M., and Wolfe, B. B. (2013b). Adapting to permafrost change: a
science framework. Eos, Trans. Am. Geophys. Union 94, 373–375.
doi:10.1002/2013EO420002.
Vonk, J. E., Tank, S. E., Bowden, W. B., Laurion, I., Vincent, W. F., Alekseychik, P., Amyot, M.,
Billet, M. F., Canário, J., Cory, R. M., Deshpande, B. N., Helbig, M., Jammet, M., Karlsson,
J., Larouche, J., MacMillan, G., Rautio, M., Walter Anthony, K. M., and Wickland, K. P.
(2015). Reviews and Syntheses: Effects of permafrost thaw on arctic aquatic ecosystems.
Biogeosciences Discuss. 12, 10719–10815. doi:10.5194/bgd-12-10719-2015.
Wagner, D., Lipski, A., Embacher, A., and Gattinger, A. (2005). Methane fluxes in permafrost
habitats of the Lena Delta: Effects of microbial community structure and organic matter
quality. Environ. Microbiol. 7, 1582–1592. doi:10.1111/j.1462-2920.2005.00849.x.
102
Walter, K. M., Chanton, J. P., Chapin, F. S., Schuur, E. A. G., and Zimov, S. A. (2008). Methane
production and bubble emissions from arctic lakes: Isotopic implications for source pathways
and ages. J. Geophys. Res. 113. doi:10.1029/2007JG000569.
Walter, K. M., Smith, L. C., and Chapin, F. S. (2007). Methane bubbling from northern lakes:
present and future contributions to the global methane budget. Philos. Trans. A. Math. Phys.
Eng. Sci. 365, 1657–1676. doi:10.1098/rsta.2007.2036.
Walter, K. M., Zimov, S. a, Grosse, G., Jones, M. C., Anthony, P. M., Chapin, F. S., Finlay, J. C.,
Mack, M. C., Davydov, S., Frenzel, P., and Frolking, S. (2014). A shift of thermokarst lakes
from carbon sources to sinks during the Holocene epoch. Nature 511, 452–456.
doi:10.1038/nature13560.
Walter, K. M., Zimov, S. A., Chanton, J. P., Verbyla, D., and Chapin, F. S. (2006). Methane
bubbling from Siberian thaw lakes as a positive feedback to climate warming. Nature 443, 71–
75. doi:10.1038/nature05040.
Wartiainen, I., Hestnes, A. G., McDonald, I. R., and Svenning, M. M. (2006). Methylobacter
tundripaludum sp. nov., a methane-oxidizing bacterium from Arctic wetland soil on the
Svalbard islands, Norway (78 degrees N). Int. J. Syst. Evol. Microbiol. 56, 109–13.
doi:10.1099/ijs.0.63728-0.
Wartiainen, I., Hestnes, A. G., and Svenning, M. M. (2003). Methanotrophic diversity in high arctic
wetlands on the islands of Svalbard (Norway)-denaturing gradient gel electrophoresis analysis
of soil DNA and enrichment cultures. Can. J. Microbiol. 49, 602–612. doi:10.1139/w03-080.
Watanabe, S., Laurion, I., Chokmani, K., Pienitz, R., and Vincent, W. F. (2011). Optical diversity
of thaw ponds in discontinuous permafrost: A model system for water color analysis. J.
Geophys. Res. 116, G02003. doi:10.1029/2010JG001380.
Wik, M., Varner, R. K., Walter Anthony, K., MacIntyre, S., and Bastviken, D. (2016). Climate-
sensitive northern lakes and ponds are critical components of methane release. Nat. Geosci. 9,
99–106. doi:10.1038/ngeo2578.
Wilkins, D., Lu, X.-Y., Shen, Z., Chen, J., and Lee, P. K. H. (2015). Pyrosequencing of mcrA and
archaeal 16S rRNA genes reveals diversity and substrate preferences of methanogen
communities in anaerobic digesters. Appl. Environ. Microbiol. 81, 604–13.
doi:10.1128/AEM.02566-14.
Will, C., Thürmer, A., Wollherr, A., Nacke, H., Herold, N., Schrumpf, M., Gutknecht, J., Wubet,
T., Buscot, F., and Daniel, R. (2010). Horizon-specific bacterial community composition of
German grassland soils, as revealed by pyrosequencing-based analysis of 16S rRNA genes.
Appl. Environ. Microbiol. 76, 6751–9. doi:10.1128/AEM.01063-10.
Woese, C. R. (1996). Phylogenetic trees: Whither microbiology? Curr. Biol. 6, 1060–1063.
doi:10.1016/S0960-9822(02)70664-7.
Woese, C. R., Kandler, O., and Wheelis, M. L. (1990). Towards a natural system of organisms:
proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. U. S. A. 87,
4576–4579. doi:10.1073/pnas.87.12.4576.
Wold, S., Sjostrom, M., and Eriksson, L. (2001). PLS-regression : a basic tool of chemometrics.
103
Chemom. Intell. Lab. Syst. 58, 109–130.
Wrona, F. J., Johansson, M., Culp, J. M., Jenkins, A., Mård, J., Myers-Smith, I. H., Prowse, T. D.,
Vincent, W. F., and Wookey, P. A. (2016). Transitions in Arctic ecosystems: Ecological
implications of a changing hydrological regime. J. Geophys. Res. Biogeosciences 121.
doi:10.1002/2015JG003133.OnlineOpen.
Wu, L., Ma, K., and Lu, Y. (2009). Rice roots select for type I methanotrophs in rice field soil. Syst.
Appl. Microbiol. 32, 421–428. doi:10.1016/j.syapm.2009.05.001.
Xie, H., Bélanger, S., Demers, S., Vincent, W. F., and Papakyriakou, T. N. (2009).
Photobiogeochemical cycling of carbon monoxide in the southeastern Beaufort Sea in spring
and autumn. Limnol. Oceanogr. 54, 234–249. doi:10.4319/lo.2009.54.1.0234.
Yang, S., Liebner, S., Alawi, M., Ebenhöh, O., and Wagner, D. (2014). Taxonomic database and
cut-off value for processing mcrA gene 454 pyrosequencing data by MOTHUR. J. Microbiol.
Methods 103, 3–5. doi:10.1016/j.mimet.2014.05.006.
Yannarell, A. C., and Triplett, E. W. (2004). Within- and between-lake variability in the
composition of bacterioplankton communities : investigations using multiple spatial scales.
Appl. Environ. Microbiol. 70, 214–223. doi:10.1128/AEM.70.1.214.
Yavitt, J. B., Yashiro, E., Cadillo-Quiroz, H., and Zinder, S. H. (2011). Methanogen diversity and
community composition in peatlands of the central to northern Appalachian Mountain region,
North America. Biogeochemistry 109, 117–131. doi:10.1007/s10533-011-9644-5.
Ye, W., Liu, X., Lin, S., Tan, J., Pan, J., Li, D., and Yang, H. (2009). The vertical distribution of
bacterial and archaeal communities in the water and sediment of Lake Taihu. FEMS
Microbiol. Ecol. 70, 107–20. doi:10.1111/j.1574-6941.2009.00761.x.
Yun, J., Ma, A., Li, Y., Zhuang, G., Wang, Y., and Zhang, H. (2010). Diversity of methanotrophs in
Zoige wetland soils under both anaerobic and aerobic conditions. J. Environ. Sci. 22, 1232–
1238. doi:10.1016/S1001-0742(09)60243-6.
Yvon-Durocher, G., Allen, A. P., Bastviken, D., Conrad, R., Gudasz, C., St-Pierre, A., Thanh-Duc,
N., and del Giorgio, P. A. (2014). Methane fluxes show consistent temperature dependence
across microbial to ecosystem scales. Nature 507, 488–491. doi:10.1038/nature13164.
Zak, D. R., Blackwood, C. B., and Waldrop, M. P. (2006). A molecular dawn for biogeochemistry.
Trends Ecol. Evol. 21, 288–295. doi:10.1016/j.tree.2006.04.003.
Zhang, T., Zhu, W., Mo, J., Liu, L., and Dong, S. (2011). Increased phosphorus availability
mitigates the inhibition of nitrogen deposition on CH4 uptake in an old-growth tropical forest,
southern China. Biogeosciences 8, 2805–2813. doi:10.5194/bg-8-2805-2011.
104
Annexes
Annexe 1. Sequencing results of the number of reads and number of OTUs and diversity indexes calculated with
QIIME for each sample. Samples are designated by pond name followed by the position in the water column
(surface, S; bottom, B), and then by fraction (small, S; large, L).
Sample Reads OTUs Shannon Simpson Chao1
SAS1B-S-S 3837 204 5.17 0.93 218
SAS1B-B-S 4384 198 4.41 0.89 223
SAS2A-S-S 3242 169 4.07 0.87 195
SAS2A-B-S 4063 163 3.91 0.84 188
KWK1-S-S 3071 116 5.02 0.94 128
KWK1-B-S 10562 307 4.03 0.72 340
KWK1-S-L 6114 185 5.44 0.95 199
KWK1-B-L 7807 291 4.80 0.82 315
KWK6-S-S 3832 182 5.82 0.96 213
KWK6-B-S 3639 182 5.16 0.94 222
KWK6-S-L 5856 202 4.98 0.91 223
KWK6-B-L 4916 238 5.30 0.94 256
KWK23-S-S 5502 186 5.60 0.96 219
KWK23-B-S 3577 223 5.18 0.91 241
BGR1-S-S 4374 127 4.82 0.93 150
BGR1-B-S 3922 102 4.48 0.89 114
BGR1-S-L 6058 261 6.09 0.97 275
BGR1-B-L 5993 209 5.43 0.94 222
BGR2-S-S 3922 99 4.13 0.89 110
BGR2-B-S 4164 106 3.86 0.85 116
BGR2-S-L 6936 204 4.26 0.80 235
BGR2-B-L 6708 141 4.02 0.85 153
105
Annexe 2. Ponds sampled during the 2012 and 2013 field campaign and the availability of data.
Pond Depth Year cDNA Illumina
sequencing data
qPCR data
Small Large
BGR1 Surface 2013 X X X X BGR1 Bottom 2013 X X X X
BGR2 Surface 2012 X X X X
BGR2 Bottom 2012 X X X X
NASH Surface 2012
NASH Bottom 2012 X X X X
KWK1 Surface 2012
KWK1 Bottom 2012 X X X X
KWK6 Surface 2012
KWK6 Bottom 2012 X X X X
KWK12 Surface 2013
KWK12 Bottom 2013 X
KWK23 Surface 2012
KWK23 Bottom 2012 X X X X
SAS1A Surface 2013 X X X
SAS1A Bottom 2013 X X X
SAS1B Surface 2013
SAS1B Bottom 2012 X X X X
SAS2A Surface 2013 X X X
SAS2A Bottom 2013 X X X
SAS2A Surface 2012 X X X X
SAS2A Bottom 2012 X X X X
SAS2B Surface 2013 X X X X
SAS2B Bottom 2013 X X X X
106
Annexe 3. Properties of the pmoA primers fused with the Trueseq sequencing primers.
Primer Targeting
region
Trueseq primers References
PmoA
169f
pmoA ACACTCTTTCCCTACACGACGCTCTTCCGATCT-
GGNGACTGGGACTTCTGG
(Kolb et al.,
2003)
pmoA
661r
pmoA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
T- CCGGMGCAACGTCYTTACC
(Kolb et al.,
2003)
Generic forward
second-PCR primer
AATGATACGGCGACCACCGAGATCTACAC[index
1]ACACTCTTTCCCTACACGAC
Generic reverse
second-PCR primer
CAAGCAGAAGACGGCATACGAGAT[index2]GTG
ACTGGAGTTCAGACGTGT
107
Annexe 4. Physico-chemical properties of the surface and bottom (0.5 m above the sediments) of the sampled
ponds. Temperature (T°C), Conductivity in µS cm-1 (Cond), dissolved oxygen in mg L-1(O2), pH, total nitrogen in
mg L-1 (TN), total phosphorus in µg L-1 (TP), dissolved organic carbon in mg L-1 (DOC), total suspended solids
(TSS), Chlorophyll a in µg L-1 (Chla), concentration of carbon dioxide in µM (CO2) and concentration of methane
in µM (CH4). -: no data
Pond Depth T°C Cond O2 pH TN TP SRP DOC TSS Chla CO2 CH4
BGR1 surface 20.0 0.1 9.9 8.8 - 22.2 - - 1.6 0.9 22.6 1.1
BGR1 bottom 9.7 0.1 3.0 7.3 - 19.4 - - - 1.2 - -
BGR2 surface 15.0 0.2 9.4 7.3 0.5 49.1 3.4 9.3 13.1 2.4 20.2 0.4
BGR2 bottom 11.0 0.4 3.5 7.2 1.2 148.9 4.5 8.7 57.4 3.8 229.2 2.6
NASH surface 18.3 89.0 9.7 7.6 0.6 30.5 6.2 4.1 18.2 2.1 - -
NASH bottom 7.1 0.1 1.7 7.3 0.6 64.8 6.3 3.7 18.3 2.0 - -
KWK1 surface 17.9 0.1 9.7 6.7 0.6 67.9 3.7 12.0 20.3 10.9 - -
KWK1 bottom 6.4 0.2 0.5 6.2 1.1 87.8 12.6 12.0 140.8 10.3 - -
KWK6 surface 14.0 0.1 9.9 6.4 0.4 29.8 1.3 5.2 7.3 3.3 - -
KWK6 bottom 8.3 0.1 1.8 6.4 0.7 99.9 1.0 5.2 16.0 27.1 - -
KWK23 surface 14.7 0.0 9.8 6.4 0.4 57.1 5.5 7.8 6.4 1.9 - -
KWK23 bottom 4.4 0.3 0.4 6.1 2.7 170.5 133.6 10.9 73.6 7.2 - -
SAS1A surface 18.5 - - - - - 3.3 - 2.8 12.6 - -
SAS1A bottom 13.5 0.1 6.4 6.0 0.9 15.9 3.1 15.5 27.1 5.0 - -
SAS1B surface 9.1 0.2 1.7 5.6 1.8 29.1 3.0 16.2 33.1 3.0 - -
SAS1B bottom 9.1 0.2 1.7 5.6 1.8 29.1 3.0 16.2 33.1 3.0 - -
SAS2A surface 19.9 0.1 5.8 6.2 0.7 10.9 3.0 14.9 2.6 1.4 470.8 3.4
SAS2A bottom 4.6 0.3 0.3 5.6 1.6 41.5 4.1 18.9 - 18.1 1954.9 101.7
SAS2B surface 16.4 0.1 5.2 6.8 - 24.1 - - - 8.6 290.0 3.0
SAS2B bottom 6.1 0.1 0.2 6.4 - 58.2 3.0 - - 2.7 3872.2 292.0
108
Annexe 5. Rarefaction curves of the pmoA. OTUs were clustered at 93%.
109
Annexe 6. 16S rRNA and methanogenic orders recovered from the surface water samples, and percent
representation in the sequences.
Taxonomy SAS2A SAS2B BGR2
Large Small Large Small Large Small
Methanomicrobiales 23 4 8 2 51 41
Methanosarcinales 18 < 1 33 <1 8 <1
Methanobacteriales 2 0 1 <1 2 <1
Methanocellales <1 0 0 0 <1 <1
Unclassified Euryarchaeota 40 69 41 64 23 36
MEG 7 21 12 26 9 18
Thermoplasmata 4 < 1 < 1 < 1 4 < 1
Halobacteriales < 1 < 1 <1 <1 <1 2
DESG < 1 0 < 1 2 < 1 < 1
MCG 2 < 1 1 < 1 < 1 0
Group C3 < 1 < 1 < 1 1 < 1 < 1
Marine Benthic Group B 0 < 1 < 1 0 < 1 < 1
Thermoprotei 0 0 0 0 < 1 < 1
Unclassified Crenarchaeota 0 0 < 1 0 < 1 0
Thaumarchaeota 0 0 0 0 0 0
Unclassified Archaea 3 3 3 4 1 1
110
Annexe 7. Rarefaction curves of the 16S rRNA. OTUs were clustered at 97%.
111
Annexe 8. Properties of the V6-V8 16S rRNA and mcrA primers fused with the Trueseq sequencing primers.
Primer Targeting
region
Trueseq primers References
A-956F V6-V8 ACACTCTTTCCCTACACGACGCTCTTCCGATCT-
TYAATYGGANTCAACRCC
Comeau et al.,
2011
A-1401R V6-V8 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-
CRGTGWGTRCAAGGRGCA
Comeau et al.,
2011
MLF mcrA ACACTCTTTCCCTACACGACGCTCTTCCGATCT-
GGTGGTGTMGGDTTCACMCARTA
Luton et al.,
2002
MLR mcrA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-
TTCATTGCRTAGTTWGGRTAGTT
Luton et al.,
2002
Generic forward
second-PCR primer
AATGATACGGCGACCACCGAGATCTACAC[index1]AC
ACTCTTTCCCTACACGAC
Generic reverse
second-PCR primer
CAAGCAGAAGACGGCATACGAGAT[index2]GTGACTG
GAGTTCAGACGTGT
top related