cartographie des complexes multiprotéiques humains suite à la … · 2020. 8. 7. · ptre -bi...
TRANSCRIPT
Cartographie des complexes multiprotéiques
humains suite à la modification ciblée du génome
Mémoire
Jérémy Loehr
Maitrise en biologie cellulaire et moléculaire
Maitrise ès Sciences (M.Sc.)
Québec, Canada
© Jérémy Loehr, 2017
ii
iii
RÉSUMÉ
La purification par affinité couplée à l’analyse par spectrométrie de masse (AP-MS)
est une méthode de choix pour l’étude des interactions protéines-protéines chez les cellules
humaines. Par contre, cette technique est sensible aux perturbations causées par la
surexpression ectopique des protéines cibles. Des effets anormaux, tels que la formation
d’agrégats et la délocalisation des protéines cibles, peuvent mener à des conclusions
erronées. Il est donc important de reproduire le plus précisément possible les niveaux
physiologiques normaux des protéines à l’étude. Les travaux présentés dans ce mémoire
décrivent le développement d’un système robuste et rapide couplant l’édition du génome et
la protéomique permettant l’isolation de complexes protéiques natifs exprimés à des
niveaux quasi physiologiques. L’approche a servie de tremplin afin d’atteindre l’objectif
ultime qui est de caractériser les protéines exprimées à partir de leur contexte génomique
naturel. À l’aide des outils d’édition génomique, nous avons introduit de façon ciblée au
locus AAVS1 une cassette permettant l’expression de protéines d’intérêt étiquetées avec une
séquence permettant la purification par affinité. Ainsi, nous avons purifié de nombreuses
holoenzymes impliquées dans la réparation de l’ADN et la modification de la chromatine.
Nous avons identifié de nouvelles sous-unités et interactions au sein de complexes déjà
bien caractérisés et rapportons l’isolation de MCM8/9, soulignant ainsi l’efficacité et la
robustesse de notre approche. La technique présentée dans ce mémoire améliore et
simplifie l’exploration des interactions protéiques ainsi que l’étude de leur activité
biochimique, structurelle et fonctionnelle.
v
ABSTRACT
Conventional affinity purification followed by mass spectrometry (AP-MS) analysis
is a broadly applicable method to decipher molecular interaction networks and infer protein
function. However, it is sensitive to perturbations induced by ectopically overexpressed
target proteins and does not reflect multilevel physiological regulation in response to
diverse stimuli. Here, we developed an interface between genome editing and proteomics to
isolate native protein complexes produced from their natural genomic contexts. We used
CRISPR/Cas9 and ZFNs to insert cDNA of interest in the endogenous genomic safe harbor
locus AAVS1 and purified several DNA repair and chromatin modifying holoenzymes to
near homogeneity. We uncovered novel subunits and interactions amongst well-
characterized complexes and report the isolation of MCM8/9, highlighting the efficiency
and robustness of the approach. These methods improve and simplify both small and large-
scale explorations of protein interactions, as well as the study of biochemical activities and
structure-function relationships.
vii
TABLE DES MATIÈRES
RÉSUMÉ iii
ABSTRACT v
TABLE DES MATIÈRES vii
LISTE DES TABLEAUX xi
LISTE DES FIGURES xiii
LISTE DES ABRÉVIATIONS ET SIGLES xv
REMERCIEMENTS xvii
AVANT PROPOS xix
INTRODUCTION 1
1.0 Identification des complexes protéiques cellulaires ............................................... 3
1.1 Techniques utilisées pour la purification des complexes protéiques ............... 3
1.1.1 Purification d’affinité en tandem ............................................................ 3
Limites ........................................................................................... 5 1.1.1.1
1.1.2 Purification par étiquette d’affinité ......................................................... 6
L’étiquette FLAG ........................................................................... 7 1.1.2.1
L’étiquette Strep ............................................................................. 8 1.1.2.2
1.2 Les systèmes inductibles avec la tétracycline .................................................. 9
1.2.1 Le système Tétracycline-Off ................................................................... 9
1.2.2 Le système Tétracycline-On ................................................................. 10
1.2.3 L’amélioration des systèmes ................................................................. 11
1.2.4 Limites .................................................................................................. 12
1.3 Limites des techniques présentement utilisées. .............................................. 12
2.0 Concept de genomic safe harbour ........................................................................ 13
2.1 Insertion au locus AAVS1 ............................................................................. 14
3.0 L’édition du génome grâce aux nucléases d’ingénierie ....................................... 14
3.1 Les endonucléases .......................................................................................... 15
3.1.1 Les nucléases à doigt de zinc ................................................................ 15
Origines ........................................................................................ 15 3.1.1.1
viii
Reconnaissance et clivage d’une séquence spécifique d’ADN.... 15 3.1.1.2
Utilité pour la modification du génome ....................................... 16 3.1.1.3
Limites ......................................................................................... 17 3.1.1.4
3.1.2 Les nucléase effectrices de type activateur de transcription ................. 17
Origines ........................................................................................ 17 3.1.2.1
Reconnaissance et clivage d’une séquence spécifique d’ADN.... 18 3.1.2.2
Utilisation pour la modification du génome ................................ 19 3.1.2.3
Limites ......................................................................................... 19 3.1.2.4
3.1.3 Le système CRISPR/Cas9 ..................................................................... 19
Origines ........................................................................................ 19 3.1.3.1
Reconnaissance et clivage d’une séquence spécifique d’ADN.... 20 3.1.3.2
Protospacer Adjacent Motif ......................................................... 21 3.1.3.3
Utilisation pour la modification du génome ................................ 22 3.1.3.4
Limites ......................................................................................... 22 3.1.3.5
4.0 Mécanismes de réparation de l’ADN ................................................................... 23
4.1 Réparation des coupures simple brin ............................................................. 23
4.2 Réponse aux dommages à l’ADN .................................................................. 24
4.2.1 Jonction des extrémités non-homologues ............................................. 26
Mécanisme ................................................................................... 26 4.2.1.1
Protéines impliquées .................................................................... 26 4.2.1.2
Importance de ce mécanisme pour l’invalidation génique ........... 28 4.2.1.3
4.2.2 Recombinaison homologue ................................................................... 28
Mécanisme ................................................................................... 28 4.2.2.1
Protéines impliquées .................................................................... 28 4.2.2.2
Voies de réparation menant au HR .............................................. 29 4.2.2.3
4.2.2.3.1 Synthesis Dependent Strand Annealing ............................. 29
4.2.2.3.2 Double-Strand Break Repair .............................................. 30
4.2.2.3.3 Break-induced repair .......................................................... 31
4.2.2.3.4 Single-Strand Annealing..................................................... 31
Importance du processus de réparation pour l’édition du génome32 4.2.2.4
4.2.3 Utilisation temporelle des mécanismes de réparation de l’ADN .......... 33
ix
PROBLÉMATIQUE ET OBJECTIFS DES TRAVAUX 35
CHAPITRE 1 37
AVANT-PROPOS ................................................................................................. 39
RÉSUMÉ ............................................................................................................... 41
ABSTRACT .......................................................................................................... 43
INTRODUCTION ................................................................................................. 45
EXPERIMENTAL PROCEDURES...................................................................... 47
RESULTS .............................................................................................................. 50
DISCUSSION ........................................................................................................ 68
REFERENCES ...................................................................................................... 72
SUPPLEMENTAL EXPERIMENTAL PROCEDURES ..................................... 79
SUPPLEMENTAL INFORMATION ................................................................... 83
DISCUSSION GÉNÉRALE 97
CONCLUSION 104
RÉFÉRENCES 107
xi
LISTE DES TABLEAUX
Introduction
Tableau 1: Caractéristiques des étiquettes d’affinités communément utilisées ..................... 7
Tableau 2: Motif de liaison du PAM dans des orthologues de Cas9 .................................... 22
Chapitre 1
Table S1, Related to Figures 1 and 2. NuA4 Complex Subunits Identified by Mass
Spectrometry Analysis .................................................................................................. 54
Table S2, Related to Figure 3. PRC2 Complex Subunits Identified by Mass Spectrometry
Analysis ........................................................................................................................ 60
Table S1, Related to Figures 1 and 2. NuA4 Complex Subunits Identified by Mass
Spectrometry Analysis .................................................................................................. 93
Table S2, Related to Figure 3. PRC2 Complex Subunits Identified by Mass Spectrometry
Analysis ........................................................................................................................ 94
Table S3, Related to Figure 4. FA Core and Anchor Complexes Subunits Identified by
Mass Spectrometry Analysis ........................................................................................ 94
Table S4, Related to Figure 5. MCM8 Complex Subunits Identified by Mass Spectrometry
Analysis ........................................................................................................................ 95
Discussion
Tableau 3 : Avantages et désavantages des techniques de purification de complexes
protéine-protéine utilisées précédemment et de celle décrite dans ce mémoire ........ 100
Tableau 4: Avantages et désavantages des systèmes Tet-On et notre système auto-
inductible .................................................................................................................... 102
xiii
LISTE DES FIGURES
Introduction
Figure 1 : Un survol de la stratégie de purification TAP ........................................................ 4
Figure 2 : Séquences d'acide aminé de l'étiquette FLAG et 3xFLAG .................................... 8
Figure 3 : Représentation schématique du principe de purification d’un strep-tag et d’un
twin-strep-tag .................................................................................................................. 9
Figure 4 : Tétracycline Off et Tétracycline On .................................................................... 11
Figure 5 : Le système Tet-On 3G permet l’induction de l’expression d’un gène en présence
de la doxycycline. ......................................................................................................... 12
Figure 6 : Schéma du mécanisme d’action et de la structure d’une nucléase à doigt de zinc
...................................................................................................................................... 16
Figure 7 : Représentation schématique de la structure et de la fonction des TALENs ........ 18
Figure 8 : Schéma de la nucléase Cas9 guidée par l’ARN ................................................... 21
Figure 9 : Schéma de réparation d’une DSB par les voies NHEJ et HR .............................. 25
Figure 10 : Représentation d’une réparation par Synthesis Dependent Strand Annealing .. 30
Figure 11 : Représentation de Double-Strand Break Repair ................................................ 30
Figure 12 : Représentation du Break-Induced Repair .......................................................... 31
Figure 13 : Représentation de Single-Strand Annealing ...................................................... 32
Chapitre 1
Figure 1. ZFN-Driven Gene Addition to the AAVS1 Locus Simplifies Tandem Affinity
Purification of Multisubunit Protein Complexes .......................................................... 51
Figure 2. CRISPR/Cas9-Driven Tagging of NuA4 Subunits Enables Reciprocal Tandem
Affinity Purification of the Endogenous Native Complexes ........................................ 57
Figure 3. Tandem Affinity Purification of the Native PRC2 Protein Complex ................... 59
Figure 4. Tandem Affinity Purification of Endogenously Tagged Fanconi Anemia Core
Complex........................................................................................................................ 63
Figure 5. Tandem Affinity Purification of Endogenously Tagged Minichromosome
Maintenance Complex Component 8 ........................................................................... 64
xiv
Figure 6. Efficient Complex Purification from Unselected Gene-Modified Cell Pools ...... 66
Figure S1. Related to Figure 1. Determination of the Optimal Purification Steps for TAP
and Protein Expression in Single Cell-Derived Clones After ZFN / CRISPR-Driven
Gene Addition to the AAVS1 Locus ............................................................................ 83
Figure S2, Related to Figure 2. Strategy for CRISPR/Cas9-Driven Insertion of the TAP Tag
to the C-Terminus of the EPC1, EP400 and MBTD1 Proteins .................................... 85
Figure S3, Related to Figure 2. CRISPR/Cas9-Driven Insertion of the TAP Tag to the C-
Terminus of the EPC1 and EP400 Proteins .................................................................. 86
Figure S4, Related to Figure 3. TALEN-Driven Insertion of the TAP Tag to the N-
Terminus of the EZH2 Protein ..................................................................................... 87
Figure S5, Related to Figures 4 and 5. Strategy for CRISPR/Cas9-Driven Insertion of the
TAP Tag to the N-Terminus of FANCF and to the C-Terminus of MCM8 ................ 89
Figure S6, Related to Figure 1. Tandem-Affinity Purification (TAP) of JADE1L, JADE1S,
and the ATM kinase along with the Presentation of the Auto-Regulated Tet-On 3G
System. ......................................................................................................................... 92
xv
LISTE DES ABRÉVIATIONS ET SIGLES
AAVS1 Site d’intégration 1 du virus associé à l'adénovirus
AAVS1 Virus associé à l'adénovirus
AP Apurinique ou apyrimidine
ATM Ataxia telangiectasia mutated
BER Réparation par excision de bases
BIR Break-induced repair
Cas CRISPR-associé
CBP Peptide liant à la calmoduline
CRISPR Courtes répétitions palindromiques groupées et régulièrement espacées
crRNA CRISPR RNA
DBD Domaine de liaison à l'ADN
DDR Réponse aux dommages à l'ADN
D-loop Boucle de déplacement
DNA-PKcs DNA-dependent protein kinase catalytic subunit
DSB Cassure double brin
DSBR Double-Strand Break Repair
EGTA Acide tétraacétique d’éthylène glycol
EK Entérokinase
ESCs Cellules souches embryonnaires
gRNA Guide RNA
GSH Genomic safe harbor
HJ Jonction d'Holliday
HR Recombinaison homologue
HSPC Cellules souches et progéniteurs hématopoïétique
IgG Immunoglobulin G
Indels Insertions ou délétions
iPSCs Cellules souches pluripotentes induites
KO Invalidation génique
MMR Réparation des mésappariements
NER Réparation par excision de nucléotides
NHEJ Jonction d'extrémités non homologues
PAM Protospacer Adjacent Motif
PPP1R12C Phosphatase 1 Regulatory Subunit 12C
ProtA Protéine A
pTRE Promoteur Tetracycline-Response Element
pTRE-BI pTRE-bidirectionel
RPA Protéine de réplication A
xvi
rTetR Représseur Tet inversé
rtTA Transactivateur contrôlé. par la tétracycline inversé
SDSA Synthesis Dependent Strand Annealing
sgRNA Single guide RNA
SpCas9 Streptococcus pyogenes Cas9
SSA Single-Strand Annealing
TALEN Nucléases effectrices de type activateur de transcription
TALEs L'effecteur transcriptionel activator-like
TAP Purification d'affinité en Tandem
tetO Opéron Tétracycline
tet-Off Tétracycline - Off
tet-On Tétracycline - On
tetR Répresseur de la tétracycline
TEV Tobacco Etch Virus
tracrRNA Trans-activating crRNA
tTA Transactivateur contrôlé par la tétracycline
ZFN Nucléase à doigt de zinc
xvii
REMERCIEMENTS
Ce mémoire est le résultat d’un travail de recherche de près de deux ans. Je veux
adresser tous mes remerciements aux personnes qui m’ont permis de l’accomplir et qui
m’ont aidé pour la rédaction de ce mémoire.
Je souhaite tout d’abord remercier mon directeur de recherche Dr Yannick Doyon,
qui m’a accompagné tout au long de ma maitrise. Merci d’avoir pris un risque en
m’acceptant comme ton premier étudiant, d’avoir pris le temps nécessaire pour me montrer
des techniques de laboratoire ainsi que de m’avoir permis de développer une rigueur
scientifique dans mon travail.
Je tiens à remercier les gens avec qui j’ai eu la chance de travailler pendant mes
études graduées. En premier lieu, je veux remercier les gens de l’équipe Doyon. Je souhaite
particulièrement remercier Caroline pour avoir répondu à mes questions et avoir établi une
atmosphère de travail très agréable, Sophie pour ton aide qui a été indispensable dans la
rédaction de ce mémoire, et Alexandre pour ta facilité avec les mots.
Je souhaite remercier les membres des nombreuses équipes de recherche de l’étage
d’avoir permis aux membres de l’équipe Doyon (moi) d’emprunter des ressources de
laboratoire lorsque nous étions dans le stade embryonnaire du laboratoire. Et surtout
d’avoir pris le temps pour répondre à mes questions, merci à Christine, Francis, Nicolas,
Olivier, Philippe, et Suzanne.
Je souhaite remercier Jacques Côté pour m’avoir accueilli dans son laboratoire de
recherche et de m’avoir permis d’entamer les premières expériences de ma maitrise. Merci
à Valérie et à Céline pour vos conseils et votre support technique professionnel.
Je tiens à remercier tous les gens faisant partie de mon quotidien. Entre autres,
Ginette, Annie et Bertrand pour tous les soupers du dimanche et surtout pour les lunchs du
lendemain. Guillaume, Mihnea et Roccio lorsque nous réussissons à trouver du temps, nos
soirées ensemble furent toujours très appréciées.
xviii
Un grand merci à ma famille. Merci à mes parents pour essayer de comprendre ce
que je fais, et toujours être de mon côté. Merci à mon frère, tu es mon grand frère préféré.
J’adresse mes plus sincères remerciements ma conjointe Katrine. Sans toi je serais perdu, je
t’aime.
xix
AVANT PROPOS
Le présent ouvrage est déposé à la Faculté des Études Supérieures de l’Université
Laval pour l’obtention du diplôme de Master ès Sciences (MSc.). Ce mémoire porte sur le
développement d’une technique simple et rapide permettant la purification de complexes
protéiques dans leur contexte génomique natif. L’étude décrite dans cet ouvrage s’attarde
spécifiquement au développement d’une méthode à l’interface entre l’édition génique et la
protéomique permettant la purification de complexes protéiques. Ce mémoire contient une
introduction générale rédigée en français portant sur la réparation de l’ADN et l’édition
génique. Le chapitre 1 constitue le corps de l’ouvrage et relate en détail les travaux de
recherche réalisés pour ce mémoire. Ce chapitre est rédigé en anglais sous forme d’un
article scientifique tel que présenté en vue de sa publication, selon les exigences éditoriales.
Finalement, une conclusion termine ce mémoire en résumant les principaux résultats
obtenus, en analysant leurs liens respectifs et en discutant des voies futures à explorer.
L’article présenté dans ce mémoire est le fruit de mes travaux de maitrise qui ont été
réalisés au cours des deux dernières années dans le laboratoire du Dr Yannick Doyon.
L’étude présentée implique mon entière participation dans les techniques de clonage, de
transfection, de culture cellulaire, d’immuno-buvardage. Ce travail exécuté sous la
supervision du Dr Yannick Doyon a été réalisé grâce à la collaboration de Mathieu Dalvai
(étudiant postdoctoral de Dr Jacques Côté, Université Laval), Karine Jacquet (Doctorante
de Jacques Côté, Université Laval), Dr Caroline Huard (professionnelle de recherche du Dr
Yannick Doyon, Université Laval), de Céline Roques (professionnelle de recherche du Dr
Jacques Côté, Université Laval), de Dr Pauline Herst (étudiante postdoctorale de Dr
Jacques Côté, Université Laval) et du Dr Jacques Côté.
Dalvai M*, Loehr J*, Jacquet K, Huard CC, Roques C, Herst P, Côté J, and
Doyon Y, A Scalable Genome-Editing-Based Approach for Mapping
Multiprotein Complexes in Human Cells. Cell Reports 13, 621–633, October 20,
2015 *Equal contribution
INTRODUCTION
3
1.0 Identification des complexes protéiques cellulaires
Les machineries protéiques de la cellule sont responsables de la coordination et de
l’exécution des fonctions cellulaires [1, 2]. Il est donc impératif d’identifier et de
caractériser les composantes de ces complexes de façon à mieux comprendre les voies
perturbées lorsque l’organisme est malade.
1.1 Techniques utilisées pour la purification des complexes protéiques
La purification des protéines suivie d’analyses par spectrométrie de masse demeure
la méthode la plus couramment utilisée pour l’identification des complexes protéiques [3,
4]. Il est important d’avoir une quantité suffisante de la protéine à l’étude pour la réalisation
de cette technique [4]. L’étape limitante de cette caractérisation demeure donc la
purification du complexe et non l’identification des protéines [4]. Lors de l’étude de
protéines faiblement exprimées, cette limite peut être contournée par une surexpression de
la protéine cible [5]. Toutefois, cette approche couramment utilisée peut mener à la
formation d’interactions non spécifique et mener à des conclusions erronées [5].
1.1.1 Purification d’affinité en tandem
La méthode de purification des complexes protéiques utilisée chez la levure est la
purification d’affinité en tandem (TAP), décrite par Puig et al. en 2001 [6]. Cette technique
répond à la problématique précédemment décrite, car elle est optimisée de façon à obtenir
des complexes protéiques dans des conditions natives [6]. La méthode de TAP consiste en
la fusion de l’étiquette-TAP à la protéine cible par recombinaison homologue (HR).
L’étiquette-TAP est composée de trois modules : i) deux domaines de reconnaissance des
IgG de la protéine A (ProtA) provenant de Staphylococcus aureus, ii) un peptide qui se lie à
la calmoduline (CBP, Calmoduline binding protein) séparé par iii) un site de clivage de la
protéase du Tobacco Etch Virus (TEV) [6]. Cette construction, CBP-TEV-ProtA, est
conçue pour l’étiquetage en C-terminal d’une protéine cible (Figure 1A) [6]. Dans une
faible proportion des cas, environ 5%, l’ajout d’une étiquette en C-terminal peut nuire à la
4
fonction native de la protéine, produire des déficiences dans la croissance ou induire la
mort cellulaire [6]. Pour pallier à cette problématique, le même groupe de recherche a
développé une stratégie visant à placer l’étiquette-TAP en N-terminal de la protéine en
inversant l’ordre des modules, ProtA-TEV-CBP-EK (Figure 1A) [6]. Un site de clivage
(DDDDK) de l’entérokinase (EK) a aussi été ajouté, permettant ainsi de retirer
complètement les résidus de l’étiquette suite à la purification [6].
Figure 1 : Un survol de la stratégie de purification TAP
A) Représentation schématique des étiquettes TAP en C- et N-terminal. B) Survol de la stratégie de
purification TAP. [6]
À partir des extraits cellulaires préparés, les protéines fusionnées ainsi que les
protéines du même complexe sont purifiées [7]. L’extrait cellulaire est incubé dans une
première colonne de bille Sepharose IgG où le module ProtA de l’étiquette-TAP se lie
5
fortement à la matrice [6]. La protéase TEV est ensuite utilisée pour couper la protéine
chimère au site de clivage TEV permettant à la protéine cible de se dissocier de la matrice
IgG [6]. L’éluat, contenant la protéine cible fusionnée avec le module CBP, est incubé dans
une deuxième colonne contenant des microbilles liées à la calmoduline. Suite aux étapes de
lavage visant à enlever les protéases TEV et les contaminants, le complexe protéique est
relâché via l’ajout d’EGTA (Acide Tétraacétique d’éthylène glycol) [6]. Lors de
l’utilisation de la stratégie d’étiquetage-TAP en N-terminal, un traitement additionnel à
l’entérokinase peut être réalisé de façon à retirer complètement le résidu de l’étiquette
(Figure 1B) [6].
Suite à la purification, les complexes protéiques sont séparés sur un gel de SDS-
polyacrylamide, puis colorés à l’argent. Les bandes sont par la suite analysées par
spectrométrie de masse, permettant ainsi l’identification des protéines formant le complexe
purifié. Comme la purification TAP est faite sous conditions douces, des essais d’activité in
vitro peuvent être réalisés avec les complexes purifiés [6-8]. Cette technique est conçue
pour permettre la purification rapide de complexes à partir d’une quantité relativement
faible de cellules. De plus, aucune notion antérieure de la composition, l’activité, ou même
la fonction de la protéine cible et de son complexe n’est nécessaire pour l’utilisation de
cette technique [7].
Limites 1.1.1.1
Bien que la purification par étiquette-TAP soit largement utilisée, il existe
néanmoins certaines limites à son usage. La localisation de l’étiquette dans la structure 3D
de la protéine peut diminuer son exposition et ainsi réduire sa liaison aux billes d’affinité.
La présence de l’étiquette peut aussi affecter la fonction et les niveaux d’expression de la
protéine cible [6]. Changer la position de l’étiquette-TAP de C- à N-terminal peut remédier
à ces problématiques [6].
6
L’utilisation de la purification TAP a permis la purification de plus de 589
complexes protéiques, permettant ainsi l’étude systématique du protéome de la levure [9].
Malgré les succès obtenus dans la levure, cette technique se transpose difficilement dans les
eucaryotes supérieurs, car la HR est moins efficace dans ces organismes [9]. L’expression
dans la levure de gènes humains fusionnés à l’étiquette-TAP a permis l’étude fonctionnelle
de nombreuses protéines [9]. Toutefois, les conclusions tirées de ces études demeurent des
inférences, puisque ces dernières n’ont pas été réalisées en conditions natives chez
l’humain [10-18]. Malheureusement, cette technique est difficilement applicable dans les
cellules humaines [9]. La présence de l’étiquette-TAP peut mener à de l’interférence dans
la formation de la structure tridimensionnelle de la protéine et lors des interactions avec
d’autres protéines [19]. Aussi, certaines protéines de mammifère peuvent interagir avec la
calmoduline créant beaucoup de bruit de fond annulant ainsi la fonction principale de
l’étiquette-TAP [20, 21]. Des modifications visant à diminuer les perturbations dans la
stœchiométrie des interactions protéiques et à prévenir la localisation aberrante,
l’agrégation, l’effet dominant-négatif, ainsi que la toxicité devraient être apportées de façon
à permettre une meilleure caractérisation des complexes multiprotéiques [22, 23].
1.1.2 Purification par étiquette d’affinité
L’étiquette d’affinité est une séquence polypeptidique fusionnée à une protéine
d’intérêt de façon à en faciliter la purification et la détection. Les étiquettes d’affinités
peuvent être composées de protéines entières, de domaines protéiques ou de petites
séquences peptidiques. Les étiquettes de ce groupe partagent toutes certaines
caractéristiques : i) une procédure de purification simple; ii) un effet minimal sur la
structure tertiaire et l’activité biologique et iii) une application simple [24]. Tel que décrit
précédemment, l’utilisation de larges étiquettes constituées de domaines protéiques peut
impacter de façon négative la solubilité et la fonction de certaines protéines; il est donc
important de les retirer lors d’études fonctionnelles [24]. Une approche plus simple a été
développée et consiste en l’utilisation de très petites séquences peptidiques [25]. Il n’est
toutefois pas nécessaire de retirer ces étiquettes, car considérant leur petite taille, ces
dernières n’affectent généralement pas la fonction ou les interactions de la protéine à
7
l’étude [25]. Les étiquettes d’affinités les plus communément utilisées sont : poly-Arg-,
FLAG, poly-His-, c-myc-, S-, et Strep II-tag [25]. De façon à optimiser l’étude d’une
protéine d’intérêt, les caractéristiques de l’étiquette d’affinité utilisée doivent être prises en
compte (Tableau 1) [25]. À titre d’exemple, les étiquettes d’affinité FLAG et Strep seront
décrites plus en détail.
Tableau 1: Caractéristiques des étiquettes d’affinités communément utilisées
Tableau tiré de Terpe et al. 2003 [25]
L’étiquette FLAG 1.1.2.1
L’étiquette d’affinité FLAG est une petite séquence peptidique de 8 acides aminés
(DYKDDDDK) [26]. L’anticorps anti-FLAG monoclonal M2 se lie à la partie N-terminale
du peptide FLAGTM
permettant ainsi l’immunoprécipitation des protéines liées à l’étiquette
FLAG et de leurs complexes [27]. Cette étiquette peut être placée en C- ou en N-terminal
de la protéine cible [27]. Ce système est efficace dans plusieurs types cellulaires différents,
tels que les bactéries, la levure, et les cellules de mammifères [26, 28-32]. Les conditions
de purification du système sont généralement non dénaturantes ce qui permet de purifier
une protéine de fusion active [27]. Une version améliorée du système FLAG est le système
3xFLAG, constitué de trois épitopes FLAG regroupés ensemble (Figure 2). Il s’agit d’une
étiquette de 22 acides aminés (N-MDYKDHD-G-DYKDHD-I-DYKDDDDK-C), hydrophile
qui contient un site de clivage entérokinase [27]. La purification basée sur le système
8
3xFLAG est en mesure de détecter des quantités aussi petites que 10 fmol d’une protéine
cible tandis que le système FLAG est capable d’en détecter 100 fmol [25].
Figure 2 : Séquences d'acide aminé de l'étiquette FLAG et 3xFLAG
Figure tirée de Sigma-Aldrich [33]
L’étiquette Strep 1.1.2.2
Développé, en 1993, comme outil d’affinité pour la purification, le Strep-tag est une
petite séquence peptidique de 8 acides aminés (WSHPQFEK) qui se lie fortement dans la
pochette de liaison à la biotine de la streptavidine [34]. La Strep-Tactine est une variation
de la streptavidine qui est mutée aux positions 44, 45, et 47 [35]. Le Strep-tag a une affinité
près de 100 fois plus forte pour la Strep-tactine que pour la streptavidine [35-37]. L’élution
de la protéine fusionnée Strep-tag est faite sous condition douce avec une concentration
faible en d-desthiobiotin, résultant en un produit purifié se rapprochant de l’état natif [36].
Ceci permet donc l’étude des fonctions des complexes protéiques suite à leur purification
[36]. Une version améliorée du Strep-tag II est le Twin-Strep-tag (WSHPQFEK-
GGGSGGGSGG-SAWSHPQFEK) [38]. Cette version permet une plus grande affinité
pour la Strep-Tactine (Figure 3) [38]. Le Twin-Strep-tag consiste en deux Strep-tag II en
tandem avec une région de liaison [38].
9
Figure 3 : Représentation schématique du principe de purification d’un strep-tag et d’un twin-strep-tag
Figure tirée de Schmidt et al. 2007 [38].
1.2 Les systèmes inductibles avec la tétracycline
Malgré l’éventail de techniques disponibles, il est dans certains cas impossible
d’utiliser une des méthodes précédemment décrites pour étudier la fonction d’une protéine
cible. Par exemple, il est impossible de surexprimer de façon constitutive une protéine
cytotoxique pour en étudier les fonctions. Une approche alternative vise à induire de façon
temporelle l’expression du gène d’intérêt. Dans un premier temps, le système inductible
LacR/O provenant de E.coli a été utilisé dans les cellules de mammifères, toutefois l’agent
inductible β-D-thiogalactopyranoside réagissait trop lentement pour une induction adéquate
[39]. Pour répondre à cette problématique, deux systèmes inductibles, provenant de E. coli.,
ont été développés [40, 41]. Les systèmes tétracycline-Off (tet-Off) et tétracycline-On (tet-
On) sont fonctionnels dans les cellules humaines HeLa et démontrent une induction rapide
de l’expression du gène d’intérêt [40, 41]. Il existe cependant deux éléments clés
nécessaires à une induction efficace dans les cellules de mammifères: i) un plasmide
exprimant une protéine régulatrice, le transactivateur, et ii) un plasmide comprenant le
promoteur inductible.
1.2.1 Le système Tétracycline-Off
Dans le système tet-Off, le transactivateur contrôlé par la tétracycline (tTA) est
exprimé constitutivement et se lie au promoteur Tetracycline-Responce Element (pTRE)
10
activant ainsi le gène d’intérêt (Figure 4) [40]. Le pTRE est composé de 7 répétitions de
19pb de la séquence de l’opéron tétracycline (tetO) suivi d’un promoteur minimal CMV et
est reconnu par le répresseur de la tétracycline (tetR) [42]. Le tTA a été créé en fusionnant
tetR avec le domaine activateur de la protéine virale 16 (VP16). Lorsque la tétracycline est
présente, le tTA se lie préférentiellement à la tétracycline et non au pTRE, donc, inactive le
système [40, 41]. L’absence de tétracycline permet la liaison du tTA au pTRE, ce qui induit
l’expression du gène d’intérêt.
1.2.2 Le système Tétracycline-On
Le système Tet-On a été développé à l’inverse du système tet-OFF (Figure 4) [40].
Il s’agit donc d’un système inactif en conditions natives dans lequel l’expression du gène
d’intérêt est induite par l’ajout de tétracycline [41]. Par mutagenèse aléatoire, Gossen et al.
sont parvenus à identifier les acides aminés présents dans tetR responsables de la répression
par la tétracycline [41]. Cette découverte a permis le développement d’un répresseur tet
inversé (rTetR, reverse Tet repressor). Le transactivateur inversé de tTA (rtTA) a été créé
en fusionnant rTetR avec le domaine C-terminal de VP16, permettant ainsi d’activer le
système par l’ajout de la tétracycline au milieu.
11
Figure 4 : Tétracycline-Off et Tétracycline-On
Figure tirée de Gossen et al. 1992 [40].
1.2.3 L’amélioration des systèmes
Au cours des années, plusieurs versions améliorées des systèmes ont été conçues, tel
le système Tet-On 3G Bidirectionnel [42, 43]. Dans le Tet-On 3G, la doxycycline, un
dérivé synthétique de la tétracycline, remplace la tétracycline (Figure 5). La concentration
de doxycycline nécessaire pour induire le système est inférieure à celle de tétracycline.
Cette concentration inférieure diminue les effets cytotoxiques, ce qui est un net avantage
pour les études in vivo [44]. La doxycycline possède une demi-vie de 24 heures, donc pour
maintenir l’induction, il est nécessaire d’ajouter de la doxycycline fréquemment au milieu
de culture. Il est aussi important de noter que le nouveau système Tet-On 3G n’est
inductible que par la doxycycline et non la tétracycline comme l’était son prédécesseur
[41]. Le pTRE-bidirectionel (pTRE-BI) permet l’induction des gènes en 5’ et en 3’ [42].
Cette caractéristique permet l’expression inductible en simultané en amont et en aval des
deux transgènes d’intérêt. Comme le contrôle de l’expression du gène en 5’ est considéré
comme «fuyant», le gène placé en amont est souvent un marqueur visuel, tel mCherry ou
12
ZsGreen1, permettant la sélection des cellules ayant intégré le système. Le pTRE-BI ne
contient aucun site pour la liaison de facteurs de transcription endogènes chez les
mammifères, rendant ainsi impossible l’étude en condition d’expression native.
Figure 5 : Le système Tet-On 3G permet l’induction de l’expression d’un gène en présence de la
doxycycline.
Figure tirée de clontech [45]
1.2.4 Limites
Les techniques décrites précédemment comportent certaines limitations. Tel que
conçus, ces systèmes artificiels nécessitent une transfection simultanée de deux plasmides
et fonctionnent par intégration aléatoire dans le génome. La localisation aberrante du
transgène par l’intégration aléatoire peut mener à des effets indésirables dans la cellule [22]
Ces effets peuvent mener à des conclusions erronées en modifiant le contrôle
transcriptionnel réel, en invalidant ou surexprimant des gènes endogènes via la
modification de certaines régions régulatrices ou en ayant d’autres effets négatifs via
l’agrégation de faux complexes ou la création d’un effet dominant-négatif [22, 23].
1.3 Limites des techniques présentement utilisées.
La purification en tandem suivi de la spectrométrie de masse demeure une technique
utile pour l’étude des complexes protéiques, mais cette technique se transpose difficilement
dans les cellules humaines [6, 9]. Notamment, l’étiquette-TAP peut mener à l’interférence
dans la formation de la structure de la protéine ainsi que des interactions protéiques non
retrouvées à l’état naturel dans les cellules de mammifères [19-21]. Les études
13
fonctionnelles des protéines humaines ont été obtenues par l’expression de gènes humains
fusionnés à l’étiquette-TAP dans la levure [9]. Toutefois, les conclusions tirées de ces
études sont inférées, puisque les études n’ont pas été réalisées en conditions natives chez
l’humain [10-18].
Les étiquettes d’affinités sont de puissants outils permettant la purification de
protéines cibles. Par contre, l’utilisation de larges étiquettes constituées de domaines
protéiques peut impacter de façon négative la solubilité et la fonction de certaines protéines
[24]. L’utilisation d’étiquettes formées de très petites séquences peptidiques ne nécessite
pas de retirer ces étiquettes et n’affecte généralement pas la fonction ou les interactions de
la protéine à l’étude [25]. Par contre, les caractéristiques de l’étiquette d’affinité utilisée
doivent être prises en compte [25].
Les systèmes tétracycline permettent un contrôle sur l’expression de la protéine
cible. Toutefois, l’intégration aléatoire des deux vecteurs demeure une limite importante,
causant beaucoup de problématique potentielle dans la cellule et pouvant erroner les
conclusions ressorties [22, 23].
Des modifications visant à diminuer les perturbations dans la stœchiométrie des
interactions protéiques et à prévenir la localisation aberrante, l’agrégation, l’effet dominant-
négatif, ainsi que la toxicité devraient être apportées de façon à permettre une meilleure
caractérisation des complexes multiprotéiques [22, 23].
2.0 Concept de genomic safe harbour
Un genomic safe harbor (GSH) est une région du génome où il est possible
d’intégrer du matériel génétique sans perturber la fonction, la transcription et la régulation
des séquences codantes natives, ainsi que la structure génique [46]. Un GSH permet
l’expression suffisante d’un transgène sans prédisposer la cellule à une transformation
maligne ou en altérer la fonction [46, 47]. Aussi, l’expression du transgène par le GSH doit
être possible chez différents types cellulaires [46].
14
2.1 Insertion au locus AAVS1
Le locus Adeno-Associated Virus Integration Site 1 (AAVS1) aussi sous le nom de
Phosphatase 1 Regulatory Subunit 12C (PPP1R12C) est un gène qui encode une protéine
dont la fonction n’est pas encore connue. Chez l’humain, ce dernier se situe dans le
chromosome 19 à la position 19q13.42 et est le site d’intégration préférentiel du virus
associé à l’adénovirus (AAV) [48-50]. Comme l’infection par le AAV n’est associée à
aucune pathologie connue et que son intégration dans le locus AAVS1 ne pose aucun effet
néfaste, l’intégration au site AAVS1 est considérée inoffensive [51, 52]. Les cellules
souches embryonnaires (ESCs) et les cellules souches pluripotentes induites (iPSCs)
conservent leur pluripotence suite à l’intégration d’un transgène à AAVS1 [52-56]. De plus,
l’expression du transgène est maintenue suite à leur différenciation [52-56]. L’intégration à
AAVS1 a été démontrée comme étant bénigne dans les cellules T humaines en culture [57].
Le gène intégré est transcrit dans les lignées cellulaires communément utilisées : K562,
HeLa, HEK293, DU-145, et Hep3B, ce qui facilite son utilisation [47]. Le locus AAVS1
répond aux deux critères pour être considéré un GSH : i) l’intégration au site ne résulte pas
en effets néfastes et ii) la transcription du transgène est compétente dans plusieurs types
cellulaires [47].
3.0 L’édition du génome grâce aux nucléases d’ingénierie
L’édition du génome est une méthode qui permet l’introduction de modifications
désirées à un endroit précis du génome. Ces modifications peuvent prendre la forme
d’invalidation génique (KO, Knock-out), d’introduction de séquence exogène, ou
d’altération d’un ou plusieurs nucléotides. Cette technique nous permet de repousser les
limites des études fonctionnelles en protéomique en facilitant la modification génique.
L’édition du génome se fonde sur la création de cassures double brin (DSB) à un site
spécifique dans l’ADN à l’aide d’endonucléases, telles que les nucléases à doigt de zinc
(ZFN), les nucléases effectrices de type activateur de transcription (TALEN) et CRISPR
(Courtes répétitions palindromiques groupées et régulièrement espacées)/Cas (CRISPR-
15
associé). Ces systèmes, développés en 2005, 2011 et 2013 respectivement, possèdent une
facilité d’utilisation ouvrant la porte à la compréhension de certains phénomènes
biologiques jusqu'à présent impossible à caractériser.
3.1 Les endonucléases
3.1.1 Les nucléases à doigt de zinc
Origines 3.1.1.1
Les ZFN sont des endonucléases chimériques composées d’un domaine de liaison à
l’ADN (DBD) fusionné à un domaine de clivage [58]. Le DBD est composé de modules à
doigts de zinc Cys2His2 en tandem, modifiés pour reconnaître environ 3 nucléotides
spécifiques. Chacun de ces modules dérive de facteur de transcription eucaryote [59-61]. Le
domaine de clivage utilisé dans la ZFN est le domaine de clivage non spécifique de
l’endonucléase FokI [58].
Reconnaissance et clivage d’une séquence spécifique d’ADN 3.1.1.2
Typiquement, 3 à 6 modules sont utilisés de façon à créer le DBD d’une ZFN.
Chacun des modules est formé d’environ 30 acides aminés d’une configuration typique de
ββα [62]. Certains acides aminés situés sur la surface de l’hélice-α interagissent avec
environ 3 paires de bases se trouvant dans le grand sillon de l’ADN [62]. L’assemblage de
plusieurs doigts de zinc permet donc la reconnaissance d’une séquence spécifique d’ADN
[62].
La fonction endonucléase de la ZFN est assurée par la fusion du domaine de clivage
non spécifique de l’enzyme de restriction Fok1 aux modules de protéines à doigt de zinc.
Cette dernière doit dimériser pour être active [63]. Une paire de ZFN dans une orientation
adéquate et espacée de 4-7 pb est nécessaire pour créer une DSB à un endroit précis dans le
génome (Figure 6) [63]. L’obligation des ZFN à travailler en paire augmente la longueur de
16
la séquence de reconnaissance à l’ADN de 18 à 36 pb, accentuant considérablement le
potentiel d’obtenir un site de reconnaissance unique et limitant ainsi les sites de clivages
potentiels hors cible [64, 65].
Figure 6 : Schéma du mécanisme d’action et de la structure d’une nucléase à doigt de zinc
Figure tirée de Urnov et al. 2010 [64]
a) Schéma d’une ZFN dimérisée et liée à sa cible. Chaque ZFN contient le domaine de clivage FokI
lié à 3 à 6 modules à doigt de zinc. Ces derniers sont conçus pour reconnaître une séquence spécifique (boîtes
bleues et rouges) sur chacun des brins de l’ADN. Un petit nombre de bases (typiquement 5 à 6) sépare les
séquences cibles de la ZFN (Miller et al 2007 ref 58). b) L’assemblage des modules d’une ZFN. Pour générer
une protéine à doigt de zinc avec une spécificité à la séquence GGGGGTGAC, trois modules liant
spécifiquement un triplet de bases sont identifiés, puis liés. [63]
Utilité pour la modification du génome 3.1.1.3
Les ZFN furent les premières nucléases d’ingénierie à être développées et ont servi
à faire des études pionnières dans les plantes, les poissons et les mammifères [64, 66-68].
La ZFN est actuellement la seule nucléase à être utilisée lors d’études cliniques chez
l’humain. Sangamo Biosciences utilise une ZFN à la base de leurs stratégies de correction
17
génique pour différentes maladies (clinicaltrials.gov). Notamment, ils ont un projet en
Phase 2 visant à modifier le gène CCR5, un corécepteur utilisé par le VIH pour infecter les
cellules T. Ils ont aussi actuellement deux projets en Phase 1, l’un ciblant les cellules
souches et progéniteurs hématopoïétique (HSPC) des patients VIH, et l’autre ciblant les
HSPC dans les patients souffrant d’anémie à cellules falciformes.
Limites 3.1.1.4
L’utilisation des ZFN comporte toutefois certaines limites. Il faut synthétiser les
protéines spécifiques pour chaque site de coupure, ce processus peut être ardu à exécuter et
nécessite beaucoup de temps et d’argent. Seul un certain nombre de combinaisons de
reconnaissance de nucléotide sont possibles [69]. En effet, les modules protéiques adjacents
peuvent exercer une influence les uns sur les autres, ce qui complique la synthèse de ZFN
[69]. Pour fonctionner, les ZFN doivent être utilisés en paires ce qui permet de réduire les
DSB hors cible, mais ces derniers ne sont pas complètement éliminés [69].
3.1.2 Les nucléase effectrices de type activateur de transcription
Origines 3.1.2.1
Les TALENs ont été développées comme une alternative aux ZFN, car elles sont
plus simples à générer. Tout comme les ZFN, ces dernières utilisent un code protéine-ADN
simple d’utilisation et sont composées d’un DBD et d’un domaine de clivage (Figure 7)
[70]. Le DBD est composé de séquences répétées provenant des nucléases effectrices de
type activateur de transcription (TALEs), une protéine sécrétée par la bactérie
Xanthomonas qui altère la transcription de gène dans la plante hôte, favorisant ainsi son
infection [71]. Les TALENs clivent l’ADN grâce à leur fusion au domaine endonucléase de
l’enzyme de restriction Fok1.
18
Figure 7 : Représentation schématique de la structure et de la fonction des TALENs
a) Structure d’un TALEN. b) Assemblage de deux TALENs pour créer une DSB. Le clivage par le
domaine FokI s’effectue dans la séquence qui se situe entre les deux régions de l’ADN lié par les deux
monomères TALEN. c) Chacune des protéines TALE reconnaît une paire de bases spécifiques grâce à deux
résidus. d) Liaison d’un TALEN à l’ADN. Chaque domaine répété se lie à une paire de bases, notons la
présence d’une thymine en 5’ de la première base liée par une répétition TALE. [70]
Reconnaissance et clivage d’une séquence spécifique d’ADN 3.1.2.2
Le domaine de répétition TALEs est composé de plusieurs séquences répétitives qui
se lient spécifiquement à une seule base d’ADN. Les séquences répétitives sont composées
de 33-35 acides aminés. Parmi ceux-ci, les résidus retrouvés aux positions 12-13 confèrent
l’interaction spécifique avec une base de l’ADN [72]. Les résidus principalement utilisés à
ces positions sont NN, NI, HD et NG, pour reconnaître les bases G, A, C et T,
respectivement [70]. La co-crystalisation, des domaines de répétition TALEs liés à la
séquence d’ADN cible, a démontré que les séquences répétitives individuelles sont
constituées de deux hélices-α en forme de V qui se chevauchent. Les résidus aux positions
8 et 12 interagissent ensemble de façon à stabiliser la structure [2, 73]. Ces dernières
19
forment une super-hélice autour de l’ADN plaçant ainsi les résidus en position 12 et 13
dans le grand sillon de l’ADN [2, 73].
Utilisation pour la modification du génome 3.1.2.3
Plusieurs études ont démontré que l’efficacité des TALEN à créer des DSB est
similaire à celle des ZFN [74-77]. Les répétitions TALE peuvent être assemblées
facilement. Notamment, une libraire de TALENs ciblant 18740 gène humains codant des
protéines a été développée [78]. Une étude préclinique a utilisé des TALEN ciblant le gène
CCR5 pour y induire des petites insertions ou délétions (Indels) et, en conséquence, induire
une protection contre l’infection du VIH-1 in vitro [79].
Limites 3.1.2.4
Le site de liaison à l’ADN reconnu par les TALENs doit débuter par une thymine
(T) ce qui limite l’éventail des séquences pouvant être ciblées [78]. La livraison des
composantes du système TALEN pose aussi un problème puisque leur grande taille rend
impossible leur empaquetage dans un virus adéno-associé, le vecteur de choix pour la
thérapie génique. [80].
3.1.3 Le système CRISPR/Cas9
Origines 3.1.3.1
Le système CRISPR/Cas est le système d’édition génique le plus récent et démontre
une grande facilité d’utilisation [81]. Les séquences répétées, maintenant nommées
CRISPR, ont été initialement identifiées en observant cinq répétitions de 29 paires de bases
espacées par 32 paires de bases à proximité du gène iap chez la bactérie Escherichia coli
[82]. En 2007, Barrangou, Horval et Moineau, ont lié les CRISPR à une réponse
immunitaire dans les procaryotes lorsqu’ils ont démontré l’acquisition d’une résistance aux
20
attaques de phages en introduisant les séquences de CRISPR chez Streptococcus
thermophilus [82]. L’immunité est possible, car un ARN produit par la séquence CRISPR
guide la nucléase du système CRISPR/Cas aux séquences spécifiques du phage invasif,
permettant son clivage et sa désintégration [83]. Le système CRISPR/Cas et ses variantes
ont été retrouvés dans nombreuses espèces de bactérie et archaea [83]. Les systèmes
CRISPR/Cas ont été classifiés en trois groupes : type I, type II et type III, ainsi que dans
des sous-types respectifs [84]. En 2012, le système CRISPR/Cas9 appartenant au type II a
été démontré comme étant un puissant outil d’ingénierie génétique, ce système est capable
de produire une DSB ciblée [83]. Ce système a été utilisé avec succès dans plusieurs
organismes différents [85-89].
Reconnaissance et clivage d’une séquence spécifique d’ADN 3.1.3.2
Le système CRISPR/Cas9 à son état naturel consiste en trois éléments : crRNA
(CRISPR RNA), tracrRNA (trans-activating crRNA) et Cas. L’hybridation du crRNA avec
le tracrRNA permet leur association avec la nucléase Cas9 [90-93]. Une fusion chimérique
de l’ARN tracrRNA :crRNA, nommée sgRNA (single guide RNA) ou gRNA (guide RNA),
est plus fréquemment utilisée pour l’édition de génome (Figure 8) [83]. La séquence de 20
nucléotides guide faisant partie du crRNA, permet de diriger avec précision la nucléase à la
séquence homologue cible dans le génome [83, 90, 93]. Cette séquence cible doit être
située directement en amont d’une séquence génomique appelée Protospacer Adjacent
Motif (PAM) [83, 90, 93]. Cas9 subit un changement de conformation plaçant les deux
domaines endonucléiques, RuvC et HNH sur les brins opposés de l’ADN ciblé et le clive à
environ 3 à 4 nucléotides en amont du PAM [83, 90, 93].
21
Figure 8 : Schéma de la nucléase Cas9 guidée par l’ARN
La nucléase Cas9 de S. pyogenes (jaune) est ciblée pour l’ADN génomique (en exemple dans le
locus EMX1 humain) par un ARN-guide consistant en une séquence guide de 20 nucléotides (bleu) et un
échafaud (rouge). La séquence guide se lie avec l’ADN cible (ligne bleue), directement en aval du 5’-NGG
PAM (rose). Cas9 crée une DSB à ̴ 3 pb en amont du PAM (triangle rouge). Tirée de Jinek et al.[83].
Protospacer Adjacent Motif 3.1.3.3
Le PAM est une petite séquence dans l’ADN génomique obligatoire pour la
reconnaissance d’une séquence génique par le sgRNA [94]. Toutefois, cette nécessité ne
limite pas significativement les possibilités de séquence guide considérant sa petite taille
[94]. Par exemple, la séquence PAM de SpCas9 (Streptococcus pyogenes Cas9) est 5’-
NGG-3’, une séquence qui est présente à environ chaque 8 à 12 pb dans le génome humain
[94, 95]. Certaines nucléases provenant d’espèces différentes peuvent avoir un PAM
différent, ce qui permet plus de flexibilité pour la sélection d’un site de coupure dans le
génome (Tableau 2) [96]. Le PAM et les 8 à 12 premières bases du guide sont les plus
importants pour la reconnaissance du site [83]. Cette séquence appelée ‘seed’ est
primordiale à la liaison du guide ARN [83]. Cas9 reconnait tout d’abord un PAM dans le
génome. Elle ouvre la double hélice d’ADN et teste l’appariement systématique de chaque
base du sgRNA allant du 3’ jusqu’au 5’ [83]. Un mésappariement dans la région ‘seed’ va
induire un relâchement du système tandis qu’un mésappariement après le ‘seed’ peut être
toléré [83].
22
Tableau 2: Motif de liaison du PAM dans des orthologues de Cas9
Des orthologues de Cas9 avec les séquences de PAM connu. Le PAM du Cas9 de Lactobacillus
buchneri a été inféré à partir de d’autres séquences connues, mais n’a pas été validé expérimentalement. [96]
Utilisation pour la modification du génome 3.1.3.4
CRISPR/Cas9 est actuellement l’outil le plus puissant pour l’édition du génome, sa
facilité de synthèse et le faible coût y étant associé jouent un grand rôle dans sa popularité.
Plusieurs domaines de recherche ont été facilités grâce au CRISPR, dont la génération
d’animaux transgéniques. Le groupe de recherche de Rudolf Jaenisch a démontré qu’il est
possible de créer plusieurs mutations chez la souris en une seule génération [97]. Les
premières études cliniques chez l’humain viennent d’être approuvées en juin aux États-
Unis. CRISPR/Cas9 sera utilisé pour la thérapie génique ex vivo dans des cellules T de
patients souffrant de cancer [98].
Limites 3.1.3.5
Le PAM est la limite majeure pour la construction des gRNAs, car elle est
invariable. Toutefois, de plus en plus d’orthologues de Cas9 qui sont découvertes possèdent
des PAM différents de celui de SpCas9, ce qui permet d’augmenter les possibilités de cibler
une séquence précise [92, 99-102]. D’autres types de nucléases peuvent aussi avoir des
PAM différents. Cpf1, une endonucléase de Class 2 du système CRISPR-Cas, possède un
PAM riche en thymine : 5’-TTN-3’ [103].
23
Une autre limite identifiée est la tolérance du système CRISPR/Cas aux
mésappariements [47, 83, 95]. Les 10-12 pb en 5’ du gRNA sont généralement les plus
tolérantes au mésappariement [83, 95]. Cette caractéristique mène à une problématique de
DSB hors cible, qui peut mener à des mutations inattendues [104]. Des stratégies ont été
apportées pour diminuer les DSB hors cible, mais elles ne réussissent pas à complètement
les éliminer. En diminuant à 17 nucléotides le nombre de nucléotides pour former un ARN
guide, les DSB hors cible sont réduits dans certains cas de 5000 fois [47]. Ce processus ne
semble toutefois pas affecter l’efficacité des gRNA à atteindre leur cible [47]. Aussi, Cas9
D10A, une nickase créée en mutant et en désactivant le domaine endonucléique RuvC,
nécessite deux CRISPR-Cas9-D10A pour faire une DSB. Cette technique, rappelant le
fonctionnement des ZFN et des TALENs, augmente ainsi la spécificité du système [105].
De même, la fusion Fok1-dCas9 nécessite aussi d’être utilisée en paire. Ce système utilise
la nucléase Fok1 qui doit dimériser pour couper l’ADN et une Cas9 désactivée [106].
4.0 Mécanismes de réparation de l’ADN
4.1 Réparation des coupures simple brin
Lorsque seul un brin d’ADN est coupé, l’autre brin agi comme gabarit pour
permettre la correction. La réparation par excision de base (BER) permet de réparer un
nucléotide grâce à la glycosylase d’ADN, qui reconnaît et enlève le nucléotide en question,
créant un site apurinique ou apyrimidique (AP) [107]. Des endonucléases AP créent une
coupure simple brin dans le site AP pour permettre la réparation en utilisant le brin
complémentaire comme gabarit [107].
La réparation par excision de nucléotides (NER) répare le dommage à l’ADN
provenant de rayons UV [108]. La région endommagée est enlevée en une procédure de
trois étapes : i) reconnaissance du dommage, ii) excision du dommage à l’ADN en amont et
en aval, iii) et resynthèse de la région d’ADN excisée en utilisant le brin complémentaire
comme gabarit [108]. La réparation des mésappariements (MMR) permet la reconnaissance
des mésappariements base-base, ainsi que des petites Indels de nucléotides pendant la
24
réplication et la recombinaison de l’ADN, évitant ainsi que la mutation ne devienne
permanente dans la cellule [109-111].
4.2 Réponse aux dommages à l’ADN
Une DSB de l’ADN est potentiellement létale pour la cellule. La reconnaissance
rapide des dommages à l’ADN et la réparation avec précision de l’ADN sont les aspects les
plus importants de la réponse aux dommages à l’ADN (DDR) dans la cellule [57]. La
réparation des DSB se fait principalement par deux voies de réparation de l’ADN, soit par
jonction d’extrémités non homologues (NHEJ) ou par HR [112].
La réponse la plus précoce à une DSB est le recrutement du complexe MRN
(Mre11, Rad50, Nbs1) suivi rapidement du recrutement de la kinase ataxia telangiectasia
mutated (ATM) qui à son tour phosphoryle l’histone H2AX à proximité de la DSB [113-
115]. MRE11, quant à elle, est une 3’ à 5’exonuclease double brin et une endonucléase
d’ADN simple brin qui assure l’alignement de l’ADN brisé pour permettre sa liaison [116].
Rad50 est une protéine superhélice possédant une activité ATP-dépendante pour la liaison
de l’ADN [116]. Le complexe MRN clive les extrémités d’ADN en guise de préparation
pour la HR ou la NHEJ [116-118]. Le complexe NuA4 est le complexe protéique clé dans
l’acétylation d’histone et la réparation des DSB chez les mammifères. Il contient au moins
16 sous-unités dont trois sous-unités possèdent une activité catalytique : Tip60
l’acétyltransférase, le moteur ATPase p400 et les hélicases Ruvbl1 et Ruvbl2 [119-122].
Tip60 (aussi connue sous le nom d’acétyltransférase KAT5) est recrutée au DSB,
s’autophosphoryle et active l’ATM kinase [123-125]. De nombreuses études démontrent
que l’ATM phosphoryle Kap1 ce qui est une étape critique pour la réparation des DSB dans
l’hétérochromatine [126, 127]. Le recrutement du complexe NuA4 à la DSB permet
l’acétylation de l’histone 4, ce qui, en combinaison avec l’activité de l’ATPase SWI/SNF
DNA-dépendant de p400, permet de diminuer les interactions histone-histone [128]. Ce
relâchement des histones permet une plus grande accessibilité pour la réparation de l’ADN
au site de la cassure [128]. Les processus cellulaires menant au choix d’utiliser une voie de
réparation ou l’autre ne sont pas encore bien compris, par contre, les protéines 53BP1 et
25
BRCA1 sont connues comme ayant un rôle clé à cet égard [129, 130]. Il a toutefois été
démontré que CtIP interagit avec le complexe MRN et régule la résection, une étape clé
dans la décision d’utiliser la réparation par HR dans les cellules mammifères [131].
Figure 9 : Schéma de réparation d’une DSB par les voies NHEJ et HR.
L’ADN ayant subi une DSB et le gabarit homologue utilisé pour la réparation sont respectivement
représentés par une paire de lignes noires et grises. A) Les extrémités de la DSB sont liées par MR(X)N et le
complexe Ku/DNA-PK. B) Dans la réparation NHEJ, les extrémités de la DSB sont stabilisées par MR(X)N
et Ku/DNA-PK. C) MR(X)N et Ku/DNA-PK recrutent le complexe ligase et alignent les extrémités de la
DSB. D) Les extrémités de la DSB sont ligaturées ou sont traitées pour d’autre ligation (repair). E) Dans la
HR, les extrémités 5’ de la DSB sont réséquées par MR(X)N et d’autres nucléases. F) RPA se lie à l’ADN
simple brin généré par la résection. G) L’ADN simple brin lié par la RPA est substitué par la formation du
26
filament-Rad51, impliquant Rad52, Rad55-Rad57 et Rad54. H) La recherche d’homologie et l’invasion du
brin du filament-Rad51 mènent à la formation de la D-loop. I) À partir de la D-loop, différentes voies de HR
peuvent mener à la réparation de DSB. Tirée de Pardo et al. [132]
4.2.1 Jonction des extrémités non homologues
Mécanisme 4.2.1.1
La NHEJ est l’une des voies majeures de réparation de l’ADN suite à une DSB.
Cette méthode de réparation est active en tout temps lors du cycle cellulaire, mais elle
prédomine lors des phases G0/G1 et G2 [133-136].
La NHEJ relie directement les extrémités d’ADN coupées, ce qui peut introduire de
petits Indels de nucléotides pouvant mener à une invalidation génique. C’est pour cette
raison que la NHEJ est considérée propice à l’erreur, malgré le fait que ce ne soit pas
toujours le cas. Il existe trois étapes majeures dans la voie de réparation des DSB par
NHEJ : a) retrait de l’ADN endommagé par des nucléases, b) la réparation par les
polymérases, et c) la ligation des deux extrémités d’ADN par des ligases.
Protéines impliquées 4.2.1.2
Chez les mammifères, les protéines principalement impliquées dans la réparation
par NHEJ sont l’hétéroduplexe Ku70/80, la sous-unité catalytique de la protéine kinase
ADN-dépendent (DNA-dependent protein kinase catalytic subunit, DNA-PKcs) et les
protéines du complexe de ligation : X-ray cross-complementing protein 4 (XRCC4),
XRCC4-like factor (XLF, aussi connue sous le nom Cernunnos) ainsi que la DNA ligase IV
[137-140].
Les protéines Ku70 et Ku80, nommées en fonction de leurs poids moléculaires en
kDa, forment un hétéroduplexe en se liant aux extrémités coupées de l’ADN et recrutent
l’ADN-PKcs une sérine/thionine kinase [141]. Une fois recrutée à la DSB, l’ADN-PKcs
s’autophosphoryle, et s’autoactive. Par son activation, elle recrute et active Artemis en la
27
phosphorylant [134, 135]. Le complexe Artemis : ADN-PKcs possède une activité
endonucléase 5’ qui a une préférence à cliver l’ADN simple brin 5’ pour y laisser des bouts
francs, ainsi qu’une activité endonucléase 3’ avec une préférence pour l’ADNsb 3’ laissant
4 nt en surplomb [142]. De plus, le complexe Artemis : DNA-PKcs possède la capacité de
cliver les boucles d’ADN [142]. Ces activités préparent les extrémités d’ADN pour la
ligation par le complexe de ligation [142, 143].
La polymérase mu est impliquée dans la préparation d’ADN pré-ligation, car elle
possède de multiples activités enzymatiques. Toutefois, d’autres polymérases peuvent
contribuer à la réparation par NHEJ lorsque mu est absente, telle la polymérase lamdba
[144, 145]. La polymérase mu se lie à la DSB via Ku par les domaines BRCT situés en N-
terminal des polymérases [146]. Lorsque Ku et XRCC4 : ADN ligase IV sont présents avec
ces polymérases, elles acquièrent la capacité de synthétiser l’ADN après les extrémités
coupées, et ce, sans avoir besoin d’un gabarit [147-150]. Comme d’autres polymérases, la
polymérase mu peut glisser sur le brin guide ce qui la rend propice à l’erreur [151-153]. La
polymérase mu peut aussi synthétiser de l’ADN indépendamment d’un gabarit lorsqu’elle
est seule ou en présence de XRCC4 : ADN ligase IV [154].
La ligation des extrémités d’ADN est réalisée par la ligase IV qui est liée par les
protéines XRCC4 et XFL ancrées sur l’hétéroduplexe Ku70/80 [146, 155]. XRCC4 et XLF
ont des propriétés similaires; elles ne possèdent pas d’activité enzymatique, mais stimulent
l’activité de la ligase IV ainsi que sa readénylation lorsqu’elles y sont liées [155]. La ligase
IV est capable de ligaturer des extrémités compatibles d’une longueur de 4 nt [156].
L’interaction de la ligase IV avec XRCC4 permet la ligation des extrémités possédant une
microhomologie de 2 pb [155, 157, 158]. Si la ligase IV se trouve ancrée au site de la DSB
avec Ku, l’activité de ligation est améliorée de 10 fois [154]. Lorsque XLF s’ajoute, le
complexe XLF:XRCC4:DNA ligase IV est capable de ligaturer des extrémités d’ADN
incompatible avec plus d’efficacité [159, 160]. La NHEJ est un mécanisme qui, malgré son
potentiel d’introduire des indels, est nécessaire pour permettre la survie de la cellule dans
une situation autrement mortelle [136].
28
Importance de ce mécanisme pour l’invalidation génique 4.2.1.3
L’invalidation génique est nécessaire pour étudier la fonction d’un gène dans un
organisme spécifique. Une fois le gène invalidé, il suffit de comparer les fonctions de la
cellule ou de l’organisme invalidé à celles d’un contrôle pour inférer les fonctions du gène.
En utilisant une endonucléase ciblant spécifiquement le gène d’intérêt, il est possible
d’invalider rapidement et efficacement un gène et étudier ses effets dans la cellule [161].
Récemment, le groupe de recherche de Feng Zhang a développé une stratégie pour induire
multiples invalidations de gène en simultané dans les cellules de mammifère utilisant le
système CRISPR-Cpf1 avec 4 ARN guides [161].
4.2.2 Recombinaison homologue
Mécanisme 4.2.2.1
La HR est une des voies de réparation des DSB qui est considérée sans erreur, car
elle utilise la séquence homologue de la chromatine sœur pour faire une correction parfaite
[132]. Comme les chromatides sœurs ne sont présentes que lors des phases S et G2/M, la
réparation par HR est restreinte à ces phases du cycle cellulaire [162]. La HR classique se
caractérise principalement par trois étapes successives : 1) la résection de l’extrémité 5’ à la
DSB, suivi de 2) l’invasion de brin de la chromatine sœur et la recherche d’une séquence
d’homologie, puis 3) la résolution intermédiaire [132].
Protéines impliquées 4.2.2.2
La première étape de la réparation par HR est la dégradation de l’extrémité 5’
d’ADN. Cette étape est régie par les protéines MRE11, RAD50, NBS1, CtIP and EXO1,
ainsi que par d’autres complexes qui demeurent à être identifiés [132]. Cette résection
résulte en la production d’un ADN simple brin en 3’ qui est rapidement lié par la protéine
de réplication A (RPA), un complexe hétérotrimérique qui se lie à l’ADNss avec haute
affinité [163-165]. La liaison de RPA permet d’éviter la formation de structures secondaires
29
de l’ADNss ainsi que de recruter Rad52 et les protéines encodées par les gènes du groupe
épistatique de RAD52 : RAD50, RAD51, RAD52, RAD54, RAD55, RAD57, RAD59,
RDH54, MRE11 et XRS2. Ces dernières forment le filament Rad51 qui remplace RPA sur
l’ADNss 3’ [163-167]. L’ADNss 3’ enrobé par le filament Rad51 peut donc amorcer une
invasion du brin de la chromatine sœur en créant une boucle de déplacement, (D-loop) suivi
d’une recherche de séquences homologues pour permettre la synthèse de l’ADN [168-170].
Rad54 jouerait un rôle important dans le processus de recherche de séquences d’homologie
et dans la maturation d’intermédiaires de la recombinaison suite à la formation de la D-loop
[171-173].
Voies de réparation menant au HR 4.2.2.3
Différentes voies de réparation mènent à une réparation par HR. Le processus
associé au choix de la cellule d’utiliser l’une ou l’autre de ces voies est encore peu connu.
Toutefois, chacune des voies présentées ci-dessous résulte en un échange de matériel
génétique entre deux chromosomes homologues.
4.2.2.3.1 Synthesis Dependent Strand Annealing
Dans la voie de Synthesis Dependent Strand Annealing (SDSA), le brin invasif
identifie une séquence homologue dans la chromatine sœur. Cette dernière sert de gabarit
pour l’élongation [174]. La nouvelle séquence synthétisée se déplace à l’autre bout de la
DSB et permet la synthèse d’une nouvelle région complémentaire [174]. Cette voie de
réparation ne produit pas d’échange génétique par enjambement [175].
30
Figure 10 : Représentation d’une réparation par Synthesis Dependent Strand Annealing
A) Déplacement des brins par le brin invasif et liaison à l’autre extrémité du DSB. B) Clivage des
séquences non homologues, élongation et ligation produisent un enjambement. Figure tirée de Pardo et al.
[132]
4.2.2.3.2 Double-Strand Break Repair
Lors d’une réparation par la voie classique du Double-Strand Break Repair (DSBR),
l’élongation a lieu sur les deux brins d’invasion simultanément en utilisant le gabarit
provenant de la même D-loop [174]. La résultante est la formation de jonctions d’Holliday
(HJ) qui peuvent produire ou non des événements d’enjambement dépendamment du type
de clivage utilisé pour résoudre la jonction [174].
Figure 11 : Représentation de Double-Strand Break Repair
Élongation et ligation du brin invasif : formation de double-jonction d’Holliday. Figure tirée de
Pardo et al.[132]
31
4.2.2.3.3 Break-induced repair
Le break-induced repair (BIR) est une voie de réparation de l’ADN qui est
privilégiée lorsqu’une seule terminaison de la DSB peut trouver une séquence d’homologie
ou lorsqu’une extrémité d’ADN est perdue [176, 177]. Le brin invasif identifie une
séquence d’homologie, forme un D-loop et initie une synthèse unidirectionnelle d’ADN. Le
brin complémentaire est ensuite synthétisé de façon discontinue [178]. La BIR résulte en
une perte d’hétérozygosité et une possibilité de perte de séquence [178].
Figure 12 : Représentation du Break-Induced Repair
La réparation de la DSB mène à une duplication du gabarit du bras chromosomal. A) L’invasion de
brin par l’extrémité 3’ d’un DSB et la formation de D-loop. B) Formation de la fourche de réplication et la
synthèse d’ADN (flèche en pointillé grise). C) Réplication complète du gabarit du bras homologue et ligation
des brins : formation de HJ. D) Réparation du DSB par résolution du HJ (petite flèche noire). Figure tirée de
Pardo et al. [132]
4.2.2.3.4 Single-Strand Annealing
Une réparation par Single-Strand Annealing (SSA) peut se produire lorsque la DSB
a lieu entre des séquences répétitives [179]. Si l’ADNss 3’ résultant n’identifie pas de
séquence homologue sur la chromatine sœur, il y a poursuite de la résection, ce qui peut
entraîner la perte de plusieurs kilobases d’ADNss 3’ [179]. Suite à la résection des ADNss
32
3’, l’identification de séquences d’ADN homologues sur les deux brins résulte en leur
alignement, puis en la résection de la séquence non homologue par Rad1- Rad10 et les
protéines Msh2, Msh3 et Slx4 [180-182]. La réparation est par la suite terminée par une
élongation et une ligation finale [179]. Cette méthode de réparation produit une délétion de
la séquence qui se trouve entre les séquences répétitives, ce qui peut être critique ou non
pour la fonction de la cellule.
Figure 13 : Représentation de Single-Strand Annealing
A) Résection de l’extrémité 5’ du DSB et la liaison par complémentarité des répétitions d’ADN
(flèche grise en tandem). B) Clivage de la séquence non homologue (flèche noire). C) Élongation. D)
Ligation. Figure tirée de Pardo et al. [132]
Importance du processus de réparation pour l’édition du 4.2.2.4
génome
Lorsqu’on fourni un ADN donneur exogène à la cellule, il est possible d’utiliser la
HR afin d’intégrer des séquences d’ADN avec des bras d’homologie en amont et en aval de
la DSB. Cela donne donc la possibilité d’intégrer une ou des mutations ponctuelles, faire de
la correction génique ou intégrer une séquence spécifique. Par exemple, il est possible
d’intégrer un gène d’intérêt, une étiquette d’affinité, et/ou un domaine fonctionnel
provenant d’un autre gène [183, 184].
33
4.2.3 Utilisation temporelle des mécanismes de réparation de l’ADN
Les deux voies de réparation présentées ci-haut sont en compétition directe selon la
phase de croissance dans laquelle se trouve la cellule. Le NHEJ est connue pour être actif
en tout temps, car ce dernier ne nécessite pas de gabarit, les deux extrémités créées par la
DSB sont directement religaturées ensemble. À l’opposé, la HR est active seulement dans
les phase S tardive et G2/M de la cellule, lorsque les chromatines sœurs y sont présentes.
Cette caractéristique a d’ailleurs récemment été utilisée en couplant l’expression de Cas9 au
cycle cellulaire de façon à augmenter la fréquence de HR in vitro [185].
35
PROBLÉMATIQUE ET OBJECTIFS DES TRAVAUX
Problématique
Les techniques actuellement utilisées pour la purification des complexes protéiques
par surexpression posent des limites importantes à l’étude des complexes protéiques natifs
chez l’humain. Cette approche couramment utilisée peut mener à des effets anormaux, tels
que la formation d’interactions non spécifiques, la délocalisation des protéines cible et la
cytotoxicité, qui peuvent mener à des conclusions erronées. Il est donc important de
reproduire le plus précisément possible les niveaux physiologiques normaux des protéines à
l’étude.
Dans ce contexte, le présent mémoire visait à tester l’hypothèse suivante :
L’intégration ciblée au locus AAVS1 d’un cDNA d’intérêt possédant une étiquette permet
de purifier des complexes protéiques dans un contexte quasi natif, en absence de
surexpression.
Objectif des travaux
1. Développer une technique fondée sur la modification du génome permettant la
purification de complexes protéiques dans des conditions optimales pour l’étude de leur
fonction et structure.
2. Établir des lignées cellulaires humaines pouvant exprimer des protéines toxiques.
36
Objectifs spécifiques
1.a) Utiliser les techniques d’édition de génomes pour créer des lignées stables de cellules
humaines qui expriment nos cDNA d’intérêt au GSH AAVS1.
1.b) Purifier en tandem les protéines exprimées par les lignées stables en se servant de
l’étiquette en tandem 3xFLAG/TwinStrep.
1.c) Purifier les protéines MCM8 et EZH2.
2.a) Utiliser le système Tet-On 3G pour créer un système auto-inductible d’expression des
protéines cibles étiquetées.
37
CHAPITRE 1
A Scalable Genome Editing-Based Approach for Mapping the Human
ProteinInteractome
Mathieu Dalvai 1,2,3, Jeremy Loehr 1,3, Karine Jacquet 1,2, Caroline C. Huard 1, Céline Roques 1,2, Pauline Herst 1,2, Jacques Côté 1,2 and Yannick Doyon 1
1Centre Hospitalier Universitaire de Québec Research Center and Faculty of Medicine,
Laval University, Quebec City, QC, Canada.
2St-Patrick Research Group in Basic Oncology and Laval University Cancer Research
Center, Quebec City, QC, Canada.
3Co-first authors.
Copyright © Cell Press From Cell Reports ®, 13, 621–633, October 20, 2015
Reprinted with the permission from Cell Press
Article publié dans Cell Reports 13, 621–633, October 20, 2015
39
AVANT-PROPOS
Ce travail exécuté sous la supervision du Dr Yannick Doyon et du Dr Jacques Côté
a été réalisé grâce à la collaboration de Dr Mathieu Dalvai (étudiant postdoctoral de Dr
Jacques Côté, Université Laval). Karine Jacquet (Doctorante de Jacques Côté, Université
Laval), Dr Caroline Huard (professionnelle de recherche du Dr Yannick Doyon, Université
Laval), Céline Roques (professionnelle de recherche du Dr Jacques Côté, Université Laval),
Dr Pauline Herst (étudiante postdoctoral de Dr Jacques Côté, Université Laval) ont
participé à l’élaboration conceptuelle de l’étude. Dr Mathieu Dalvai a travaillé dans le volet
d’étiquetage endogène. Ma participation dans cette étude consiste en la construction des
plasmides, l’établissement des lignées cellulaires stables ainsi que l’obtention et l’analyse
des résultats dans le volet d’édition génique au locus AAVS1. Les étapes de rédaction ont
été réalisées par Dr Yannick Doyon.
41
RÉSUMÉ
La purification par affinité couplée à l’analyse par spectrométrie de masse
(AP-MS) est une méthode de choix pour l’étude des interactions protéines-protéines chez
les cellules humaines. Par contre, cette technique est sensible aux perturbations causées par
la surexpression ectopique des protéines cibles. Des effets anormaux, tels que la formation
d’agrégats et la délocalisation des protéines cibles, peuvent mener à l’établissement de
conclusions erronées. Il est donc important de reproduire le plus précisément possible les
niveaux physiologiques normaux des protéines à l’étude. Les travaux présentés dans ce
mémoire décrivent le développement d’un système robuste et rapide à l’interface entre
l’édition du génome et la protéomique permettant l’isolation de complexes protéiques natifs
dans leur contexte génomique naturel. À l’aide des systèmes Clustered regularly
interspaced short palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9) et
transcription activator-like effector nucleases (TALEN) nous avons étiqueté différents
gènes endogènes et purifié de nombreuses holoenzymes impliquées dans la réparation de
l’ADN et la modification de la chromatine à presque homogénéité. Nous avons identifié des
sous-unités et des interactions au sein de complexes déjà bien caractérisés et rapportons
l’isolation de MCM8/9, soulignant ainsi l’efficacité et la robustesse de cette approche. La
technique présentée améliore et simplifie l’exploration des interactions protéiques ainsi que
l’étude de l’activité biochimique, structurelle et fonctionnelle.
43
ABSTRACT
Conventional affinity purification followed by mass spectrometry (AP-MS) analysis
is a broadly applicable method to decipher molecular interaction networks and infer protein
function. However, it is sensitive to perturbations induced by ectopically overexpressed
target proteins and does not reflect multilevel physiological regulation in response to
diverse stimuli. Here we developed an interface between genome editing and proteomics to
isolate native protein complexes produced from their natural genomic contexts. We used
CRISPR/Cas9 and TALENs to tag endogenous genes and purified several DNA repair and
chromatin modifying holoenzymes to near homogeneity. We uncovered novel subunits and
interactions amongst well-characterized complexes and report the isolation of MCM8/9,
highlighting the efficiency and robustness of the approach. These methods improve and
simplify both small and large-scale explorations of protein interactions, as well as the study
of biochemical activities and structure-function relationships.
45
INTRODUCTION
The cell is composed of a collection of protein machines responsible for the
coordinated execution of cellular functions (Alberts, 1998). Deciphering the components
and activities of these molecular assemblies is crucial to understand the cellular networks
that are perturbed under disease states (Gavin et al., 2011; Rolland et al., 2014). For
example, the identification of cancer-driving mutations amongst a background of passenger
mutations can be improved by tying combinations of rare mutations to specific protein
complexes (Krogan et al., 2015; Leiserson et al., 2015; Rolland et al., 2014). Besides, the
growing list of cancer related genes often comprises uncharacterized proteins for which
focused proteomic studies could help uncover function (Lawrence et al., 2014; Vogelstein
et al., 2013).
Affinity purification followed by mass spectrometry (AP-MS) analysis is a powerful
approach to characterize protein-protein interactions and multiprotein complexes which are
defined as sets of stably associated proteins isolated under standardized biochemical
conditions (Gavin et al., 2011). Landmark studies describing genome-wide identification of
complexes in budding yeast generated high quality datasets by relying on two major
technical innovations (Gavin et al., 2006; Krogan et al., 2006). First, the development of
standardized tandem affinity purification (TAP) protocols allowed the isolation of
complexes by sequential capture and elution using pairs of affinity tags (Rigaut et al.,
1999). Second, systematic tagging of open reading frames on the chromosomes via
homologous recombination permitted to retain the physiological regulation of gene
expression for the bait proteins.
While pioneering studies in Arabidopsis, Drosophila, and human cells using ectopic
expression of tagged proteins have yielded important insights into biological pathways in
higher eukaryotes (Behrends et al., 2010; Goudreault et al., 2009; Guruharsha et al., 2011;
46
Hegemann et al., 2011; Hutchins et al., 2010; Huttlin et al., 2015; Marcon et al., 2014;
Sardiu et al., 2008; Sowa et al., 2009; Van Leene et al., 2010), there is a need to keep
improving these methods in order to reduce perturbations in the stoichiometry of protein
interactions and prevent aberrant localization, protein aggregation, dominant negative
effects and toxicity (Doyon et al., 2011; Ho et al., 2002). For example, chromatin
modifying complexes require meticulous biochemical characterization since they often
exist in different forms with paralogous subunits and only their native assembly can
recapitulate their specificity for a given histone residue within chromatin (reviewed in
(Lalonde et al., 2014)). Hence, we developed straightforward methods to streamline the
mapping of protein-protein interactions in human cells under settings minimizing
deviations from their natural context. We used engineered nucleases such as zinc-finger
nucleases (ZFNs), TAL effector nucleases (TALENs) and clustered regularly interspaced
short palindromic repeats (CRISPR)/Cas9 to simplify the generation of cell lines with
tailored modifications and enable the expression of tagged proteins from their endogenous
loci (Hsu et al., 2014; Joung and Sander, 2013; Sternberg and Doudna, 2015; Urnov et al.,
2010). First, we exploited a genomic safe harbor locus to rapidly and reliably generate cells
lines expressing bait proteins at near physiological levels as a surrogate to classical
plasmid- or virus-based methods for stable cell line generation. Second, we introduced an
affinity tag at the N and C-terminus of proteins encoded by endogenous genes in order to
retain the dynamic control of gene expression specified by the native chromosomal context
and the natural post-transcriptional regulation mechanisms. Under these conditions, we
obtained near homogenous preparations of native proteins complexes in sufficient amounts
to perform biochemical assays and identify their subunits via mass spectrometry analysis.
The tagged cell lines were also used for immunoprecipitation of cross-linked chromatin
fragments (Chromatin Immunoprecipitation, ChIP) to study protein-DNA interactions in
vivo under normalized conditions. These tools were portable to numerous proteins and
represent a general solution for protein isolation, complex identification, and genome
location analysis under physiological conditions. Importantly, the scalability and
adaptability of this system will open avenues for the systematic and unbiased mapping of
protein-protein networks in a variety of organisms.
47
EXPERIMENTAL PROCEDURES
Cell culture and transfection
K562 cells were obtained from the ATCC and maintained at 37 °C under 5% CO2
in RPMI medium supplemented with 10% FBS, penicillin-streptomycin and GlutaMAX.
When cultivated in Erlenmeyer or spinner flasks, 25 mM HEPES-NaOH pH 7.4 was added.
Cells were transfected using the Amaxa 4D-Nucleofector (Lonza) per manufacturer's
recommendations.
ZFN, TALEN, and CRISPR/Cas9 reagents
The AAVS1-targeting ZFNs and EZH2 TALENs (Addgene #36775 and #36776)
have been described (Hockemeyer et al., 2009; Reyon et al., 2012). The CMV-driven
human codon optimized Cas9 nuclease and nickase (Cas9 D10A) vectors (Addgene #41815
and #41816) and the U6-driven guide RNA (gRNA) vector to target human AAVS1 (T2
target sequence; Addgene #41818) have been described (Mali et al., 2013). The two U6-
driven guide RNA (gRNA) vectors to target human FANCF have been described (Tsai et
al., 2014). All other gRNA expression vectors were built in the MLM3636 (Addgene
#43860) backbone. Target sequences for EPC1 (GTGACGTAGCTTCCTCCGAG), EP400
(TGCCCTGACTACTGGCACGG), MBTD1 (ATCAAACAAGAGCCATGAGG) and
MCM8 (CCAGCTTCAAACTATGTAAA) were chosen according to a web-based CRISPR
design tool (Hsu et al., 2013). The DNA sequence for the gRNA for EP400, MBTD1 and
MCM8 were modified at position 1 to encode a ‘G’ due to the transcription initiation
requirement of the human U6 promoter. When present on a nuclease construct, FLAG
epitopes were removed by subcloning.
48
Construction of plasmid donors for recombination
The AAVS1-TAP tagging plasmid (Addgene #68375) was assembled in the AAVS1
SA-2A-puro-pA vector (Hockemeyer et al., 2009) by inserting a synthetic DNA fragment
containing a SV40 late polyadenylation sequence, hPGK1 promoter and TAP tag sequence
in between the puromycin resistance gene and the BGH polyadenylation site. The donor
plasmids for tagging EPC1, EP400, MBTD1, EZH2 and FANCF were synthesized as
gBlocks gene fragments (Integrated DNA Technologies) and assembled using Zero Blunt
TOPO cloning kit (Life Technologies) or cloned by restriction into pUC19. The homology
arms for the MCM8 donor plasmid were amplified by PCR from K562 genomic DNA.
Targeted integration to the AAVS1 locus
One millions cells were transfected with 1 µg of ZFN expression vector and 4 µg of
donor constructs. Simultaneous selection and cloning was performed for 10 days in
methylcellulose-based semi-solid RPMI medium supplemented with 0.25 µg/ml puromycin
starting 3 days post transfection. Clones were picked and expanded in 96 wells for 3 days
and transferred to 12 wells plates for another 3 days before cells were harvested for western
blot.
CRISPR/Cas9 and TALEN-driven targeted integration
For targeting using the CRISPR/Cas9 system, one million cells were transfected
with 2 µg of gRNA plasmid, 2 µg of Cas9 vector and 4 µg of donor. For TALEN-driven
integration, 2.5 µg of each vector and 4 µg of donor were transfected. Limiting dilution
cloning was performed 3 days post transfection and targeted clones were identified via out-
out PCR. For the experiments shown in Figure 6, 3 million cells were transfected at the
same DNA ratios and the cells were cultivated in 10 ml of RPMI media in a T-75 flask for
3 days. The cells were then diluted to 2E5 / ml and grown in Erlenmeyer flasks with
agitation until they reached a density of 1E6 / ml. Under these conditions we typically
49
obtained 2E8 cells (200 ml culture at saturation) 7 days post transfection and 1E9 cells (1 l
culture at saturation) 10 days post transfection.
Tandem affinity purification (TAP)
Typically, nuclear extracts (Abmayr et al., 2006) were prepared from 1E9 to 3E9
cells (1 l to 3 l cultures at saturation), adjusted to 0.1% Tween-20 and ultracentrifuged at
100 000 x g for 45 min. Extracts were precleared with 300 µl of Sepharose CL-6B (Sigma),
then 250 µl of anti-FLAG M2 affinity resin (Sigma) was added for 2 h at 4°C. The beads
were then washed in Poly-Prep columns (Bio-Rad) with 40 column volumes (CV) of buffer
# 1 (20 mM HEPES-KOH pH 7.9, 10 % glycerol, 300 mM KCl, 0.1% Tween 20, 1 mM
DTT, 1X Halt protease and phosphatase inhibitor cocktail without EDTA (Pierce))
followed by 40 CV of buffer # 2 (20 mM HEPES-KOH pH 7.9, 10 % glycerol, 150 mM
KCl, 0.1% Tween 20, 1 mM DTT, 1X Halt protease and phosphatase inhibitor cocktail
without EDTA (Pierce)). Complexes were eluted with 5 CV of buffer # 2 supplemented
with 150 µg/ml 3x FLAG peptide (Sigma) for 1 h at 4°C. Next, fractions were mixed with
125 µl Strep-Tactin sepharose (IBA) affinity matrix for 1 h at 4°C and the beads were
washed with 40 CV of buffer # 2 in Poly-Prep columns (Bio-Rad). Complexes were eluted
in 2 fractions with 4 CV of buffer # 2 supplemented with 2.5 mM D-biotin, flash frozen in
liquid nitrogen and stored at -80°C. Typically, 15 µl of the first elution (3% of total) loaded
on Bolt or NuPAGE 4–12% Bis-Tris gels (life technologies) and analyzed by silver
staining. For purifications from whole cell extracts (WCE), cells were washed twice with
PBS and lysed in buffer A (20 mM HEPES-KOH pH 7.9, 10 % glycerol, 300 mM KCl,
0.1% IGEPAL CA-630, 1 mM DTT, 1X Halt protease and phosphatase inhibitor cocktail
without EDTA (Pierce)) (ratio of 100 µl of lysis buffer per 1E6 cells) for 30 min at 4°C.
Extracts were centrifuged for 30 min at 17 000 x g and the purifications were performed as
described above.
HAT and HMT assay
TAP purified fractions were assayed for enzymatic activity on short
oligonucleosomes isolated from HeLa S3 cells as described (Doyon et al., 2004;
Musselman et al., 2012).
50
RESULTS
Characterization of a Potent Tandem Affinity Tag
An ideal TAP tag leads to high recovery of a fusion protein present at low
concentration with minimal background contaminants. It should be functional as N and C-
terminal fusions and its size and amino acid (AA) sequence should have no impact on
protein function. In preliminary experiments we evaluated several tags including the AC-
TAP, SBP, FLAG-HA tags and settled on a combination of 3xFLAG and 2xSTREP tags as
both tags can be eluted under gentle conditions and yield to the isolation of highly purified
material (see below) ((Doyon et al., 2006) and data not shown). Our version contains 59
AA for a predicted molecular weight of 6 kilodaltons (kDa) and does not necessitate
proteolytic cleavage (Figure 1A).
To fine-tune our purification scheme we selected the KAT5/TIP60 tumor suppressor
protein, the catalytic subunit of the NuA4 (Nucleosome acetyltransferase of histone H4)
complex that regulates gene expression, promotes DNA repair via homologous
recombination and is required for embryonic stem cells self-renewal and differentiation
(Steunou, 2014). NuA4 is composed of more than 15 subunits ranging from 20 to 400 kDa
in size (Cai et al., 2005; Doyon et al., 2006; Doyon et al., 2004; Ikura et al., 2000). We first
established two independent pools of cells expressing KAT5 fused to a C-terminal TAP tag
and performed purifications from whole cell extracts to determine the proper order of steps
required to achieve high yields and purity. We observed that the high binding capacity of
the anti-FLAG M2 affinity resin is best used as a first step to recover the maximal amount
of complexes while the Strep-Tactin resin increases dramatically the purity of the final
samples yielding to near homogenous preparations from low amounts of starting material
(Figure S1).
51
1Figure 1. ZFN-Driven Gene Addition to the AAVS1 Locus Simplifies Tandem Affinity Purification of
Multisubunit Protein Complexes
A) Schematic of the donor construct and of the AAVS1 locus following cDNA addition. The first
two exons of the PPP1R12C gene are shown as open boxes. Also annotated are the locations of the splice
acceptor site (SA), Sa self-cleaving peptide sequence (2A), puromycine resistance gene (Puro),
polyadenylation sequence (pA), human phosphoglycerate kinase 1 promoter (hPGK1), and 3xFLAG-
2xSTREP tandem affinity tag (Tag); homology arms left and right (HA-L, HA-R) are respectively 800 and
840 bp. Sequence of the TAP tag. The 3xFLAG sequence is in bold, and 2xSTREP is in bold and underlined.
B) Silver-stained SDS-PAGE showing the purified EPC1 complex. K562 cells expressing the tag (Mock) and
a clonal cell line expressing EPC1-tag (EPC1). C) Silver-stained SDS-PAGE showing the purified EP400
complex from a clonal cell line expressing EP400 tag (EP400). Proteins were identified from unfractionated
protein samples and assigned to specific gel bands based on extensive western blotting analysis. D) Western
blots of selected NuA4 subunits on purified fractions. E) Autoradiogram showing the results of HAT assays
to determine the specificity of the EPC1 and EP400 complexes. Coomassie staining was used as a loading
control for histones. See also Figure S1.
52
Tandem-Affinity Purification Following Nuclease-Driven Gene Addition to the
AAVS1 Genomic Safe Harbor Locus
In order to rapidly generate isogenic cell lines expressing TAP tagged cDNAs, we
used nuclease-driven targeted integration into the human PPP1R12C gene, a safe harbor
genomic locus known as AAVS1 that allows stable transgenesis and neutral marking of the
cell (DeKelver et al., 2010; Hockemeyer et al., 2009; Lombardo et al., 2011). This system
is composed of a nuclease that cleaves the first intron of PPP1R12C and a gene-trap vector
allowing puromycin selection of targeted cells. We adapted this system to integrate tagged
cDNAs and used the moderately active human PGK1 promoter to achieve slight
overexpression conditions (Figure 1A and see below). We targeted two subunits of NuA4
to the AAVS1 locus and purified the associated complexes. We chose the enhancer of
polycomb homolog 1 (EPC1) and the E1A binding protein p400 (EP400) as model proteins.
Due to their size, respectively 100 and 400 kDa, we reasoned that it would represent a
substantial test for biochemical stability during purification. Likewise, targeting required
error-free ZFN-driven addition of their relatively large expression cassettes of 4.3 kb and
11.3 kb.
K562 cells were selected as our model cell line because they can be cultivated,
expanded, and transfected with high efficiency as suspension cultures. They are also
permissive to genome editing events and tolerate cloning via either limiting dilution or in
semi-solid media. Moreover, as a designated tier 1 cell line used by all investigators of the
Encyclopedia of DNA Elements (ENCODE) project, a myriad of genomic and epigenomic
data is available for this cell line (Consortium, 2012).
We first transfected K562 cells with AAVS1-targeting ZFNs and the EPC1 donor
and selected clones in methylcellulose-containing media supplemented with puromycin
(Figure 1A). Single cell-derived colonies were picked after 10 days, expanded, and
53
transgene expression was monitored by western blot. In a typical experiment, more than 90
% of the clones expressed the transgene with little variability (see Figure S1 for an
example). Nuclear extracts were prepared from an EPC1-tag cell line, as well as from K562
cells expressing only the tag (Mock), and subjected to TAP. EPC1 complex subunits
separated by SDS–polyacrylamide gel electrophoresis (SDS–PAGE) could be
unambiguously identified on silver stained gels due to the very low protein background
observed in the mock purification after double-affinity purification (Figures 1B). Mass
spectrometry analysis identified all known components of NuA4, in addition to MBTD1,
which was not previously ascertained as a core complex subunit (Cai et al., 2005; Doyon et
al., 2006; Doyon et al., 2004; Ikura et al., 2000) (Table S1). Next, we performed a
reciprocal purification of the complex by repeating the process with EP400, coding for the
large SWI/SNF2-family ATPase that incorporates histone variant H2A.Z into chromatin
(Weber and Henikoff, 2014). We obtained a complex that was indiscernible from the EPC1
assembly (Figures 1C, 1D ; Table S1). In contrast to previously published data, the EP400
complex contains the KAT5 catalytic subunit (Fuchs et al., 2001). It appears that
overexpression of EP400 that was achieved using retroviral-based gene delivery in the
previous study resulted in the purification of a partially assembled complex.
An important characteristic of our system is that the purified fractions can be
assayed biochemically in vitro. To determine if the purified complexes are recovered in
sufficient amounts and concentration, we performed histone acetyltransferase (HAT)
assays. We observed robust enzymatic activity for both complexes with substrate
specificity consistent with published reports for KAT5/NuA4 (Doyon et al., 2004; Ikura et
al., 2000) (Figure 1E). Again, these observations contrast with the minimal traces of HAT
activity observed for the EP400 complex and the reported disconnection between these two
enzymatic activities (Fuchs et al., 2001; Park et al., 2010; Tyteca et al., 2006). Taken
together, these data demonstrate that coupling our TAP approach with gene targeting at
AAVS1 creates a highly efficient surrogate method for the isolation of native protein
complexes under near physiological conditions.
54
1Table S1, Related to Figures 1 and 2. NuA4 Complex Subunits Identified by Mass Spectrometry
Analysis
Predicted molecular weights, total spectral counts and # of unique peptides for
identified proteins are indicated. AAVS1-EPC1/EP400 and CRISPR-EPC1/EP400 indicate
whether the subunits were expressed ectopically from the AAVS1 locus or from the
endogenous loci, respectively.
Tandem-Affinity Purification of Native Multisubunit Protein Complexes
following CRISPR/Cas9-Driven Tagging of Endogenous Genes
Having demonstrated that our purification strategy worked efficiently and
eliminated most background contaminants at the low expression levels obtained by
targeting the AAVS1 locus, we aimed to determine if proteins expressed from their natural
chromosomal contexts could be isolated with high specificity as physiologically regulated
endogenous complexes. We designed CRISPR/Cas9-based nucleases to cleave DNA at the
vicinity of the stop codon of EPC1 in order to stimulate homology-directed integration of
55
the TAP tag using a donor molecule containing short homology arms (Figures 2A and S2).
Following transfection of K562 cells with the nuclease and recombination donor, we
readily detected the incorporation of the tag in the pool of cells by PCR (Figure S3).
Targeted clones, isolated by limiting dilution in absence of any selection, were observed at
a frequency of 6% (10/165) and accurate gene modification was confirmed by western blot
analysis and sequencing (Figures 2B, 2C and S3). We did not obtain homozygous clones
for this gene, but we note that PCR analysis suggests that three copies of the locus are
present in K562 cells (Figure S3). Comparison of the EPC1-tag protein levels expressed
from the AAVS1 locus versus the endogenous gene revealed an approximately 2.5 fold
overexpression in the former case (Figures 2G and S3). We performed side-by-side TAP
from an endogenously tagged EPC1 cell line, and from a clone targeted at AAVS1, and
observed matching banding patterns on silver stained gels (Figure S3). Mass spectrometry
analysis confirmed the complete coverage of the subunits when the complex is purified
from the endogenous locus (Table S1). To confirm these observations, we used a similar
approach to perform a reciprocal purification of the complex by tagging the endogenous
EP400 gene at its C-terminus (Figures 2D and S2). The efficiency of targeting in this case
was 21% (13/61, including 2 homozygous clones). For the purification, a homozygous
clone expressing tagged EP400 was selected (Figures 2E, 2F and S3). This clone expressed
approximately 2 fold less protein than the one used in the AAVS1 purification (Figures 2G
and S3). Both complexes could be purified to near homogeneity and displayed strong
H4/H2A-specific HAT activity towards nucleosomes (Figures 2H and 2I; Table S1). Since
MBTD1 was reproducibly detected in these preparations, we performed reciprocal tagging
to confirm its stable association with NuA4. CRISPR/Cas9-mediated integration of the
TAP tag at its C-terminus was efficient reaching 26 % (20/78, including 6 homozygous
clones) of positive clones (Figures S2 and data not shown). Purification of MBTD1 using a
homozygote clone confirmed its association with NuA4 (Figures 2J and 2K). Thus, our
approach led to the most complete characterization of native NuA4 components to date.
Not only we were able to conclusively demonstrate that EPC1 and EP400 exclusively
associate with the complex, but we also identified MBTD1 as novel subunit. These data
demonstrate that highly efficient purification of native protein complexes is achievable with
56
minimal chromosomal sequence disruption and preservation of endogenous physiological
regulation of the bait protein.
57
2Figure 2. CRISPR/Cas9-Driven Tagging of NuA4 Subunits Enables Reciprocal Tandem Affinity
Purification of the Endogenous Native Complexes
A) Schematic of the EPC1 locus, Cas9 target site, and donor construct used to insert the TAP tag to
the C terminus of the EPC1 protein. Annotated are the positions of the stop codon (TAG), the protospacer
adjacent motif (PAM) that specifies the cleavage site, and homology arms left and right (HA-L, HA-R). B)
Schematic and results of a PCR-based assay (out-out PCR) to detect targeted integration (TI) of the tag
sequence in single-cell-derived K562 clones obtained by limiting dilution. Primers are located outside of the
homology arms and are designed to yield a longer PCR product if the tag is inserted. C) Western blot showing
EPC1-tag protein expression in K562 clones. Mock indicates cells treated with donor and Cas9 nuclease in
the absence of gRNA. The FLAG M2 antibody was used to detect EPC1, and the GAPDH antibody was used
as a loading control. D) Targeting scheme for EP400, depected as in (A). E) Same as (B), but for EP400. F)
EP400 expression monitored as in (C). G) 2-fold serial dilutions of whole-cell extracts prepared from AAVS1-
EPC1/EP400 and CRISPR-EPC1/EP400 cell lines were analyzed by western blot to determine the relative
expression of EPC1-tag proteins. Error bars indicate the SD from two independently preformed experiments.
H) Silver-stained SDS-PAGE showing the purified EPC1 and EP400 complexes. Wild-type K562 cells
(Mock) and clonal cell lines expressing EPC1-tag (#112) and EP400-tag (#43) from their endogenous loci. I)
Autoradiogram showing the results of HAT assays to determine the specificity of the complexes. Coomassie
staining was used as a loading control for histones. J) Silver-stained SDS-PAGE showing the purified
MBTD1 complex. K) Western blots of selected NuA4 subunits on purified fractions. Wild-type K562 cells
(Mock). Proteins were identified from unfractionated proteins samples and assigned to specific gel bands
based on extensive western blotting analysis. See also Figures S2 and S3.
TALEN-Enabled Purification of the Endogenous Polycomb Repressive
Complex 2
To test the generality of the TAP procedure, we undertook the purification of the
enhancer of zeste homolog 2 (EZH2), the catalytic subunit of the polycomb repressive
complex 2 (PRC2) responsible for the di- and tri-methylation of histone H3 at lysine 27
(H3K27me2/3), a histone mark that correlates with silent or poorly transcribed genomic
regions (Margueron and Reinberg, 2011). EZH2 is a critical regulator of development,
controls stem cells pluripotency and differentiation, its deregulation being at the center of
58
novel therapeutic strategies for a variety of cancers (Plass et al., 2013). First, EZH2 with an
N-terminal TAP tag was targeted to the AAVS1 locus (Figure S1). Next, we replaced the
natural ATG of EZH2 with the TAP tag via homology-directed repair at the chromosomal
locus using a pair of TAL effector nucleases (TALENs) (Figures 3A and S4) (Reyon et al.,
2012). Twenty one percent (20/96, including 6 homozygous clones) of screened clones had
a tagged allele as assessed by PCR, western blotting and sequencing (Figures 3B, 3C and
S4). A homozygote clone expressing exclusively the tagged EZH2 protein was selected for
TAP. Interestingly, in this context, the endogenous locus drives higher protein expression
levels as compared to the ectopically expressed protein from the AAVS1 locus (Figure S4).
The complexes were isolated from nuclear extracts prepared from both cell lines and
analyzed by SDS-PAGE and silver staining. Both preparations appeared similar as a
specific protein band pattern could be clearly identified from the gels when compared to the
mock fractions (Figures 3D and 3E). Co-purified proteins were analyzed by mass
spectrometry leading to the unambiguous identification of all known PRC2 components
(Table S2) (Margueron and Reinberg, 2011). Sub-stoichiometric interactions between
PRC2 and the EHMT1/2 complex, a H3K9 mono- and di-methyltransferase, were also
detected in the TALEN-derived clone (Figure 3F and Table S2). The interaction is not
mediated by co-localization/co-purification on DNA since it is not sensitive to treatment
with benzonase (Figure S4). This association uncovers a direct physical link that supports
the concept of an H3K27me/H3K9me switch for the long-term repression of differentiation
genes (Mozzetta et al., 2014). It also indicates that biallelic targeting of endogenous genes,
leading to exclusive expression of the tagged bait protein in the cell, can reveal labile and
important interactions. Lastly, the purified fractions contained robust enzymatic activity as
determined by histone methyltransferase (HMT) assays (Figure 3G).
59
3Figure 3. Tandem Affinity Purification of the Native PRC2 Protein Complex
A) Schematic of the EZH2 locus, TALEN target site, and donor construct used to insert an affinity tag to
the N terminus of the EZH2 protein. Annotated are the positions of the start codon (ATG), the left and right
TALEN target sites, and homology arms left and right (HA-L, HA-R). B) Schematic results of a PCR-based
assay (out-out PCR) to detect targeted integration (TI) of the tag sequence in single-cell-derived K562 clones
obtained by limiting dilution following TALEN-driven gene targeting. Primers are located outside of the
60
homology arms and are designed to yield a longer PCR product if the tag is inserted. C) Western Blots
showing tag-EZH2 protein expression in the K562 clones. Mock indicates cells treated with donor only. The
FLAG M2 antibody was used to detect EZH2 and the actin antibody was used as a loading control. D) Silver-
stained SDS-PAGE showing the purified EZH2 complex expressed from the AAVS1 locus. K562 cells
expressing the tag (Mock) and a clonal cell line ectopically expressing tag-EZH2. E) Silver-stained SDS-
PAGA showing the purified EZH2 complex expressed from the endogenous locus. Wild-type K562 cells
(Mock) and a clonal cell line expressing tag-EZH2 (#63). Proteins were identified from unfractionated protein
samples and assigned to specific gel bands based on western blotting analysis and predicted molecular
weights. F) Western blots of selected PRC2 subunits on purified fractions shown in (D) and (E). G)
Autoradiogram showing the results of a HMT assay used to determine the specificity of the EZH2 complex.
Coomassie staining was used as a loading control hor histones. H) Binding of endogenously tagged EZH2 and
EPC1 to target gene promoters as determined by ChIP-qPCR analysis. Values are expressed as % of input
chromatin. Error bars indicate the SD from two independently performed experiments. See also Figure S4.
2Table S2, Related to Figure 3. PRC2 Complex Subunits Identified by Mass Spectrometry Analysis
Predicted molecular weights, total spectral counts and # of unique peptides for identified
proteins are indicated. AAVS1-EZH2 and TALEN-EZH2 indicate whether EZH2 was expressed
ectopically from the AAVS1 locus or from its endogenous locus, respectively.
61
Interactions Between Endogenously Tagged Chromatin Modifying Complexes
and Genomic DNA Regions
Chromatin Immunoprecipitation (ChIP) is a powerful technique used to investigate
the interaction between proteins and DNA in the cell permitting to identify the genomic
regions bound by a protein of interest. We tested if the endogenously tagged cell lines could
be used for ChIP using the well-characterized anti-FLAG M2 antibody and analyzed the
occupancy of tag-EZH2 and EPC1-tag to the HOXA9 locus and to the RPL36AL ribosomal
protein gene. We observed strong binding of EZH2 at HOXA9, a bona fide PRC2 target,
and marginal enrichment at RPL36AL (Figure 3H). In contrast, EPC1 was specifically
recruited to the highly transcribed RPL36AL gene, as expected for NuA4 (Figure 3H). The
effectiveness of ChIP assays and genome-wide location analysis currently rely on validated
antibodies to target proteins, which varies greatly. Thus, the use of a common tag added on
endogenous proteins will greatly enhance reproducibility, and importantly, enable accurate
comparison between different sets of factors in distinct growth conditions (Bradbury and
Pluckthun, 2015; Venters et al., 2011).
Purification of Endogenous DNA Repair Complexes
To further exemplify the robustness of our strategy, we extended our studies to
proteins involved in DNA repair. The Fanconi anemia (FA) core complex is a multisubunit
ubiquitin ligase that initiates DNA repair of interstrand crosslinks (Walden and Deans,
2014). Based on the work of several groups, its subunit composition has been well
established and the core was defined as containing FANCA, FANCB, FANCC, FANCE,
FANCF, FANCG, FANCL, FAAP20, and FAAP100 (Walden and Deans, 2014). However,
some variations in its architecture are observed suggesting that the complex is composed of
sub-modules (Ali et al., 2012; Rajendra et al., 2014; Walden and Deans, 2014). We
attempted to purify the FA core complex through the FANCF protein as it is suggested to
62
act as a scaffolding subunit. We tagged the N-terminus of FANCF using the CRISPR/Cas9
double nicking strategy and selected a homozygote clone expressing exclusively the tagged
FANCF protein for TAP (Ran et al., 2013) (Figures 4A-4C and S5). In this experiment, five
percent (5/96, including 2 homozygous clones) of screened clones had a tagged allele. Our
approach successfully resulted in the purification of a core complex that is highly similar to
previously reported assemblies (Figure 4D and Table S3) (Ali et al., 2012; Rajendra et al.,
2014). In addition, subunits of the anchor complex (FANCM, FAAP24 and FAAP16) were
detected with the core complex in cells under normal cycling conditions (Walden and
Deans, 2014) (Table S3). Next, we attempted to purify minichromosome maintenance
complex component 8 (MCM8), a protein evolutionarily related to members of the MCM2-
7 replicative helicase family (Maiorano et al., 2006). MCM8 has previously been shown to
promote homologous recombination via its interaction with MCM9, but it is unknown if
this association is exclusive. (Lutzmann et al., 2012; Nishimura et al., 2012; Park et al.,
2013). C-terminal tagging of MCM8 clearly revealed the strict heterodimeric nature of the
complex (Figures 5 and S5; Table S4). Taken together, these findings establish the value of
using nuclease-mediated endogenous gene tagging to refine the composition and enzymatic
activities of protein complexes and highlight the robustness of our TAP strategy.
63
4Figure 4. Tandem Affinity Purification of Endogenously Tagged Fanconi Anemia Core Complex
A) Strategy for CRISPR/Cas9-driven insertion of the TAP tag to the C terminus of the FANCF
protein. Schematic of the FANCF locus, Cas9 double nickase target sites, and donor construct. The positions
of the start codon (ATG) and protospacer adjacent motif (PAM) that specify nicking sites are shown. B)
Schematic and results of a PCR-based assay (out-out PCR) to detect targeted integration (TI) of the tag
sequence in a single-cell-derived clone obtained by limiting dilution following CRISPR/Cas9-driven gene
targeting. Primers are located outside of the homology arms and are designed to yield a longer PCR product if
the tag is inserted. C) Western blots showing tag-FANCF protein expression in K562 clones. Mock indicates
cells treated with GFP expression vector. The FLAG M2 antibody was used to detect FANCF, and the
tubuline antibody was used as a loading control. D) Silver-stained SDS-PAGE showing the purified FANCF
complex. Wild-type K562 cells (Mock) and a clonal cell line expressing tag-FANCF (#12). Proteins were
identified from unfractionated protein samples and assigned to specific gel bands based on predicted
molecular weights. See also Figure S5.
64
5Figure 5. Tandem Affinity Purification of Endogenously Tagged Minichromosome Maintenance
Complex Component 8
A) Strategy for CRISPR/Cas9-driven insertion of the TAP tag to the C terminus of the MCM8
protein. Schematic of the MCM8 locus, wild-type Cas9 target site, and donor construct. Annotated are the
positions of the stop codon (TAA), target site, and protospacer adjacent motif (PAM) that specifies the
cleavage site. B) Schematic and results of a PCR-based assay (in-out PCR) to detect targeted integration (TI)
of the tag sequence in a single-cell-derived clone obtained by limiting dilution following CRISPR/Cas9-
driven gene targeting. In the particular case, one primer is located upstream of the homology arm and one
binds the right homology arm to yield a longer PCR product if the tag is inserted. C) Western blots showing
MCM8-tag protein expression in K562 clone #75. Mock indicates cells treated with donor Cas9 nuclease in
the absence of gRNA. The FLAG M2 antibody was used to detect MCM8, and the GAPDH antibody was
used as a loading control. D) Silver-stained SDS-PAGE showing the purified MCM8 complex. Wild-type
K562 cells (Mock) and a clonal cell line expressing MCM8 tag (#75). Proteins were identified from
unfractionated protein samples and assigned to specific gel bands based on predicted molecular weights. See
also Figure S5.
65
Towards High-Throughput Genome-Scale Purification of Native Endogenous
Protein Complexes
The combined robustness of the endogenous targeting and purification methods lead
us to test whether it was possible to purify the native protein complexes from the pool of
cells shortly after transfection. If such a scheme were successful, it would offer the unique
opportunity to easily and rapidly tag all human genes at their genomic location and isolate
complexes. We transfected cells with the EP400 CRISPR/Cas9 nuclease and donor vectors
and expanded cells for 7 days before harvesting them for TAP purification (Figure 6A).
Over the course of the experiment, we monitored the presence of targeted alleles in the cell
population via PCR (Figures 6B and 6C). The EP400 complex could be efficiently purified
from whole cell extracts with all its associated subunits (Figure 6D). Then, we confirmed
this observation with the EZH2 reagents and obtained an almost pure complex 10 days post
transfection (Figures 6E-6G). It is critical to mention that no selection or cell sorting was
used to enrich for tagged cells in the population before attempting the purifications. Thus,
the requirement to generate genome-edited cell clones can be bypassed such that protein
complexes can be directly isolated from gene-modified cell pools. These data constitute a
blueprint for high-throughput genome-scale charting of physiological protein-protein
interactions in human cells.
66
6Figure 6. Efficient Complex Purification from Unselected Gene-Modified Cell Pools
A) Timeline of the experiment. B) Schematic of a PCR-based assay (out-out PCR) to detect targeted
integration (TI) of the tag sequence at the C terminus of EP400. Primers are located outside of the homology
arms and are designed to yield a longer PCR product if the tag is inserted. C) Results of an out-out PCR assay
conducted on genomic DNA from K562 cells transfected with (1) EGFP expression vector and EP400 donor
(Mock) and (2) wild-type Cas9 expression vector, gRNA #3, and EP400 donor (EP400). Cells were collected
at various time points post-transfection. D) Silver-stained SDS-PAGE showing the purified EP400 complex
isolated from the cell pool 7 days post-transfection. E) Same as in (B) but for the N-terminal tagging of
EZH2. F) Same as in (C) but using the EZH2 TALENs and donor. G) Silver-stained SDS-PAGE showing the
67
purified EZH2 complex isolated from the cell pool 10 days post-transfection. Proteins were identified from
unfractionated protein samples and assigned to specific gel bands based on western blotting analysis and
predicted molecular weights.
68
DISCUSSION
USES AND LIMITATIONS OF THE AAVS1 SAFE HARBOR ECTOPIC
EXPRESSION SYSTEM
The methods described here offer unique advantages as compared to traditional
approaches used to study protein complexes in metazoan cells. The purification strategy not
only allows the identification of associated proteins by mass spectrometry, but the purity
and yields of the preparations are sufficient to perform enzymatic and mechanistic studies
in vitro. It is worth noting that gene targeting at AAVS1 can be performed in any human
cell lines since the nuclease target site is naturally occurring as compared to the Flp-In
system that requires prior integration of a Flp Recombination Target (FRT) site into the
genome. Biosafety issues associated with the use of lentiviral vectors (Biosafety level 2
containment) are also avoided. Thus, it offers greater flexibility of use than traditional
ectopic expression systems used for proteomic analysis. Note that ZFNs, TALENs and
CRISPR/Cas9 nucleases targeting AAVS1 can be used interchangeably (Figure S1)
(Hockemeyer et al., 2009; Hockemeyer et al., 2011; Mali et al., 2013). The generation of
cell lines expressing near physiological levels of bait proteins using the AAVS1 targeting
system is straightforward and can be used to rapidly isolate a protein of interest and to
perform reciprocal purifications in order to confirm the stable association of a subunit with
a protein complex. It can also be used to generate panels of variants under isogenic settings
and for the analysis of specific splicing isoforms. As an example, the long and short
isoforms of JADE1 regulate the presence of ING4/5 tumor suppressor proteins in the
KAT7/HBO1 histone acetyltransferase complex (Figure S6) (Saksouk et al., 2009). One
can also contemplate using this system to test the function of several mutants in the
background of a cellular gene knockout. This could be especially useful for the functional
study of essential genes. In addition, it offers a surrogate to study protein fusions resulting
from complex genomic rearrangements that cannot be modeled via genome editing
currently. As these protein fusions are often “toxic” when expressed in cells, we established
a single-vector autoregulated Tet-On expression system permitting tightly controlled
inducible expression of target proteins (Figure S6). Of course, this system requires
obtaining and subcloning the cDNA of interest, which could be troublesome for very large
69
proteins. However, this does not seem to be a major limitation as we successfully purified
the EP400 complex (400 kDa) and obtained highly purified 350 kDa Ataxia telangiectasia
mutated (ATM) kinase, a critical activator of the DNA damage response that is notoriously
challenging to purify (Figure S6) (Shiloh and Ziv, 2013). Importantly, the use of standard
and characterized nucleases can minimize the risk of confounding results due to off target
mutagenesis.
ADVANTAGES AND LIMITATIONS OF ENDOGENOUS TAGGING
Seamless tagging of genes at their natural chromosomal locations preserves the
physiological regulation of the bait protein expression, and of its splicing variants. Since
the epitope tag inserted is of very small size and is not linked to a drug resistance gene or
other extraneous elements, natural 5’ and 3’ UTR are minimally perturbed and no sequence
is lost. Cis-acting regulatory elements are maintained within (introns) and outside
(promoters/enhancers) transcribed regions. Thus, native regulatory mechanisms of protein
expression are retained and the impact of various stimuli that modulate isoform ratios and
interactors can be more precisely studied. Current limitations linked to constitutive
overexpression of bait proteins leading to higher rates of false positive and negative
interactions are therefore avoided. As examples, our approach settled the score on the
KAT5 and EP400 enzymatic activities, clearly establishing them as part of a single stable
macromolecular assembly in vivo. Moreover, this approach led to the identification of
MBTD1 as a novel subunit of NuA4. It also demonstrates a direct physical link, in solution,
between H3K27 and H3K9 histone methyltransferases, an interaction previously suggested
to occur only through colocalization on the genome during development (Alekseyenko et
al., 2014). Histone and residue specificity of chromatin modifying enzymes has been
marred on multiple occasions over the years by several conflicting and debated results in
the literature. Still today, the specificity of many enzymes is up to interpretation. We feel
that our approach using endogenous activities along with native substrates will lead to a
more coherent picture helping us to better understand the dynamic nature of the epigenome
during development and disease (Lalonde et al., 2014).
70
The wide availability of research reagents for CRISPR/Cas9 and TALENs greatly
facilitates the design and construction of custom reagents. All nuclease-based reagents
described here were obtained from the plasmid repository Addgene. We provide detailed
examples of donor design (Figures S2, S4 and S5) in order to facilitate the implementation
and adaptation of the strategy to user-specific contexts. The use of short homology arms
facilitates the construction of donor vectors as they can be synthesized as DNA fragments
smaller than 1 kb in length. For sequences that are AT or GC rich, PCR-based amplification
of the homology arms might be required. Potential problems can be encountered if highly
repetitive elements are found in proximity of the ATG or STOP codons, in which cases, the
length of the arms should be truncated to avoid the presence of repeats in the donor.
However, this is not essential as the MCM8 donor described in this study contains
repetitive elements and successful targeting was achieved. Apart from strict biochemical
considerations, one should take into account the structure of the gene, the various protein
isoforms produced and adjacent genetic elements when choosing to tag either the 5’ or 3’
end of genes.
A sensible preoccupation with genome editing techniques is the possibility of off-
target mutagenesis. In our experiments we used TALENs, wild-type Cas9 and Cas9 D10A
(dual nickase) interchangeably and did not observe overt toxicity or loss of targeted cells.
Continuing progress in the field aiming to increase the precision of genome editing should
progressively decrease the risk of obtaining confounding results. However, we note that the
targeting specificity for the TAP tag using circular DNA donors benefits from the fact that
homology-directed repair (HDR) mechanisms are required for integration of donor
sequences. Thus, random integration of the donor is minimal because there are no
homologous sequences at these potential off-targets. Nevertheless, on-target mutagenesis
via non-homologous end joining (NHEJ) can result in small insertions and deletions
(indels) at the non-targeted allele and care should be taken to carefully genotype both
tagged and untagged alleles in clonally-derived cells lines (see Figures S3 and S5 for
examples). We note that it is possible to design the targeting strategy to minimize the
71
potential impact of such mutagenic events (see Figures S2, S4 and S5). In this study, we
used clones with biallelic integrations of the TAP tag when possible. This has an additional
advantage as all molecules of the bait proteins are tagged in the cell.
Lastly, our data suggest that high-throughput characterization of protein-protein
interactions under physiological conditions is achievable since protein complexes can be
efficiently purified from mixed cell populations containing only a fraction of tagged alleles
(Figure 6). As genome-scale CRISPR-Cas9 knockout screening in human cells is now a
reality (Shalem et al., 2014; Wang et al., 2014), it will be possible to adapt these methods to
generate nucleases targeting either the N- or C-terminus of every human proteins. Thus, a
genome-scale proteomic approach of endogenous human proteins using this strategy seems
imminently feasible.
72
REFERENCES
Abmayr, S.M., Yao, T., Parmely, T., and Workman, J.L. (2006). Preparation of
nuclear and cytoplasmic extracts from mammalian cells. Curr Protoc Mol Biol Chapter 12,
Unit 12 11.
Alberts, B. (1998). The cell as a collection of protein machines: preparing the next
generation of molecular biologists. Cell 92, 291-294.
Alekseyenko, A.A., Gorchakov, A.A., Kharchenko, P.V., and Kuroda, M.I. (2014).
Reciprocal interactions of human C10orf12 and C17orf96 with PRC2 revealed by BioTAP-
XL cross-linking and affinity purification. Proc Natl Acad Sci U S A 111, 2488-2493.
Ali, A.M., Pradhan, A., Singh, T.R., Du, C., Li, J., Wahengbam, K., Grassman, E.,
Auerbach, A.D., Pang, Q., and Meetei, A.R. (2012). FAAP20: a novel ubiquitin-binding
FA nuclear core-complex protein required for functional integrity of the FA-BRCA DNA
repair pathway. Blood 119, 3285-3294.
Behrends, C., Sowa, M.E., Gygi, S.P., and Harper, J.W. (2010). Network
organization of the human autophagy system. Nature 466, 68-76.
Bradbury, A., and Pluckthun, A. (2015). Reproducibility: Standardize antibodies
used in research. Nature 518, 27-29.
Cai, Y., Jin, J., Florens, L., Swanson, S.K., Kusch, T., Li, B., Workman, J.L.,
Washburn, M.P., Conaway, R.C., and Conaway, J.W. (2005). The mammalian YL1 protein
is a shared subunit of the TRRAP/TIP60 histone acetyltransferase and SRCAP complexes.
The Journal of biological chemistry 280, 13665-13670.
Consortium, E.P. (2012). An integrated encyclopedia of DNA elements in the
human genome. Nature 489, 57-74.
DeKelver, R.C., Choi, V.M., Moehle, E.A., Paschon, D.E., Hockemeyer, D.,
Meijsing, S.H., Sancak, Y., Cui, X., Steine, E.J., Miller, J.C., et al. (2010). Functional
genomics, proteomics, and regulatory DNA analysis in isogenic settings using zinc finger
nuclease-driven transgenesis into a safe harbor locus in the human genome. Genome
research 20, 1133-1142.
Doyon, J.B., Zeitler, B., Cheng, J., Cheng, A.T., Cherone, J.M., Santiago, Y., Lee,
A.H., Vo, T.D., Doyon, Y., Miller, J.C., et al. (2011). Rapid and efficient clathrin-mediated
endocytosis revealed in genome-edited mammalian cells. Nat Cell Biol 13, 331-337.
73
Doyon, Y., Cayrou, C., Ullah, M., Landry, A.J., Cote, V., Selleck, W., Lane, W.S.,
Tan, S., Yang, X.J., and Cote, J. (2006). ING tumor suppressor proteins are critical
regulators of chromatin acetylation required for genome expression and perpetuation. Mol
Cell 21, 51-64.
Doyon, Y., Selleck, W., Lane, W.S., Tan, S., and Cote, J. (2004). Structural and
functional conservation of the NuA4 histone acetyltransferase complex from yeast to
humans. Mol Cell Biol 24, 1884-1896.
Fuchs, M., Gerber, J., Drapkin, R., Sif, S., Ikura, T., Ogryzko, V., Lane, W.S.,
Nakatani, Y., and Livingston, D.M. (2001). The p400 complex is an essential E1A
transformation target. Cell 106, 297-307.
Gavin, A.C., Aloy, P., Grandi, P., Krause, R., Boesche, M., Marzioch, M., Rau, C.,
Jensen, L.J., Bastuck, S., Dumpelfeld, B., et al. (2006). Proteome survey reveals modularity
of the yeast cell machinery. Nature 440, 631-636.
Gavin, A.C., Maeda, K., and Kuhner, S. (2011). Recent advances in charting
protein-protein interaction: mass spectrometry-based approaches. Current opinion in
biotechnology 22, 42-49.
Goudreault, M., D'Ambrosio, L.M., Kean, M.J., Mullin, M.J., Larsen, B.G.,
Sanchez, A., Chaudhry, S., Chen, G.I., Sicheri, F., Nesvizhskii, A.I., et al. (2009). A PP2A
phosphatase high density interaction network identifies a novel striatin-interacting
phosphatase and kinase complex linked to the cerebral cavernous malformation 3 (CCM3)
protein. Molecular & cellular proteomics : MCP 8, 157-171.
Guruharsha, K.G., Rual, J.F., Zhai, B., Mintseris, J., Vaidya, P., Vaidya, N.,
Beekman, C., Wong, C., Rhee, D.Y., Cenaj, O., et al. (2011). A protein complex network
of Drosophila melanogaster. Cell 147, 690-703.
Hegemann, B., Hutchins, J.R., Hudecz, O., Novatchkova, M., Rameseder, J.,
Sykora, M.M., Liu, S., Mazanek, M., Lenart, P., Heriche, J.K., et al. (2011). Systematic
phosphorylation analysis of human mitotic protein complexes. Science signaling 4, rs12.
Ho, Y., Gruhler, A., Heilbut, A., Bader, G.D., Moore, L., Adams, S.L., Millar, A.,
Taylor, P., Bennett, K., Boutilier, K., et al. (2002). Systematic identification of protein
complexes in Saccharomyces cerevisiae by mass spectrometry. Nature 415, 180-183.
Hockemeyer, D., Soldner, F., Beard, C., Gao, Q., Mitalipova, M., DeKelver, R.C.,
Katibah, G.E., Amora, R., Boydston, E.A., Zeitler, B., et al. (2009). Efficient targeting of
expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nature
biotechnology 27, 851-857.
74
Hockemeyer, D., Wang, H., Kiani, S., Lai, C.S., Gao, Q., Cassady, J.P., Cost, G.J.,
Zhang, L., Santiago, Y., Miller, J.C., et al. (2011). Genetic engineering of human
pluripotent cells using TALE nucleases. Nature biotechnology 29, 731-734.
Hsu, P.D., Lander, E.S., and Zhang, F. (2014). Development and applications of
CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278.
Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V.,
Li, Y., Fine, E.J., Wu, X., Shalem, O., et al. (2013). DNA targeting specificity of RNA-
guided Cas9 nucleases. Nature biotechnology 31, 827-832.
Hutchins, J.R., Toyoda, Y., Hegemann, B., Poser, I., Heriche, J.K., Sykora, M.M.,
Augsburg, M., Hudecz, O., Buschhorn, B.A., Bulkescher, J., et al. (2010). Systematic
analysis of human protein complexes identifies chromosome segregation proteins. Science
328, 593-599.
Huttlin, E.L., Ting, L., Bruckner, R.J., Gebreab, F., Gygi, M.P., Szpyt, J., Tam, S.,
Zarraga, G., Colby, G., Baltier, K., et al. (2015). The BioPlex Network: A Systematic
Exploration of the Human Interactome. Cell 162, 425-440.
Ikura, T., Ogryzko, V.V., Grigoriev, M., Groisman, R., Wang, J., Horikoshi, M.,
Scully, R., Qin, J., and Nakatani, Y. (2000). Involvement of the TIP60 histone acetylase
complex in DNA repair and apoptosis. Cell 102, 463-473.
Joung, J.K., and Sander, J.D. (2013). TALENs: a widely applicable technology for
targeted genome editing. Nat Rev Mol Cell Biol 14, 49-55.
Krogan, N.J., Cagney, G., Yu, H., Zhong, G., Guo, X., Ignatchenko, A., Li, J., Pu,
S., Datta, N., Tikuisis, A.P., et al. (2006). Global landscape of protein complexes in the
yeast Saccharomyces cerevisiae. Nature 440, 637-643.
Krogan, N.J., Lippman, S., Agard, D.A., Ashworth, A., and Ideker, T. (2015). The
Cancer Cell Map Initiative: Defining the Hallmark Networks of Cancer. Mol Cell 58, 690-
698.
Lalonde, M.E., Cheng, X., and Cote, J. (2014). Histone target selection within
chromatin: an exemplary case of teamwork. Genes Dev 28, 1029-1041.
Lawrence, M.S., Stojanov, P., Mermel, C.H., Robinson, J.T., Garraway, L.A.,
Golub, T.R., Meyerson, M., Gabriel, S.B., Lander, E.S., and Getz, G. (2014). Discovery
and saturation analysis of cancer genes across 21 tumour types. Nature 505, 495-501.
75
Leiserson, M.D., Vandin, F., Wu, H.T., Dobson, J.R., Eldridge, J.V., Thomas, J.L.,
Papoutsaki, A., Kim, Y., Niu, B., McLellan, M., et al. (2015). Pan-cancer network analysis
identifies combinations of rare somatic mutations across pathways and protein complexes.
Nature genetics 47, 106-114.
Lombardo, A., Cesana, D., Genovese, P., Di Stefano, B., Provasi, E., Colombo,
D.F., Neri, M., Magnani, Z., Cantore, A., Lo Riso, P., et al. (2011). Site-specific integration
and tailoring of cassette design for sustainable gene transfer. Nature methods 8, 861-869.
Lutzmann, M., Grey, C., Traver, S., Ganier, O., Maya-Mendoza, A., Ranisavljevic,
N., Bernex, F., Nishiyama, A., Montel, N., Gavois, E., et al. (2012). MCM8- and MCM9-
deficient mice reveal gametogenesis defects and genome instability due to impaired
homologous recombination. Mol Cell 47, 523-534.
Maiorano, D., Lutzmann, M., and Mechali, M. (2006). MCM proteins and DNA
replication. Curr Opin Cell Biol 18, 130-136.
Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E.,
and Church, G.M. (2013). RNA-guided human genome engineering via Cas9. Science 339,
823-826.
Marcon, E., Ni, Z., Pu, S., Turinsky, A.L., Trimble, S.S., Olsen, J.B., Silverman-
Gavrila, R., Silverman-Gavrila, L., Phanse, S., Guo, H., et al. (2014). Human-chromatin-
related protein interactions identify a demethylase complex required for chromosome
segregation. Cell reports 8, 297-310.
Margueron, R., and Reinberg, D. (2011). The Polycomb complex PRC2 and its
mark in life. Nature 469, 343-349.
Mozzetta, C., Pontis, J., Fritsch, L., Robin, P., Portoso, M., Proux, C., Margueron,
R., and Ait-Si-Ali, S. (2014). The histone H3 lysine 9 methyltransferases G9a and GLP
regulate polycomb repressive complex 2-mediated gene silencing. Mol Cell 53, 277-289.
Musselman, C.A., Avvakumov, N., Watanabe, R., Abraham, C.G., Lalonde, M.E.,
Hong, Z., Allen, C., Roy, S., Nunez, J.K., Nickoloff, J., et al. (2012). Molecular basis for
H3K36me3 recognition by the Tudor domain of PHF1. Nat Struct Mol Biol 19, 1266-1272.
Nishimura, K., Ishiai, M., Horikawa, K., Fukagawa, T., Takata, M., Takisawa, H.,
and Kanemaki, M.T. (2012). Mcm8 and Mcm9 form a complex that functions in
homologous recombination repair induced by DNA interstrand crosslinks. Mol Cell 47,
511-522.
76
Park, J., Long, D.T., Lee, K.Y., Abbas, T., Shibata, E., Negishi, M., Luo, Y.,
Schimenti, J.C., Gambus, A., Walter, J.C., et al. (2013). The MCM8-MCM9 complex
promotes RAD51 recruitment at DNA damage sites to facilitate homologous
recombination. Mol Cell Biol 33, 1632-1644.
Park, J.H., Sun, X.J., and Roeder, R.G. (2010). The SANT domain of p400 ATPase
represses acetyltransferase activity and coactivator function of TIP60 in basal p21 gene
expression. Mol Cell Biol 30, 2750-2761.
Plass, C., Pfister, S.M., Lindroth, A.M., Bogatyrova, O., Claus, R., and Lichter, P.
(2013). Mutations in regulators of the epigenome and their connections to global chromatin
patterns in cancer. Nature reviews. Genetics 14, 765-780.
Rajendra, E., Oestergaard, V.H., Langevin, F., Wang, M., Dornan, G.L., Patel, K.J.,
and Passmore, L.A. (2014). The genetic and biochemical basis of FANCD2
monoubiquitination. Mol Cell 54, 858-869.
Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E.,
Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., et al. (2013). Double nicking by RNA-
guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380-1389.
Reyon, D., Tsai, S.Q., Khayter, C., Foden, J.A., Sander, J.D., and Joung, J.K.
(2012). FLASH assembly of TALENs for high-throughput genome editing. Nature
biotechnology 30, 460-465.
Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B.
(1999). A generic protein purification method for protein complex characterization and
proteome exploration. Nature biotechnology 17, 1030-1032.
Rolland, T., Tasan, M., Charloteaux, B., Pevzner, S.J., Zhong, Q., Sahni, N., Yi, S.,
Lemmens, I., Fontanillo, C., Mosca, R., et al. (2014). A proteome-scale map of the human
interactome network. Cell 159, 1212-1226.
Saksouk, N., Avvakumov, N., Champagne, K.S., Hung, T., Doyon, Y., Cayrou, C.,
Paquet, E., Ullah, M., Landry, A.J., Cote, V., et al. (2009). HBO1 HAT complexes target
chromatin throughout gene coding regions via multiple PHD finger interactions with
histone H3 tail. Mol Cell 33, 257-265.
Sardiu, M.E., Cai, Y., Jin, J., Swanson, S.K., Conaway, R.C., Conaway, J.W.,
Florens, L., and Washburn, M.P. (2008). Probabilistic assembly of human protein
interaction networks from label-free quantitative proteomics. Proceedings of the National
Academy of Sciences of the United States of America 105, 1454-1459.
77
Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S.,
Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G., et al. (2014). Genome-scale CRISPR-
Cas9 knockout screening in human cells. Science 343, 84-87.
Shiloh, Y., and Ziv, Y. (2013). The ATM protein kinase: regulating the cellular
response to genotoxic stress, and more. Nat Rev Mol Cell Biol 14, 197-210.
Sowa, M.E., Bennett, E.J., Gygi, S.P., and Harper, J.W. (2009). Defining the human
deubiquitinating enzyme interaction landscape. Cell 138, 389-403.
Sternberg, S.H., and Doudna, J.A. (2015). Expanding the Biologist's Toolkit with
CRISPR-Cas9. Mol Cell 58, 568-574.
Steunou, A.L., Rossetto, D., and Côté, J. (2014). Regulating Chromatin by Histone
Acetylation. In Fundamentals of Chromatin Workman, J.L., Abmayr, S.M., ed. (Springer-
Verlag New York), 147-212.
Tsai, S.Q., Wyvekens, N., Khayter, C., Foden, J.A., Thapar, V., Reyon, D.,
Goodwin, M.J., Aryee, M.J., and Joung, J.K. (2014). Dimeric CRISPR RNA-guided FokI
nucleases for highly specific genome editing. Nature biotechnology 32, 569-576.
Tyteca, S., Vandromme, M., Legube, G., Chevillard-Briet, M., and Trouche, D.
(2006). Tip60 and p400 are both required for UV-induced apoptosis but play antagonistic
roles in cell cycle progression. EMBO J 25, 1680-1689.
Urnov, F.D., Rebar, E.J., Holmes, M.C., Zhang, H.S., and Gregory, P.D. (2010).
Genome editing with engineered zinc finger nucleases. Nature reviews. Genetics 11, 636-
646.
Van Leene, J., Hollunder, J., Eeckhout, D., Persiau, G., Van De Slijke, E., Stals, H.,
Van Isterdael, G., Verkest, A., Neirynck, S., Buffel, Y., et al. (2010). Targeted
interactomics reveals a complex core cell cycle machinery in Arabidopsis thaliana.
Molecular systems biology 6, 397.
Venters, B.J., Wachi, S., Mavrich, T.N., Andersen, B.E., Jena, P., Sinnamon, A.J.,
Jain, P., Rolleri, N.S., Jiang, C., Hemeryck-Walsh, C., et al. (2011). A comprehensive
genomic binding map of gene and chromatin regulatory proteins in Saccharomyces. Mol
Cell 41, 480-492.
Vogelstein, B., Papadopoulos, N., Velculescu, V.E., Zhou, S., Diaz, L.A., Jr., and
Kinzler, K.W. (2013). Cancer genome landscapes. Science 339, 1546-1558.
78
Walden, H., and Deans, A.J. (2014). The Fanconi anemia DNA repair pathway:
structural and functional insights into a complex disorder. Annu Rev Biophys 43, 257-278.
Wang, T., Wei, J.J., Sabatini, D.M., and Lander, E.S. (2014). Genetic screens in
human cells using the CRISPR-Cas9 system. Science 343, 80-84.
Weber, C.M., and Henikoff, S. (2014). Histone variants: dynamic punctuation in
transcription. Genes Dev 28, 672-682.
79
SUPPLEMENTAL EXPERIMENTAL PROCEDURES
Surveyor nuclease (Cel-1) assay and Out-Out PCR
Genomic DNA from 2.5E5 cells was extracted with 250 μl of QuickExtract DNA
extraction solution (Epicentre) per manufacturer's recommendations. Cel-1 assays were
performed with the Surveyor mutation detection kit (Transgenomics) according to the
manufacturer’s protocol, with the exception that the reactions were incubated for 20 min at
42°C without enhancing solution. Samples were separated on 10% PAGE gels in TBE
buffer. To detect the targeted integration of the TAP tag, genomic DNA was subjected to
30 cycles of PCR using the Phusion polymerase (Thermo Scientific) and reactions were
loaded on 1% agarose gels in TAE buffer. Primer sequences are shown in Table S1.
Western blot
Antibodies to Flag M2 (A8592, Sigma), Tubulin (DM1A, Santa Cruz), TRRAP
(SC5405, Santa Cruz), BRD8 (A300-219A, Bethyl), TIP60 (S2475, Epitomic), MRG15
(39361, Actif Motif), EHMT2 (ab183889, Abcam), SUZ12 (3737, Cell signaling), GAPDH
(1OR-G109a, Fitzgerald), and beta-Actin (TLC 002.100, BioShop) were used.
Chromatin Immunoprecipitation assays (ChIP)
ChIP assays were performed as previously described [186]. Briefly, 1 mg of
chromatin was sonicated to fragments of ~500 bp and immunoprecipitated using 10 ug of
FLAG M2 antibodies (F3165, Sigma), or an irrelevant IgG antibody (pp64K, Millipore)
and recovered using protein A/G magnetic beads. The precipitated DNA was amplified by
real-time qPCR, using primer sets designed to amplify regions of the RPL36AL and
HOXA9 genes. qRT-PCR primers: RPL36AL 5’-CCATGCCTGAGACCTTTTTC-3’ and
5’-TGCTCAGAATCCTGGGTAGG-3’ HOXA9 5’-TGCCTTTCCTAACCAGTTCAGC-
80
3’ and 5’-CGGGCAGAAGACGCACATCCCG-3’. ChIP data are shown as % of input
chromatin signal. Data presented is based on 2 biological replicates.
Sample preparation for mass spectrometry analysis
Preparative gels (12% NuPAGE Bis-Tris) for tandem mass spectrometry were run
over 1 cm to stack all proteins into 1 band and stained with Sypro Ruby (Bio-Rad). The gel
slice was digested with trypsin on a MassPrep liquid handling robot (Waters) according to
the manufacturer’s specifications. Briefly, proteins were reduced with 10 mM DTT and
alkylated with 55 mM iodoacetamide. Trypsin digestion was performed using 126 nM of
modified porcine trypsin (Sequencing grade, Promega) at 37°C for 18 h. Digestion products
were extracted using 1% formic acid, 2% acetonitrile followed by 1% formic acid, 50%
acetonitrile. The recovered extracts were pooled, vacuum centrifuge dried and then
resuspended into 15 ul of 2% acetonitrile, 0.05% trifluoroacetic acid and 5 ul were analyzed
by mass spectrometry.
Proteins identification by mass spectrometry
The analyses were performed at the proteomic platform of the Quebec Genomics
Center. Peptide samples were separated by online reversed-phase (RP) nanoscale capillary
liquid chromatography (nanoLC) and analyzed by electrospray mass spectrometry (ESI
MS/MS). The experiments were performed with a Dionex UltiMate 3000 nanoRSLC
chromatography system (Thermo Fisher Scientific) connected to an Orbitrap Fusion mass
spectrometer (Thermo Fisher Scientific) equipped with a nanoelectrospray ion source.
Peptides were trapped at 20 ul / min in loading solvent (2% acetonitrile, 0.05% TFA) on a
5mm x 300 μm C18 pepmap cartridge pre-column (Thermo Fisher Scientific) during 5
minutes. Then, the pre-column was switch online with a self-made 50 cm x 75 um internal
diameter separation column packed with ReproSil-Pur C18-AQ 3-μm resin (Dr. Maisch
HPLC) and the peptides were eluted with a linear gradient from 5-40% solvent B (A: 0,1%
formic acid, B: 80% acetonitrile, 0.1% formic acid) in 60 minutes, at 300 nL/min. Mass
81
spectra were acquired using a data dependent acquisition mode using Thermo XCalibur
software version 3.0.63. Full scan mass spectra (350 to 1800m/z) were acquired in the
orbitrap using an AGC target of 4e5, a maximum injection time of 50 ms and a resolution
of 120 000. Internal calibration using lock mass on the m/z 445.12003 siloxane ion was
used. Each MS scan was followed by acquisition of fragmentation spectra of the most
intense ions for a total cycle time of 3 seconds (top speed mode). The selected ions were
isolated using the quadrupole analyzer in a window of 1.6 m/z and fragmented by Higher
energy Collision-induced Dissociation (HCD) with 35% of collision energy. The resulting
fragments were detected by the linear ion trap in rapid scan rate with an AGC target of 1E4
and a maximum injection time of 50ms. Dynamic exclusion of previously fragmented
peptides was set for a period of 20 sec and a tolerance of 10 ppm.
For database searching, all MS/MS peak lists (MGF files) were generated using
Thermo Proteome Discoverer version 1.4.0.288 (Thermo Fisher). MGF sample files were
then analyzed using Mascot version 2.4.0 (Matrix Science). Mascot was set up to search the
UniprotKB Homo Sapiens database (release 11/2014, 162831 sequences) assuming the
digestion enzyme trypsin. Mascot was searched with a fragment ion mass tolerance of 0.6
Da and a parent ion tolerance of 10 ppm. Oxidation of methionine and deamidation of
asparagine and glutamine were specified as a variable modifications and
carbamidomethylation as fixed modification. Two missed cleavages were allowed.
Scaffold (version 4.0.1), Proteome Software Inc., Portland, OR) was used to
validate MS/MS based peptide and protein identifications. Proteins/peptides FDR rate was
set to 1% or less based on decoy database searching. The Protein Prophet algorithm
assigned protein probabilities. Proteins that contained similar peptides and could not be
differentiated based on MS/MS analysis alone were grouped to satisfy the principles of
parsimony.
82
Gene CEL1 primers
EPC1 R: GAGCATTGCTGTCAAGTCCCF:
TGATGGTAATGTAGTTGACTGTGG
P400 R: AAAGCACTACATGCTCACAAAGA
F: CAGCAGGTGCAGATGATCC
EZH2 R: TTCCATTATGCCTTGCTACTG
F: CAAAGACTGATTAATGTGCATGG
Gene Out-Out PCR primers
EPC1 R: CCAAGGAGTCCACAGCTACC
F: AAGCCTGACACAAATCTCAGT
P400 R: AAGACCACGAGGCATTTTTC
F: CTCTCACCCTTTTCCCAAGA
MBTD1 R: GCGGATCACAAGGTCAAGAG
F: CCCACCTGAAAAATCTGGAA
EZH2 R: CGATTGCCATCCTTTCTTTG
F: GTGGCACAAGAGGCAAAAAT
FANCF R: CAGATAGACAGGAGACAGCGC
F: GAGCGTTTCCTCACGTCACAG
MCM8* R: ACTTTTGGGACATCATTTTTCAGAG
F: CAACAGGTCAACAGCGAAAA
Primers Used for the CEL1 and out-out PCR Assays * Due to the presence of
highly repetitive sequences in the 3’ UTR and the use of a long (979bp) right homology
arm, the detection of integration was performed via « in-out » PCR (the reverse primer
binds into the homology arm).
Supplemental References
Musselman, C.A., Avvakumov, N., Watanabe, R., Abraham, C.G., Lalonde, M.E.,
Hong, Z., Allen, C., Roy, S., Nunez, J.K., Nickoloff, J., et al. (2012). Molecular basis for
H3K36me3 recognition by the Tudor domain of PHF1. Nat Struct Mol Biol 19, 1266-1272.
83
SUPPLEMENTAL INFORMATION
7Figure S1. Related to Figure 1. Determination of the Optimal Purification Steps for TAP and Protein
Expression in Single Cell-Derived Clones After ZFN / CRISPR-Driven Gene Addition to the AAVS1 Locus
A) Purification Scheme from total cell extracts. B) Silver stained SDS-PAGE showing the distinct
steps of purification of the KAT5 histone acetyltransferase complex. K562 cells expressing the tag (Mock)
and two pools of cells expressing KAT5-tag (KAT pool #1 and #2). C) Western blots showing tag-EZH2
protien expression in K562 clones obtained by simultaneous selection and cloning of cells in methylcellulose-
based semi-solid medium containing puromycin following ZFN-driven gene targeting. Also shown is a
sample from a pool of cells selected in suspension culture. D) Same as in C but using CRISPR system. The
FLAG M2 antibody was used to detect EZH2 and the tubulin antibody was used as a loading control.
84
85
8Figure S2, Related to Figure 2. Strategy for CRISPR/Cas9-Driven Insertion of the TAP Tag to the C-
Terminus of the EPC1, EP400 and MBTD1 Proteins
A) Schematic of the EPC1 locus, wild-type Cas9 target site, and donor construct. Annotated are the
positions of the stop codon (TAG), the target site, and the protospacer adjacent motif (PAM) that specifies the
cleavage site. The 3’ end of the left homology arm (HA-L) starts just before the STOP and the 5’ end of the
right homology arm (HA-R) starts after the STOP. Note that in this case, the STOP codon in the donor was
changed from TAG to TGA to reduce the possibility of cleavage by the CRISPR/Cas9 enzyme. This way, the
donor sequence contains a truncated target sequence of just 11 bp, which should be sufficient to prevent DSB
formation in the episomal donor and in the chromosome after targeted integration of the tag. We avoid
repetitive sequences in HA-L and HA-R. The optimal guide RNA is selected based on several criteria; (i) high
activity based on CEL1 assay, (ii) induction of DSB in proximity to the STOP codon, (iii) option to prevent
donor cleavage (see above) and, if possible, (iv) cleavage in the 3’ UTR of the gene to prevent NHEJ-
mediated mutagenesis of the coding sequence of the untargeted allele. B) Same as A, but for the EP400 locus.
In this case, the donor sequence contains a truncated target sequence of just 9 bp, which should be sufficient
to prevent DSB formation in the episomal donor and in the chromosome after targeted integration of the tag.
It was not possible to select a cleavage site in the 3’ UTR of the gene to prevent NHEJ-mediated mutagenesis
of the coding sequence of the untargeted allele. C) Same as A, but for the MBTD1 locus. In this case, the
donor sequence contains a truncated target sequence of just 5 bp, which should be sufficient to prevent DSB
formation in the episomal donor and in the chromosome after targeted integration of the tag. It was not
possible to select a cleavage site in the 3’ UTR of the gene to prevent NHEJ-mediated mutagenesis of the
coding sequence of the untargeted allele.
86
9Figure S3, Related to Figure 2. CRISPR/Cas9-Driven Insertion of the TAP Tag to the C-Terminus of the
EPC1 and EP400 Proteins
A) Result of a CEL1 assay at EPC1 to determine the frequency of CRISPR/Cas9-induced indels,
conducted on genomic DNA from K562 cells collected 3 days posttransfection with the indicated guide
RNAs. Arrows denote specific cleavage products. B) Schematic of a PCR-based assay (Out-Out PCR) to
detect targeted integration (TI) of the tag sequence. Primers are located outside of the homology arms and are
designed to yield a longer PCR product if the tag is inserted. C) Results of a out-out PCR assay conducted on
genomic DNA from K562 cells transfected with (i) wild-type Cas9 expression vector and EPC1 donor (Mock)
and (ii) wild-type Cas9 expression vector, gRNA #1 and EPC1 donor (Nuclease + Donor). Cells were
collected 3 days post-transfection. D) Same as in C, but on single-cell derived clones. E) Sequencing of the
untargeted allele reveals a CRISPR-Cas9 induced deletion in the 3’ UTR of EPC1. F) Two-fold serial
dilutions of whole cell extracts prepared from AAVS1-EPC1 and CRISPR-EPC1 cell lines were analyzed by
western blot to determine the relative expression of EPC1-tag proteins. The FLAG M2 antibody was used to
detect EPC1-tag and the GAPDH antibody was used as a loading control. ImageJ was used for quantification.
G) Silver stained SDS-PAGE showing the EPC1 complex obtained from the endogenous (CRISPR) and the
AAVS1 loci. Eluted fractions (E1, E2). (H, I, J, K) Same as in A, C, D, F but for EP400.
87
10Figure S4, Related to Figure 3. TALEN-Driven Insertion of the TAP Tag to the N-Terminus of the
EZH2 Protein
A) Strategy for TALEN-Driven Insertion of the TAP Tag to the N-Terminus of the EZH2 Protein.
Schematic of the EZH2 locus, TALEN target sites, and donor construct. The position of the start codon
(ATG) is shown. The 3’ end of the left homology arm (HA-L) starts just before the ATG and the 5’ end of the
right homology arm (HA-R) starts after the ATG. A Kozak consensus sequence was placed upstream of the
tag sequence for efficient translation initiation at this site. Note that in this case, the TALEN binding sites are
separated by the tag sequence in the donor, which should be sufficient to prevent DSB formation in the
episomal donor and in the chromosome after targeted integration of the tag. We avoid repetitive sequences in
HA-L and HA-R. B) Result of a CEL1 assay to determine the frequency of TALEN-induced indels,
conducted on genomic DNA from K562 cells collected 3 days posttransfection. Arrows denote specific
cleavage products. C) Results of a out-out PCR assay conducted on genomic DNA from K562 cells
transfected with (i) EZH2 donor (Mock) and (ii) TALENs plus EZH2 donor (Nuclease + Donor). Cells were
collected 3 days post-transfection. D) Two-fold serial dilutions of whole cell extracts prepared from AAVS1-
EZH2 and TALEN-EZH2 (#63) cell lines were analyzed by western blot to determine the relative expression
of tag-EZH2 proteins. The FLAG M2 antibody was used to detect tag-EZH2 and the actin antibody was used
as a loading control. E) The relative density (intensity) of the various bands on the films were compared using
88
the software ImageJ (http://rsb.info.nih.gov/ij/index.html) and expression was normalized to the levels
obtained in the AAVS1 cell line. F) Benzonase treatment does not prevent interaction between PCR2 and
EHMT1/2 complexes. Purified fractions were diluted to 50 mM KCL in presence of MgCl2 and incubated at
4o C for 5 hours with 12,5 U of benzonase. Treated fractions were then immunoprecipitated O/N with anti-
FLAG beads, washed, and analyzed by western blot.
89
11Figure S5, Related to Figures 4 and 5. Strategy for CRISPR/Cas9-Driven Insertion of the TAP Tag to
the N-Terminus of FANCF and to the C-Terminus of MCM8
A) Schematic of the FANCF locus, Cas9 double nickase target sites, and donor construct. The position of
the start codon (ATG) and the protospacer adjacent motifs (PAM) that specify the nicking sites are shown.
The 3’ end of the left homology arm (HA-L) starts just before the ATG and the 5’ end of the right homology
arm (HA-R) starts after the ATG. A Kozak consensus sequence was placed upstream of the tag sequence for
efficient translation initiation at this site. Note that in this case, the nicking sites are separated by the tag
sequence in the donor, which should be sufficient to prevent DSB formation in the episomal donor and in the
chromosome after targeted integration of the tag. We avoid repetitive sequences in HA-L and HA-R. B)
Schematic of the MCM8 locus, wild-type Cas9 target site, and donor construct. Annotated are the positions of
the stop codon (TAA), the target site, and the protospacer adjacent motif (PAM) that specifies the cleavage
site. The 3’ end of the left homology arm (HA-L) starts just before the STOP and the 5’ end of the right
homology arm (HA-R) starts after the STOP. Note that in this case, the donor contains 2 stop codons and a
XhoI site upstream of the right homology arm. This way, the donor contains a truncated target sequence of
just 1 bp, which should be sufficient to prevent DSB formation in the episomal donor and in the chromosome
after targeted integration of the tag. This specific donor has longer homology arms of 782 and 979 bp that
90
were amplified from genomic DNA and contains repetitive sequences as opposed to other donors used in this
study. C) Sequencing of the untargeted MCM8 allele in the #75 MCM8-Tag cell line reveals a CRISPR-Cas9
induced 7 bp deletion introducing a frameshift at the C-terminus of MCM8. D) Alignment of the wild-type
and predicted MCM8 mutant protein.
91
92
12Figure S6, Related to Figure 1. Tandem-Affinity Purification (TAP) of JADE1L, JADE1S, and the
ATM kinase along with the Presentation of the Auto-Regulated Tet-On 3G System.
A) Silver stained SDS-PAGE showing the purified JADE1L-tag and JADE1S-tag complexes
expressed from the AAVS1 locus. JADE1L and JADE1S are splicing isoforms of PHF17. Nuclear extracts
from K562 cells expressing the tag (Mock) and clonal cell lines expressing JADE1L-tag and JADE1S-tag
were analyzed. B) Western blots of selected KAT7 (HBO1) subunits on purified fractions shown in A. C)
Silver stained SDS-PAGE showing the purified ATM after each purification steps. K562 cells expressing the
tag (Mock) and a clonal cell line expressing tag-ATM (ATM). Eluted fractions (E1, E2) from the two
purification steps are shown. D) Schematic of donor construct and of the AAVS1 locus following ORF
addition for the robust induction of target proteins upon doxycycline treatment. The first two exons of the
PPP1R12C gene are shown as open boxes. Also annotated are the locations of the splice acceptor site (SA),
2A self-cleaving peptide sequence (2A), puromycin resistance gene (Puro), polyadenylation sequence (pA),
bi-directional tet-responsive promoter (pTRE3G-BI), Tet3G transactivator (Tet3G), 3xFLAG-2xSTREP
tandem affinity tag (Tag), homology arms left and right (HA-L, HA-R). E) Western blots showing MCM8-tag
protein expression in two K562 clones treated for 72hrs with doxycycline (250 ng/ml). Expression of MCM8
and of the Tet-on transactivator was monitored by western blot with antibodies to FLAG (anti-FLAG) and to
TetR (anti-TetR), respectively. Blots with antibody to -tubulin (anti-tubulin) were used as controls for
loading. F) Western blots showing tag-EZH2 protein expression in a K562 clone treated for 24hrs with
increasing doses of doxycycline. Expression of EZH2 and of the Tet-on transactivator was monitored by
western blot with antibodies to FLAG (anti-FLAG) and to TetR (anti-TetR), respectively. Blots with antibody
to -tubulin (anti-tubulin) were used as controls for loading.
93
3Table S1, Related to Figures 1 and 2. NuA4 Complex Subunits Identified by Mass Spectrometry
Analysis
Predicted molecular weights, total spectral counts and # of unique peptides for
identified proteins are indicated. AAVS1-EPC1/EP400 and CRISPR-EPC1/EP400 indicate
whether the subunits were expressed ectopically from the AAVS1 locus or from the
endogenous loci, respectively.
94
4Table S2, Related to Figure 3. PRC2 Complex Subunits Identified by Mass Spectrometry Analysis
Predicted molecular weights, total spectral counts and # of unique peptides for identified proteins are
indicated. AAVS1-EZH2 and TALEN-EZH2 indicate whether EZH2 was expressed ectopically from the
AAVS1 locus or from its endogenous locus, respectively.
5Table S3, Related to Figure 4. FA Core and Anchor Complexes Subunits Identified by Mass
Spectrometry Analysis
Predicted molecular weights, total spectral counts and # of unique peptides for identified proteins
are indicated. CRISPR-FANCF indicates that FANCF is expressed from its endogenous locus.
95
6Table S4, Related to Figure 5. MCM8 Complex Subunits Identified by Mass Spectrometry Analysis
Predicted molecular weights, total spectral counts and # of unique peptides for identified proteins
are indicated. CRISPR-MCM8 indicates that MCM8 is expressed from its endogenous locus.
DISCUSSION GÉNÉRALE
99
Grâce à la disponibilité des bases de données, il est dorénavant possible d’inférer la
fonction d’une protéine en comparant la séquence des acides aminés avec celles de
protéines provenant de certains gènes préalablement caractérisés. Il est toutefois toujours
préférable de caractériser la protéine dans son état naturel plutôt que d’utiliser des moyens
indirects. Pour déterminer les interactions protéine-protéine, la purification d’affinité suivie
de la spectrométrie de masse (AP-MS) est la norme [187]. Par contre, l’efficacité de la
technique est grandement réduite dans les cellules de mammifères [9].
La purification d’affinité utilise des étiquettes d’affinités, des outils très puissants,
pour purifier le complexe d’intérêt [7]. Il faut malgré tout garder en tête les interactions
possibles de l’étiquette d’affinité avec les autres protéines dans l’organisme à l’étude ce qui
peut mener à des taux élevés de bruit de fond. La TAP a été optimisée chez la levure et a
permis la caractérisation de plus de 589 complexes protéiques [9]. Les limites majeures de
la technique sont la quantité et la qualité des protéines à purifier. Lorsque la protéine est
faiblement exprimée dans la cellule, la surexpression est nécessaire pour obtenir une
quantité suffisante de protéines. Par contre, cela peut mener à des aberrations dans la
stœchiométrie. La technique de TAP pour la purification de complexe de la protéine cible
est bien établie dans la levure. Malheureusement, cette technique se transfère difficilement
dans les eucaryotes supérieurs notamment dans les cellules humaines.
Les travaux présentés ici utilisent les techniques d’ingénieries du génome pour
répondre à cette problématique en intégrant un cDNA d’intérêt étiqueté dans le GSH
AAVS1, permettant ainsi son expression à des niveaux presque physiologiques. Cette
technique permet d’obtenir un aperçu rapide et précis des interactions protéiques de la
protéine cible dans les conditions naturelles. Il s’agit d’un avantage certain par rapport aux
techniques traditionnelles d’expression ectopique.
La deuxième technique mise au point se base sur l’intégration d’étiquettes d’affinité
en tandem 3xFLAG-Twin-Strep soit en N ou en C-terminal du gène d’intérêt. Cette
méthode permet de conserver l’intégrité de la régulation native du gène ainsi que son
emplacement dans le génome. Cette technique est plus laborieuse à réaliser, mais les
résultats reflètent plus précisément les interactions protéiques de la protéine cible dans le
contexte naturel de la cellule.
100
1Tableau 3 : Avantages et désavantages des techniques de purification de complexes protéine-protéine
utilisées précédemment et de celle décrite dans ce mémoire
Techniques utilisées précédemment Technique décrite
Purification d’affinité TAP 3xFLAG/TwinStrep TAP-
TAG intégré à AAVS1
Avantage Approche générique
Facile à reproduire
Possible de purifier des
protéines/complexes
protéiques faiblement
exprimés.
Approche générique
Facile à reproduire
Possible de purifier des
protéines/complexes
protéiques faiblement
exprimés.
Condition de purification
physiologiquement douce.
Réduction massive du bruit
de fond.
Efficace dans les études à
petite et grande échelle.
Approche générique et
rapide
Facile à reproduire
Possible de purifier des
protéines/complexes
protéiques très faiblement
exprimés.
Condition de purification
physiologiquement douce.
Réduction massive du bruit
de fond.
Efficace dans les études à
petite et grande échelle.
Niveau d’expression
presque physiologique de
la protéine cible.
Bon alternatif à
l’étiquetage endogène.
Désavantage Expression de gène
ectopique.
La fusion protéine-TAG
peut influencer la fonction
de la protéine.
Les caractéristiques de
l’étiquette d’affinité
différente peuvent induire
des limitations uniques à la
technique.
Nécessite un protocole de
purification unique pour
chaque étiquette d’affinités
différentes.
Expression de gène
ectopique.
La fusion protéine-TAG
peut influencer la fonction
de la protéine.
L’efficacité de la technique
est grandement réduite
dans les cellules
d’eucaryotes supérieurs.
CBP peut interférer avec
les voies de signalisation
du calcium.
Expression du cDNA par
un promoteur ectopique.
La fusion protéine-TAG
peut influencer la fonction
de la protéine.
Sous clonage du cDNA
d’intérêt.
En intégrant les techniques préalablement disponibles aux techniques de pointes
utilisant les nucléases d’ingénieries, nous avons développé une méthode applicable à
l’étude de complexes protéiques faiblement exprimés dans les cellules humaines. Il est à
noter que les endonucléases ciblant le GSH AAVS1, ZFNs, TALENs et CRISPR/Cas9
101
peuvent toutes être utilisées et sont interchangeables dans le protocole. La technique est
facile à réaliser, rapide et permet d’observer les interactions protéiques à des niveaux
d’expression presque physiologiques en intégrant le cDNA approprié au GSH AAVS1. Peu
d’informations préalables sur la protéine d’intérêt sont nécessaires pour l’application de
cette technique. Pour démontrer la puissance de la technique, nous avons isolé des clones
uniques ayant intégré notre construction avec le cDNA d’EPC1 à AAVS1. La spectrométrie
de masse suite à la TAP a identifié tous les composants du complexe NuA4 déjà confirmés.
De plus, comme l’extraction des protéines a été faite dans des conditions douces, nous
avons identifié la protéine Malignant Brain Tumor domain-containing protein 1 (MBTD1),
une protéine importante pour la régulation développementale, mais jamais auparavant
associée au complexe NuA4 [188]. MBTD1 se lie aux lysines mono- ou di- méthylées des
histones grâce à l’une des quatre répétitions MBT [188, 189]. Ceci permet de mesurer les
taux de lysine méthylé sur les H3 et H4, et de bien positionner le complexe NuA4 [190].
Le complexe NuA4 est un complexe bien caractérisé. Ayant trouvé un nouveau
partenaire en utilisant notre technique, il est possible de croire que de nouvelles
interactions protéiques pourraient être découvertes dans des complexes déjà bien
caractérisés. Par exemple, on peut penser à la voie de signalisation de la survie cellulaire
phosphatidylinositol 3-kinase (PI3K). Des anomalies dans cette voie sont considérées
impliquées dans de nombreux types de cancers et l’augmentation de l’activité de cette voie
de signalisation est souvent associée à une résistance aux thérapies contre le cancer [191,
192]. Mechanistic target of rapamycin (mTOR) est une sérine/thréonine kinase de la voie
de signalisation PI3K identifiée comme étant la cible cellulaire de la rapamycine [193].
mTOR peut former deux complexes protéiques différents, mTORC1 et mTORC2 régulant
la synthèse protéique nécessaire pour la croissance et la prolifération de la cellule [193].
Chacun de ces complexes est formé d’un nombre important de partenaires en interaction
jouant entre autre des rôles d’activateurs ou d’inhibiteurs. Afin de potentiellement
découvrir de nouvelles interactions protéiques pouvant mener à de nouvelles stratégies de
thérapie pour le cancer, il serait facile de purifier les complexes mTORC1 et mTORC2 en
utilisant notre technique. En introduisant les cDNA de mTOR, ou mieux encore celui des
cDNA des autres protéines connues des complexes, tels : Raptor, LST8, PRAS40,
102
DEPTOR et Rictor, mSIN1, GβL, respectivement. Il serait donc possible de purifier les
complexes et valider chacune de leurs composantes.
Comme les techniques actuelles se fondent sur la surexpression de gène, il peut en
résulter des effets anormaux dans la cellule ce qui peut mener à des conclusions erronées.
La surexpression de certaines protéines peut aussi mener à une toxicité, ce qui rend leur
étude très difficile. C’est pour cette raison qu’ATM n’a jamais été purifié sans
surexpression. Nous avons initialement pensé utiliser le système Tet-On 3G auto-inductible
pour permettre la purification de ATM, mais l’intégration à AAVS1 avec le cDNA TAP-
TAG s’est avéré être une technique très robuste qui a permis sa purification, une première
dans la littérature. Cette première purification d’ATM ouvre la porte à des études plus
poussées sur sa fonction.
2Tableau 4: Avantages et désavantages du système Tet-On et de notre système auto-inductible
Système Tet-On Système auto-inductible
Tet-On 3G
Avantage Contrôle sur l’expression de
la protéine cible.
Expression de la protéine
d’intérêt rapide.
Contrôle sur l’expression de
la protéine cible.
Expression de la protéine
d’intérêt rapide.
Facile à reproduire.
Possible de purifier des
protéines/complexes
protéiques très faiblement
exprimés.
Condition de purification
physiologiquement douce.
Réduction massive du bruit
de fond.
Efficace dans les études à
petite et grande échelle.
Désavantage Intégration aléatoire pouvant
mener à une perturbation
dans la stœchiométrie de la
cellule.
Sous clonage du cDNA
d’intérêt.
Expression variable de la
protéine cible dans chaque
clone.
Optimisation pour
l’expression de la protéine
cible nécessaire.
103
Le système Tet-on permet d’induire l’expression de la protéine, ce qui est un
avantage certain pour l’étude des protéines cytotoxiques. Toutefois, dans son design actuel,
les constructions s’intègrent aléatoirement ce qui augmente la possibilité de perturber la
stœchiométrie de la cellule. Il est donc important de cibler l’intégration de séquence
d’intérêt à un GSH pour ne pas perturber la cellule. Les nouveaux systèmes
d’endonucléases ZFN, TALEN et CRISPR/Cas9 sont des outils indispensables à cet effet,
car ils nous permettent de créer une DSB à un endroit précis dans le génome et y intégrer
nos séquences d’intérêt.
Nous avons créé un système auto-inductible Tet-ON 3G exprimant le cDNA
d’intérêt au GSH AAVS1. Ce système permet d’étudier des protéines cytotoxiques, telles
des protéines fusions résultant de translocation génomique comme EPC1-PHF1. Ce
système permet d’induire l’expression de la protéine cible peu avant l’étape d’extraction.
L’induction du système est robuste et l’expression de la protéine cible peut être optimisée
via la concentration de doxycycline utilisée pour induire le système. Les concentrations
requises pour l’induction par la doxycycline n’ont aucun effet néfaste connu. Plusieurs
translocations menant à des protéines fusions différentes ont été identifiées dans des
tumeurs malignes, tels JAZF1-PHF1 et MEAF6-PHF1. Il n’est pas encore possible de
sélectionner les cellules avec ces translocations pour permettre une étude de l’effet direct de
la translocation. En utilisant le cDNA de la protéine fusion d’intérêt avec le système auto-
inductible Tet-On 3G intégré à AAVS1, il serait possible d’obtenir ces protéines fusions
TAP-TAG et ainsi d’identifier leurs interactions par spectrométrie de masse. Il serait aussi
possible d’obtenir une quantité suffisante de protéines pour faire des tests enzymatiques et
pour une cristallographie. Il serait possible de faire ressortir des conclusions pertinentes
avec la protéine fusion.
Perspectives
Utiliser le site AAVS1 pour intégrer de l’ADN dans un génome sans produire
d’effets néfastes est intéressant dans l’optique de corriger des maladies génétiques par
édition génique et d’éliminer la nécessité de prendre des médicaments. En utilisant le GSH
104
ROSA26, cette technique peut aussi être utilisée chez la souris. Ultimement, il serait donc
possible de compenser une déficience enzymatique en y introduisant un gène fonctionnel in
vivo.
Une possibilité intéressante serait d’incorporer à AAVS1 un gène essentiel connu et
d’induire par la suite l’invalidation de sa forme native pour étudier les effets du gène dans
la cellule. Le système auto-inductible TetOn-3G a été créé pour répondre au besoin
d’exprimer des protéines cytotoxiques et pour en faciliter l’étude.
Il est important de mentionner que cibler le locus AAVS1 peut être fait dans toutes
les lignées cellulaires humaines et que l’ADN intégré est retenu même après
différenciation. Il serait donc intéressant d’incorporer l’ADN d’intérêt dans des cellules
souches, tel des cellules souches hématopoïétiques et induire la différenciation pour obtenir
plusieurs types de cellules humaines découlant tous de la même manipulation génétique.
Ceci permettrait de créer des lignées cellulaires dans tous les types cellulaires dont il est
possible d’induire la différenciation à partir d’un seul évènement.
Cette technique nous permettrait aussi d’étiqueter des protéines qui pourraient par la
suite être identifiées par immunohistochimie ou immunofluorescence lorsqu’aucun
anticorps spécifique n’est disponible. Par exemple, visualiser la distribution tissulaire d’un
GPCR précis.
Les méthodes développées dans le cadre de nos travaux offrent un avantage unique
comparativement à l’approche traditionnelle utilisée pour étudier les complexes protéiques
dans les cellules de mammifère. La stratégie de purification permet non seulement
d’identifier les protéines associées par spectrométrie de masses, mais la pureté et la quantité
récupérée permettent l’étude enzymatique et mécanistique in vitro.
105
CONCLUSION
Les travaux décrits dans le présent mémoire, ainsi que les recherches sur lesquelles
ce dernier s’appuie, démontrent le potentiel indéniable de la technique 3xFLAG/TwinStrep
TAP-TAG intégré à AAVS1. Cette technique a d’ailleurs été utilisée par plusieurs autres
groupes depuis sa publication [194-196]. Cette méthode rapide et facile permet d’obtenir un
premier aperçu des interactions protéine-protéine sans nécessiter beaucoup d’informations
initiales sur la protéine cible. Les résultats présentés ont permis d’identifier une interaction
nouvelle dans le complexe NuA4, un complexe auparavant très bien caractérisé ainsi que de
purifier la protéine ATM un exploit jamais fait auparavant. Quoique cette technique ne
reflète pas les conditions naturelles dans les cellules, car le promoteur de la construction est
ectopique, les niveaux d’expression de la protéine demeurent proches des concentrations
normales et permettent de rapprocher nos conclusions de la réalité. Les résultats présentés
ici bonifient grandement les techniques d’étiquetage endogène permettant de purifier une
protéine d’intérêt fonctionnelle et en quantité suffisante pour étudier ses interactions
protéine-protéine ainsi que ses fonctions enzymatiques.
107
RÉFÉRENCES
1. Alberts, B., The cell as a collection of protein machines: preparing the next
generation of molecular biologists. Cell, 1998. 92(3): p. 291-4.
2. Mak, A.N., et al., The crystal structure of TAL effector PthXo1 bound to its DNA
target. Science, 2012. 335(6069): p. 716-9.
3. Blackstock, W.P. and M.P. Weir, Proteomics: quantitative and physical mapping of
cellular proteins. Trends Biotechnol, 1999. 17(3): p. 121-7.
4. Guide to Protein Purification 2nd edition. Academic Press ed. Vol. 436. 2009.
5. Swaffield, J.C., K. Melcher, and S.A. Johnston, A highly conserved ATPase protein
as a mediator between acidic activation domains and the TATA-binding protein.
Nature, 1995. 374(6517): p. 88-91.
6. Puig, O., et al., The tandem affinity purification (TAP) method: a general procedure
of protein complex purification. Methods, 2001. 24(3): p. 218-29.
7. Rigaut, G., et al., A generic protein purification method for protein complex
characterization and proteome exploration. Nat Biotechnol, 1999. 17(10): p. 1030-
2.
8. Shevchenko, A., et al., Linking genome and proteome by mass spectrometry: large-
scale identification of yeast proteins from two dimensional gels. Proc Natl Acad Sci
U S A, 1996. 93(25): p. 14440-5.
9. Gavin, A.C., et al., Functional organization of the yeast proteome by systematic
analysis of protein complexes. Nature, 2002. 415(6868): p. 141-7.
10. Behrends, C., et al., Network organization of the human autophagy system. Nature,
2010. 466(7302): p. 68-76.
11. Goudreault, M., et al., A PP2A phosphatase high density interaction network
identifies a novel striatin-interacting phosphatase and kinase complex linked to the
cerebral cavernous malformation 3 (CCM3) protein. Mol Cell Proteomics, 2009.
8(1): p. 157-71.
12. Guruharsha, K.G., et al., A protein complex network of Drosophila melanogaster.
Cell, 2011. 147(3): p. 690-703.
13. Hegemann, B., et al., Systematic phosphorylation analysis of human mitotic protein
complexes. Sci Signal, 2011. 4(198): p. rs12.
14. Hutchins, J.R., et al., Systematic analysis of human protein complexes identifies
chromosome segregation proteins. Science, 2010. 328(5978): p. 593-9.
15. Huttlin, E.L., et al., The BioPlex Network: A Systematic Exploration of the Human
Interactome. Cell, 2015. 162(2): p. 425-40.
16. Sardiu, M.E., et al., Probabilistic assembly of human protein interaction networks
from label-free quantitative proteomics. Proc Natl Acad Sci U S A, 2008. 105(5): p.
1454-9.
17. Sowa, M.E., et al., Defining the human deubiquitinating enzyme interaction
landscape. Cell, 2009. 138(2): p. 389-403.
18. Van Leene, J., et al., Targeted interactomics reveals a complex core cell cycle
machinery in Arabidopsis thaliana. Mol Syst Biol, 2010. 6: p. 397.
19. Gavin, A.C., et al., Proteome survey reveals modularity of the yeast cell machinery.
Nature, 2006. 440(7084): p. 631-6.
108
20. Agell, N., et al., Modulation of the Ras/Raf/MEK/ERK pathway by Ca(2+), and
calmodulin. Cell Signal, 2002. 14(8): p. 649-54.
21. Head, J.F., A better grip on calmodulin. Curr Biol, 1992. 2(11): p. 609-11.
22. Doyon, J.B., et al., Rapid and efficient clathrin-mediated endocytosis revealed in
genome-edited mammalian cells. Nat Cell Biol, 2011. 13(3): p. 331-7.
23. Ho, Y., et al., Systematic identification of protein complexes in Saccharomyces
cerevisiae by mass spectrometry. Nature, 2002. 415(6868): p. 180-3.
24. Bucher, M.H., A.G. Evdokimov, and D.S. Waugh, Differential effects of short
affinity tags on the crystallization of Pyrococcus furiosus maltodextrin-binding
protein. Acta Crystallogr D Biol Crystallogr, 2002. 58(Pt 3): p. 392-7.
25. Terpe, K., Overview of tag protein fusions: from molecular and biochemical
fundamentals to commercial systems. Appl Microbiol Biotechnol, 2003. 60(5): p.
523-33.
26. Blanar, M.A. and W.J. Rutter, Interaction cloning: identification of a helix-loop-
helix zipper protein that interacts with c-Fos. Science, 1992. 256(5059): p. 1014-8.
27. Einhauer, A. and A. Jungbauer, The FLAG peptide, a versatile fusion tag for the
purification of recombinant proteins. J Biochem Biophys Methods, 2001. 49(1-3):
p. 455-65.
28. Su, X., A.K. Prestwood, and R.A. McGraw, Production of recombinant porcine
tumor necrosis factor alpha in a novel E. coli expression system. Biotechniques,
1992. 13(5): p. 756-62.
29. Einhauer, A., et al., Expression and purification of homogenous proteins in
Saccharomyces cerevisiae based on ubiquitin-FLAG fusion. Protein Expr Purif,
2002. 24(3): p. 497-504.
30. Schuster, M., et al., Protein expression strategies for identification of novel target
proteins. J Biomol Screen, 2000. 5(2): p. 89-97.
31. Kunz, D., N.P. Gerard, and C. Gerard, The human leukocyte platelet-activating
factor receptor. cDNA cloning, cell surface expression, and construction of a novel
epitope-bearing analog. J Biol Chem, 1992. 267(13): p. 9101-6.
32. Zhang, X.K., et al., Novel pathway for thyroid hormone receptor action through
interaction with jun and fos oncogene activities. Mol Cell Biol, 1991. 11(12): p.
6016-25.
33. Sigma-Aldrich. FLAG System. [cited 2017 3 février]; Available from:
http://www.sigmaaldrich.com/life-science/proteomics/recombinant-protein-
expression/purification-detection/flag-system.html.
34. Schmidt, T.G. and A. Skerra, The random peptide library-assisted engineering of a
C-terminal affinity peptide, useful for the detection and purification of a functional
Ig Fv fragment. Protein Eng, 1993. 6(1): p. 109-22.
35. Voss, S. and A. Skerra, Mutagenesis of a flexible loop in streptavidin leads to
higher affinity for the Strep-tag II peptide and improved performance in
recombinant protein purification. Protein Eng, 1997. 10(8): p. 975-82.
36. Schmidt, T.G., et al., Molecular interaction between the Strep-tag affinity peptide
and its cognate target, streptavidin. J Mol Biol, 1996. 255(5): p. 753-66.
109
37. Korndorfer, I.P. and A. Skerra, Improved affinity of engineered streptavidin for the
Strep-tag II peptide is due to a fixed open conformation of the lid-like loop at the
binding site. Protein Sci, 2002. 11(4): p. 883-93.
38. Schmidt, T.G. and A. Skerra, The Strep-tag system for one-step purification and
high-affinity detection or capturing of proteins. Nat Protoc, 2007. 2(6): p. 1528-35.
39. Wyborski, D.L. and J.M. Short, Analysis of inducers of the E.coli lac repressor
system in mammalian cells and whole animals. Nucleic Acids Res, 1991. 19(17): p.
4647-53.
40. Gossen, M. and H. Bujard, Tight control of gene expression in mammalian cells by
tetracycline-responsive promoters. Proc Natl Acad Sci U S A, 1992. 89(12): p.
5547-51.
41. Gossen, M., et al., Transcriptional activation by tetracyclines in mammalian cells.
Science, 1995. 268(5218): p. 1766-9.
42. Loew, R., et al., Improved Tet-responsive promoters with minimized background
expression. BMC Biotechnol, 2010. 10: p. 81.
43. Baron, U., et al., Co-regulation of two gene activities by tetracycline via a
bidirectional promoter. Nucleic Acids Res, 1995. 23(17): p. 3605-6.
44. Zhou, X., et al., Optimization of the Tet-On system for regulated gene expression
through viral evolution. Gene Ther, 2006. 13(19): p. 1382-90.
45. Clontech Laboratories, I. Tet-On 3G Inducible Expression Systems User Manual.
[cited 2017 29 Janvier]; Available from:
http://www.clontech.com/xxclt_ibcGetAttachment.jsp?cItemId=17569.
46. Sadelain, M., E.P. Papapetrou, and F.D. Bushman, Safe harbours for the integration
of new DNA in the human genome. Nat Rev Cancer, 2011. 12(1): p. 51-8.
47. DeKelver, R.C., et al., Functional genomics, proteomics, and regulatory DNA
analysis in isogenic settings using zinc finger nuclease-driven transgenesis into a
safe harbor locus in the human genome. Genome Res, 2010. 20(8): p. 1133-42.
48. Kotin, R.M., R.M. Linden, and K.I. Berns, Characterization of a preferred site on
human chromosome 19q for integration of adeno-associated virus DNA by non-
homologous recombination. EMBO J, 1992. 11(13): p. 5071-8.
49. Tan, I., et al., Phosphorylation of a novel myosin binding subunit of protein
phosphatase 1 reveals a conserved mechanism in the regulation of actin
cytoskeleton. J Biol Chem, 2001. 276(24): p. 21209-16.
50. Ogata, T., T. Kozuka, and T. Kanda, Identification of an insulator in AAVS1, a
preferred region for integration of adeno-associated virus DNA. J Virol, 2003.
77(16): p. 9000-7.
51. Henckaerts, E. and R.M. Linden, Adeno-associated virus: a key to the human
genome? Future Virol, 2010. 5(5): p. 555-574.
52. Smith, J.R., et al., Robust, persistent transgene expression in human embryonic stem
cells is achieved with AAVS1-targeted integration. Stem Cells, 2008. 26(2): p. 496-
504.
53. Zou, J., et al., Oxidase-deficient neutrophils from X-linked chronic granulomatous
disease iPS cells: functional correction by zinc finger nuclease-mediated safe
harbor targeting. Blood, 2011. 117(21): p. 5561-72.
110
54. Ramachandra, C.J., et al., Efficient recombinase-mediated cassette exchange at the
AAVS1 locus in human embryonic stem cells using baculoviral vectors. Nucleic
Acids Res, 2011. 39(16): p. e107.
55. Yang, L., et al., Human cardiovascular progenitor cells develop from a KDR+
embryonic-stem-cell-derived population. Nature, 2008. 453(7194): p. 524-8.
56. Hockemeyer, D., et al., Efficient targeting of expressed and silent genes in human
ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol, 2009. 27(9): p. 851-7.
57. Lombardo, A., et al., Site-specific integration and tailoring of cassette design for
sustainable gene transfer. Nat Methods, 2011. 8(10): p. 861-9.
58. Kim, Y.G., J. Cha, and S. Chandrasegaran, Hybrid restriction enzymes: zinc finger
fusions to Fok I cleavage domain. Proc Natl Acad Sci U S A, 1996. 93(3): p. 1156-
60.
59. Miller, J., A.D. McLachlan, and A. Klug, Repetitive zinc-binding domains in the
protein transcription factor IIIA from Xenopus oocytes. EMBO J, 1985. 4(6): p.
1609-14.
60. Wolfe, S.A., L. Nekludova, and C.O. Pabo, DNA recognition by Cys2His2 zinc
finger proteins. Annu Rev Biophys Biomol Struct, 2000. 29: p. 183-212.
61. Miller, J.C., et al., An improved zinc-finger nuclease architecture for highly specific
genome editing. Nat Biotechnol, 2007. 25(7): p. 778-85.
62. Beerli, R.R. and C.F. Barbas, 3rd, Engineering polydactyl zinc-finger transcription
factors. Nat Biotechnol, 2002. 20(2): p. 135-41.
63. Vanamee, E.S., S. Santagata, and A.K. Aggarwal, FokI requires two specific DNA
sites for cleavage. J Mol Biol, 2001. 309(1): p. 69-78.
64. Urnov, F.D., et al., Genome editing with engineered zinc finger nucleases. Nat Rev
Genet, 2010. 11(9): p. 636-46.
65. Kim, E., et al., Precision genome engineering with programmable DNA-nicking
enzymes. Genome Res, 2012. 22(7): p. 1327-33.
66. Gaj, T., C.A. Gersbach, and C.F. Barbas, 3rd, ZFN, TALEN, and CRISPR/Cas-
based methods for genome engineering. Trends Biotechnol, 2013. 31(7): p. 397-
405.
67. Perez-Pinera, P., D.G. Ousterout, and C.A. Gersbach, Advances in targeted genome
editing. Curr Opin Chem Biol, 2012. 16(3-4): p. 268-77.
68. Segal, D.J. and J.F. Meckler, Genome engineering at the dawn of the golden age.
Annu Rev Genomics Hum Genet, 2013. 14: p. 135-58.
69. Ramirez, C.L., et al., Unexpected failure rates for modular assembly of engineered
zinc fingers. Nat Methods, 2008. 5(5): p. 374-5.
70. Joung, J.K. and J.D. Sander, TALENs: a widely applicable technology for targeted
genome editing. Nat Rev Mol Cell Biol, 2013. 14(1): p. 49-55.
71. Boch, J. and U. Bonas, Xanthomonas AvrBs3 family-type III effectors: discovery
and function. Annu Rev Phytopathol, 2010. 48: p. 419-36.
72. Boch, J., et al., Breaking the code of DNA binding specificity of TAL-type III
effectors. Science, 2009. 326(5959): p. 1509-12.
73. Deng, D., et al., Structural basis for sequence-specific recognition of DNA by TAL
effectors. Science, 2012. 335(6069): p. 720-3.
111
74. Sander, J.D., et al., Targeted gene disruption in somatic zebrafish cells using
engineered TALENs. Nat Biotechnol, 2011. 29(8): p. 697-8.
75. Tesson, L., et al., Knockout rats generated by embryo microinjection of TALENs.
Nat Biotechnol, 2011. 29(8): p. 695-6.
76. Reyon, D., et al., FLASH assembly of TALENs for high-throughput genome editing.
Nat Biotechnol, 2012. 30(5): p. 460-5.
77. Hockemeyer, D., et al., Genetic engineering of human pluripotent cells using TALE
nucleases. Nat Biotechnol, 2011. 29(8): p. 731-4.
78. Kim, Y., et al., A library of TAL effector nucleases spanning the human genome.
Nat Biotechnol, 2013. 31(3): p. 251-8.
79. Shi, B., et al., TALEN-Mediated Knockout of CCR5 Confers Protection Against
Infection of Human Immunodeficiency Virus. J Acquir Immune Defic Syndr, 2017.
74(2): p. 229-241.
80. Ellis, B.L., et al., Zinc-finger nuclease-mediated gene correction using single AAV
vector transduction and enhancement by Food and Drug Administration-approved
drugs. Gene Ther, 2013. 20(1): p. 35-42.
81. Ishino, Y., et al., Nucleotide sequence of the iap gene, responsible for alkaline
phosphatase isozyme conversion in Escherichia coli, and identification of the gene
product. J Bacteriol, 1987. 169(12): p. 5429-33.
82. Barrangou, R., et al., CRISPR provides acquired resistance against viruses in
prokaryotes. Science, 2007. 315(5819): p. 1709-12.
83. Jinek, M., et al., A programmable dual-RNA-guided DNA endonuclease in adaptive
bacterial immunity. Science, 2012. 337(6096): p. 816-21.
84. Makarova, K.S., et al., Evolution and classification of the CRISPR-Cas systems. Nat
Rev Microbiol, 2011. 9(6): p. 467-77.
85. DiCarlo, J.E., et al., Genome engineering in Saccharomyces cerevisiae using
CRISPR-Cas systems. Nucleic Acids Res, 2013. 41(7): p. 4336-43.
86. Gratz, S.J., et al., Genome engineering of Drosophila with the CRISPR RNA-guided
Cas9 nuclease. Genetics, 2013. 194(4): p. 1029-35.
87. Friedland, A.E., et al., Heritable genome editing in C. elegans via a CRISPR-Cas9
system. Nat Methods, 2013. 10(8): p. 741-3.
88. Jiang, W., et al., Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene
modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res, 2013.
41(20): p. e188.
89. Wang, H., et al., One-step generation of mice carrying mutations in multiple genes
by CRISPR/Cas-mediated genome engineering. Cell, 2013. 153(4): p. 910-8.
90. Deltcheva, E., et al., CRISPR RNA maturation by trans-encoded small RNA and
host factor RNase III. Nature, 2011. 471(7340): p. 602-7.
91. Brouns, S.J., et al., Small CRISPR RNAs guide antiviral defense in prokaryotes.
Science, 2008. 321(5891): p. 960-4.
92. Garneau, J.E., et al., The CRISPR/Cas bacterial immune system cleaves
bacteriophage and plasmid DNA. Nature, 2010. 468(7320): p. 67-71.
93. Gasiunas, G., et al., Cas9-crRNA ribonucleoprotein complex mediates specific DNA
cleavage for adaptive immunity in bacteria. Proc Natl Acad Sci U S A, 2012.
109(39): p. E2579-86.
112
94. Hsu, P.D., et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat
Biotechnol, 2013. 31(9): p. 827-32.
95. Cong, L., et al., Multiplex genome engineering using CRISPR/Cas systems. Science,
2013. 339(6121): p. 819-23.
96. Anders, C., et al., Structural basis of PAM-dependent target DNA recognition by the
Cas9 endonuclease. Nature, 2014. 513(7519): p. 569-73.
97. Yang, H., H. Wang, and R. Jaenisch, Generating genetically modified mice using
CRISPR/Cas-mediated genome engineering. Nat Protoc, 2014. 9(8): p. 1956-68.
98. Reardon, S. First CRISPR clinical trial gets green light from US panel. Nature,
2016. DOI: 10.1038/nature.2016.20137.
99. Mali, P., et al., RNA-guided human genome engineering via Cas9. Science, 2013.
339(6121): p. 823-6.
100. Mali, P., et al., CAS9 transcriptional activators for target specificity screening and
paired nickases for cooperative genome engineering. Nat Biotechnol, 2013. 31(9):
p. 833-8.
101. Fonfara, I., et al., Phylogeny of Cas9 determines functional exchangeability of dual-
RNA and Cas9 among orthologous type II CRISPR-Cas systems. Nucleic Acids Res,
2014. 42(4): p. 2577-90.
102. Esvelt, K.M., et al., Orthogonal Cas9 proteins for RNA-guided gene regulation and
editing. Nat Methods, 2013. 10(11): p. 1116-21.
103. Zetsche, B., et al., Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-
Cas system. Cell, 2015. 163(3): p. 759-71.
104. Haeussler, M., et al., Evaluation of off-target and on-target scoring algorithms and
integration into the guide RNA selection tool CRISPOR. Genome Biol, 2016. 17(1):
p. 148.
105. Ran, F.A., et al., Double nicking by RNA-guided CRISPR Cas9 for enhanced
genome editing specificity. Cell, 2013. 154(6): p. 1380-9.
106. Guilinger, J.P., D.B. Thompson, and D.R. Liu, Fusion of catalytically inactive Cas9
to FokI nuclease improves the specificity of genome modification. Nat Biotechnol,
2014. 32(6): p. 577-82.
107. Dianov, G.L. and U. Hubscher, Mammalian base excision repair: the forgotten
archangel. Nucleic Acids Res, 2013. 41(6): p. 3483-90.
108. Scharer, O.D., Nucleotide excision repair in eukaryotes. Cold Spring Harb Perspect
Biol, 2013. 5(10): p. a012609.
109. Li, G.M., Mechanisms and functions of DNA mismatch repair. Cell Res, 2008.
18(1): p. 85-98.
110. Kolodner, R.D. and G.T. Marsischky, Eukaryotic DNA mismatch repair. Curr Opin
Genet Dev, 1999. 9(1): p. 89-96.
111. Modrich, P. and R. Lahue, Mismatch repair in replication fidelity, genetic
recombination, and cancer biology. Annu Rev Biochem, 1996. 65: p. 101-33.
112. Valerie, K. and L.F. Povirk, Regulation and mechanisms of mammalian double-
strand break repair. Oncogene, 2003. 22(37): p. 5792-812.
113. Bonner, W.M., et al., GammaH2AX and cancer. Nat Rev Cancer, 2008. 8(12): p.
957-67.
113
114. Lavin, M.F., ATM and the Mre11 complex combine to recognize and signal DNA
double-strand breaks. Oncogene, 2007. 26(56): p. 7749-58.
115. Goedecke, W., et al., Mre11 and Ku70 interact in somatic cells, but are
differentially expressed in early meiosis. Nat Genet, 1999. 23(2): p. 194-8.
116. Haber, J.E., The many interfaces of Mre11. Cell, 1998. 95(5): p. 583-6.
117. Paull, T.T. and M. Gellert, The 3' to 5' exonuclease activity of Mre 11 facilitates
repair of DNA double-strand breaks. Mol Cell, 1998. 1(7): p. 969-79.
118. Paull, T.T. and M. Gellert, A mechanistic basis for Mre11-directed DNA joining at
microhomologies. Proc Natl Acad Sci U S A, 2000. 97(12): p. 6409-14.
119. Jha, S., E. Shibata, and A. Dutta, Human Rvb1/Tip49 is required for the histone
acetyltransferase activity of Tip60/NuA4 and for the downregulation of
phosphorylation on H2AX after DNA damage. Mol Cell Biol, 2008. 28(8): p. 2690-
700.
120. Doyon, Y. and J. Cote, The highly conserved and multifunctional NuA4 HAT
complex. Curr Opin Genet Dev, 2004. 14(2): p. 147-54.
121. Doyon, Y., et al., Structural and functional conservation of the NuA4 histone
acetyltransferase complex from yeast to humans. Mol Cell Biol, 2004. 24(5): p.
1884-96.
122. Cheng, X., et al., Eaf1 Links the NuA4 Histone Acetyltransferase Complex to Htz1
Incorporation and Regulation of Purine Biosynthesis. Eukaryot Cell, 2015. 14(6): p.
535-44.
123. Sun, Y., et al., A role for the Tip60 histone acetyltransferase in the acetylation and
activation of ATM. Proc Natl Acad Sci U S A, 2005. 102(37): p. 13182-7.
124. Sun, Y., et al., DNA damage-induced acetylation of lysine 3016 of ATM activates
ATM kinase activity. Mol Cell Biol, 2007. 27(24): p. 8502-9.
125. Sun, Y., et al., Histone H3 methylation links DNA damage detection to activation of
the tumour suppressor Tip60. Nat Cell Biol, 2009. 11(11): p. 1376-82.
126. Goodarzi, A.A., et al., ATM signaling facilitates repair of DNA double-strand
breaks associated with heterochromatin. Mol Cell, 2008. 31(2): p. 167-77.
127. Noon, A.T., et al., 53BP1-dependent robust localized KAP-1 phosphorylation is
essential for heterochromatic DNA double-strand break repair. Nat Cell Biol, 2010.
12(2): p. 177-84.
128. Chan, H.M., et al., The p400 E1A-associated protein is a novel component of the
p53 --> p21 senescence pathway. Genes Dev, 2005. 19(2): p. 196-201.
129. Bothmer, A., et al., 53BP1 regulates DNA resection and the choice between
classical and alternative end joining during class switch recombination. J Exp Med,
2010. 207(4): p. 855-65.
130. Bunting, S.F., et al., 53BP1 inhibits homologous recombination in Brca1-deficient
cells by blocking resection of DNA breaks. Cell, 2010. 141(2): p. 243-54.
131. Limbo, O., et al., Ctp1 is a cell-cycle-regulated protein that functions with Mre11
complex to control double-strand break repair by homologous recombination. Mol
Cell, 2007. 28(1): p. 134-46.
132. Pardo, B., B. Gomez-Gonzalez, and A. Aguilera, DNA repair in mammalian cells:
DNA double-strand break repair: how to fix a broken relationship. Cell Mol Life
Sci, 2009. 66(6): p. 1039-56.
114
133. Chiruvella, K.K., Z. Liang, and T.E. Wilson, Repair of double-strand breaks by end
joining. Cold Spring Harb Perspect Biol, 2013. 5(5): p. a012757.
134. Karanam, K., et al., Quantitative live cell imaging reveals a gradual shift between
DNA repair mechanisms and a maximal use of HR in mid S phase. Mol Cell, 2012.
47(2): p. 320-9.
135. Sonoda, E., et al., Differential usage of non-homologous end-joining and
homologous recombination in double strand break repair. DNA Repair (Amst),
2006. 5(9-10): p. 1021-9.
136. Moore, J.K. and J.E. Haber, Cell cycle and genetic requirements of two pathways of
nonhomologous end-joining repair of double-strand breaks in Saccharomyces
cerevisiae. Mol Cell Biol, 1996. 16(5): p. 2164-73.
137. Ochi, T., et al., DNA repair. PAXX, a paralog of XRCC4 and XLF, interacts with
Ku to promote DNA double-strand break repair. Science, 2015. 347(6218): p. 185-
8.
138. Xing, M., et al., Interactome analysis identifies a new paralogue of XRCC4 in non-
homologous end joining DNA repair pathway. Nat Commun, 2015. 6: p. 6233.
139. Radhakrishnan, S.K., N. Jette, and S.P. Lees-Miller, Non-homologous end joining:
emerging themes and unanswered questions. DNA Repair (Amst), 2014. 17: p. 2-8.
140. Lieber, M.R., The mechanism of double-strand DNA break repair by the
nonhomologous DNA end-joining pathway. Annu Rev Biochem, 2010. 79: p. 181-
211.
141. Cannan, W.J. and D.S. Pederson, Mechanisms and Consequences of Double-Strand
DNA Break Formation in Chromatin. J Cell Physiol, 2016. 231(1): p. 3-14.
142. Ma, Y., et al., Hairpin opening and overhang processing by an Artemis/DNA-
dependent protein kinase complex in nonhomologous end joining and V(D)J
recombination. Cell, 2002. 108(6): p. 781-94.
143. Yannone, S.M., et al., Coordinate 5' and 3' endonucleolytic trimming of terminally
blocked blunt DNA double-strand break ends by Artemis nuclease and DNA-
dependent protein kinase. Nucleic Acids Res, 2008. 36(10): p. 3354-65.
144. Bertocci, B., et al., Nonoverlapping functions of DNA polymerases mu, lambda, and
terminal deoxynucleotidyltransferase during immunoglobulin V(D)J recombination
in vivo. Immunity, 2006. 25(1): p. 31-41.
145. Wilson, T.E. and M.R. Lieber, Efficient processing of DNA ends during yeast
nonhomologous end joining. Evidence for a DNA polymerase beta (Pol4)-dependent
pathway. J Biol Chem, 1999. 274(33): p. 23599-609.
146. Ma, Y., et al., A biochemically defined system for mammalian nonhomologous DNA
end joining. Mol Cell, 2004. 16(5): p. 701-13.
147. Davis, B.J., J.M. Havener, and D.A. Ramsden, End-bridging is required for pol mu
to efficiently promote repair of noncomplementary ends by nonhomologous end
joining. Nucleic Acids Res, 2008. 36(9): p. 3085-94.
148. Nick McElhinny, S.A., et al., A gradient of template dependence defines distinct
biological roles for family X polymerases in nonhomologous end joining. Mol Cell,
2005. 19(3): p. 357-66.
149. Moon, A.F., et al., The X family portrait: structural insights into biological
functions of X family polymerases. DNA Repair (Amst), 2007. 6(12): p. 1709-25.
115
150. Nick McElhinny, S.A. and D.A. Ramsden, Polymerase mu is a DNA-directed
DNA/RNA polymerase. Mol Cell Biol, 2003. 23(7): p. 2309-15.
151. Dominguez, O., et al., DNA polymerase mu (Pol mu), homologous to TdT, could act
as a DNA mutator in eukaryotic cells. EMBO J, 2000. 19(7): p. 1731-42.
152. Tippin, B., et al., To slip or skip, visualizing frameshift mutation dynamics for
error-prone DNA polymerases. J Biol Chem, 2004. 279(44): p. 45360-8.
153. Ramadan, K., et al., De novo DNA synthesis by human DNA polymerase lambda,
DNA polymerase mu and terminal deoxyribonucleotidyl transferase. J Mol Biol,
2004. 339(2): p. 395-404.
154. Gu, J., et al., XRCC4:DNA ligase IV can ligate incompatible DNA ends and can
ligate across gaps. EMBO J, 2007. 26(4): p. 1010-23.
155. Riballo, E., et al., XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation
following ligation. Nucleic Acids Res, 2009. 37(2): p. 482-92.
156. Grawunder, U., et al., Activity of DNA ligase IV stimulated by complex formation
with XRCC4 protein in mammalian cells. Nature, 1997. 388(6641): p. 492-5.
157. Palmbos, P.L., J.M. Daley, and T.E. Wilson, Mutations of the Yku80 C terminus and
Xrs2 FHA domain specifically block yeast nonhomologous end joining. Mol Cell
Biol, 2005. 25(24): p. 10782-90.
158. Koch, C.A., et al., Xrcc4 physically links DNA end processing by polynucleotide
kinase to DNA ligation by DNA ligase IV. EMBO J, 2004. 23(19): p. 3874-85.
159. Tsai, C.J., S.A. Kim, and G. Chu, Cernunnos/XLF promotes the ligation of
mismatched and noncohesive DNA ends. Proc Natl Acad Sci U S A, 2007. 104(19):
p. 7851-6.
160. Gu, J., et al., Single-stranded DNA ligation and XLF-stimulated incompatible DNA
end ligation by the XRCC4-DNA ligase IV complex: influence of terminal DNA
sequence. Nucleic Acids Res, 2007. 35(17): p. 5755-62.
161. Zetsche, B., et al., Multiplex gene editing by CRISPR-Cpf1 using a single crRNA
array. Nat Biotechnol, 2017. 35(1): p. 31-34.
162. Price, B.D. and A.D. D'Andrea, Chromatin remodeling at DNA double-strand
breaks. Cell, 2013. 152(6): p. 1344-54.
163. Song, B. and P. Sung, Functional interactions among yeast Rad51 recombinase,
Rad52 mediator, and replication protein A in DNA strand exchange. J Biol Chem,
2000. 275(21): p. 15895-904.
164. Hays, S.L., et al., Studies of the interaction between Rad52 protein and the yeast
single-stranded DNA binding protein RPA. Mol Cell Biol, 1998. 18(7): p. 4400-6.
165. Lisby, M., et al., Choreography of the DNA damage response: spatiotemporal
relationships among checkpoint and repair proteins. Cell, 2004. 118(6): p. 699-713.
166. Sung, P., Yeast Rad55 and Rad57 proteins form a heterodimer that functions with
replication protein A to promote DNA strand exchange by Rad51 recombinase.
Genes Dev, 1997. 11(9): p. 1111-21.
167. Krogh, B.O. and L.S. Symington, Recombination proteins in yeast. Annu Rev
Genet, 2004. 38: p. 233-71.
168. Sartori, A.A., et al., Human CtIP promotes DNA end resection. Nature, 2007.
450(7169): p. 509-14.
116
169. White, C.I. and J.E. Haber, Intermediates of recombination during mating type
switching in Saccharomyces cerevisiae. EMBO J, 1990. 9(3): p. 663-73.
170. Sun, H., D. Treco, and J.W. Szostak, Extensive 3'-overhanging, single-stranded
DNA associated with the meiosis-specific double-strand breaks at the ARG4
recombination initiation site. Cell, 1991. 64(6): p. 1155-61.
171. Heyer, W.D., et al., Rad54: the Swiss Army knife of homologous recombination?
Nucleic Acids Res, 2006. 34(15): p. 4115-25.
172. Bugreev, D.V., F. Hanaoka, and A.V. Mazin, Rad54 dissociates homologous
recombination intermediates by branch migration. Nat Struct Mol Biol, 2007.
14(8): p. 746-53.
173. Sugawara, N., X. Wang, and J.E. Haber, In vivo roles of Rad52, Rad54, and Rad55
proteins in Rad51-mediated recombination. Mol Cell, 2003. 12(1): p. 209-19.
174. Szostak, J.W., et al., The double-strand-break repair model for recombination. Cell,
1983. 33(1): p. 25-35.
175. Nassif, N., et al., Efficient copying of nonhomologous sequences from ectopic sites
via P-element-induced gap repair. Mol Cell Biol, 1994. 14(3): p. 1613-25.
176. Voelkel-Meiman, K. and G.S. Roeder, Gene conversion tracts stimulated by HOT1-
promoted transcription are long and continuous. Genetics, 1990. 126(4): p. 851-67.
177. Morrow, D.M., C. Connelly, and P. Hieter, "Break copy" duplication: a model for
chromosome fragment formation in Saccharomyces cerevisiae. Genetics, 1997.
147(2): p. 371-82.
178. Llorente, B., C.E. Smith, and L.S. Symington, Break-induced replication: what is it
and what is it for? Cell Cycle, 2008. 7(7): p. 859-64.
179. Lin, F.L., K. Sperle, and N. Sternberg, Model for homologous recombination during
transfer of DNA into mouse L cells: role for DNA ends in the recombination
process. Mol Cell Biol, 1984. 4(6): p. 1020-34.
180. Saparbaev, M., L. Prakash, and S. Prakash, Requirement of mismatch repair genes
MSH2 and MSH3 in the RAD1-RAD10 pathway of mitotic recombination in
Saccharomyces cerevisiae. Genetics, 1996. 142(3): p. 727-36.
181. Flott, S., et al., Phosphorylation of Slx4 by Mec1 and Tel1 regulates the single-
strand annealing mode of DNA repair in budding yeast. Mol Cell Biol, 2007.
27(18): p. 6433-45.
182. Fishman-Lobell, J. and J.E. Haber, Removal of nonhomologous DNA ends in
double-strand break recombination: the role of the yeast ultraviolet repair gene
RAD1. Science, 1992. 258(5081): p. 480-4.
183. Thomas, K.R. and M.R. Capecchi, Site-directed mutagenesis by gene targeting in
mouse embryo-derived stem cells. Cell, 1987. 51(3): p. 503-12.
184. Moehle, E.A., et al., Targeted gene addition into a specified location in the human
genome using designed zinc finger nucleases. Proc Natl Acad Sci U S A, 2007.
104(9): p. 3055-60.
185. Bajar, B.T., et al., Fluorescent indicators for simultaneous reporting of all four cell
cycle phases. Nat Methods, 2016. 13(12): p. 993-996.
186. Musselman, C.A., et al., Molecular basis for H3K36me3 recognition by the Tudor
domain of PHF1. Nat Struct Mol Biol, 2012. 19(12): p. 1266-72.
117
187. Gavin, A.C., K. Maeda, and S. Kuhner, Recent advances in charting protein-protein
interaction: mass spectrometry-based approaches. Curr Opin Biotechnol, 2011.
22(1): p. 42-9.
188. Eryilmaz, J., et al., Structural studies of a four-MBT repeat protein MBTD1. PLoS
One, 2009. 4(10): p. e7274.
189. Guo, Y., et al., Methylation-state-specific recognition of histones by the MBT repeat
protein L3MBTL2. Nucleic Acids Res, 2009. 37(7): p. 2204-10.
190. Kim, J., et al., Tudor, MBT and chromo domains gauge the degree of lysine
methylation. EMBO Rep, 2006. 7(4): p. 397-403.
191. Myers, A.P. and L.C. Cantley, Targeting a common collaborator in cancer
development. Sci Transl Med, 2010. 2(48): p. 48ps45.
192. McCubrey, J.A., et al., Targeting the RAF/MEK/ERK, PI3K/AKT and p53 pathways
in hematopoietic drug resistance. Adv Enzyme Regul, 2007. 47: p. 64-103.
193. Liu, P., et al., Targeting the phosphoinositide 3-kinase pathway in cancer. Nat Rev
Drug Discov, 2009. 8(8): p. 627-44.
194. Smith, R.J., et al., Ataxia telangiectasia mutated (ATM) interacts with p400 ATPase
for an efficient DNA damage response. BMC Mol Biol, 2016. 17(1): p. 22.
195. Jacquet, K., et al., The TIP60 Complex Regulates Bivalent Chromatin Recognition
by 53BP1 through Direct H4K20me Binding and H2AK15 Acetylation. Mol Cell,
2016. 62(3): p. 409-21.
196. Zee, B.M., et al., Streamlined discovery of cross-linked chromatin complexes and
associated histone modifications by mass spectrometry. Proc Natl Acad Sci U S A,
2016. 113(7): p. 1784-9.