transcriptional analysis of tranosema ......transcriptional profile was markedly different in wasp...

ASIEH RASOOLIZADEH

TRANSCRIPTIONAL ANALYSIS OF TRANOSEMA ROSTRALE ICHNOVIRUS (TrIV) GENES, WITH

EMPHASIS ON THE REP GENE FAMILY

Mémoire présenté à la Faculté des études supérieures de l’Université Laval

dans le cadre du programme de maîtrise en biologie pour l’obtention du grade de Maître ès Sciences (M.Sc.)

DÉPARTEMENT DE BIOLOGIE FACULTÉ DES SCIENCES ET DE GÉNIE

UNIVERSITÉ LAVAL QUÉBEC

2009

© Asieh Rasoolizadeh, 2009

RÉSUMÉ

La guêpe endoparasitoïde Tranosema rostrale transmet un ichnovirus (“TrIV”) à son hôte

lépidoptère, Choristoneura fumiferana, au moment de la ponte. Ce virus, lequel possède

un génome segmenté d’ADNdb et ne peut se répliquer que dans l’ovaire du parasitoïde,

est essentiel à la survie de la guêpe immature à l’intérieur de son hôte. Dans une étude

antérieure, 86 cadres de lecture ouverts (ORF) ont été identifiés dans le génome de TrIV,

dont 35 qui ont pu être affectés à des familles de gènes ichnoviraux connues. La balance

n’affichait aucune similitude à des gènes connus. Dans le but d’évaluer (i) la précision de

l'annotation du génome de TrIV et (ii) l'importance relative de chaque famille de gènes

dans le succès du parasitisme par T. rostrale, une analyse transcriptionnelle de type qPCR

a été réalisée chez des larves de C. fumiferana infectées ainsi que dans des ovaires de T.

rostrale. Alors que la majorité (91%) des ORF attribués à des familles de gènes connues

ont produit des transcrits dans les larves infectées, mais à des niveaux très variables, cette

proportion était plus faible (67%) pour un échantillon de 12 ORF non-attribués. Parmi les

sept familles de gènes présentes dans le génome de TrIV, la famille rep est la mieux

représentée, avec 17 membres; tous se sont avérés être exprimés dans des larves infectées

et/ou les ovaires de guêpe. Dans les chenilles infectées, cependant, les transcrits de deux

d'entre eux, F1-1 et F1-2, étaient beaucoup plus abondants que ceux des autres gènes rep.

De plus, le profil transcriptionnel de la famille rep était clairement différent dans les

ovaires de guêpe, où le gène C166-1 a génére le plus abondant des transcrits rep, ce qui

suggère que différents membres de cette famille pourraient avoir des fonctions

spécifiques dans chaque hôte. L'abondance relative des segments génomiques était plus

élevée pour les deux segments portant les trois gènes rep les plus fortement exprimés

chez des chenilles infectées, mais la corrélation entre ces deux variables était faible pour

les autres gènes rep, suggérant que des facteurs additionnels sont impliqués dans la

régulation de l'expression des gènes rep chez les larves infectées. Des différences entre

les gènes rep de TrIV ont également été observées en ce qui a trait à l'abondance relative

des transcripts dans différents tissus de C. fumiferana, ce qui suggère l’existence de rôles

distincts ou d’une spécialisation pour chacun des membres de cette famille à l’intérieur

de différents tissus. Lorsqu’on compare les niveaux de transcripts rep, dans des chenilles

infectées, à ceux de gènes appartenant à d'autres familles connues du génome de TrIV, un

gène de la famille TrV (TrV1) et un gène rep (F1-1) se sont avérés beaucoup plus

fortement transcrits que tous les autres gènes examinés, soulignant l'importance probable

de ces deux familles dans la subjugation de C. fumiferana par T. rostrale. Dans les

ovaires de guêpe, le profil transcriptionnel était dominé par un gène rep et par un membre

d'une famille nouvellement décrite et identifiée parmi des ORF qui n’avaient pu être

attribués à des familles connues; ces gènes codent pour les protéines sécrétées affichant

un nouveau motif cystéine.

ABSTRACT

The endoparasitic wasp Tranosema rostrale transmits an ichnovirus (“TrIV”) to its

lepidopteran host, Choristoneura fumiferana, during parasitization. This virus, which has

a segmented dsDNA genome and can replicate only in the wasp’s ovaries, is essential to

the survival of the immature wasp within its host. In a prior study, 86 putative open

reading frames (ORFs) were identified in the TrIV genome, including 35 that could be

assigned to previously recognized ichnoviral gene families. The balance displayed no

similarity to known genes. In an effort to assess (i) the accuracy of the TrIV genome

annotation and (ii) the relative importance of each gene family in the success of

parasitism by T. rostrale, a temporal and tissue-specific qPCR transcriptional analysis

was conducted in infected C. fumiferana hosts and T. rostrale wasp ovaries. The majority

(91%) of putative ORFs assigned to known gene families were observed to be expressed

in infected larvae, albeit at widely varying levels, but this proportion was lower (67%) for

a sample of 12 unassigned ORFs. Among the seven known gene families present in the

TrIV genome, the rep family is the numerically most important one, with 17 members; all

of these were shown to be expressed in infected larvae and/or wasp ovaries. In infected

caterpillars, however, two of them, F1-1 and F1-2, had much more abundant transcripts

than the others. The rep transcriptional profile was markedly different in wasp ovaries,

where the C166-1 gene generated the most abundant rep transcripts, suggesting that

different members of this family may have host-specific functions. Relative abundance of

genome segments was highest for the two segments bearing the three most highly

iii

expressed rep genes, but the correlation between these two variables was poor for the

other rep genes, suggesting that some other factors are involved in the regulation of rep

gene expression in infected larvae. Inter-gene differences were also observed in the

relative abundance of TrIV rep transcripts in different C. fumiferana tissues, pointing to

tissue-specific roles or specialized functions for individual members of this gene family.

In comparing rep transcript levels to those of genes belonging to other known TrIV gene

families, a TrV (TrV1) and a rep (F1-1) gene clearly outnumbered all other genes

examined in infected caterpillars, pointing to the likely importance of these two gene

families in host subjugation by T. rostrale. In wasp ovaries, the transcriptional profile

was dominated by a rep gene and a member of a newly described family identified

among previously unassigned ORFs; these genes encode secreted proteins displaying a

novel cysteine motif.

iv

AVANT-PROPOS – FOREWORD

During my graduate studies, I have met several people at Laval University who have

shared their knowledge and experience with me to make my work both possible and more

pleasant. I take this opportunity to thank them all from the bottom of my heart. More

specifically, I would like to thank my co-supervisor, Dr. Michel Cusson. He generously

welcomed me to his lab, gave me the opportunity to develop my competences, and

provided me with scientific training on a daily basis. Dr. Cusson has a distinct way of

dealing with problems and gives his students an opportunity to discover themselves and

recognize their abilities. It has always been a great pleasure to share with him new

results, and his constant cheering, interest and enthusiasm allowed me to push through

and get through several difficult tasks.

I would also like to thank my director, Prof. Conrad Cloutier, for taking time to assess my

manuscript and help me get through the Master’s program. I will never forget the first

course I took with him, which he (naturally) gave in French, a lovely language that,

unfortunately, I do not fully grasp yet; he patiently helped me throughout the semester.

Furthermore, I would like to express my gratitude to the members of our laboratory at the

Laurentian Forestry Centre (LFC). In particular, I thank Catherine Béliveau and Don

Stewart, two molecular biologists who have helped me by providing valuable and

friendly guidance during my stay at LFC.

I will also be eternally grateful for the support I received from the few real friends I made

at Laval University; their friendly support was much appreciated, and I sincerely thank

them all.

Last, but not least, I wish to express my profound gratitude to my parents. Although I am

living far away from them, they are always in my heart. The distance did not keep them

from providing invaluable advice and generous support. I have always benefited from

their gracious words and encouragements, which allowed me, during hard times, to keep

moving forward and continue on my career path.

v

TABLE OF CONTENTS

RÉSUMÉ…………………………………………………………………………………………ii

ABSTRACT………….. ............................................................................................................... iii

AVANT-PROPOS – FOREWORD .............................................................................................. v

TABLE OF CONTENTS ............................................................................................................. vi

LIST OF FIGURES...................................................................................................................... ix

LIST OF TABLES ....................................................................................................................... xi

CHAPITRE 1….INTRODUCTION ........................................................................................... 1

1.1 La tordeuse des bourgeons de l’épinette, Choristoneura fumiferana ............................ 2

1.1.1 Cycle Vital ................................................................................................................. 2

1.2 Les parasitoïdes.............................................................................................................. 4

1.3 Polydnavirus .................................................................................................................. 4

1.3.1 Classification ............................................................................................................. 5

1.3.2 Cycle Vital ................................................................................................................. 6

1.3.3 Organization du genome............................................................................................ 7

1.3.4 Bracovirus.................................................................................................................. 8

1.3.5 Ichnovirus .................................................................................................................. 9

1.4 La guêpe Tranosema rostrale, un parasitoïde de la TBE............................................. 10

1.4.1 Le polydnavirus de Tranosema rostrale (TrIV) ...................................................... 10

1.5 Objectifs du projet........................................................................................................ 11

1.6 Référence ..................................................................................................................... 13

CHAPITRE 2….Tranosema rostrale ichnovirus repeat element genes display distinct transcriptional patterns in caterpillar and wasp hosts .......................................... 18

2.1 Summary ...................................................................................................................... 18

2.2 Résumé......................................................................................................................... 19

2.3 Introduction.................................................................................................................. 20

2.4 Material and methods................................................................................................... 22

2.4.1 RNA and DNA extraction ....................................................................................... 22

2.4.2 Reverse transcription and qPCR.............................................................................. 23

2.4.3 Bioinformatics ......................................................................................................... 24

2.5 Results and Discussion................................................................................................. 25

vi

2.5.1 Critical assessment of the LRE methodology.......................................................... 25

2.5.2 Transcript abundance in parasitized larvae.............................................................. 26

2.5.3 Transcript abundance in CF-injected larvae ............................................................ 29

2.5.4 Transcript abundance in wasp ovary and head-thorax complexes........................... 30

2.5.5 Gene dosage............................................................................................................. 32

2.5.6 Comparison of TrIV rep proteins and identification of non-polydnaviral rep homologs ................................................................................................................. 34

2.6 References.................................................................................................................... 38

CHAPITRE 3….Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries...................................................... 42

3.1 Abstract ........................................................................................................................ 42

3.2 Résumé......................................................................................................................... 43

3.3 Introduction.................................................................................................................. 44

3.4 Materials and Methods................................................................................................. 46

3.4.1 RNA extraction........................................................................................................ 46

3.4.2 cDNA library construction ...................................................................................... 46

3.4.3 Bioinformatics analyses........................................................................................... 47

3.4.4 Amplification of ORF-specific cDNAs from the cDNA library ............................. 47

3.4.5 Reverse transcription and quantitative real-time PCR (qPCR)................................ 48

3.5 Results.......................................................................................................................... 49

3.5.1 Detection of TrIV transcripts in infected larvae ...................................................... 49

3.5.2 Transcript abundance of TrIV ank, inx, Cys-motif, PRRP and N genes.................. 52

3.5.3 Transcript abundance of TrIV “unassigned” genes ................................................. 53

3.5.4 Comparison of transcript abundance across all TrIV gene families ........................ 55

3.5.5 Accuracy of splicing junction predictions ............................................................... 57

3.6 Discussion .................................................................................................................... 58

3.7 References.................................................................................................................... 61

CHAPITRE 4….Conclusion ..................................................................................................... 65

4.1 Références.................................................................................................................... 70

ANNEXE A…..Effect of TrIV rep gene expression on host gene transcription, as determined by microarray analysis.............................................................................................. 71

A.1 Introduction .................................................................................................................... 71

A.2 Material and methods ..................................................................................................... 72

A.3 Results ............................................................................................................................ 73

vii

viii

A.4 Discussion....................................................................................................................... 74

A.5 References ...................................................................................................................... 75

ANNEXE B…. Supplementary data for chapter 2: .................................................................... 76

ANNEXE C…. Supplementary data for chapter 3: .................................................................... 78

LIST OF FIGURES

Figure 1-1 Schéma du cycle vital de la tordeuse des bourgeons de l'épinette. ............................... 3

Figure 1-2 Représentation schématisée du cycle vital de Tranosema rostrale (Laforge, 1999). . 11

Figure 2-1 Transcript levels of 17 TrIV rep genes in naturally parasitized C. fumiferana 6th instar

larvae, as determined by quantitative real-time RT-PCR using total RNA extracted from whole

caterpillars, 1, 3 and 5 d post-parasitization (p.p.). ...................................................................... 27

Figure 2-2 Transcript levels of 17 TrIV rep genes in naturally parasitized 6th instar larvae, as

determined by quantitative real-time RT-PCR using total RNA extracted from four different

tissues: FB, fat body; CE, cuticular epithelium; HC, haemocytes; MG, midgut. The larvae were

parasitized within 24 h after the molt to the 6th (last) stadium, and the RNA extracted from

individual tissues 2 days after parasitization. ................................................................................ 28

Figure 2-3 Transcript levels of 17 TrIV rep genes in 6th instar larvae injected with 0.5 FE of T.

rostrale calyx fluid, as determined by quantitative real-time RT-PCR using total RNA extracted

from whole caterpillars, 1, 3 and 5 d post-injection (p.i.).. .......................................................... 29

Figure 2-4 Transcript levels of 17 TrIV rep genes in T. rostrale ovaries and head-thorax

complexes, as determined by quantitative real-time RT-PCR....................................................... 31

Figure 2-5 Assessment of genome segment abundance within the TrIV packaged genome, as

determined by quantitative real-time PCR using viral DNA as template...................................... 33

Figure 2-6 ClustalX alignment of all known and predicted TrIV rep family proteins. Black

arrows indicate the positions of conserved cysteine residues........................................................ 36

Figure 2-7 ClustalX alignment of selected ichnoviral rep proteins from TrIV, HfIV, and HdIV, as

well as a rep-like protein from the granulovirus HearGV. ............................................................ 37

Figure 3-1 qPCR determination of transcript levels of 11 TrIV putative genes (23), distributed

among five gene families, in C. fumiferana 6th instar larvae, 3 d following natural parasitization

by T. rostrale (3 d p.p.) ................................................................................................................. 52

Figure 3-2 ClustalW alignment of amino acid sequences deduced from selected TrIV unassigned

ORFs that were found to form groups of two or more related proteins. A) Four related proteins

x

displaying a novel C-terminal cysteine motif (cysteine residues are shown as white letters against

black background). ........................................................................................................................ 54

Figure 3-3 qPCR determination of transcript levels of 12 TrIV putative ORFs selected among 51

unassigned ORFs (23), in C. fumiferana 6th instar larvae, 3 d following natural parasitization by

T. rostrale (3 d p.p.) or injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.), as well as in T.

rostrale adult ovaries. Putative genes are here clustered according to whether they are orphan or

belong to a family (“OSSP” and “unassigned family B”; see caption of Fig. 2). ......................... 55

Figure 3-4 Comparison of transcript abundance among selected representatives of all known

TrIV gene families, in C. fumiferana 6th instar larvae, 3 d following injection of 0.5 FE T. rostrale

calyx fluid (3 d p.i.). ...................................................................................................................... 56

Figure 3-5 Comparison of transcript abundance among selected representatives of all known

TrIV gene families, in adult T. rostrale ovaries. ........................................................................... 56

LIST OF TABLES

Table 2-1 Critical assessment of the accuracy of LRE-based qPCR determinations (Rutledge and

Stewart, 2008a,b) by comparison with estimates obtained by application of the “limiting dilution

assay” (LDA) method (Wang and Spadoro, 1998)........................................................................ 25

Table 3-1 Overall assessment of the expression (detected or not; + or ) of known and predicted

TrIV ORFs in TrIV-infected C. fumiferana larvae........................................................................ 50

Table 3-2 Differences between predicted and observed splicing junctions for two TrIV spliced

genes, TrV3 and a Cys-motif gene. ................................................................................................ 57

CHAPITRE 1

INTRODUCTION

Les insectes (classe Insecta) constituent le groupe taxonomique le plus important au sein

de l’embranchement des arthropodes. Ils forment également le taxon le plus diversifié,

avec plus d’un million d’espèces connues. Bien que la majorité des insectes aient des

effets directs ou indirects bénéfiques ou neutres sur l’activité humaine, une faible

proportion (<1% de toutes les espèces d’insectes décrites) est considérée comme lui étant

nuisible (Gullan et Cranston, 2000 ; Coulson et Witter, 1984). Les insectes nuisibles sont

généralement divisés en trois grandes catégories fonctionnelles: (i) ceux qui transmettent

des maladies aux humains et aux animaux domestiques, (ii) ceux qui détruisent des

produits fabriqués par l’Homme et (iii) ceux qui détruisent ou réduisent la croissance des

cultures agricoles et des arbres (Ross, 1965).

Pour la gestion des insectes ravageurs, on a recours à différents produits antiparasitaires

tels que les insecticides chimiques et biologiques. La répression des ravageurs forestiers

au moyen de pulvérisations d’insecticides chimiques conventionnels a joué un rôle

important dans la protection des forêts pendant plusieurs années. Cependant, leurs effets

négatifs sur l’environnement et la santé humaine ont graduellement entrainé leur

bannissement complet en milieu forestier en Amérique du Nord (Armstrong & Ives,

1995). Maintenant, on tend à utiliser des insecticides microbiens ou des insecticides de

synthèse à risques réduits, lesquels ciblent une fonction spécifique aux insectes et ont, par

1

conséquent, peu ou pas d’effets sur des organismes non-ciblés. Ainsi, des bactéries, des

virus, des champignons et des nématodes ont fait l’objet d’évaluations comme agents de

lutte biologique (Lacey et al, 2001), et certains ont été homologués et commercialisés.

Ces pesticides ont un moindre impact sur l’environnement et la santé humaine. Leur

utilisation entraîne donc une réduction des résidus de pesticides conventionnels et

contribue à la préservation des ennemis naturels.

1.1 La tordeuse des bourgeons de l’épinette, Choristoneura fumiferana

La tordeuse des bourgeons de l’épinette (TBE), Choristoneura fumiferana (Lepidoptera :

Tortricidae), est le ravageur forestier le plus important des forêts de conifères de l’est du

Canada. La TBE cause des dommages au cours de sa période larvaire en se nourrissant

des bourgeons et des jeunes pousses d’arbres. Une attaque sévère répétée sur plusieurs

années peut entraîner la mort des arbres infestés (Armstrong & Ives, 1995). La TBE

attaque principalement le sapin baumier (Abies balsamea), mais elle peut aussi causer des

damages importants à l’épinette rouge (Picea rubens), l’épinette blanche (Picea glauca)

et l’épinette noire (Picea mariana). Les populations de TBE atteignent des niveaux

épidémiques de façon cyclique et constituent ainsi une menace pour plus de cinquante

millions d’hectares de forêt. Les peuplements gravement affectés prennent une coloration

rouille en raison de la présence d’aiguilles desséchées et retenues par des fils de soie

tissés par les larves. À l’automne, la majorité des aiguilles mortes sont emportées par le

vent et les peuplements ainsi défoliés deviennent grisâtres (Dajoz, 2000).

1.1.1 Cycle Vital

Choristoneura fumiferana a un cycle vital comprenant six stades larvaires (Fig. 1-1). Les

papillons s’accouplent vers la mi-juillet et les femelles pondent leurs œufs directement

sur les aiguilles de sapin et d’épinette. Suite à l’éclosion de l’œuf, la larve (chenille) de

premier stade tisse, dans la cime de l’arbre, un petit abri de soie appelé « hibernacle ».

2

C’est alors que la chenille mue au deuxième stade larvaire et interrompt son

développement jusqu’à la fin de l’hiver ; pendant cette période de dormance appelée

diapause, la chenille cesse de se nourrir. En mai, la larve de deuxième stade quitte son

hibernacle et mue au troisième stade larvaire, après quoi elle commence à se nourrir de

jeunes aiguilles. Généralement, c’est aux stades avancés de développement (4e, 5e et 6e

stades) que cet insecte cause le plus de dommages au feuillage. Les larves sont reconnues

à leur corps brun (18-24 mm de longueur) et leur tête noire. Au mois de juin, la larve de

6e stade cesse de se nourrir et entreprend la recherche d’un endroit, de préférence la cime

des arbres, pour sa pupaison et sa métamorphose. Les papillons adultes émergent vers la

fin juin-début juillet (Dajoz, 2000).

Figure 1-1 Schéma du cycle vital de la tordeuse des bourgeons de l'épinette. (https://email.nrcan.gc.ca/exchweb/bin/redir.asp?URL=http://www.srd.gov.ab.ca/forests/health/insects/sprucebudworm.aspx

La TBE est attaquée par de nombreux prédateurs et parasitoïdes. La plupart des insectes

parasitoïdes font partie de l’ordre des Diptères (mouches et moustiques) et de l’ordre des

Hyménoptères (guêpes, abeilles et fourmis). Différents parasitoïdes s’attaquent à

différents stades développementaux de la TBE, tels les œufs, les jeunes larves, les larves

plus âgées et les pupes (Dajoz, 2000).

3

1.2 Les parasitoïdes

Les parasitoïdes forment un vaste groupe d’ennemis naturels que l’on peut diviser en

deux grandes catégories selon que le développement de leurs stades immatures est

complété à l’extérieur (i.e., sur la face externe ; ectoparasitoïdes) ou à l’intérieur de l’hôte

(endoparasitoïdes). Dans un cas comme dans l’autre, la parasitoïde entraîne ultimement la

mort de son hôte. Les parasitoïdes Hyménoptères appartiennent au sous-ordre des

Apocrita, au sein duquel on trouve deux superfamilles. La mieux connue de celles-ci,

Ichneumonidea, est composée des familles Ichneumonidae et Braconidae. Les femelles

appartenant à ces familles utilisent leur ovipositeur (appendice abdominal) pour parasiter

leur hôte (i.e., y pondre un œuf ; Hajek, 2004).

Les insectes hôtes réagissent à la présence de corps étrangers tels les œufs d’un

endoparasitoïde en les « encapsulant », c’est-à-dire en les couvrant de plusieurs couches

d’hémocytes, une réaction qui est généralement accompagnée d’une mélanisation de la

capsule. Cette réponse est connue sous le nom d’encapsulement (Asgari, 2007).

Toutefois, certains parasitoïdes ont développé des moyens de se protéger contre cette

réaction ou même de l’inhiber. Plusieurs facteurs naturels qui sont injectés dans la larve

hôte au moment de la ponte, tels des venins, des protéines ovariennes, et des particules

pseudovirales, sont impliqués dans la protection de l’œuf et de la jeune larve contre la

réponse immunitaire de l’hôte. Alors que certains de ces facteurs protègent la guêpe

immature de façon passive, d’autres participent à l’inhibition active de la réponse

immunitaire de l’hôte. Par exemple, les œufs de Braconidae, au moment de leur éclosion,

libèrent des cellules géantes connues sous le nom de « tératocytes » ; ces cellules ont été

impliquées dans la suppression de la réponse immunitaire de l’hôte (Asgari, 2007).

Certains virus ont un effet semblable.

1.3 Polydnavirus

Parmi les agents transmis par certaines guêpes endoparasitoïdes à leur hôte pour inhiber

l’encapsulation, on compte les polydnavirus (PDV), lesquels constituent un groupe de

4

virus uniques en raison de l’association mutualiste obligatoire qu’ils forment avec

certaines guêpes endoparasitoïdes des familles Braconidae et Ichneumonidae. Le génome

des polydnavirus est constitué de plusieurs segments génomiques circulaires d’ADNdb ;

cette particularité génomique est d’ailleurs à l’origine de leur nom (Polydisperse DNA

Virus). Les PDV sont transmis à l’hôte Lépidoptère au moment de l’oviposition, et

l’expression de certains de leurs gènes est essentielle au succès du développement de

l’œuf et de la larve de guêpe dans la chenille hôte (Stoltz, 1993; Krell et al., 1982;

Turnbull & Webb, 2002).

1.3.1 Classification

Les virus sont classifiés en fonction de la nature de leur génome (ADN ou ARN, simple

ou double brin, linéaire ou circulaire, segmenté ou non, etc.), de la morphologie de leur

virion, de leur spectre d’hôtes, et de leur cycle vital. Le "International Committee on

Taxonomy of Viruses" (ICTV) reconnait présentement les PDV comme formant une

famille distincte, les Polydnaviridae, laquelle inclut les seuls virus (connus) possédant un

génome segmenté composé d’ADN circulaire double brin. Tel que mentionné ci-dessus,

les PDV sont associés à certaines guêpes des familles Braconidae et Ichneumonidae;

l’ICTV reconnait de ce fait deux genres, les Bracovirus (BV) et les Ichnovirus (IV). Bien

qu’ils partagent de nombreuses caractéristiques, les IV et les BV semblent avoir des

origines évolutives distinctes (Whitefield, 2002; Bezier et al., 2009). Chez les Braconidae

et les Ichneumonidae, quatre (Cheloninae, Microgastrinae, Cardiochilinae et Miracinae)

et deux (Campoleginae et Banchinae) sous-familles, respectivement, ont été identifiées

comme contenant des guêpes porteuses de PDV (Stoltz et al, 1995a). Bien que les virus

associés aux quatre sous-familles de Braconidae semblent avoir un ancêtre commun

(Bezier et al., 2009), il pourrait en être autrement des virus associés aux deux sous-

familles d’Ichneumonidae (Lapointe et al., 2007).

5

1.3.2 Cycle Vital

Le génome des PDV est intégré au génome de la guêpe hôte sous forme de provirus; la

transmission du virus à travers la population de guêpes est donc mendélienne (verticale)

(Fleming et Summers, 1986; Stoltz et al., 1986; Stoltz, 1990, Fleming & Krell, 1993).

Le cycle vital des PDV comporte deux volets (ou deux "bras"): le premier est constitué de

la réplication et de la transmission, alors que le deuxième est constitué de l’infection et de

l’expression des gènes viraux dans l’hôte Lépidoptère (Stoltz, 1993). La réplication du

génome viral est confinée à une portion spécialisée des ovaires de la guêpe, le « calice »,

lequel est situé à la jonction des ovarioles et de l’oviducte latéral. La réplication

commence au stade pupal du développement de la guêpe femelle, en réponse à des

changements dans les titres d’ecdystéroïdes. Bien que les connaissances sur le mécanisme

de réplication des PDV demeurent pour l’instant limitées, selon le scénario le plus

probable, des groupes de segments proviraux sont excisés des chromosomes de la guêpe,

puis amplifiés pour former des épisomes circulaires par un mécanisme du type « rolling

circle » (Webb, 1998 ; Marti et al, 2003). Il y a alors encapsidation dans le noyau, où les

particules virales acquièrent leur première (IV) ou unique (BV) enveloppe. Les virions

migrent alors vers la membrane cytoplasmique pour être libérées dans la lumière de

l’oviducte. Là, les virions forment la fraction particulaire du « fluide du calice » (CF),

dans lequel baignent les œufs de la guêpe (Stoltz & Vinson, 1977 ; Kroemer & Webb,

2004).

Les bracovirus sont libérés dans l’oviducte par la lyse des cellules épithéliales du calice,

alors que les ichnovirus sont libérés par exocytose. C’est ainsi que les ichnovirus

acquièrent une deuxième membrane unitaire, celle-ci étant constituée d’une portion

d’épithélium du calice (Norton et al., 1975; Stoltz & Vinson, 1977; Stoltz & Vinson,

1979; Stoltz et al., 1976).

Au moment de l’oviposition, la guêpe transmet le virus à la chenille hôte. Il n’y a pas de

réplication virale chez celle-ci, mais l’expression de gènes viraux entraîne la production

de protéines qui sont impliquées dans la protection des œufs et des larves de guêpe contre

6

la réponse immunitaire de la chenille hôte ainsi que dans la régulation développementale

de la chenille hôte (Stoltz, 1993; Stoltz & Vinson, 1977; Stoltz et al, 1986; Tanaka &

Vinson, 1991). Ainsi, c’est l’expression de gènes polydnaviraux qui permet à la guêpe de

compléter son développement larvaire, et c’est la survie de la guêpe qui permet la

transmission du génome proviral à la génération suivante.

1.3.3 Organization du genome

Bien que le génome de tous les PDV soit constitué de segments circulaires d’ADNdb, le

nombre (~25 à > 100) et la taille (~2 à 42 kb) des segments génomiques varient d’une

espèce à l’autre (Tanaka et al, 2007; Krell et al., 1982; Fleming, 1992). La taille du

génome des polydnavirus est difficile à estimer de façon précise, mais on sait qu’ils sont

typiquement de grande taille (187 à 567 kb), polymorphiques, qu’ils contiennent une

proportion importante d’ADN non-codant (70%) et qu’ils sont dépourvus de gènes

nécessaires à la réplication ou à l’élaboration des protéines structurales de la capside.

Puisque la réplication est confinée à l’ovaire de la guêpe, les gènes de rréplication ne sont

présents que dans le génome de la guêpe (i.e. ne sont pas encapsidés). D’ailleurs, une

équipe vient d’identifier, dans les génomes de guêpes porteuses, des gènes d’origine

nudivirale encodant des protéines structurales de BV (Bezier et al., 2009). Les gènes

polydnaviraux peuvent donc tous être qualifiés de gènes de virulence, i.e., qui induisent

des pathologies chez la chenille hôte (Tanaka et al., 2007).

Dans un génome polydnaviral les segments génomiques ne sont pas présents en quantités

équimolaires, ce qui entraîne des différences de dosage génique pouvant affecter le

niveau d’expression de certains gènes chez les chenilles infectées. Bien que l’expression

des gènes polydnaviraux ait été étudiée principalement chez les larves parasitées, certains

de ces gènes sont aussi exprimés chez la guêpe porteuse. On reconnait d’ailleurs trois

classes de gènes polydnaviraux: les gènes de classe I, qui sont exprimés chez la guêpe

durant la réplication du virus, ceux de classe II, qui sont exprimés chez l’hôte parasité, et

ceux de classe III, qui sont exprimés à la fois chez la guêpe et chez son hôte lépidoptère

(Theilmann & Summers, 1988; Kroemer & Webb, 2004). Les guêpes « infectées » (ou

7

« porteuses ») étant asymptomatiques, on comprend que les gènes de la classe II, dont

l’expression est responsable des effets pathologiques observés chez la chenille hôte, aient

reçu plus d’attention que ceux des autres classes (Kroemer & Webb, 2004). Il faut

cependant noter que les gènes de virulences identifiés chez les BV et les IV sont, pour la

majorité, distincts les uns des autres.

1.3.4 Bracovirus

Les virions des bracovirus sont constitués de nucléocapsides cylindriques de diamètre

uniforme mais de longueur variable. Les virions sont composés d’une ou de plusieurs

nucléocapsides, enveloppées par une membrane unitaire simple. Des analyses ont montré

que chaque nucléocapside contient un seul segment génomique, et que la longueur de la

nucléocapside est vraisemblablement proportionnelle à la taille du segment génomique

qu’elle contient (Albrecht et al., 1994; Beck et al., 2007).

Chez les PDV de façon générale, les gènes se sont diversifiés en familles, et le génome

d’un virus contient typiquement plusieurs familles de gènes. Pour les BV, on en a recensé

dix: EP-1, egf, glc, HP, PTP, cyst, BV-like et Rec-like, crp (ou Cys) et ank. Seules ces

deux dernières familles sont communes aux IV et aux BV (Kroemer & Webb, 2004).

Certaines de ces familles contiennent des gènes qui codent pour des protéines affichant

des similitudes significatives à d’autres protéines eucaryotiques déjà caractérisées. C’est

le cas, par exemple, des protéines Egf-motif du BV de Microplitis demolitor (MdBV). Ces

gènes génèrent des transcrits épissés qui codent pour des protéines homologues aux

facteurs de croissance épidermique, lesquels sont riches en cystéines (Strand et al., 1997;

Trudeau et al., 2000). Cette similitude a permis de formuler des hypothèses quant à leur

fonction et de les évaluer.

8

1.3.5 Ichnovirus

Sur la base des connaissances actuelles, les génomes d’IV comportent plus de 20

segments génomiques dont la taille individuelle varie entre 2 et 28 kb. La taille totale du

génome est estimée à 250-300 kb. Les nucléocapsides d’ichnovirus de guêpes

campoplégines sont de forme lenticulaire et de taille relativement uniforme (~85 nm x

330 nm), et sont individuellement enveloppés de deux membranes unitaires (Stoltz, 1993;

Stoltz et al, 1995a ; Webb, 1998). Chaque nucléocapside est de taille suffisante pour

contenir le génome complet, bien que cette hypothèse n’ait pas encore été évaluée

expérimentalement. Les nucléocapsides d’ichnovirus de guêpes banchines sont de taille

plus petite et de longueur plus variable, et peuvent être enveloppés individuellement ou

en groupes (Lapointe et al., 2007).

Comme chez les BV, on reconnait plusieurs familles de gènes chez les IV de guêpes

campoplégines: Cys, rep, ank, inx, PRRP, TrV, et N. De façon étonnante, les familles de

gènes des IV de guêpes banchines s’apparentent davantage à celles des BV (pour plus de

détails, voir Lapointe et al., 2007). Les fonctions des gènes de certaines familles sont

connues (ou on a une bonne idée de ce qu’elles semblent être) en raison de la similitude

des protéines encodées à d’autres protéines eucaryotiques déjà caractérisées. C’est le cas,

par exemple, des ankyrines (ank), des innexines (inx) et des protéines Cys-motif (Cys) ;

toutes ces protéines semblent être impliquées dans la dépression du système immunitaire

de l’hôte (Kroemer & Webb, 2004). Par contre, d’autres ne présentent aucune similitude

à des protéines connues ou n’affichent aucun motif reconnaissable. C’est le cas, par

exemples, des protéines des familles TrV et rep. Les gènes ichnoviraux rep (repeat

element protein) sont ainsi nommés parce qu’ils contiennent des motifs d’éléments

répétés imparfaits de ~540 bp (Theilmann & Summers, 1988). Ils représentent la famille

de gènes ichnoviraux la plus hautement conservée et la mieux représentée (50% des

gènes assignés) chez les quatre espèces étudiées (Tanaka et al. 2007; Volkoff et al. 2002;

Galibert et al. 2006). Des études antérieures suggèrent qu’ils encodent des protéines non-

sécrétées de fonction inconnue (Tanaka et al, 2007).

9

1.4 La guêpe Tranosema rostrale, un parasitoïde de la TBE

Parmi les parasitoïdes qui attaquent communément la TBE dans la région de Québec, on

compte la guêpe Tranosema rostrale (Brischke) (Hymenoptera : Ichneumonidae :

Campopleginae). Il s’agit d’un endoparasitoïde solitaire capable de pondre dans tous les

stades post-diapausants de son hôte, avec une préférence pour les stades 3 à 5 (Cusson et

al., 1998b).

1.4.1 Le polydnavirus de Tranosema rostrale (TrIV)

La guêpe ichneumone T. rostrale pond ses œufs dans la cavité abdominale de son hôte

principal, la TBE. Au moment de la ponte, la guêpe femelle injecte dans son hôte une

dose de polydnavirus, lequel est connu sous le nom de Tranosema rostrale ichnovirus

(TrIV). Contrairement à d’autres IVs caractérisés à ce jour, TrIV ne semble pas jouer un

rôle important dans la suppression de la réponse immunitaire cellulaire de l’hôte.

Toutefois, il inhibe très fortement la métamorphose (Doucet et Cusson, 1996a, b). Dans

l’hôte parasité, les gènes viraux sont exprimés, ce qui mène à des changements qui

permettent aux œufs et larves de guêpe d’achever leur développement (Doucet et Cusson,

1998 a, b). Le parasitisme débute à la fin mai dans la région de Québec et le

développement post-embryonnaire comprend trois stades larvaires qui durent environ 14

jours à 20°C. Au premier stade larvaire, les larves se nourrissent des tissus de l’hôte

(Cusson et al, 1998a). À la fin du troisième stade, les larves de T. rostrale quittent leur

hôte et tissent un cocon dans lequel elles entreprennent la pupaison et la métamorphose.

La guêpe adulte émerge du cocon au bout de 9 à 10 jours; en forêt, cela correspond à la

fin juin-début juillet. Quelques jours après l’émergence, les adultes sont prêts pour la

reproduction et on croit qu’une ou deux autres générations additionnelles se produisent au

cours du reste de l’été sur des hôtes autres que la TBE (Fig. 1-2) (Cusson et al., 1998a).

Plus de 80% du génome de TrIV a été séquencé et sa taille totale est estimée à environ

250 kb. L’analyse du génome de TrIV indique la présence de représentants de chacune

10

des familles connues de gènes d’ichnovirus. Le génome de TrIV contient aussi une

famille, TrV, qui semble lui être unique (Tanaka et al., 2007).

œuf

larve

Polydnavirus

pupe dans

adulte

ponte

Pup s

c

e dan

ocon

Figure 1-2 Représentation schématisée du cycle vital de Tranosema rostrale (Laforge, 1999).

Le génome de TrIV contient au moins 17 cadres de lecture ouverts (« open reading

frames » ou ORF) encodant des protéines rep; les gènes sont situés sur 10 segments

génomiques différents (Tanaka et al., 2007). Tel que mentionné ci-dessus, la fonction de

ces gènes est inconnue. Parce qu’ils représentent la famille de gènes ichnoviraux la plus

hautement conservée et la mieux représentée chez les quatre espèces étudiées, on peut

supposer que leur fonction au cours du parasitisme est d’une d’importance fondamentale.

1.5 Objectifs du projet

Cette étude a d’abord été entreprise dans le but d’explorer les fonctions possibles des

gènes rep chez les deux hôtes de TrIV, la chenille de TBE parasitée et la guêpe T.

rostrale. Dans un premier temps, j’ai réalisé une étude en q-RT-PCR pour quantifier les

transcrits des 17 gènes rep de TrIV chez des larves de TBE parasitées par T. rostrale ou

injectées du virus TrIV, ainsi que dans des tissus spécifiques de larves parasitées et des

ovaires de guêpes. En réalisant cette étude, j’espérais que les patrons de transcription

11

observés fournissent des indices sur la fonction possible des gènes rep. Ces analyses sont

présentées au Chapitre II.

Au Chapitre III, je compare l’expression des gènes rep à celle de plusieurs autres gènes

de TrIV identifiés lors de l’annotation du génome (Tanaka et al., 2007). À cette fin, j’ai

d’abord construit une banque d’ADNc en utilisant de l’ARN extrait de chenilles

infectées. En utilisant des amorces spécifiques pour chaque ORF, j’ai tenté d’amplifier

chaque gène par PCR à partir de la banque d’ADNc. Les amplicons ont alors été clonés

pour séquençage; dans les cas de gènes épissés, cette approche a permis de déterminer si

les jonctions d’épissage avaient été prédites correctement. En complément, j’ai évalué les

niveaux de transcrits pour les mêmes ORF dans des larves de TBE parasitées ou injectées

de virus ainsi que dans des ovaires guêpe, par qPCR. Cette étude, a permis de comparer

l’importance relative de chaque famille de gènes en termes de niveaux d’expression.

La conclusion générale, présentée au Chapitre IV, aborde des thèmes qui n’ont pu faire

l’objet d’un traitement approfondi dans les deux chapitres précédents. J’y explore aussi

quelques unes des façons dont la recherche sur les familles de gènes de PDV pourrait

mener à la mise au point de nouveaux outils de lutte contre les ravageurs.

A l’Annexe A, je présente le travail que j’ai entrepris dans le but d’évaluer, par analyse

«microarray», l’impact de la sur-expression d’un gène rep, dans des cellules de TBE, sur

la modulation de l’expression des gènes de TBE. L’objectif de ce travail était d’identifier

les voix métaboliques affectées par les gènes rep, ce qui pourrait fournir d’autres indices

sur leurs fonctions. Au moment de compléter la rédaction du présent mémoire, l’analyse

microarray n’avait pas encore été menée; ainsi, l’Annexe A décrit la procédure utilisée

pour la sur-expression d’un gène rep dans des cellules de TBE en culture. Les Annexes B

et C, quant à elles, contiennent des données supplémentaires relatives aux articles

reproduits dans les Chapitres II et III, respectivement.

12

1.6 Références

1. Albrecht, A., Wyler, T., Pfister-Wilhelm, R., Heiniger, P., Hurt, E., Gruber, A.,

Schumperli, D. & Lanzrein, B., (1994) Polydnavirus of the parasitic wasp

Chelonus inanitus (Braconidae): characterization, genome organization and time

point of replication. J. Gen. Virol. 75, 3353-3363.

2. Armstrong, J.A. & Ives, W.G.H. (1995). Introduction. Insectes forestiers

ravageurs au Canada. Armstrong J.A. et Ives, W.G.H., Eds. Ressources naturelles

Canada, Ottawa.

3. Asgari, S. (2007). Endoparasitoid venom proteins as modulators of host immunity

and development. In Rivers, D. and Yoder, J. (Ed.), Recent Advances in the

Biochemistry, Toxicity, and Mode of Action of Parasitic Wasp Venoms (pp. 57-

73) India: Research Signpost.

4. Beck, M. H., Inman, R. B. & Strand, M. R. (2007). Microplitis demolitor

bracovirus genome segments vary in abundance and are individually packaged in

virions. Virology. 359, 179-189.

5. Bézier, A., Annaheim, M., Herbinière, J., et al. (2009). Polydnaviruses of

braconid wasps derive from an ancestral nudivirus. Science. 323, 926 – 930.

6. Coulson, R., Witter, J. (1984). Forest entomology, ecology, and management.

New York: John Wiley. 669 pp.

7. Cusson, M., Barron, J.R., Goilet, H., Régnière, J. & Doucet, D. (1998a). Biology

and status of Tranosema rostrale (Hymenoptera: Ichneumonidae), a parasitoid of

the eastern spruce budworm (Lepidoptera: Tortricidae). Ann. Entomol. Soc. Am.

91, 87-93.

8. Cusson, M., Lucarotti, C., Stoltz, D., Krell, P. & Doucet, D. (1998b). A

polydnavirus from the spruce budworm parasitoid, Tranosema rostrale

(Ichneumonidae). J. Invertebr. Pathol. 72, 50-56.

13

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Beck%20MH%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Strand%20MR%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

9. Dajoz, R. (2000). Insects and Forests, the Role and Diversity of Insects in the

Forest Environment. Intercept Ltd, New York.

10. Doucet D, Cusson M. (1996a). Alteration of developmental rate and growth of

Choristoneura fumiferana parasitized by Tranosema rostrale: role of the calyx

fluid. Entomol. Exp. Appl. 81, 21-30.

11. Doucet D, Cusson M. (1996b). Role of calyx fluid in alterations of immunity in

Choristoneura fumiferana larvae parasitized by Tranosema rostrale. Comp.

Biochem. Physiol. 114, 311-317.

12. Fleming, J.G.W. (1992). Polydnaviruses: mutualists and pathogens. Annu. Rev.

Entomol. 37, 401-425.

13. Fleming, J.G.W & Krell, P.J. (1993). Polydnavirus organization. In parasites and

pathogens of insects (Edited by Beckage N.E., Thampson, S.N. and Federici, B.

A.), Vol, 2, 189-225.

14. Fleming J.G.W. & Summers M.D. (1986). Campoletis sonorensis endoparasitic

wasps contain forms of C. sonorensis virus DNA suggestive of integrated and

extrachromosomal polydnavirus DNAs. J. Virol. 57, 552-562.

15. Galibert, L., Devauchelle, G., Cousserans, F., Rocher, J., Cérutti, P., Barat-

Houari, M., Fournier, P. & Volkoff, A. N. (2006). Members of the Hyposoter

didymator Ichnovirus repeat element gene family are differentially expressed in

Spodoptera frugiperda. J. Virol. 3, 48.

16. Gullan, P.J. & Cranston, P.S. (2000). The insects: An outline of entomology,

second edition. Blackwell Science Ltd, Eds., USA.

17. Hajek, A.E. (2004). Natural enemies: an introduction to biological control.

Cambridge University Press. Cambridge, UK.

14

18. Krell P.J., Summers M.D. & Vinson S.B. (1982). Virus with a multipartite

superhelical genome from the inchneumonid parasitoid, Campoletis sonorensis. J.

Virol. 43, 859-870.

19. Kroemer, J. A. & Webb, B. A. (2004). Polydnavirus genes and genomes:

emerging gene families and new insights into polydnavirus replication. Annu.

Rev. Entomol. 49, 431-456.

20. Lacey, L.A., Frutos R., Kaya H.K. & Vail, P. (2001). Insect pathogens as

biological control agents: Do they have a future? Biol. Control. 21, 230-248.

21. Laforge, M. (1999). Expression des gènes du polydnavirus de Tranosema rostrale

chez La tordeuse des bourgeons de L’épinette, Choristoneura fumiferana.

Mémoire de maîtrise, Faculté des études supérieures de l’Université Laval.

22. Lapointe, R., Tanaka K., Barney, W. E., Whitfield, J. B., Banks, J. C, Béliveau,

C., Stoltz, D., Webb, B. A., and Cusson M. (2007). Genomic and Morphological

Features of a Banchine Polydnavirus: Comparison with Bracoviruses and

Ichnoviruses. J. Virol. 81, 6491-6501.

23. Marti, D., Grossniklaus-Burgin, C., Wyder, S., Wyler, T. & Lanzrein, B. (2003).

Ovary development and polydnavirus morphogenesis in the parasitic wasp

Chelonus inanitus. I. Ovary morphogenesis, amplification of viral DNA and

ecdysteroid titres. J. Gen. Virol. 84, 1141–1150.

24. Norton, W.N., Vinson, S.B. & Stoltz, D.B. (1975). Nuclear secretory particles

associated with the calyx cells of the inchneumonid parasitoid Campoletis

sonorensis (Cameron). Cell Tissue. Res. 162, 195-208.

25. Stoltz, D.B., Beckage, N.E., Blissard, G.W., Fleming, J.G.W., Krell, P.J.,

Theilmann, D.A., Summers, M.D. & Webb, B.A. (1995a). Family Polydnaviridae.

Virus Taxonomy. Murphy, F.A., Fauquet, C.M., Bishop, D.H.L., Ghabrial, S.A.,

Jarvis, A.W., Martelli, G.P., Mayo, M.A. & Summers, M.D., Eds. Springer-

Verlag, New York.

15

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Kroemer%20JA%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Webb%20BA%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

26. Stoltz, D., Shen, X.-R., Boggis, C. & Sisson, G. (1995b). Molecular diagnosis of

Kashmir bee virus infection. J. Apic Res. 34, 153–160.

27. Stoltz, D. B. (1993). The polydnavirus life cycle. In Parasites and Pathogens of

Insects, 1, 80-101. Edited by N. Beckage, S. N. Thompson & B. A. Federici. San

Diego, CA: Academic Press.

28. Stoltz, D.B. (1990). Evidence for chromosomal transmission of polydnavirus

genomes. Can. J. Microbiol. 36, 538-543.

29. Stoltz, D. B., Guzo, D. & Cook, D. (1986). Studies on polydnavirus transmission.

Virology. 155, 120-131.

30. Stoltz, D.B. and Vinson S.B. (1979). Viruses and parasitism in insects. Adv. Virus

Res. 24, 125-171.

31. Stoltz, D.B., & Vinson, S.B. (1977). Baculovirus-like particles in the reproductive

tracts of female parasitoid wasps. II. The genus Apanteles. Can. J. Microbiol. 23,

28-37.

32. Stoltz, D.B., Vinson, S.B. & MacKinnon E.A. (1976). Baculovirus-like particles

in the reproductive tracts of female parasitoid wasps. Can. J. Microbiol. 22, 1013-

1023.

33. Strand, M.R., Witherell, R.A. and Trudeau, D. (1997). Two Microplitis demolitor

polydnavirus mRNAs expressed in hemocytes of pseudoplusia includens contain

a common cysteine-rich domain. J. Virol. 71, 2146-2156.

34. Tanaka, K., Lapointe, R., Barney, W. E., Makkay, A. M., Stoltz, D., Cusson, M. &

Webb, B. A. (2007). Shared and species-specific features among ichnovirus

genomes. Virology. 363, 26-35.

35. Tanaka, T. and Vinson, S.B. (1991). Depression of prothoracic gland activity of

Heliothis virescens by venom and calyx fluids from the parasitoid, Cardiochiles

nigriceps. J. Insect. Physiol. 37, 139–144.

16

http://www.ncbi.nlm.nih.gov/pubmed/3776098?ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum

http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T79-4B6C91S-1&_user=319368&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000014578&_version=1&_urlVersion=0&_userid=319368&md5=9f2e4a1626349609fabe038f2ea29d4d#bbib35

17

36. Theilmann, D. A. & Summers, M. D. (1988). Identification and comparison of

Campoletis sonorensis virus transcripts expressed from four genomic segments in

the insect hosts Campoletis sonorensis and Heliothis virescens. Virology. 167,

329-341.

37. Trudeau, D., Witherell, R.A., Strand, M.R. (2000). Characterization of two novel

Microplitis demolitor polydnavirus mRNAs expressed in Pseudoplusia includens

haemocytes. J. Gen. Virol. 81, 3049– 3058

38. Turnbull M, Webb B. (2002). Perspectives on polydnavirus origines and

evolution. Adv. Virus Res. 58, 203-54.

39. Webb, B.A. (1998). Polydnavirus biology, genome structure, and evolution. In

Insect Viruses. Miller, L.K. & Ball, L.A., Eds. Plenum Publishing Corporation,

New York.

40. Whitfield, J.B. (2002). Estimating the age of the polydnavirus/braconid wasp

symbiosis. PNAS. 99, 7508-7513.

41. Volkoff, A. N., Béliveau, C., Rocher, J., Hilgarth, R., Levasseur, A., Duonor-

Cérutti, M., Cusson, M. & Webb, B. A. (2002). Evidence for a conserved

polydnavirus gene family: ichnovirus homologs of the CsIV repeat element genes.

Virology. 300, 316-331.


http://www.ncbi.nlm.nih.gov/pubmed/12205780?ordinalpos=2&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DefaultReportPanel.Pubmed_RVDocSum

http://www.ncbi.nlm.nih.gov/pubmed/12205780?ordinalpos=2&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DefaultReportPanel.Pubmed_RVDocSum

CHAPITRE 2

Tranosema rostrale ichnovirus repeat element

genes display distinct transcriptional patterns in

caterpillar and wasp hosts1

2.1 Summary

The endoparasitic wasp Tranosema rostrale transmits an ichnovirus (IV) to its

lepidopteran host, Choristoneura fumiferana, during parasitization. As shown for other

IVs, the segmented dsDNA genome of the T. rostrale virus (TrIV) features several multi-

gene families, including the repeat element (rep) family, whose products display no

known similarity to non-IV proteins, except for a homolog encoded by the genome of the

Helicoverpa armigera granulovirus; their functions remain unknown. This study applied

linear regression of efficiency analysis to the real-time PCR quantification of transcript

abundance for all 17 TrIV rep open reading frames (ORFs), in parasitized and virus-

injected C. fumiferana larvae, as well as in T. rostrale ovaries and head-thorax

complexes. Although transcripts were detected for most rep ORFs in infected caterpillars,

1 This chapter appeared in the June 2009 issue of Journal of General Virology. Rasoolizadeh, A., Béliveau C., Stewart

D., Cloutier C., & Cusson M. (2009). Tranosema rostrale ichnovirus repeat element genes display distinct

transcriptional patterns in caterpillar and wasp hosts. J. Gen. Virol. 90 (6), 1505-1514.

18

two of them clearly outnumbered the others in whole larvae, with a tendency for levels to

drop over time after infection. The genome segments bearing the three most highly

expressed rep genes in parasitized caterpillars were present in higher proportions than

other rep-bearing genome segments in TrIV DNA, suggesting a possible role for gene

dosage in the regulation of transcription level. TrIV rep genes also showed important

differences in the relative abundance of their transcripts in specific tissues (cuticular

epithelium, fat body, haemocytes, and midgut), implying tissue-specific roles for

individual members of this gene family. Significantly, no rep transcripts were detected in

T. rostrale head-thorax complexes whereas some were abundant in ovaries. There, the

transcriptional pattern was completely different from that observed in infected

caterpillars, suggesting that some rep genes have wasp-specific functions.

2.2 Résumé

La guêpe endoparasitoïde Tranosema rostrale transmet un ichnovirus (“TrIV") à son hôte

lépidoptère, Choristoneura fumiferana, au moment de la ponte. TrIV possède un génome

segmenté à ADN double-brin circulaire, lequel contient des gènes appartenant à plusieurs

familles, dont la famille repeat element (rep). Les produits de ces gènes n’ont pas

d’homologues connus à l’extérieur des ichnovirus, à l'exception de protéines encodées

par le génome du granulovirus d’Helicoverpa armigera; leurs fonctions demeurent

inconnues. La présente étude a appliqué la méthode LRE à l’analyse RT-PCR en temps

réel (qPCR) pour quantifier l'abondance des transcrits de 17 gènes rep de TrIV chez des

larves de C. fumiferana parasitées par T. rostrale ou injectées du virus, ainsi que dans les

ovaires et le complexe tête-thorax de T. rostrale. Alors que des transcrits ont été détectés

pour la majorité des gènes rep dans des chenilles infectées, deux d'entre eux avaient des

transcrits beaucoup plus abondants que ceux des autres gènes rep dans des larves

infectées, avec une tendance à la baisse des niveaux au fil du temps après l'infection. Les

segments génomiques portant les trois gènes rep qui étaient exprimés le plus fortement

dans les chenilles parasitées étaient présents, dans l'ADN de TrIV, en proportions plus

élevées que les autres segments génomiques portant des gènes rep, ce qui suggère un rôle

possible pour le dosage des gènes dans la régulation du niveau de transcription.

19

L’abondance relative des transcripts de chaque gène rep de TrIV s’est avérée variable

parmi quatre tissus larvaires de C. fumiferana (épithélium cuticulaire, corps gras,

hémocytes et intestin moyen), ce qui suggère des rôles distincts ou la spécialisation de

ces gènes à l’égard des différents tissus. Bien qu’aucun transcrit de gène rep n’ait été

détecté dans le complexe tête-thorax de T. rostrale, certains étaient abondants dans les

ovaires. Là, le patron de transcription était complètement différent de celui observé chez

des chenilles infectées, ce qui suggère que certains gènes rep ont des fonctions

spécifiques à la guêpe.

2.3 Introduction

Hymenopteran endoparasitoids deposit their eggs within the haemocoele of arthropods,

most of which are insects (Eggleton & Belshaw, 1993). To protect their eggs from

detection by the host immune system and to provide an appropriate developmental and

physiological milieu for survival of their immature progeny within the host, female wasps

typically inject their eggs along with various materials capable of disguising the egg

surface and/or altering host physiology. For example some members of the families

Ichneumonidae and Braconidae transmit, to their caterpillar hosts, a virus that is essential

for survival of the immature wasp within the parasitized insect (reviewed in Stoltz, 1993).

These viruses, known as polydnaviruses (PDVs), feature a segmented, circular dsDNA

genome, with individual genome segments varying in size and genetic content. A copy of

the viral genome is present as a provirus within the wasp’s chromosomes, thus providing

a mechanism for the vertical transmission of PDVs within parasitoid populations. Viral

replication is restricted to the calyx region of the wasp ovary, from which virions are

released into the lumen of lateral oviducts. There, they form the particulate fraction of the

"calyx fluid" (CF). During oviposition a female wasp injects one or more eggs, along

with CF and other secreted proteins and venom, into the lepidopteran host. Although no

viral replication occurs in parasitized caterpillar, expression of PDV genes causes

developmental and immune dysfunctions that protect the egg and wasp larvae from

encapsulation by host hemocytes and/or lead to retardation or arrest of host

20

metamorphosis, thus providing more time for the wasp larva to complete its development

in advance of host pupation (reviewed in Kroemer & Webb, 2004; Stoltz, 1993).

PDV genes are divided into three large categories based on whether they are expressed in

the carrier wasp (class I), the infected caterpillar (class II) or both (class III; Theilmann &

Summers, 1988). Because of their potentially major significance in the success of

parasitism, class II genes have been studied more extensively than those of the other two

groups. A number of these genes encode proteins displaying motifs or structural and

sequence features observed in previously characterized eukaryotic proteins. Based on

these similarities, it has been possible to generate and test hypotheses about their likely

functions. Such an approach has led to proposed functions for various PDV genes (e.g.,

the vankyrins; Falabella et al., 2007; Kroemer & Webb, 2005; Thoetkiattikul et al.,

2005).

Other PDV genes, however, display no known similarity to other eukaryotic or viral

(non-PDV) genes, rendering their functional analysis more difficult. Such is the case of

the repeat element (rep) gene family, the largest gene family identified to date in the

genus Ichnovirus (PDVs associated with ichneumonid wasps). These genes consist of

imperfectly conserved repeats of ~540-bp arranged either singly or in direct tandem

arrays (Theilmann & Summers, 1987). Members of the rep gene family encode non-

secreted proteins that are conserved among several ichnovirus species (Tanaka et al.,

2007; Volkoff et al., 2002; Webb et al., 2006). Expression of rep genes has been detected

in both parasitoids and their parasitized hosts (Galibert et al., 2006; Theilmann &

Summers, 1988). The Tranosema rostrale ichnovirus (TrIV) genome contains at least 17

different ORFs identified as belonging to the rep gene family; they are located on 10

different genome segments (Tanaka et al., 2007). In an earlier study, two TrIV rep genes

(TrFrep1 and TrFrep2) were shown to be expressed from TrIV genome segment F

(Volkoff et al., 2002; this genome segment has been renamed F1 and the two rep genes it

contains are now referred to as F1-1 and F1-2; Tanaka et al., 2007). As a first step

towards elucidating the function(s) of these gene products, we initiated a study of the

temporal and tissue-specific transcription of all known and putative TrIV rep genes. A

similar study of 10 rep genes from the ichnovirus of Hyposoter dydimator (HdIV) has

21

revealed important differences in gene-specific transcript abundance, but minor

differences in host and tissue specificity (Galibert et al., 2006). Using a recently

developed and powerful qPCR approach (Rutledge and Stewart, 2008a, b), the present

study examines transcriptional patterns in the host Choristoneura fumiferana, either

naturally parasitized by T. rostrale or injected with its CF, as well as in the wasp’s

ovaries and head-thorax complexes. We also examine the possible effect of gene dosage

(i.e. relative genome segment abundance) on rep gene transcription. Finally, we present

new bioinformatics analyses conducted with the intent of detecting rep homologs among

more recent GenBank entries.

2.4 Material and methods

2.4.1 RNA and DNA extraction

Within 24 h after the moult to the last (6th) instar, C. fumiferana larvae were either

parasitized once by T. rostrale or injected with 0.5 female-equivalent (FE) of T. rostrale

calyx fluid (CF), as described (Doucet & Cusson, 1996 a, b). For each sampling point [1,

3 and 5 d post-parasitization (p.p.) or post-injection (p.i.)], total RNA was extracted and

pooled from 3-5 whole C. fumiferana larvae, using the TRIZOL reagent (Invitrogen),

according to the manufacturer’s instructions (Béliveau et al., 2000). RNA was also

extracted from fat body (FB), cuticular epithelium (CE), midgut (MG) and haemocytes

(HC) obtained from a pool of 3-5 larvae 48 h after parasitization. In addition, total RNA

was extracted and pooled from five ovary pairs dissected from post-emergence 5-10 day-

old T. rostrale females, using the QIAshredder and RNeasy Mini Kit (Qiagen), according

to the manufacturer’s instructions. The head-thorax complexes of the same five females

were also subjected to total RNA extraction using the TRIZOL reagent.

TrIV DNA was extracted from the CF of 16 T. rostrale female wasps as described (Stoltz

et al., 1986). The DNA was first ethanol-precipitated and then resuspended in 100 μl TE,

pH 7.6.

22

2.4.2 Reverse transcription and qPCR

To remove DNA contaminants from RNA extracts, 500 ng of total RNA was treated with

2 U amplification-grade DNase I (Invitrogen) for 15 min at 25°C. We ran controls with

no reverse transcriptase for the four most highly transcribed ORFs and detected no

significant amplification, indicating the absence of genomic DNA contamination in the

extracts. RNA (500 ng) from parasitized and CF-injected C. fumiferana larvae, as well as

from T. rostrale head-thorax complexes, and 200 ng RNA from ovarian tissue was

reverse-transcribed using 0.5 µg of an oligo(dT) primer and 200 U Superscript II RNase

H- reverse transcriptase (Invitrogen). The reaction was carried out in 1x PCR buffer, with

0.5 mM of each dNTP and 40 U of RNAguard ribonuclease inhibitor (Amersham

Biosciences), at 42˚C for 50 min.

For qPCR analysis, four primers were initially designed for each rep gene, using diverse

regions among aligned rep nucleotide sequences. These four primer pairs were used to

assess primer performance and quantitative precision. Initial amplification tests were

conducted on reverse-transcribed RNA obtained from parasitized C. fumiferana larvae. A

single primer pair was then selected for each rep gene (see Supplementary data in

Annexe B), based upon high amplification efficiency and lack of non-specific

amplification products, and used for the analysis of the remaining samples.

PCR amplifications were carried out on aliquots of individual RT reactions containing

cDNA in amounts equivalent to 2.5 ng RNA, except for ovarian samples, which

contained amounts of cDNA equivalent to 1 ng RNA. Four replicate amplification

reactions containing 500 nM of each primer were conducted for each sample, using an

MX3000P spectrofluorometric thermal cycler (Stratagene) and QuantiTectTM SYBR

Green PCR Kit (Qiagen), initiated with a 15-min incubation at 95˚C, followed by a

cycling regime of 95˚C, 10 s and 65˚C, 2 min. Each run was completed with a melting

curve analysis to confirm the specificity of amplification and absence of primer dimers.

Amplification efficiency was determined for each amplification reaction using LRE

(“linear regression of efficiency”) analysis, and the number of target molecules calculated

using lambda genomic DNA as a quantitative standard (Rutledge & Stewart, 2008a, b).

23

LRE is a powerful methodology recently developed for modeling real-time qPCR

amplification. It provides absolute target amounts without the need to produce standard

curves and can generate absolute accuracies of < ±25%, while displaying single molecule

sensitivity.

To assess the proportion, within a TrIV DNA extract, of each rep gene-bearing genome

segment, the same qPCR approach was applied directly to 0.01 ng of TrIV DNA, using

one of the primer pairs designed for transcript quantification for each genome segment

(see Supplementary data in Annexe B).

To evaluate the accuracy of the measurements made here using LRE analysis, we applied

the “limiting dilution assay” (LDA; Wang & Spadoro, 1998) approach to three of our

samples, and compared the estimates obtained with each method. Briefly, based on

values determined by LRE, samples were diluted so that each of 20 replicate aliquots

would contain ~1 copy of cDNA or genomic DNA. As dictated by Poisson distribution, a

large proportion of aliquots will not contain a target molecule, and will fail to produce an

amplification profile. The average number of molecules per aliquot (Nav) can be

calculated using the equation:

total

nilLnNav

where nil is the number of amplification reactions failing to produce an amplification

profile and total is the total number of reactions [see Rutledge & Stewart, 2008b for

additional details about LDA]. Multiplication of Nav by the dilution factor provides the

LDA estimate.

2.4.3 Bioinformatics

To explore the possibility that sequences recently deposited in GenBank may be

homologous to ichnoviral rep genes, all TrIV rep proteins were submitted to a Blastp

24

analysis. Alignments of amino acid sequences were performed with CLUSTAL-X

(Thompson et al., 1997) using default settings.

2.5 Results and Discussion

2.5.1 Critical assessment of the LRE methodology

To assess the reliability of the qPCR estimates made in this study using the LRE

approach, target quantities in three of our samples were determined using both LRE and

LDA analysis. The LDA method generated estimates that were congruent with those

obtained by LRE analysis, for one DNA and two RNA samples (Table 2-1), confirming

the accuracy of the LRE methodology. In addition, amplification efficiencies were high

and uniform across all 17 rep genes, in all treatment groups, and across all 10 TrIV

genome segments, with maximal amplification efficiencies (Emax; see Rutledge & Stewart

2008a,b) of 101.3 ± 1.7% and 101.5 ± 1.5% (mean ± SD) for transcript and genome

segment abundance, respectively. Thus, in assessing transcript levels for large multi-gene

families such as those found in PDVs or for measuring the relative abundance of many

PDV genome segments, application of the LRE approach to qPCR determinations

provides unprecedented accuracy, and substantially improves analytical throughput over

methods requiring the production of standard curves for each DNA examined.

Table 2-1 Critical assessment of the accuracy of LRE-based qPCR determinations (Rutledge and Stewart, 2008a,b) by comparison with estimates obtained by application of the “limiting dilution assay” (LDA) method (Wang and Spadoro, 1998). Three example runs are shown here, two for transcript levels and one for viral DNA

(“Sample id”). Nil: number of amplification reactions failing to produce an amplification profile; Nav, mean number of molecules per aliquot (see Material and Methods for details). The LRE values reported here for transcripts (first two) are the copy number/2.5 ng of total RNA, while the value for C166 genomic DNA is the number of genome segments/0.01 ng of DNA (i.e., the concentrations at which the LRE measurements were made).

Sample id LRE values Dilution factor Nil Nav LDA values

F1.1, 3-d.p.p. 40,297 40,000 7 1.05 41,993

F1.1, 3-d.p.i. 137,822 140,000 8 0.92 128,281

C166 DNA 19,338 20,000 6 1.20 24,079

25

2.5.2 Transcript abundance in parasitized larvae

TrIV rep genes displayed important differences in gene-specific, time-dependent and

tissue-specific levels of transcripts in naturally parasitized last-stadium C. fumiferana

larvae. In whole caterpillars, transcripts were detected for almost all genes examined, but

transcript abundance was generally low [< 550 transcripts/ng total RNA] except for F1-1

(~16,000 at 3 days p.p.) and, to a lesser extent, F1-2 (~2,200 at 1 days p.p.; Fig 2-1).

Whether these differences in transcript abundance among rep genes are indicative of their

relative importance in the subjugation of C. fumiferana hosts is not clear, but the strong

predominance of F1-1 transcripts suggests that the product of this gene plays a vital role

in the success of parasitism.

Levels of rep gene transcripts were not stable during the course of parasitism and tended

to decrease by > 50% between the first (day 1) and last (day 5) sampling points p.p.,

although three genes (most notably F1-1) displayed higher levels of transcripts at 3 d p.p.

than at the other two sampling times (Fig 2-1). A temporal pattern of expression similar

to that observed here for F1-1 was reported earlier for another TrIV gene, TrV1, in

parasitized C. fumiferana larvae (Béliveau et al., 2000). Differences in temporal patterns

of expression among viral genes, in a given host, have been observed for other PDVs,

including examples where maximal transcript levels were seen several days after

oviposition (e.g., Ibrahim et al., 2007). Although such differences suggest that individual

PDV gene products may target specific phases of parasitism, the observed transcriptional

patterns may be dictated, at least in part, by the stability of the viral genome segments

from which transcripts are generated, a variable that could differ considerably according

to whether or not the developing wasp larva feeds on infected tissues supporting viral

gene expression (Beck et al., 2007).

26

Figure 2-1 Transcript levels of 17 TrIV rep genes in naturally parasitized C. fumiferana 6th instar larvae, as

determined by quantitative real-time RT-PCR using total RNA extracted from whole caterpillars, 1, 3 and 5

days post-parasitization (p.p.). Larvae were parasitized within 24 h after the molt to the 6th (last) stadium. Actual

transcript numbers are provided above each bar for values 50. Each value presented here is the mean of four technical

replicates carried out on an RNA extract obtained from a pool of 3-5 parasitized larvae. Error bars: SD.

In our investigation of tissue-specific transcription at 2 d p.p., the overall gene-specific

pattern of transcript abundance (Fig 2-2) was similar to that observed in whole larvae

(Fig 2-1), but with some notable exceptions. For example, in the four tissues examined,

F1-2 displayed lower proportions of transcripts relative to F1-1 than in whole larvae,

while the opposite trend was observed for F3-2. This suggests that the tissues supporting

high levels of F1-2 transcription were not sampled in the present study, whereas some of

the sampled tissues were enriched for F3-2 transcripts. More significantly, TrIV rep

genes exhibited important differences in their tissue specificity: whereas F1-1 transcripts

were most abundant in C. fumiferana cuticular epithelium and fat body, corroborating

earlier assessments made by northern blot analysis (Volkoff et al., 2002), the transcripts

of several other genes were at higher levels in haemocytes (B2-2, C7-2, F3-2) or the

midgut (C4-2, D5-2, D6-1 , F1-2) than in the other three tissues (Fig 2-2). These results

are in contrast with those obtained by Galibert et al. (2006), who found that the fat body

and cuticular epithelium of parasitized Spodoptera littoralis hosts had the highest levels

of HdIV rep transcripts for all 10 rep ORFs examined, followed by nervous tissue, which

was not investigated in the present study. It remains to be seen whether the observed

27

trend in HdIV rep gene expression was influenced by the choice of rep ORFs that were

studied, as we now know that the HdIV genome contains many additional rep genes (A.-

N. Volkoff, personal communication). Thus, this apparent difference between the two

biological systems could be due to a gene sampling bias.

Figure 2-2 Transcript levels of 17 TrIV rep genes in naturally parasitized 6th instar larvae, as determined by

quantitative real-time RT-PCR using total RNA extracted from four different tissues: FB, fat body; CE,

cuticular epithelium; HC, haemocytes; MG, midgut. The larvae were parasitized within 24 h after the molt to the 6th

(last) stadium, and the RNA extracted from individual tissues 2 days after parasitization. Each value presented here is

the mean of four technical replicates carried out on an RNA extract obtained from a pool of 3-5 parasitized larvae.

Error bars: SD.

Tissue-specific differences in polydnavirus gene transcript abundance in parasitized hosts

have also been observed for ichnovirus ank genes (Kroemer & Webb, 2005) and

bracovirus PTP genes (Gundersen-Rindal & Pedroni, 2006; Provost et al. 2004). Such

tissue-specific expression suggests that the diversity of genes within a given PDV gene

family may be associated with the existence of tissue-specific roles for different family

members in the caterpillar hosts, or that some of these related gene products, while

having the same function, are more effective in one tissue than in another. Irrespective of

its functional significance, tissue-specific variation in transcript levels implies that there

exist tissue-specific host factors modulating the transcription of specific rep genes.

28

2.5.3 Transcript abundance in CF-injected larvae

The TrIV rep transcript levels observed in CF-injected larvae (Fig 2-3) displayed gene-

specific and time-dependent differences similar to those observed for parasitized whole

larvae (Fig 2-1), with the exception that absolute transcript levels were generally much

higher than those observed at equivalent sampling times in parasitized larvae, particularly

1 d after treatment (> 85 times higher in the case of F1-1), indicating that the virus dose

contained in 0.5 FE of CF is much higher than that injected by a female wasp during

natural parasitization. As a point of comparison, the dose of virus injected by the wasp

Microplitis demolitor into its host has been estimated to be between 0.04 and 0.005 FE of

CF per ovipositional event (Beck et al., 2007).

Figure 2-3 Transcript levels of 17 TrIV rep genes in 6th instar larvae injected with 0.5 FE of T. rostrale calyx

fluid, as determined by quantitative real-time RT-PCR using total RNA extracted from whole caterpillars, 1, 3

and 5 d post-injection (p.i.). Larvae were injected within 24 h after the molt to the 6th (last) stadium. Actual transcript

numbers are provided above each bar for values < 2,000. Each value presented here is the mean of four technical

replicates carried out on an RNA extract obtained from a pool of 3-5 injected larvae. Error bars: SD.

29

Another difference between patterns found for parasitized and CF-injected larvae was the

rise seen in F1-1 transcript abundance on 3 d p.p., an increase that was not observed in

injected caterpillars, although absolute levels of F1-1 transcripts were higher in the latter

than in the former group, at all three sampling points. With few exceptions, transcript

levels decreased substantially from day 1 to days 3 and 5 p.i., suggesting that the

unusually high inoculum injected in larvae may have triggered, in the host, faster

clearance or breakdown of some viral DNA than in parasitized caterpillars. The present

qPCR findings for F1-1 (= TrFrep1) are in agreement with an earlier assessment made by

northern blot analysis which showed F1-1 to be transcribed at much higher levels in CF-

injected larvae than in parasitized caterpillars (Volkoff et al., 2002).

2.5.4 Transcript abundance in wasp ovary and head-thorax complexes

The pattern of TrIV rep gene transcription in T. rostrale ovaries was markedly different

from that seen in naturally parasitized or CF-injected C. fumiferana larvae. Whereas F1-1

and F1-2 were the most highly expressed rep genes in infected caterpillars (Figs 2-1, 2-2

and 2-3), transcripts generated from these two genes displayed low abundance in wasp

ovaries compared with other genes such as C166-1, the transcript levels of which were by

far the highest (Fig 2-4).

Interestingly, the C3-1 gene, whose transcription was barely detectable in infected

caterpillars (Figs 2-1, 2-2 and 2-3), was the second most highly transcribed gene in wasp

ovaries. In addition, the transcript levels of C3-2, C7-2, D5-2 and F3-2, which were

modest in infected C. fumiferana larvae (Figs 2-1, 2-2 and 2-3), varied between ~5,000

and 10,000 per ng total RNA in wasp ovaries (Fig 2-4). In comparison, all TrIV rep

genes had undetectable or very low transcript levels in wasp head-thorax complexes (Fig

2-4).

30

Figure 2-4 Transcript levels of 17 TrIV rep genes in T. rostrale ovaries and head-thorax complexes, as

determined by quantitative real-time RT-PCR. Total RNA was extracted from five ovary pairs dissected from post-

emergence 5-10 day-old T. rostrale females and from the head-thorax complexes of the same females. Each value

presented here is the mean of four technical replicates carried out on each RNA extract. Actual transcript numbers are

provided above each bar for values < 500. Error bars: SD.

Using northern blot analysis, Theilmann and Summers (1988) provided the first report on

the transcription of CsIV rep genes in C. sonorensis female reproductive tissues. These

authors observed that some rep genes were transcribed exclusively in the parasitized host

while others produced transcripts only in wasp ovaries or in both hosts. The quantitative

transcriptional data provided here for 17 TrIV rep genes in both parasitized hosts and

wasp ovaries are in agreement with that earlier finding. The distinct transcriptional

patterns of rep genes in T. rostrale ovaries (Fig 2-4) and parasitized or CF-injected larvae

(Figs 2-1, 2-2 and 2-3) suggest that individual rep genes may play either wasp- or

caterpillar-specific roles. In contrast, HdIV rep1 was the most highly expressed rep gene

in both infected caterpillar hosts and wasp ovaries (Galibert et al., 2006), suggesting that

the host-specific expression reported here may not apply to all ichnoviruses. With respect

to TrIV, the observation that some rep genes may be expressed only in the wasp (e.g.,

C3-1) raises the questions as to (i) why such genes are found in a packaged virus meant

to be delivered to the lepidopteran host and (ii) whether there are additional, unpackaged

31

rep genes in the T. rostrale genome, expressed only in wasp ovaries. Of course, the

possibility exists that some of the TrIV rep genes that were found to be weakly expressed

in parasitized C. fumiferana larvae would be expressed strongly in other lepidopteran

hosts (e.g., C. rosaceana; Cusson et al., 1998) or tissues not sampled yet, including genes

that were found here to be expressed only in the ovary. Additionally, it is not quite clear

whether rep genes that are expressed in the wasp ovary are transcribed from episomal or

chromosomal DNA, or both. Interestingly, none of the rep genes that were found to be

expressed in T. rostrale ovaries were transcribed at significant levels in the other wasp

tissues examined (Fig 2-4), thus suggesting an ovary-specific role for those that are

transcribed in that tissue. Given that rep gene products are not predicted to be secreted,

rep proteins expressed in wasp ovaries are not expected to be released in the lumen of the

oviduct for subsequent injection into the caterpillar during parasitization. For this reason,

their expression in the ovary suggests that they could play a role in virus replication, a

hypothesis that could be tested by following developmental changes in ovarian rep

transcript abundance in pupae, the stage at which virus replication begins (Marti et al.,

2003; Webb & Summers 1992).

2.5.5 Gene dosage

In earlier work examining the relationship between the abundance of PDV gene

transcripts and the proportion of the genome segments bearing these genes within the

packaged viral genome, no clear correlation between the two variables was observed

(Beck et al., 2007; Galibert et al., 2006). Here, the three most highly expressed TrIV rep

genes in parasitized caterpillars, F1-1, F1-2 and C166-1 (Fig 2-1), were found to be

borne by the two most abundant TrIV genome segments (Fig 2-5), suggesting that gene

dosage, in this particular instance, may have some impact on transcript abundance.

Yet, when all TrIV rep genes were considered, we observed no significant correlation

between transcript levels and the proportion of the originating genome segments. Clearly,

factors other than, or in addition to, gene dosage affect transcript levels, including

possible differences in promoter strength, the presence or absence of host factors that

32

may affect the transcription of individual rep genes and/or differences in mRNA stability.

For example, there were important differences in the abundance of F1-1 and F1-2

transcripts, which are generated from genes present on the same genome segment.

Integration of genome segment F1 into the lepidopteran host genomic DNA could also be

a factor resulting in the enhancement of F1-1 and F1-2 transcription. Although the

integration of genome segment F1 has not been demonstrated in the parasitized host, it

clearly occurs in infected C. fumiferana CF-124T cells in culture (Doucet et al., 2007).

Such an integrational event would permit sustained expression of the integrated genes

when titers of episomal DNA go down. The question of whether other rep-containing

genome segments undergo integration into C. fumiferana genomic DNA remains to be

examined.

Figure 2-5 Assessment of genome segment abundance within the TrIV packaged genome, as determined by

quantitative real-time PCR using viral DNA as template. The same primer pairs used for transcript quantification

were used to quantify genome segments. C166 and C289 are contigs associated with genome segments that have not

been cloned and that remain partially sequenced (Tanaka et al., 2007). Error bars: SD.

33

2.5.6 Comparison of TrIV rep proteins and identification of non-polydnaviral rep homologs

A ClustalX alignment of all 17 deduced TrIV rep proteins revealed regions that are well

conserved across all members of this family, including five cysteine residues that are

present in all proteins except C7-2; the latter lacks the second and third cysteines, and its

N terminus is substantially truncated relative to the other TrIV rep proteins (Fig 2-6). The

most conserved region is observed in the vicinity of the fifth cysteine residue (Fig 2-6),

comprising a segment of ~18 amino acids that also appears well conserved among rep

proteins from other ichnoviruses, including those of Hyposoter fugitivus (HfIV) and

HdIV (Fig 2-7). A blastp search using all TrIV rep proteins as query sequences revealed

the existence of two putative rep homologs in the granulovirus of Helicoverpa armigera

(HearGV), the genome of which has recently been sequenced and annotated (Harrison &

Popham, 2008). One of these two proteins, hear76, has only 70 amino acid residues and

displays a modest level of similarity to ichnoviral rep proteins (e.g., blastp expect value

of 0.36 for similarity to TrIV F3-1); however, the other predicted protein, hear75, has 171

amino acid residues, contains 4 of the 5 conserved cysteine residues referred to above,

and shows significant similarity to many ichnoviral rep proteins, most notably within the

aforementioned highly conserved region (Fig. 2-7).

Blastp expect values for similarity between hear75 and ichnoviral rep proteins varied

between 6e-09 and 3e-05 for HfIV-D3-2 and TrIV-F3-1, respectively. No rep homologs

have been detected in the other baculovirus genomes sequenced to date; thus, their

presence in HearGV may well be the result of lateral gene transfer from an ichnovirus

genome (Harrison & Popham, 2008).

As observed in earlier analyses of rep proteins, no conserved domains were detected in

any of the 17 TrIV representatives of this family, with the exception of F1-2, in which a

PIWI-like domain was detected in the region comprised between residues 60 and 150, but

with a low (0.001) expect value. The same protein was also found to display a modest

level of similarity to a bacterial transposase (accession number: ABM04822) within its C

terminus, an interesting observation given that TrIV genome segment F1 has been shown

34

to spontaneously integrate into the genome of C. fumiferana cells in culture, through an

unidentified mechanism (Doucet et al., 2007).

Although the new bioinformatics analyses performed here provided few new insights into

the function(s) of rep genes, the presence of rep homologs in the recently sequenced

genome of a granulovirus could eventually provide an indirect means of assessing their

role through the production of a HearGV rep knock-out, followed by an assessment of

this genetic alteration on viral replication or other aspects of the infection cycle.

Deployment of this strategy, however, would require the prior development of an

efficient in vitro system for HearGV.

In summary, the present study suggests that the very high level of diversification seen

within the ichnoviral rep gene family may have evolved in response to the necessity to

fine-tune the function(s) and/or effectiveness of rep proteins for expression in different

hosts and tissues. Given that rep genes encode proteins that are not secreted and that

some of them are expressed at relatively high levels in wasp ovaries without any overt

pathological consequence, the possibility exists that their function has more to do with

cell homeostasis (in IV- or GV-infected lepidopteran cells or in ovarian wasp cells

supporting viral replication) than virulence. Some PDV-encoded proteins are secreted

and display deleterious effects on other cells (e.g., Béliveau et al., 2003); because PDVs

do not replicate in the lepidopteran host, sustained viral gene expression for the duration

of immature parasitoid development is predicted to require a mechanism preventing

infected cells from being negatively affected by secreted PDV proteins and/or

suppressing breakdown of viral DNA and transcripts by host cells. Some Campoletis

sonorensis ichnovirus (CsIV) ank gene products appear to have such a function given that

they have been shown to delay lysis of baculovirus-infected cells (Fath-Goodin et al.,

2006). We are currently examining the effect of TrIV rep gene expression on C.

fumiferana host cell gene expression, with the aim of identifying the pathway(s) targeted

by rep proteins.

35

Figure 2-6 ClustalX alignment of all known and predicted TrIV rep family proteins. Black arrows indicate the

positions of conserved cysteine residues. Asterisks (*), double dots (:) and single dots (.) above letters in the

alignments denote identical residues, and conserved and semi-conserved substitutions, respectively. GenBank accession

numbers: C7-1, BAF45598; C7-2, BAF45599; D5-1, BAF45610; D5-2, BAF45611; C289-1, BAF45769; C3-2,

BAF45588; F3-2, BAF45626; F3-3, BAF45627; F3-1, BAF73402; C4-1, BAF45589; C4-2, BAF45590; B2-2,

BAF45579; C3-1, BAF45585; D6-1, BAF45614; F1-1, AAN32723; F1-2, ACJ72220; C166-1, BAF45767.

36

Figure 2-7 ClustalX alignment of selected ichnoviral rep proteins from TrIV, HfIV, and HdIV, as well as a rep-

like protein from the granulovirus HearGV. Black arrows indicate the positions of conserved cysteine residues; the

grey arrow points to the third conserved cysteine residue, which is replaced by an alanine in the HearGV rep-like

protein. Asterisks (*), double dots (:) and single dots (.) above letters in the alignments denote identical residues, and

conserved and semi-conserved substitutions, respectively. GenBank accession numbers: HfIV-D3-2, BAF45718; HfIV-

D10-2, BAF45741; TrIV-F3-1, BAF73402; HdIV-rep5, AAR89177; HearGV-hear75, ABY47766.

Acknowledgements

The authors thank AN Volkoff for fruitful discussions about the work of her group on

HdIV rep genes and D Stoltz for helpful comments on an earlier version of the

manuscript. This research was supported by grants from the Canadian Forest Service

(CFS) and a Discovery grant from the Natural Sciences and Engineering Research

Council of Canada to MC.

37

2.6 References

1. Beck, M. H., Inman, R. B. & Strand, M. R. (2007). Microplitis demolitor

bracovirus genome segments vary in abundance and are individually packaged in

virions. Virology. 359, 179-189.

2. Béliveau, C., Laforge, M., Cusson, M. & Bellemare, G. (2000). Expression of a

Tranosema rostrale polydnavirus gene in the spruce budworm, Choristoneura

fumiferana. J. Gen. Virol. 81, 1871-1880.

3. Béliveau, C., Levasseur, A., Stoltz, D. & Cusson, M. (2003). Three related TrIV

genes: comparative sequence analysis and expression in host larvae and Cf-124T

cells. J Insect Physiol 49, 501-511.

4. Cusson, M., Barron, J. R., Goulet, H., Régnière, J. & Doucet, D. (1998). Biology

and status of Tranosema rostrale (Hymenoptera: Ichneumonidae), a parasitoid of

the eastern spruce budworm (Lepidoptera: Tortricidae). Ann. Entomol. Soc. Am.

91, 87-93.

5. Doucet, D. & Cusson, M. (1996a). Alteration of developmental rate and growth of



6. Doucet, D. & Cusson, M. (1996b). Role of calyx fluid in alterations of immunity

in Choristoneura fumiferana larvae parasitized by Tranosema rostrale. Comp.

Biochem. Physiol. 114A, 311-317.

7. Doucet, D., Levasseur, A., Béliveau, C., Lapointe, R., Stoltz, D. & Cusson, M.

(2007). In vitro integration of an ichnovirus genome segment into the genomic

DNA of lepidopteran cells. J. Gen. Virol. 88, 105-113.

8. Eggleton, P. & Belshaw, B. (1993). Comparisons of dipteran, hymenopteran and

coleopteran parasitoids: provisional phylogenetic explanations. Biol. J. Linn. Soc.

48, 213-226.

38



9. Falabella, P., Varricchio, P., Provost, B., Espagne, E., Ferrarese, R., Grimaldi, A.,

Eguileor, M., Fimiani, G., Ursini, M. V. & other authors (2007). Characterization

of the IκB-like gene family in polydnaviruses associated with wasps belonging to

different braconid subfamilies. J. Gen. Virol. 88, 92-104.

10. Fath-Goodin, A., Gill, T. A., Martin, S. B., & Webb, B. A. (2006). Effect of

Campoletis sonorensis ichnovirus Cys-motif proteins on Heliothis virescens larval

development. J. Insect. Physiol. 52, 576-585.

11. Galibert, L., Devauchelle, G., Cousserans, F., Rocher, J., Cérutti, P., Barat-

Houari, M., Fournier, P. & Volkoff, A. N. (2006). Members of the Hyposoter

didymator Ichnovirus repeat element gene family are differentially expressed in

Spodoptera frugiperda. J. Virol. 3, 48.

12. Gundersen-Rindal, D.E. & Pedroni, M. J. (2006). Characterization and

transcriptional analysis of protein tyrosine phosphatase genes and an ankyrin

repeat gene of the parasitoid Glyptapanteles indiensis polydnavirus in the

parasitized host. J. Gen. Virol. 87, 311-322.

13. Harrison, R. L. & Popham, H. J. R. (2008). Genomic sequence analysis of a

granulovirus isolated from the Old World bollworm, Helicoverpa armigera. Virus

Genes 36, 565-581.

14. Ibrahim, A. M., Choi, J.Y., Je, Y.H., Kim, Y. (2007). Protein tyrosine

phosphatases encoded in Cotesia plutellae bracovirus: sequence analysis,

expression profile, and a possible biological role in host immunosuppression.

Dev. Comp. Immunol. 31, 978-990.

15. Kroemer, J. A. & Webb, B. A. (2004). Polydnavirus genes and genomes:

emerging gene families and new insights into polydnavirus replication. Annu.

Rev. Entomol. 49, 431-456.

16. Kroemer, J. A. & Webb, B. A. (2005). IκB-related vankyrin genes in the

Campoletis sonorensis ichnovirus: temporal and tissue-specific patterns of

39

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Fath-Goodin%20A%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Gundersen-Rindal%20DE%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Pedroni%20MJ%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Ibrahim%20AM%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Choi%20JY%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Je%20YH%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Kim%20Y%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus



expression in parasitized Heliothis virescens lepidopteran hosts. J. Virol. 79,

7617-7628.

17. Marti, D., Grossniklaus-Bürgin, C., Wyder, S., Wyler, T., & Lanzrein, B. (2003).

Ovary development and polydnavirus morphogenesis in the parasitic wasp

Chelonus inanitus. I. Ovary morphogenesis, amplification of viral DNA and

ecdysteroid titres. J. Gen. Virol. 84, 1141-1150.

18. Provost, B., Varricchio, P., Arana, E., Espagne, E., Falabella, P., Huguet, E., La

Scaleia, R., Cattolico, L., Poirié, M., & other authors. (2004). Bracoviruses

contain a large multigene family coding for protein tyrosine phosphatases. J.

Virol. 78, 13090-13103.

19. Rutledge, R. G. & Stewart, D. (2008a). A kinetic-based sigmoidal model for the

polymerase chain reaction and its application to high-capacity absolute

quantitative real-time PCR. BMC Biotechnol. 8, 47.

20. Rutledge, R. G. & Stewart, D. (2008b). Critical evaluation of methods used to

determine amplification efficiency refutes the exponential character of real-time

PCR. BMC. Mol. Bio. 9, 96.

21. Stoltz, D. B. (1993). The polydnavirus life cycle. In Parasites and Pathogens of

Insects, Vol. 1, pp. 80-101. Edited by N. Beckage, S. N. Thompson & B. A.

Federici. San Diego, CA: Academic Press.

22. Stoltz, D. B., Guzo, D. & Cook, D. (1986). Studies on polydnavirus transmission.

Virology. 155, 120-131.

23. Tanaka, K., Lapointe, R., Barney, W. E., Makkay, A. M., Stoltz, D., Cusson, M.

& Webb, B. A. (2007). Shared and species-specific features among ichnovirus


24. Theilmann, D. A. & Summers, M. D. (1987). Physical analysis of the Campoletis

sonorensis virus multipartite genome and identification of a family of tandemly

repeated elements. J. Virol. 61, 2589-2598.

40

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Marti%20D%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Grossniklaus-B%C3%BCrgin%20C%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Wyder%20S%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Wyler%20T%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Lanzrein%20B%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Provost%20B%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Varricchio%20P%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Arana%20E%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Espagne%20E%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Falabella%20P%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Huguet%20E%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22La%20Scaleia%20R%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22La%20Scaleia%20R%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Cattolico%20L%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Poiri%C3%A9%20M%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Rutledge%20RG%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Stewart%20D%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus





41

25. Theilmann, D. A. & Summers, M. D. (1988). Identification and comparison of



329-341.

26. Thoetkiattikul, H., Beck, M. H. & Strand, M. R. (2005). Inhibitor κB-like proteins

from a polydnavirus inhibit NF-κB activation and suppress the insect immune

response. Proc. Natl. Acad. Sci.USA. 102, 11426-11431.

27. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G.

(1997). The Clustal X windows interface: flexible strategies for multiple sequence

alignment aided by quality analysis tools. Nucleic. Acids. Res. 24, 4876-4882.

28. Volkoff, A. N., Béliveau, C., Rocher, J., Hilgarth, R., Levasseur, A., Duonor-

Cérutti, M., Cusson, M. & Webb, B. A. (2002). Evidence for a conserved

polydnavirus gene family: ichnovirus homologs of the CsIV repeat element genes.

Virology 300, 316-331.

29. Wang, Z. & Spadoro, J. (1998). Determination of target copy number of

quantitative standards used in PCR-based diagnostic assays. In Gene

Quantification pp. 31-43. Edited by F. Ferré. Boston: Birkhäuser.

30. Webb, B. A., Strand, M. R., Dickey, S. E., Beck, M. H., Hilgarth, R. S., Barney,

W. E., Kadash, K., Kroemer, J. A., Lindstrom, K. G. & other authors (2006).

Polydnavirus genomes reflect their dual roles as mutualists and pathogens.

Virology 347, 160-174.

31. Webb, B. A. & Summers, M. D. (1992). Stimulation of polydnavirus replication

by 20-hydroxyecdysone. Experientia 48, 1018-




http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Dickey%20SE%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus


http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Hilgarth%20RS%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Barney%20WE%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus


http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Kadash%20K%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus


http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Lindstrom%20KG%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus


http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Summers%20MD%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

CHAPITRE 3

Global transcriptional profile of Tranosema

rostrale ichnovirus genes in infected lepidopteran

hosts and wasp ovaries1

3.1 Abstract

The ichnovirus TrIV, transmitted by the endoparasitic wasp Tranosema rostrale to its

lepidopteran host during oviposition, replicates asymptomatically in wasp ovaries and

causes physiological dysfunctions in parasitized caterpillars. The need to identify

ichnoviral genes responsible for disturbances induced in lepidopteran hosts has provided

the impetus for the sequencing and annotation of ichnovirus genomes, including that of

TrIV. In the latter, 86 putative genes were identified, including 35 that could be assigned

to recognized ichnoviral gene families. With the aim of assessing the relative importance

of each TrIV gene, as inferred from its level of expression, and evaluating the accuracy of

the gene predictions made during genome annotation, the present study builds on an

earlier qPCR quantification of transcript abundance of TrIV rep ORFs, in both

lepidopteran and wasp hosts, extending it to other gene families as well as to a sample of

1 This chapter has been accepted for publication in the journal Virologica Sinica, and is to be included in a special issue on insect viruses. Rasoolizadeh A, Dallaire F, Stewart D, Beliveau C, Cusson M, Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries. Virologica Sinica in press.

42

unassigned ORFs. We show that the majority (91%) of putative ORFs assigned to known

gene families are expressed in infected larvae, while this proportion is lower (67%) for a

sample taken among the remaining ORFs. Selected members of the TrV and rep gene

families are shown to be transcribed in infected larvae at much higher levels than genes

from any other TrIV gene family, pointing to their likely involvement in host

subjugation. In wasp ovaries, the transcriptional profile is dominated by a rep gene and a

member of a newly described gene family encoding secreted proteins displaying a novel

cysteine motif, which we identified among previously unassigned ORFs.

3.2 Résumé

L’ichnovirus TrIV est transmis par la guêpe endoparasitoïde Tranosema rostrale à son

hôte lépidoptère, Choristoneura fumiferana, au moment de la ponte. TrIV se réplique de

façon asymptomatique dans les ovaires de T. rostrale et entraîne des perturbations

physiologiques chez les chenilles parasitées. La nécessité d'identifier les gènes

responsables des perturbations induites par les ichnovirus chez les hôtes lépidoptères a

donné l'impulsion initiale au séquençage et à l'annotation de trois génomes ichnoviraux, y

compris celui de TrIV. Chez ce dernier, on a identifié 86 gènes, dont 35 qui ont pu être

attribués à des familles de gènes ichnoviraux déjà connues. Dans le but d'évaluer

l'importance relative de chaque famille de gènes de TrIV, tel qu’estimée par le niveau

d'expression de chaque gène, et d'évaluer l'exactitude des prédictions géniques faites au

moment de l'annotation du génome, nous avons bonifié une étude précédente, laquelle

portait sur la quantification des transcrits des gènes rep de TrIV chez l’hôte lépidoptère et

la guêpe, en l'étendant à d'autres familles de gènes, ainsi qu’à un échantillon de gènes

non-attribués (i.e., qui n’ont pas d’homologues connus). Nous montrons que la majorité

(91%) des gènes attribués à des familles de gènes connues sont exprimés dans les larves

infectées, cette proportion étant plus faible (67%) pour un échantillon les gènes non-

attribués. Certains membres des familles TrV et rep se sont avérés être transcrits, dans les

larves infectées, à des niveaux beaucoup plus élevés que les gènes des autres familles,

suggérant un rôle important pour ces deux familles dans la subjugation de l'hôte. Dans les

ovaires de T. rostrale, le profil transcriptionnel était dominé par un gène rep ainsi que par

43

un gène d'une famille nouvellement identifiée parmi les gènes non-attribués ; ces gènes

codent pour des protéines qui sont sécrétées et qui affichent un nouveau motif cystéine.

3.3 Introduction

The complex and singular life cycle of polydnaviruses (PDVs) has fascinated biologists

ever since these unusual viral entities were first reported in the scientific literature. As

such, they have raised countless questions, many of which have been addressed through

experimental work focusing on the elucidation of their functions and origins.

PDVs are dsDNA viruses whose genome is made up of multiple circular segments. Their

replication is confined to the ovaries of some endoparasitic wasps, where viral DNA is

generated from a copy of the viral genome permanently maintained within the wasp

genome. Virions are assembled in the nuclei of ovarian calyx cells and subsequently

released into the lumen of the oviducts. They are later injected into a lepidopteran host

during the process of parasitization (i.e., egg laying); in this host, no viral replication

takes place but expression of PDV genes induces immune and developmental

disturbances that are essential to the successful completion of wasp development. For this

reason, the association of PDVs with parasitic wasps has been described as mutualistic

(14, 22).

Recent endeavors in the area of PDV genome sequencing and annotation (7, 12, 16, 23,

26) have generated a wealth of data and new hypotheses about the evolution of these

intriguing insect viruses, as well as new questions about the diversification and functions

of the new putative genes identified in their genomes.

In the three campoplegine ichnoviruses (IV) (PDVs associated with ichneumonid wasps

of the subfamily Campopleginae) whose genomes have been sequenced [Campoletis

sonorensis IV (CsIV), Hyposoter fugitivus IV (HfIV) and Tranosema rostrale IV (TrIV);

23, 26], approximately half of the predicted ORFs have been assigned to previously

described or characterized gene families, such as those encoding proteins that display

significant sequence or structural similarity to proteins found in other organisms (inx,

44

ank, and Cys-motif), while members of the remaining families were identified on the

basis of similarity to previously characterized IV transcripts (rep and TrV families) or

because of the demonstrated existence of related putative ORFs among two or more IV

genomes (N, PRRP). All other putative ORFs, which constitute the remaining half, could

not be readily assigned to specific gene families as they did not display similarity to

known proteins (“unassigned” ORFs).

Annotation of the TrIV genome revealed the presence of several gene families. The

repeat element family (rep) is the largest with 17 members, followed by the TrV family

(7 members), N family (4 members), inx family (3 members), ank family (2 members),

Cys-motif (1 member) and PRRP (1 member). The remaining putative ORFs (59%) could

not be assigned to any known family (23).

In earlier studies, we assessed the transcription of selected TrIV genes from the rep

(TrFrep1; 25) and TrV (TrV1, TrV2 and TrV4; 1, 2, 5) families in the lepidopteran host

Choristoneura fumiferana by Northern blot analysis. More recently, we conducted a

detailed qPCR analysis of the abundance of all 17 TrIV rep transcripts, in both

lepidopteran and wasp hosts (19). This study indicated that two TrIV rep genes, F1-1 and

F1-2 (= TrFrep1 and TrFrep2), are expressed at much higher levels than all other

members of this family in infected C. fumiferana larvae. In addition, the rep

transcriptional profile seen in T. rostrale ovaries was found to be markedly different from

that observed in infected caterpillars.

For the present study, we wanted to extend the latter qPCR analysis to other putative

ORFs identified during annotation of the TrIV genome, so as to assess the accuracy of

our gene predictions and to generate a global transcriptional profile for a large sample of

TrIV genes across all known families and among unassigned genes. Here, we show that a

high proportion of genes identified during annotation are expressed in either the

caterpillar or wasp (ovaries) host, but that some members of the TrV and rep families are

expressed at much higher levels in infected caterpillars than genes from any other TrIV

gene family examined, suggesting that selected members of these two families play a

critical role in host subjugation. Similarly, the transcripts generated by another rep gene

45

and a previously unassigned gene clearly outnumber all other TrIV transcripts in wasp

ovaries. This previously unassigned gene is shown to belong to a new family of four

genes encoding secreted proteins expressed almost exclusively in wasp ovaries and

displaying a novel cysteine motif.

3.4 Materials and Methods

3.4.1 RNA extraction

Choristoneura fumiferana larvae were either parasitized by T. rostrale within 24 h after

the molt to the last instar or injected with 0.5 female equivalents (FE) of calyx fluid (CF),

as described (9, 10). Total RNA was extracted from five larvae of each group 3 d post-

parasitization (p.p.) or post-injection (p.i.), using TRIZOL reagent (Invitrogen),

according to the manufacturer’s instructions (1). In addition, total RNA was extracted and

pooled from five ovary pairs dissected from post-emergence 5-10 day-old T. rostrale

females, using the QIAshredder and RNeasy Mini Kit (Qiagen), according to the

manufacturer’s instructions.

3.4.2 cDNA library construction

A cDNA library was constructed as described (19) using RNA extracted from CF-

injected C. fumiferana larvae. Briefly, 3 µg of total RNA was reverse-transcribed using

an oligo-dT primer with the following sequence: TTTTGTACAAGC (T)16, followed by

synthesis of the second cDNA strand and ligation of an adaptor; the latter was used for

amplification of the cDNA using an adaptor-specific primer (ASP; 5´-

CTAATACGACTCACTATAGGGC-3´) in conjunction with the oligo dT primer. PCR

amplification was performed using 0.1 µM of primers, 0.3 mM of each dNTP and 1.5 U

of Taq platinum High Fidelity (Invitrogen) in 1x PCR High Fidelity buffer (Invitrogen),

46

containing MgSO4 (2 mM). The conditions consisted of a first heating step at 94ºC for 2

min, and then 20 cycles of 94ºC, 30 s; 55ºC, 1 min; 68ºC, 5 min.

3.4.3 Bioinformatics analyses

To determine whether some of the TrIV ORFs that had not been assigned to a known

gene family (23) could form new families, we conducted local blast (Blastp) searches

against a TrIV unassigned ORF data base, followed by a multiple amino acid sequence

alignment performed by ClustalW2, subsequently adjusted manually for one of the

identified families. For amino acid composition analysis and signal peptide predictions,

we used ProtParam3 and SignalP4, respectively. Disulfide bond predictions were made

using the Scratch Protein Predictor5.

3.4.4 Amplification of ORF-specific cDNAs from the cDNA library

To determine which of the putative ORFs identified in the genome of TrIV were

expressed in TrIV-infected larvae, we first conducted PCR amplifications of predicted

TrIV ORFs from the above cDNA library. Primers were designed within the coding

sequence of each putative ORF (Supplemental Data in Annexe C Table C-1). Two µl of a

25x dilution of the cDNA library was used for PCR amplification, with 0.25 µM of each

primer and 0.2 mM of each dNTP, in 1x PCR buffer. After a hot start at 94ºC for 3 min,

PCR was carried out by addition of 2 U of Tag DNA polymerase at 80ºC. The rest of the

cycling conditions were as follows: 30 cycles of 94ºC, 45 s; 48ºC, 45 s; 72ºC, 1 min; and

a final extension step at 72ºC for 5 min. The amplification products were then cloned into

pGEM-T easy vector (Promega) according to the manufacturer’s instructions and

subjected to sequence analysis.

2 http://www.ebi.ac.uk/Tools/clustalw2/index.html 3 http://www.expasy.ch/tools/protparam.html 4 http://www.cbs.dtu.dk/services/SignalP/ 5 http://www.ics.uci.edu/~baldig/scratch/

47

http://www.ebi.ac.uk/Tools/clustalw2/index.html

http://www.expasy.ch/tools/protparam.html

http://www.cbs.dtu.dk/services/SignalP/

http://www.ics.uci.edu/%7Ebaldig/scratch/

3.4.5 Reverse transcription and quantitative real-time PCR (qPCR)

To remove DNA contaminants from RNA extracts, 500 ng of total RNA was treated with

2 U amplification-grade DNase I (Invitrogen) for 15 min at 25°C. We ran no-RT controls

for the four most highly transcribed ORFs and detected no significant amplification,

pointing to the virtual absence of genomic DNA contamination in the extracts. 500 ng

RNA from parasitized and CF-injected C. fumiferana larvae, and 200 ng RNA from

ovarian tissue was reverse-transcribed using 0.5 µg of an oligo(dT) primer and 200 U

Superscript II RNase H- reverse transcriptase (Invitrogen). The reaction was carried out

in 1x PCR buffer, with 0.5 mM of each dNTP and 40 U of RNAguard ribonuclease

inhibitor (Amersham Biosciences), at 42˚C for 50 min.

For qPCR analysis, four primers were initially designed for each TrIV gene, using

diverse regions among aligned nucleotide sequences. These four primer pairs were used

to assess primer performance and quantitative precision. Initial amplification tests were

conducted on reverse-transcribed RNA obtained from parasitized C. fumiferana larvae. A

single primer pair was then selected for each gene (see Supplemental Data in Annexe C

Table 2), based upon high amplification efficiency and lack of non-specific amplification

products, and used for the analysis of the remaining samples.

PCR amplifications were carried out on aliquots of individual RT reactions containing

cDNA in amounts equivalent to 2.5 ng RNA, except for ovarian samples, which

contained amounts of cDNA equivalent to 1 ng RNA. Four replicate amplification

reactions containing 500 nM of each primer were conducted for each sample, using an

MX3000P spectrofluorometric thermal cycler (Stratagene) and QuantiTect TM SYBR

Green PCR Kit (Qiagen), initiated with a 15-min incubation at 95˚C, followed by a

cycling regime of 95˚C, 10 s and 65˚C, 2 min. Each run was completed with a melting

curve analysis to confirm the specificity of amplification and absence of primer dimers.

Amplification efficiency was determined for each amplification reaction using LRE

(“linear regression of efficiency”) analysis, and the number of target molecules calculated

using lambda genomic DNA as a quantitative standard (20, 21; see 19 for details).

48

3.5 Results

3.5.1 Detection of TrIV transcripts in infected larvae

As a first step towards determining which of the known and putative TrIV genes are

expressed in infected C. fumiferana hosts, we conducted ORF-specific PCR

amplifications from a cDNA library constructed using RNA from TrIV-injected C.

fumiferana last-instars, 3 d p.i. Using this approach, transcripts were detected for 77% of

all assigned TrIV ORFs, while only 42% for the 12 unassigned ORFs that we sampled

generated amplification products (Table 3-1). These proportions increased to 91% and

67%, respectively, when the presence of gene-specific transcripts was assessed using the

more sensitive qPCR-LRE approach (Table 3-1). Thus, the vast majority of TrIV genes

assigned to specific families during genome annotation were found to be expressed in

TrIV-infected C. fumiferana larvae; for unassigned genes, this proportion was lower,

based on the present sample. Furthermore, as indicated in the quantitative analyses

presented below, some TrIV genes were found to be expressed almost exclusively in T.

rostrale ovaries.

49

Table 3-1 Overall assessment of the expression (detected or not; + or ) of known and predicted TrIV ORFs in

TrIV-infected C. fumiferana larvae. The list of genes includes all those assigned to known IV gene families and 12 of

51 predicted ORFs that could not originally be assigned to a family (23)6

Gene family id ORF id Alter. name PCR1 qPCR1

B2-1

+ +

C3-1

+

C3-2

+ +

C4-1

+ +

C4-2

+

C7-1

+

C7-2

+ +

C166 Rep166 + +

C289 +

D5-1 + +

D5-2 +

D6-1 + +

F1-1 TrFrep1 + +

F1-2 TrFrep2 + +

F3-1 + +

F3-2 + +

Rep

F3-3 + +

C1-1 Ank 1 + +

Ankyrin C1-2 Ank 2 + +

Cys-motif C111-1 Cys + +

6 Two approaches were used to make this assessment: (i) PCR amplification of gene-specific cDNAs from a library constructed from

6th instar larvae, 3 d after injection (p.i.) of 0.5 FE of T. rostrale calyx fluid, and (ii) qPCR transcript quantification using total RNA obtained from similar larvae at 3 d p.i.; a given gene was considered as expressed if we detected ≥ 4 transcripts/ng total RNA. This threshold was chosen on the basis of results obtained for “no-RT” controls (RNA samples for which the reverse transcription step was omitted), where the median value was 4 copies (presumably contaminating genomic DNA). See Figs. 1, 3, 4 and 5 for quantitative data.

50

C6-1 Inx 1

D4-1 Inx 2 + +

Innexin

E1-2 Inx 3 + +

B1-1 N 1 + +

D7-1 N 2 + +

F2-1 N 3 + + N family

F2-2 N 4 + +

PRRP F1-6 PRRP + +

G2-1 TrV 1 + +

G3-1 TrV 2 + +

G2-2 TrV 3 + +

TrV 4 + +

G3-2 TrV 5

D1-2 TrV 6

TrV

C107 TrV 7 + +

A1-1 + +

C3-1

C3-3

C111-2

C116-2 OSSP 3 + +

C289-2 +

G5-1 OSSP 2 + +

G5-2

G5-3 OSSP 4 + +

G5-4 OSSP 1 + +

F2-3 B 1 +

Unassigned ORFs

F2-4 B 2 +

51

3.5.2 Transcript abundance of TrIV ank, inx, Cys-motif, PRRP and N genes

Although none of the 11 TrIV genes identified as belonging to the ank, inx, Cys-motif,

PRRP and N families displayed very high levels of transcripts in either infected C.

fumiferana hosts or T. rostrale ovaries ( 3,000 transcripts/ng total RNA), six of them

had more abundant transcripts in wasp ovaries than in parasitized caterpillars, including

two ank, two inx and two N genes (Fig. 3-1).

Figure 3-1 qPCR determination of transcript levels of 11 TrIV putative genes (23), distributed among five gene

families, in C. fumiferana 6th instar larvae, 3 d following natural parasitization by T. rostrale (3 d p.p.) or

injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.), as well as in T. rostrale adult ovaries. Larvae were parasitized or

injected within 24 h after the moult to the 6th instar. For each measurement, total RNA was extracted and pooled from 5

larvae or 5 ovary pairs dissected from 5-10 day-old females. Actual transcript numbers are provided above each bar for

values < 100. Each value presented here is the mean of four technical replicates carried out on each RNA extract. Error

bars: SD.

With the exception of the C6-1 and D4-1 inx genes, this inter-host difference was less

pronounced when the comparison was made with transcript levels measured in virus-

52

injected caterpillars, presumably as a result of the supra-physiological viral dose present

in 0.5 FE of calyx fluid (19). Interestingly, the only member of the Cys-motif family

identified in the TrIV genome was expressed at very low levels (< 200 transcripts/ng total

RNA) in both infected caterpillars and wasp ovaries, while transcript abundance for the

single TrIV representative (F1-6) of the PRRP gene family (23) was moderate (~700-

3000 transcripts/ng total RNA) in the three samples examined (Fig. 3-1).

3.5.3 Transcript abundance of TrIV “unassigned” genes

Prior to generating estimates of transcript abundance for a sample of genes among the 51

unassigned TrIV ORFs identified earlier (23), we wanted to determine whether some of

these genes formed families; given that PDV genes tend to fall within families of related

coding regions, we reasoned that putative ORFs that had clear relatives within the TrIV

genome were more likely than orphan ORFs to be real genes (i.e., transcribed DNA).

Local Blastp analyses led to the identification of three small groups of related proteins

encoded by unassigned ORFs (Fig 3-2). The first of these groups contains four members,

all of which display a novel C-terminal cysteine motif. The longer G5.1 protein has two

copies of the Cx7Cx3Cx3Cx7Cx3Cx3Cx7C motif, which is identical to that seen in the

C166.2 protein. A variant of the latter motif (Cx6Cx3Cx3Cx3Cx3Cx7Cx3Cx3Cx3Cx3-

4Cx7C) is observed in the G5.3 and G5.4 proteins, with 10 out of the 11 cysteine residues

predicted to form disulphide bonds. A putative signal peptide cleavage site was identified

in all four proteins, which are therefore predicted to be secreted (Fig 3-2A). A Blastp

analysis indicated that these proteins are unique to TrIV. Two other pairs of ORFs were

found to be either highly (F2.3, F2.4 and Fig. 3-2B) or moderately (F1.4 and D6.3; Fig 3-

2C) related.

Thus, to obtain a preliminary assessment of the transcriptional activity of TrIV

unassigned genes, we measured transcript levels for six ORFs randomly selected among

those that were considered orphans and for six others that appeared to belong to a gene

family (i.e., those presented in Fig 3-2A and 3-2B). Interestingly, five of the six orphan

ORFs had barely detectable transcripts, whether in infected hosts or in wasp ovaries,

53

while the remaining orphan gene had low but detectable quantities of transcripts in wasp

ovaries (~500 copies/ng total RNA). In contrast, the four members of the family shown in

Fig 3-2A displayed moderate levels of transcripts (~2,000-12,000 copies/ng total RNA)

in wasp ovaries, while being expressed at very low levels in infected caterpillars (Fig 3-

3). For this reason, these proteins are here assigned to a new TrIV gene family,

designated “Ovary-Specific Secreted Proteins” (OSSPs). The other two related proteins

examined were also expressed almost exclusively in wasp ovaries, but at lower levels

than those measured for OSSPs.

Figure 3-2 ClustalW alignment of amino acid sequences deduced from selected TrIV unassigned ORFs that were

found to form groups of two or more related proteins. A) Four related proteins displaying a novel C-terminal

cysteine motif (cysteine residues are shown as white letters against black background). The arrow indicates the position

of the putative signal peptide cleavage site. B) Two very similar proteins encoded by unassigned ORFs found on

genome segment F2. This group is here designated “unassigned family B”. C) Two proteins encoded by unassigned

ORFs and displaying modest similarity. For B) and C), identical residues are shown as white letters against dark gray

background, while similar residues are shown as black letters against light gray background.

54

Figure 3-3 qPCR determination of transcript levels of 12 TrIV putative ORFs selected among 51 unassigned

ORFs (23), in C. fumiferana 6th instar larvae, 3 d following natural parasitization by T. rostrale (3 d p.p.) or

injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.), as well as in T. rostrale adult ovaries. Putative genes are here

clustered according to whether they are orphan or belong to a family (“OSSP” and “unassigned family B”; see caption

of Fig. 2). For each measurement, total RNA was extracted and pooled from 5 larvae or 5 ovary pairs dissected from 5-

10 day-old females. Larvae were parasitized or injected within 24 h after the molt to the 6th instar. Actual mean

transcript numbers are provided above each bar for values < 100. Each value presented here is the mean of four

technical replicates carried out on each RNA extract. Error bars: SD.

3.5.4 Comparison of transcript abundance across all TrIV gene families

To estimate the relative importance of each gene family with respect to the abundance of

their transcripts in infected caterpillars and wasp ovaries, we selected, for each family,

the gene for which the highest level of transcripts had been measured in TrIV-injected C.

fumiferana last-instar larvae, 3 d p.i., or in adult wasp ovaries (Figs 3-4 and 3-5). In

infected caterpillars, TrV family, which encodes a secreted protein, was by far the most

highly transcribed TrIV7 gene, with nearly 300,000 copies/ng total RNA (Fig 3-4). The

rep family came second in this ranking, with the F1-1 gene (TrFrep1) producing ~52,000

transcripts/ng total RNA. In comparison, ank-2, PRRP and inx-3 generated transcript

quantities varying between ~1,000 and 3,000 copies, while all others produced < 1,000

copies /ng total RNA (Fig 3-4). 7 TrV1 from TrV gene family

55

Figure 3-4 Comparison of transcript abundance among selected representatives of all known TrIV gene families,

in C. fumiferana 6th instar larvae, 3 d following injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.). Larvae were

injected within 24 h after the molt to the 6th instar. For each family, we show the value obtained for the most highly

transcribed gene in infected caterpillars. For each qPCR measurement, total RNA was extracted and pooled from 5

larvae. Actual transcript numbers are provided above each bar for values < 50,000. Each value presented here is the

mean of four technical replicates carried out on each RNA extract. Error bars: SD. Data for TrFrep1 are from

Rasoolizadeh et al. (19).

Figure 3-5 Comparison of transcript abundance among selected representatives of all known TrIV gene families,

in adult T. rostrale ovaries. For each family, we show the value obtained for the most highly transcribed gene in wasp

ovaries. For each qPCR measurement, total RNA was extracted and pooled from 5 ovary pairs dissected from 5-10 day-

old females. Actual mean transcript numbers are provided above each bar for values < 10,000. Each value presented

here is the mean of four technical replicates carried out on each RNA extract. Error bars: SD. Data for rep166 are from

Rasoolizadeh et al. (19).

56

In wasp ovaries, a rep gene (C166.1 or rep166) dominated the transcriptional profile,

with nearly 90,000 copies/ng total RNA, followed by OSSP1, which had ~12,000 copies

(Fig 3-5). For all other genes, transcript abundance was ≤ 1,000 copies/ng total RNA,

except for ank-2, which generated ~2,800 copies (Fig 3-5).

3.5.5 Accuracy of splicing junction predictions

In the course of annotating the TrIV genome, seven genes were identified as being

spliced (Cys-motif, TrV1, TrV2, TrV3, TrV4, TrV5 and TrV6), all of which are predicted

to encode secreted proteins (23). The splicing junctions of three of these, TrV1, TrV2, and

TrV4 had been confirmed in earlier studies (1, 2). Here, we attempted the cDNA cloning

and sequencing of the remaining four genes to determine if they were indeed spliced and

whether the splicing junctions had been predicted correctly. We were not able to amplify

TrV5 and TrV6 from our cDNA library or by qPCR (Table 3-1), suggesting that these two

very small putative ORFs (they encode proteins of 74 and 56 amino acid residues,

respectively) may well be pseudogenes. However, we were able to clone the cDNAs of

the Cys-motif and TrV3 genes, both of which were confirmed to contain two exons and

one intron, although the length of the first exon had been incorrectly predicted in both

cases (Table 3-2); corrections have now been made to the appropriate GenBank entries.

Table 3-2 Differences between predicted and observed splicing junctions for two TrIV spliced genes, TrV3 and a

Cys-motif gene. The values presented here are nucleotide ranges encompassing each exon (reverse complement) on

their respective genome segments (G2 and c111). For both genes, differences between predicted and observed junctions

were at the level of exon 1 (bold letters).

Gene id Exon 1 Exon 2

Predicted Expressed Predicted Expressed Accession number

TrV3 3543..3785 3537..3785 3201..3233 3201..3233 AB291160 Cys-motif 1622..1774 1667..1774 1190..1408 1190..1408 AB291215

57

3.6 Discussion

Transcriptional analysis often constitutes a first step towards identifying the function of a

gene. The present study, along with an earlier one focusing on rep genes (19), provides a

global assessment of transcript abundance, in both infected lepidopteran hosts and carrier

wasp ovaries, for more than half of the genes identified in the genome of the ichnovirus

TrIV (23). As such, this analysis makes it possible to evaluate the likely importance of

genes within each of the known ichnovirus gene families, as may be inferred from their

observed levels of expression.

The quantitative data presented in Fig 3-4 confirm earlier assessments made by Northern

analysis (1, 2, 5) to the effect that TrV1 is, by far, the most highly expressed TrIV gene in

infected C. fumiferana larvae, with transcript levels almost six times higher than those of

the most highly expressed rep gene, TrFrep1. In comparison, genes from all other

families are expressed at levels >15 times lower than those of TrFrep1 (Fig 3-4). These

results suggest that genes from the TrV and rep families, and more specifically TrV1 and

TrFrep1, encode products that are likely to be required for induction of developmental

arrest, which is the principal physiological perturbation observed in TrIV-infected C.

fumiferana hosts (9, 10).

The Cys-motif gene family (8) has ten representatives in the CsIV genome (26), some of

which are abundantly expressed in parasitized Heliothis virescens larvae (3, 4). In this

host, their protein products appear to play a role in both immune suppression (6, 17) and

developmental disturbances (13). In comparison, we detected only one member of this

family in the TrIV genome (23), and its expression was here observed to be very low in

the three samples we examined (Fig 3-1). These results support our earlier hypothesis

(23) that Cys-motif genes may no longer be required by T. rostrale to achieve successful

parasitism, inasmuch as TrIV has little or no impact on the cellular immune response of

C. fumiferana hosts (9, 10). However, it has been noted earlier that Cys-motif and TrV

genes appear to have a common ancestor (1), but that TrV proteins lack the characteristic

cysteine motif (C…C…CC…C…C) of CsIV Cys-motif gene products, which may be

58

essential to achieve host immune dysfunction, while it may not be required for induction

of developmental arrest.

The only other ichnovirus gene family that has been extensively examined with respect to

transcript abundance is the ank (or vank) family in CsIV (15). Although transcript levels

of the seven known CsIV ank genes were not compared to those of other CsIV genes, all

but one were readily detectable by Northern blot analysis of RNAs extracted from

parasitized H. virescens larvae, and two of the protein products could be detected by

either Western blot analysis or immunofluorescence assays (15). In addition, using an rq-

RT-PCR strategy, transcripts of all seven genes could be quantified in parasitized larvae,

and transcripts could also be detected at low levels in female wasps (15). In the present

study, the two known TrIV ank genes were expressed at higher levels in wasp ovaries

than in parasitized C. fumiferana hosts at 3 d p.p. (Fig 3-1), but transcript abundance was

below 3,000 copies/ng total RNA in both hosts. Our sampling time may not have been

optimal for the detection of TrIV ank transcripts in C. fumiferana, although CsIV ank

mRNA levels were typically maximal at 3 d p.p. in parasitized H. virescens larvae (15).

In addition, the higher transcript levels observed in female wasps, compared to

parasitized caterpillars, may be due, at least in part, to the fact that we limited our

analyses to wasp ovaries, thereby generating an RNA sample enriched in TrIV

transcripts, as the ovaries appear to be the only tissue supporting significant TrIV gene

transcription in the T. rostrale host (19). Nonetheless, the data presented here suggest that

TrIV ank genes play a limited role in altering C. fumiferana host physiology.

It has been known for many years that some ichnovirus genes are expressed in the

reproductive tract of female wasp carriers (4, 24), although the functional significance of

such expression has not been elucidated. As reported earlier (19) one of the 17 TrIV rep

genes, rep166 (C166.1), was transcribed at relatively high levels in T. rostrale ovaries,

while transcript abundance of TrIV genes associated with other ichnovirus families

identified prior to the present study, including the TrV family, was much lower (Fig 3-5).

However, transcript levels of OSSP1, one of the four members of a novel TrIV gene

family (Fig 3-2), were sufficiently high (~12,000 copies/ng total RNA) to make us

consider the possible role of this protein in the biology of T. rostrale. Since OSSPs are

59

predicted to be secreted, they could accumulate in the lumen of the oviduct prior to being

injected into the lepidopteran host during oviposition. Their C-terminal cysteine motif is

clearly distinct from that of ichnovirus Cys-motif proteins, but the disulfide bonds they

are predicted to form should ensure their stability until injection in the lepidopteran host,

in which they could play a role in host regulation before TrIV gene expression begins.

Unlike OSSP1, rep166 is not a secreted protein, and is therefore not predicted to

accumulate in the ovarian fluid. For this reason, we have suggested that it may play a role

in virus replication (19). Hypotheses regarding the roles of these two proteins are

currently being addressed experimentally.

In addition to generating a global profile of TrIV gene transcription in infected C.

fumiferana larvae, the present study provides an assessment of gene predictions made

during annotation of the TrIV genome (23). Overall, these predictions were accurate,

particularly in the case of ORFs that could be assigned to known ichnovirus gene families

(Table 3-1), although small errors were made in identifying the splicing junctions of two

genes (Table 3-2). With respect to “unassigned” ORFs, our predictions appear to have

been somewhat less accurate, particularly for “orphan” putative genes, although this

conclusion is based on a relatively small sample of genes. It should also be pointed out

that the few genes that escaped detection in the present study could well be expressed in

other lepidopteran hosts of T. rostrale.

Acknowledgements

This research was supported by grants from the Canadian Forest Service (CFS) and a

Discovery grant from the Natural Sciences and Engineering Research Council of Canada

to MC.

60

3.7 References

1. Béliveau C, Laforge M, Cusson M, Bellemare G. (2000). Expression of a

Tranosema rostrale polydnavirus gene in the spruce budworm, Choristoneura

fumiferana. J. Gen. Virol. 81, 1871-1880

2. Béliveau C, Levasseur A, Stoltz D, Cusson M. (2003). Three related TrIV

ichnovirus genes: comparative sequence analysis, and expression in host larvae

and Cf-124T cells. J. Insect. Physiol. 49, 501-511.

3. Blissard G W, Smith O P, Summers M D. (1987). Two related viral genes are

located on a single superhelical DNA segment of the multipartite Campoletis

sonorensis virus genome. Virology. 160, 120-134.

4. Blissard G W, Theilmann D A, Summers M D. (1989). Segment W of Campoletis

sonorensis virus: Expression, gene products, and organization. Virology. 169, 78-

89.

5. Cusson M, Béliveau C, Laforge M, Bellemare G, Levasseur A, Stoltz D. (2001).

Hormonal alterations and molecular mechanisms underlying the induction of host

developmental arrest by endoparasitic wasps, In: Endocrine Interactions of

Parasites and Pathogens. (J.P. Edwards and R.J. Weaver, eds). BIOS Scientific

Publishers, Oxford, 111-121.

6. Cui L, Soldevila A, Webb B W. (1998). Expression and hémocytes-targeting of a

Campoletis sonorensis polydnavirus cysteine-rich gene in Heliothis virescens

larvae. Arch. Insect. Biochem. Physiol. 36, 251-271.

7. Desjardins C A, Gundersen-Rindal D E, Hostetler J B, Tallon L J, Fadrosh D W,

Fuester R W, Pedroni M J, Haas B J, Schatz M C, Jones K M, Crabtree J,

Forberger H, Nene V. (2008). Comparative genomics of mutualistic viruses of

Glyptapanteles parasitic wasps. Genome. Biol. 9,183.

61

http://www.interscience.wiley.com/jpages/0739-4462/

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Desjardins%20CA%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Gundersen-Rindal%20DE%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Hostetler%20JB%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Tallon%20LJ%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Fadrosh%20DW%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Fuester%20RW%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Pedroni%20MJ%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Haas%20BJ%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Schatz%20MC%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Jones%20KM%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Crabtree%20J%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Forberger%20H%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Nene%20V%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

8. Dib-Hajj S D, Webb B A, Summers M D. (1993). Structure and evolutionary

implications of a cysteine-rich Campoletis sonorensis polydnavirus gene family.

Proc. Natl, Acad. Sci. USA. 90, 3765-3769.

9. Doucet D, Cusson M. (1996a). Alteration of developmental rate and growth of



10. Doucet D, Cusson M. (1996b). Role of calyx fluid in alterations of immunity in

Choristoneura fumiferana larvae parasitized by Tranosema rostrale. Comp.

Biochem. Physiol. 114, 311-317.

11. Einerwold J, Jaseja M, Hapner K, Webb b, Copié V. (2001). Solution structure of

the carboxyl-terminal cysteine-rich domain of the VHv1.1 polydnaviral gene

product: comparison with other cysteine knot structural folds. Biochemistry. 40,

14404-14412.

12. Espagne E, Dupuy D, Huguet E, Cattolico L, Provost B, Martins N, Poirie M,

Periquet G, Drezen J M. (2004). Genome sequence of a polydnavirus: insights

into symbiotic virus evolution. Science. 306, 286-289.

13. Fath-Goodin A, Gill T A, Martin S B, Webb BA. (2006). Effect of Campoletis

sonorensis ichnovirus cys-motif proteins on Heliothis virescens larval

development. J. Insect. Physiol. 52, 576-585.

14. Kroemer J A, Webb B A. (2004). Polydnavirus genes and genomes: emerging

gene families and new insights into polydnavirus replication. Annu. Rev.

Entomol. 49, 431-456.

15. Kroemer J A, Webb B A. (2005). Iκβ-related vankyrins genes in the Campoletis

sonorensis Ichnovirus: temporal and tissue-specific patterns of expression in

parasitized Heliothis virescens lepidopteran hosts. Virology. 79, 7617-7628.

16. Lapointe R, Tanaka K, Barney W, Whitfield J, Banks J, Béliveau C, Stoltz D,

Webb B A, Cusson M. ( 2007). Genomic and morphological features of a

62





banchine polydnavirus: a comparison with bracoviruses and ichnoviruses. J.

Virol. 81, 6491-6501.

17. Li X, Webb B A. (1994). Apparent functional role for cysteine-rich polydnavirus

protein in suppression of insect cellular immune response. Virology. 68, 7482-

7489

18. Matz M V. (2000). Amplification of representative cDNA samples from

microscopic amounts of invertebrate tissue to search for new genes. In: Green

Fluorescent Protein: Applications and protocols (Hicks, B.W., E.d.), 1-21,

Humana Press Inc., Totowa, NJ.

19. Rasoolizadeh A, Béliveau C, Stewart D, Cloutier C, Cusson M. (2009).

Tranosema rostrale ichnovirus repeat element genes display distinct

transcriptional patterns in caterpillar and wasp hosts. J. Gen. Virol. 90: 1505 -

1514

20. Rutledge R G, Stewart D. (2008a). A kinetic-based sigmoidal model for the


quantitative real-time PCR. BMC. Biotechnol. 8, 47.

21. Rutledge R G, Stewart D. (2008b). Critical evaluation of methods used to


PCR. BMC Mol. Biol. 9, 96.

22. Stoltz D B. (1993). The polydnavirus life cycle. In Parasites and Pathogens of

Insects. 1, 80-101. Edited by N. Beckage, S. N. Thompson & B. A. Federici. San

Diego, CA: Academic Press.

23. Tanaka K, Lapointe R, Barney W, Makkay A, Stoltz D, Cusson M. Webb B A.

(2007). Shared and species-specific features among ichnovirus genomes.

Virology. 363, 26-35.

24. Theilmann D A, Summers M D. (1988). Identification and comparison of


63






64


329-341.

25. Volkoff A N, Béliveau C, Rocher J, Hilgarth R, Levasseur A, Duonor-Cérutti M,

Cusson M, Webb B A. (2002). Evidence for a conserved polydnavirus gene

family: ichnovirus homologs of the CsIV repeat element genes. Virology. 300,

316-331.

26. Webb B A, Strand M R, Dickey S E, Beck M H, Hilgarth R S, Barney W E,

Kadash K, Kroemer J A, Lindstrom K G. (2006). Polydnavirus genomes reflect

their dual roles as mutualists and pathogens. Virology. 347, 160-174.



http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Dickey%20SE%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus


http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Hilgarth%20RS%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus


http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Kadash%20K%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus


http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Lindstrom%20KG%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus

CHAPITRE 4 Conclusion

Les résultats des analyses transcriptionnelles présentées dans ce mémoire suggèrent que

l’identification des gènes réalisée au moment de l’annotation du génome de TrIV (Tanaka

et al., 2007) était, dans l’ensemble, assez juste. En effet, il s’avère que la plupart des

gènes identifiés sont exprimés, soit chez des larves de C. fumiferana parasitées par T.

rostrale ou injectées du virus TrIV, ou dans les ovaires de la guêpe, mais à des niveaux

qui varient considérablement. À ma connaissance, cette étude est la première à générer un

profil d'expression, par qPCR, pour l’ensemble des gènes d’un polydnavirus, à la fois

chez l’hôte infecté et dans l’ovaire de la guêpe porteuse.

Pour la réalisation des analyses transcriptionnelles qui sont présentées ici, j'ai utilisé, pour

chaque temps d’échantillonnage, un seul échantillon biologique. Cet échantillon

représente un pool d'ARN obtenu de plusieurs individus, lequel j’ai divisé en quatre

aliquots. C’est à partir de ces aliquots que j'ai fait des évaluations séparées des niveaux

de transcrits. Cette forme de réplication, connue sous le nom de "réplication technique",

estime la variabilité associée à la technique de quantification (sources de variation

possibles: appareils, réactifs, expérimentateur, etc), par opposition à la variation

biologique inter-individuelle.

En raison de la faible quantité de transcrits associés à certains des gènes étudiés, chez les

larves ou les guêpes, et également en raison du temps limité pour compléter le travail, le

choix a été fait de mettre en commun les ARN de plusieurs insectes et de renoncer à la

réplication biologique, où deux ou plusieurs réplicats biologiques sont obtenus. Bien que

65

des comparaisons entre des mesures faites à partir de pools d’ARN n’auraient pas fourni

d'information sur la variation inter-individuelle, de telles comparaisons auraient donné

des informations supplémentaires sur la répétabilité de l'ensemble de la procédure de

quantification. Ainsi, dans des études futures sur la transcription des gènes de TrIV, il

vaudrait la peine d’investir les ressources nécessaires pour que de tels réplicats soient

obtenus.

Deux familles des gènes de l’ichnovirus TrIV, TrV et rep, se sont avérées être les plus

importantes du point de vue de l’abondance des transcrits de certains de leurs membres

chez des chenilles parasitées. Bien que des transcrits aient été détectés pour presque tous

les gènes étudiés dans l’un ou l’autre des deux hôtes, les niveaux élevés observés pour

certains membres des familles TrV et rep suggèrent que ces deux familles de gènes jouent

des rôles cruciaux dans le succès du parasitisme de C. fumiferana par T. rostrale.

Parmi les membres de la famille rep, TrFrep1 s’est avéré être beaucoup plus fortement

exprimé que les autres gènes rep, et ses transcripts étaient plus abondants dans

l’épithélium cuticulaire et le corps gras de l’hôte que dans les deux autres tissus

examinés. Toutefois, des différences ont été observées dans l'abondance relative des

transcrits de chaque gène rep dans les quatre tissus à l’étude, ce qui suggère l'existence de

rôles spécifiques pour différents gènes rep dans ces tissus au cours du parasitisme.

Dans les ovaires de T. rostrale, le profil d'expression des gènes rep s’est avéré clairement

différent de celui observé dans les chenilles infectées. Alors que TrFrep1 était le gène rep

le plus fortement exprimé chez les larves de C. fumiferana infectées, ses transcrits étaient

à des niveaux très faibles dans l’ovaire de T. rostrale, alors que les transcrits d'un autre

gène rep, C166-1, étaient présents à des niveaux très élevés dans ce tissu. Ces différents

patrons de transcription des gènes rep entre les ovaires de la guêpe et chez la chenille

hôte suggèrent que certains gènes rep pourraient jouer des rôles spécifiques à la guêpe

alors que d’autres seraient spécifiques à la chenille. Comme la réplication ichnovirale ne

se produit que dans les ovaires de la guêpe porteuse, il semble plausible que les gènes rep

qui y sont exprimés soient impliqués dans la réplication du génome viral, bien que cette

hypothèse reste à vérifier.

66

Dans l'évaluation de l'expression d'autres gènes de TrIV, y compris ceux des familles inx,

ank, Cys-motif, PRRP, N et TrV, des transcrits ont été détectés pour la plupart des gènes

étudiés chez des larves infectées, mais, à l'exception de TrV1, ces niveaux se sont avérés

beaucoup plus faibles que ceux mesurés pour TrFrep1. Cette observation soulève la

question à savoir si ces gènes, comme ceux de la famille rep qui sont transcrits à des

niveaux très faibles, jouent un rôle important au cours du parasitisme de C. fumiferana

par T. rostrale et, si non, pourquoi leur présence dans le génome de TrIV est nécessaire.

Toutefois, il faut souligner ici que l'expression de ces gènes chez C. fumiferana a été

évaluée à un seul temps d’échantillonnage (3 jours après l'infection) et qu'ils pourraient

être exprimés plus fortement à d'autres moments après la ponte ou chez des chenilles

appartenant à d'autres espèces hôtes.

Parce que les segments génomiques des polydnavirus ne sont pas présents en quantités

équimolaires dans le génome viral, l'abondance relative de chaque segment pourrait avoir

un impact sur le niveau d'expression des gènes qu’ils portent, particulièrement dans la

chenille hôte, où le virus ne se réplique pas. Dans les analyses présentées au Chapitre 2,

les gènes rep exprimés le plus fortement chez des chenilles infectées, TrFrep1, TrFrep2

et C166-1, sont portés par les deux segments génomiques les plus abondants, parmi les

dix segments de TrIV qui contiennent des gènes rep, soit F1 et C166, ce qui suggère un

impact possible de l’abondance relative des segments génomiques sur l'expression des

gènes qu’ils portent. Toutefois, il n'y avait pas de corrélation évidente entre les niveaux

de transcrits et l'abondance des segments génomiques pour les autres gènes rep. Ainsi, il

semble que d'autres facteurs, en plus de l'abondance relative des segments génomiques,

soient impliqués dans le contrôle des niveaux d’expression de ces gènes, dont la force du

promoteur, la stabilité des segments génomiques et des transcrits, ainsi que l'intégration

possible de segments génomiques ichnoviraux au génome de l'hôte (Doucet et al., 2007).

Dans le cadre d’analyses locales de type Blastp, où chaque cadre de lecture ouvert

(« ORF ») non-assigné (à une famille de gènes connue) a été utilisé pour interroger la

base de données des séquences ORF non-assignées du génome de TrIV, trois groupes

d’ORF apparentés ont été identifiés. L’un d’entre eux est constitué de quatre membres

affichant un motif cystéine ainsi qu’un peptide signal. Fait intéressant, ces gènes

67

semblent être exprimés presqu’exclusivement dans les ovaires de la guêpe. Sur la base de

ces deux observations, il a été prédit que ces protéines sont sécrétées dans la lumière des

oviductes latéraux ; c’est pour cette raison qu’elles ont été nommées « Ovary-Specific

Secreted Proteins (OSSP). On peut envisager que les ponts disulfure formés entre les

résidus cystéine des protéines ont pour effet d’accroître leur stabilité et leur longévité

suivant leur injection présumée dans l'hôte lépidoptère. Leur fonction réelle dans le

contexte du parasitisme demeure inconnue, mais l'hypothèse selon laquelle elles sont

injectées dans l’hôte pendant la ponte pourrait être évaluée à l'aide de méthodes

immunologiques. Dans l'hôte lépidoptère, les OSSP pourraient contribuer à limiter

l’encapsulation des œufs de guêpes dans la chenille hôte et/ou lancer le processus menant

à l'arrêt du développement de la chenille hôte avant que ne débute l'expression des gènes

de TrIV à partir des virions injectés. Dans une première étape visant à évaluer cette

hypothèse, des interactions possibles entre les OSSP et les protéines hôtes pourraient être

étudiées en utilisant des approches telles que l’analyse par GST-pull-down, suivie par

l'identification des protéines impliquées dans cette interaction. Une fois ces protéines

identifiées, des hypothèses testables quant à la fonction des OSSP pourraient être

développées et évaluées. De plus, l'impact des résidus cystéine sur la structure de la

protéine et sa stabilité pourrait être évalué par modélisation moléculaire et mutagenèse

dirigée.

Puisque parmi les membres de la famille rep de TrIV, TrFrep1 est celui qui est exprimé

le plus fortement chez des chenilles parasitées, une étude visant l’identification de la

fonction de ce gène a été entreprise. Cette étude fait appel à l’approche microarray. Tel

que mentionné dans les sections précédentes, les gènes rep codent pour des protéines

non-sécrétées, et certains sont exprimés presqu’exclusivement dans les chenilles hôtes,

alors que d'autres sont spécifiques à l’ovaire de guêpe. L’arrêt du développement de

l’hôte et la suppression de sa réponse immunitaire cellulaire sont les deux effets

principaux attribués aux polydnavirus au cours du parasitisme. Toutefois, contrairement à

d'autres polydnavirus caractérisés par d'autres équipes de recherche au cours des

dernières années, TrIV ne semble pas jouer un rôle important dans l’inhibition active de

la réponse immunitaire cellulaire de l’hôte, bien qu’il entraîne des perturbations

prononcées de sa métamorphose (Cusson et al., 2000). Ainsi, dans nos tentatives visant à

68

identifier la fonction des gènes rep, le gène TrFrep1 a été exprimé dans des cellules de C.

fumiferana en culture (CF-203), avec l'intention d'évaluer les effets de sa sur-expression

sur l’expression des gènes des cellules hôtes ; ces analyses devient être complétées dans

les mois suivant le dépôt final du présent mémoire. Si la protéine TrFrep1 module

l'expression de gènes chez l'hôte, l'identification de ces gènes par l’analyse microarray

permettra d'identifier les sentiers métaboliques dans lesquels les gènes modulés sont

impliqués. Sur la base de cette information, nous devrions être en mesure de formuler des

hypothèses testables quant à leur rôle potentiel dans le succès du parasitisme par T.

rostrale.

L'étude de l'expression des gènes de TrIV chez des chenilles de C. fumiferana parasitées

par T. rostrale, ainsi que dans l’ovaire de la guêpe, est une méthode parmi d'autres pour

entreprendre l’élucidation des stratégies utilisées par ce virus pour perturber la régulation

hormonale et l’initiation de la métamorphose chez les hôtes parasités. Lorsque les

fonctions des gènes principaux auront été identifiées, certains pourraient s'avérer utiles

dans le développement de nouveaux agents de lutte biologique pour la répression des

populations de C. fumiferana dans les forêts canadiennes. Étant donné que l'infection par

TrIV nécessite que le virus soit injecté dans une chenille par une guêpe, ce virus ne

pourrait être utilisé comme ingrédient actif d’un insecticide viral, pour lequel l'infection

par voie orale doit être possible. Toutefois, certains gènes de TrIV pourraient être utilisés

pour modifier génétiquement des baculovirus insecticides, que ce soit pour améliorer leur

efficacité ou leur spectre d'hôtes. Certains gènes de TrIV pourraient aussi être utilisés

pour le génie génétique des arbres hôtes, afin d'accroître leur résistance aux défoliateurs

(Gill et al., 2006).

69

70

4.1 Références

1. Doucet, D., Levasseur, A., Béliveau, C., Lapointe, R., Stoltz, D. & Cusson, M.

(2007). In vitro integration of an ichnovirus genome segment into the genomic

DNA of lepidopteran cells. J. Gen. Virol. 88, 105-113.

2. Cusson, M., Laforge, M., Miller, D., Cloutier, C. & Stoltz, D. (2000).Functional

significance of parasitism-induced suppression of juvenile hormone esterase

activity in developmentally delayed Choristoneura fumiferana larvae. Gen.

Comp. Endocr. 117, 343-354.

3. Gill TA, Fath-Goodin A, Maiti II, Webb VA. (2006). Potential uses of Cys-motif

and other polydnavirus genes in biotechnology. Adv. Virus. Res. 68, 393–426.

4. Tanaka K, Lapointe R, Barney W, Makkay A, Stoltz D, Cusson M. Webb B A.

(2007). Shared and species-specific features among ichnovirus genomes.

Virology. 363, 26-35.

ANNEXE A Effect of TrIV rep gene expression on host gene transcription, as determined by microarray analysis

A.1 Introduction

In the course of assessing the transcription patterns of Tranosema rostrale ichnovirus

(TrIV) genes in infected Choristoneura fumiferana larvae, we observed that some

members of the TrV and rep gene families were the most highly transcribed genes in

infected larvae (Rasoolizadeh et al., 2009 a, b). These two gene families show no

similarity to other eukaryotic or viral (non-PDV) genes, and their functions during

parasitism have yet to be identified (Theilmann & Summers, 1987; Tanaka et al., 2007).

The rep gene family is the largest family within the TrIV genome, with 17 ORFs. These

genes consist of imperfectly conserved repeats of ~540-bp, and encode non-secreted

proteins (Theilmann & Summers, 1987). Among the TrIV rep family members, one gene,

TrFrep1, is expressed much more abundantly in parasitized larvae than all other members

of this family (Rasoolizadeh et al., 2009 a), suggesting that it likely plays an important

role in the course of parasitism. In an effort to identify the function of rep genes in TrIV-

infected C. fumiferana larvae, we undertook a study of the effect of rep gene expression

on host gene transcription, using microarray analysis. Here, we transfected C. fumiferana

CF-203 cells (Sohi et al., 1993) with either an empty expression vector or a vector

containing the TrFrep1 coding region. Total RNA was then extracted from the CF-203

cells 24 and 48 h following transfection, with the intent of using it to assess modulation

of host gene expression through microarray analysis. At the time of writing this appendix,

71

the latter analysis had not yet been completed, but I here report on vector construction

and TrFrep1 transcript quantification after transfection.

A.2 Material and methods

The TrFrep1 coding region was amplified by PCR using the following primers:

5´ CGTTTCCATGGGCATTATCATTATCATCGGGT 3´) and

5´ TTTTAGCACAGCGGCCGCACA 3´ (NcoI and NotI restriction sites are underlined).

PCR amplification was performed using 0.25 µM of each primer, 0.2 mM of each dNTP,

in 1x PCR buffer. After a hot start at 94°C for 3 min, PCR was carried out by addition of

2 U of Taq DNA polymerase at 80°C. The rest of the cycling conditions were as follows:

30 cycles of 94°C, 45 s; 48°C, 45 s; 72°C, 1 min; and a final extension step at 72°C for 5

min. PCR products were cloned into pGEM-T Easy (Promega) vector and sequenced.

Subsequently, the fragment was subcloned into the GFP-PE38 lepidopteran expression

vector (a gift of D. Theilmann, AAFC, Summerland, B.C.) using the two aforementioned

restriction enzymes, effectively replacing the GFP insert (Fig. 1). A C. fumiferana cell

line (CF-203) was transfected with the expression vector carrying TrFrep1, as well as

with the empty vector as a control. Cells were seeded into six-well plates and grown to

60-70% confluence and transfected with 3 µg DNA/well using the ExGEN500

transfection reagent (Fermentas, ON, Canada) as described in the manufacturer’s

protocol. Twenty-four and 48 h following transfection, total RNA was extracted using

TRIZOL reagent (Invitrogen) according to the manufacturer’s instructions. To verify the

expression of TrFrep1 in transfected cells, we quantified its transcripts using the q-PCR-

LRE approach of Rutledge and Stewart (2008 a, b) and the set of primers designed for

this gene in a previous study (Rasoolizadeh et al. 2009a).

72

A.3 Results

q-PCR analyses revealed high levels (~60,000-75,000 copies/ng RNA) of TrFrep1

transcripts in cells transfected with the TrFrep1-EP38, and a virtual absence of transcripts

in those transfected with the empty vector (Table 1). Each value shown here is the mean

of three biological replicates.

Table A. 1 Mean number of transcripts (± SD) in CF203 cells, one day and two days after transfection with the

TrFrep1-PE38 vector or the empty PE38 vector.

Mean No. of transcripts / ng total RNA ± SD

Days after transfection TrFrep1-PE38 Empty PE38

1 73,095 ± 18513 3 ± 0 2 59,058 ± 13245 0 ± 0

The correct GFP -PE38 construct621 6 bp

IE2

GFP

PE38 5'

PE38 3'

Transcription start site

Figure A. 1 The TrFrep1 coding region cloned into the PE38 lepidopteran expression vector using two

restriction enzymes (NcoI and NotI), replacing the GFP insert.

73

A.4 Discussion

The present data indicate that transfection of C. fumiferana CF-203 cells with an

expression vector carrying the TrFrep1 coding region generated high levels of TrFrep1

transcripts in those cells, while these transcripts were absent from cells transfected with

the empty vector. These RNA samples are therefore ideally suited for a microarray

analysis of the modulation of host gene expression by TrFrep1.

Among all 17 TrIV rep genes, TrFrep1 was shown earlier to have the most abundant

transcripts in parasitized C. fumiferana larvae, suggesting that it plays an important role

in the success of parasitism by T. rostrale (Rasoolizadeh et al., 2009a). If TrFrep1

expression modulates host gene expression, it should be possible to identify, using

microarray analysis, the metabolic pathway(s) in which the modulated genes are

involved. On the basis of this information, we should be able to generate testable

hypotheses about the proteins with which the TrFrep1 protein interacts and therefore

identify the function(s) of rep genes. Thus, the RNAs that were extracted from

transfected cells will now be used for the production of labeled cDNAs and hybridization

on a C. fumiferana DNA chip containing ~5000 genes. This analysis will be performed in

the laboratory of a collaborator of the Canadian Forest Service in Sault Ste. Marie.

Acknowledgments

I thank Daniel Doucet and Tim Ladd (Great Lakes Forestry Centre, Sault Ste. Marie) for

the transfection of CF-203 cells, and Catherine Béliveau (Laurentian Forestry Centre,

Quebec City) for guidance in cloning the TrFrep1 coding region in the GFP-EP38 vector.

74

75

A.5 References

1. Rasoolizadeh, A., Béliveau C., Stewart D., Cloutier C., & Cusson M. (2009a).

Tranosema rostrale ichnovirus repeat element genes display distinct

transcriptional patterns in caterpillar and wasp hosts. J. Gen. Virol. 90, 1505-1514

2. Rasoolizadeh, A., Dallaire, F., Stewart, D., Béliveau, C & Cusson, M. (2009b).

Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected

lepidopteran hosts and wasp ovaries. J. Virologica Sinica, in press.

3. Rutledge, R. G. & Stewart, D. (2008a). A kinetic-based sigmoidal model for the


quantitative real time PCR. BMC. Biotechnol. 8, 47.

4. Rutledge, R. G. & Stewart, D. (2008b). Critical evaluation of methods used to


PCR. BMC. Mol. Biol. 9, 96.

5. Sohi, S. S., Lalouette, W., MacDonald, J. A., Gringorten, J. L., & Budau, C. B.

(1993). Establishment of continuous midgut cell lines of spruce budworm

(Lepidoptera: Tortricidae) [abstract I-1001]. In Vitro Cell Dev. Biol. 29A (3).

6. Tanaka, K., Lapointe, R., Barney, W. E., Makkay, A. M., Stoltz, D., Cusson, M.

&Webb, B. A. (2007). Shared and species-specific features among ichnovirus


7. Theilmann, D. A. & Summers, M. D. (1987). Physical analysis of the Campoletis

sonorensis virus multipartite genome and identification of a family of tandemly

repeated elements. J. Virol. 61, 2589-2598.






ANNEXE B

Supplementary data for chapter 2:

Tranosema rostrale ichnovirus repeat element genes display distinct transcriptional patterns in caterpillar and wasp hosts

Table B-1 List of primer pairs used for q-PCR quantification of 17 TrIV rep transcripts and 10 rep gene-bearing TrIV genome segments. For quantification of genome segments harboring more than one rep gene, the single primer pair used is identified (*). For rep gene id, we used the name of the genome segment (e.g. C3), followed by the ORF number (e.g. C3-2). C166 and C289 denote ORFs that are on contigs 166 and 289 (i.e., partial sequences of an unidentified genome segment).

rep gene id 5´ 3´primer sequence Orientation

CTC ATC TGA ATA CGA TAA GAC AGC TCG TAC TCC Reverse B2-2

CTC TAG CGA CAG CGA ACA GAC GAC T Forward

GGT ATA AGC GCC ATT GTT CGG CCA T Reverse C3-1*

CTG TGA ACA TGC GCC GAG CAT G Forward

GCA GAT CAA AGT ATT CTC CAG AAT TTT CAA CCA AGT TTC Reverse C3-2

CGA TTT GCT TCC TGC CCT TGT CAT CT Forward

GCA CGC TCA TGT TGC GAA AAT GAA TTG TT Reverse C4-1*

TGC AAT TAC GGA CAC TTC CAT CAT TAT TGC TAT CTA C Forward

GGA GAA GTG ATG ACG GAG AAG TGG TAA GAA A Reverse C4-2

TCA CCT GCT AAA CAA AGA CGG GCA AC Forward

CAA CAG AAT CGC AGG TTC CAA ATA ATT GCC T Reverse C7-1*

CCT GTT CCA CGA CGG TGA AGA GTT TGA TA Forward

76

GC CCG TCT GAA AGT GAA CAA TAT CAC A Reverse C7-2

CCT TCA GTG GAC GAG TGC GGA AAT Forward

AGA ATC GCT GGT TCC AGA TAA CGG AGC Reverse C166-1

CTC CTG TGG AAA GGA CAG CCC AGA TA Forward

AGA TAA CAC ACG CAT TCG GCG TAT TGA AAG Reverse C289-1

CCG CGT TCT CAT CAA CAC GGA CTC Forward

GCA CAG AAG GAA TCA GGT AAT ATT TCA ACC AGT ATC T Reverse D5-1*

CCT GCC AAT GTT ACC GGA TGA ACG T Forward

GA ATT TGT CCA TCG CTG ACG CGT C Reverse D5-2

CC CTG GAG AAC AGA AGA AGT TTT CAT CAA TTC Forward

AAT TTG CAT AAC TGC CCA CTG TAT AAT AAA AGT CCA Reverse D6-1

CCA TTA TTG TGC CTT GCA CCT TGG GTC Forward

TGT AAC AGA ATC GCA CGT TCC AGG TAT AAC TTG Reverse F1-1*

ATC CTG CTC TTG TCA CTA CAA TAT CCC GG Forward

CCT AGT GGG ACA TTG CAC GGC A Reverse F1-2

ATC ACT ATT GTG CAA CGC ACG TTG AGT C Forward

GGA GAC GAA TCG AGT TAG CCA GGT AAC GAT T Reverse F3-1*

ACA ACG GGC GAG GTA GTG AGA TAA TTG TTG Forward

GCA CGA TCG AGG TAC TCA AGA CAA TGT CC Reverse F3-2

CGA CGA GCA ATG TGG TGA AAA ATT TGT GAG G Forward

TGA ATC GAG TTG ACC AGG CAT AGG GTG Reverse F3-3

GGC GAG GTG GTG AAA GAT TTG TTG CA Forward

77

ANNEXE C

Supplementary data for chapter 3:

Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries

Table C-1 Oligonucleotide sequence and orientation of primers designed for PCR amplification of TrIV putative ORFs from a cDNA library.

Gene id 5´ 3´ primer sequence Orientation Accession number

ACGTCGCGAATACTCTCAAC Forward rep-B2

ATCCGGTATTGATTCTCTCATCTG Reverse

AB291141

ATGCTGGAATATAATGCCACGC Forward rep-C3-1

TTCGGCCATGAGGTCATTG Reverse AB291143

ATCACGGTGCACGTTCAT Forward rep-C3-2

TTGAAGAGTAATCCACCGCA Reverse AB291143

ATGCAGCTCTGTCTCCTTC Forward rep-C4-1

GCGTACTTGCACTGTCGA Reverse AB291144

TTCGATCCGTCAAGACCAG Forward rep-C4-2

TCATAGCTGCACGCTCATG Reverse AB291144

AATATCGCTGCTGCCGTC Forward rep-C7-1

TGCAACAGAATCGCAGGT Reverse AB291147

TGAAGCCTTCAGTGGACG Forward rep-C7-2

GACATGCTGTTGACCATCGA Reverse AB291148

GCATCAGGAGCTTCGCTAAT Forward rep-C166

CAGTTATCAACATCGGTGCG Reverse AB291213

ATGTGTCGACGCCACAGT Forward rep-C289

ACAGATAACACACGCATTCG Reverse AB291214

CCAATAACGTTGCCGCTG Forward rep-D5-1

CAGTATCTAACGTGTACCGAGC Reverse AB291153

78

CCAATAACGTTGCCGCTG Forward rep-D5-2

TGTAAGCTTCGATACGCTTGTG Reverse AB291153

ATGGGAGACGCACGTCTT Forward rep-D6

ACGAGCGTACTTCAGCCA Reverse AB291154

ATGATGTCACCGCAGAAC Forward rep-F1-1

TGTAGTGACAAGAGCAGGATG Reverse AF421353

ATGGATAATTGTAAGTTGGGC Forward rep-F1-2

GAACACAGACGATAGGAACGA Reverse AF421353

CCGGYAGATRTAATTCTYYACATGG Forward rep-F3

RCATGTGTCGACGGAAGG Reverse AB291158

ATGGAAMTTTCCRAAATTGMAGAACT Forward Ankyrin family

TAGGCTCCYTCGKYGTCA Reverse AY940454 *

ATGTCTCGGACAATGAAACTT Forward Cys-motif protein

ACTGTTCGCCAAACGGA Reverse AB291215

CTTYCGTYTGCATTACAAAWTMACAG Forward Innexin family

CAATCWCCRATSYGWAGCTTGT Reverse

AB291146 *

AB291152 AB291156

CMKATKTTSAACMAGCTGCAR Forward N family

CACWGATGAGATATCGAGAATTYACAC Reverse

AB291140 *

AB291155 AB291157

ATGGTTCATATTCTGCGGTCA Forward PRRP protein

TCAATACTTCGGTCTTTCTTGTTG Reverse AF421353

ATCGGCGTCAATGTCTCC Forward TrV3

TGCAGATGACAATCCGTAGAATG Reverse AB291160

ATGAACATGACGTGGGTCAT Forward TrV5

GTAGCAGCCAGAACAATACCT Reverse AB291161

CGCAGTGCAAACTTGTCAG Forward TrV6

GGGACAGTGAAGGGTGATATT Reverse AB291149

TCGTCGCAGTGGTAATGG Forward TrV7

GGTAGCTCCAATACTGGCT Reverse AB291164

TCACGAGTCAGCATACGAG Forward A1-unassigned

CCTCTTGGTTGCAGGTGT Reverse AB291138

GCGATGCAAGTAGCCAGT Forward C3-1-unassigned

ACCGAGCATATCATCACCG Reverse AB291143

GTATAAGCGCCATTGTTCGG Forward C3-2-uassigned

ATTCGGAGGGATCTCCTATCC Reverse AB291143

TGCATACCATGTGGCAGG Forward C166-unassigned

GGAATACATCTGGCTGCA Reverse AB291213

AGCTATGAGGTTCGAGCTA Forward C289-unassigned

CACACGCATTCGGCGTAT Reverse AB291214

ACGCACGGAATATTGTAGCG Forward C111-unassigned

CGGCATGACTTCGTGACT Reverse AB291215

G5 1 unassignedATGAATCTTTTTTGGGTTGC Forward

AB291163

79

TTATTTGCATCCATTTCCAAC Reverse

TTTCCAGCCAGAGCTTCGACGGA Forward G5.2 unassigned

TGGTATAGCATTTCGCTCGATC Reverse AB291163

GAGCTTCTCTGGATTATGA Forward G5.3-unassigned

TTTACCGTAATGTGACATGG Reverse AB291163

GAAGCTTTCCTGGATTATCA Forward G5.4-unassigned

TTACCGTAATGTGACAGGT Reverse AB291163

TCTTGTCTGCAGACAGAT Forward F2.3 unassigned

GTATATAAAGGGCTGGCTC Reverse AB291157

ACCCGATGGACTTACTAT Forward F2.4 unassigned

GGGGTATATAAGCGCTAATCT Reverse AB291157

* Because of the high level of within-family nucleotide identities, only one set of primers

could be designed for each of these families. The PCR products, which formed distinct

bands on agarose gels, were analysed and sequenced individually.

80

Table C-2 Oligonucleotide sequence and orientation of primers designed for quantitative real time RT-PCR (qPCR) amplification of TrIV putative ORFs. Note: for primers used for rep genes, see Annexe B.

Gene id 5´ 3´ primer sequence Orientation Accession number

TGGTCGTCACCGCATCTCATCGTG Forward

A1-unassigned AATCCTCTTGGTTGCAGGTGTGAAACTT Reverse

AB291138

CATTATGAGATTTCGATGCGACTGCACAGT Forward

C3-1-unassigned GGTATGTGTGTCTGTTTGACACTGCGTT Reverse

AB291143

CGTGCTCCCAACAATAATGGTGAAAGTGG Forward

C3-2-uassigned TTAGACAGCCTAAAACCCATATTCGGAGG Reverse

AB291143

CTGAATGCAGACGCAGCCCTCG Forward

C166-unassigned GATCGGAACGTTTCCTCCGGGAATACAT Reverse

AB291213

TCATCAACACGGACTCTTTGCTACCTGT Forward

C289-unassigned TAAAGACTTTGAGGGAGCTTCACCACC Reverse

AB291214

TCACGGTCACTCATTGTTCGTAAAGAGC Forward

C111-unassigned ACTTCGTGACTTGCCGAGCTGAAC Reverse

AB291215

CTTCTACGGCCGATGTTTGACAATGTTGG Forward

G5.1-unassigned CAATTTGCGCGACAGGTGGCCATA Reverse

AB291163

CTGTGATAAAATAAAGGCCAGGTGCCAAG Forward

G5.2-unassigned GGTGGTAATTGGGTATAACACATGCCTGGA Reverse

AB291163

TCTCAACGCTGTGATAAAATAAAGGCCAGG Forward

G5.3-unassigned GTGGTAATTGGGTATAACACATGCCTGGAC Reverse

AB291163

ACGCTGTGGTAGAATGAAGGCCGAA Forward

G5.4-unassigned GTAATCCGGCATCGCAATAAATGTCTCCAC Reverse

AB291163

GCATCGTCACGATACCCGGTATACAAGT Forward

F2.3-unassigned GCACTCGGGTATATAAAGGGCTGGCTC Reverse

AB291157

TCGCCATGATACCCGGTATACGAGA Forward

F2.4-unassigned CGCTGCGGGGTATATAAGCGCTAATCT Reverse

AB291157

GGATCGACCCACCATTCCATGCTATA Forward

C2-ankyrin-1 GCCTACACAACCACAATGCAAGATCGC Reverse

AB291142

ACTACAAATAAAAAACTACAGTGGTGAGTTTCCCA Forward

C2-ankyrin-2 GCCGTCTGTCGAGCATAATTTCTCACATTC Reverse

AB291142

81

82

GGATTCTATCAAGCCCTGCTGCCAAG Forward

Cys-motif protein GCCAAACGGAATCCTATATTCACGACGC Reverse

AB291215

AGATTTTATGGGTTTCGGTCAAACAATATGAATACTGC Forward

C6-innexin CGGGATTCTAAATTTACTCACTCAAATCAGGGTTA Reverse

AB291146

CCTCAATCAGATTCTACAGTTTTCGATCATCGTGC Forward

E1-innexin CACTGTTGAAACGCTGAGCGATACGAA Reverse

AB291156

CAATTAGGGTTTACGAGTTTCGGTCATCGAGT Forward

D4-innexin CGCAAAGCATAGAAAGTGGTTTCAAACATGACG Reverse

AB291152

GCCAGACGTTAGACAATTATTGTTTGATGCTTGAC Forward

B1-N family GGGAAGTTTACTGTTGAGTGCTGGAGATGCTTTTC Reverse

AB291140

GCTTGTAAGCATGTATAACTCCGCCTCC Forward

D7-N family CGTAGAACTGCTACAGTTGGTGAATCGC Reverse

AB291155

GTACCTTCGGGATCGCTTGCTGTAAGA Forward

F2-N family 1 AGTTGATAAAATGTCTGTTGTAATGCGTTCGCTAG Reverse

AB291157

transcriptional analysis of tranosema ......transcriptional profile was markedly different in wasp...

Documents