the dynamic landscape of transcription initiation in yeast ... · 16.12.2019 · 8 dissociation of...

1

The Dynamic Landscape of Transcription Initiation in Yeast 1

Mitochondria 2

Byeong-Kwon Sohn1,*, Urmimala Basu2,*, Seung-Won Lee1, Hayoon Cho1, Jiayu Shen2, 3

Aishwarya Deshpande2, Smita S. Patel2, Hajin Kim1,3 4

1School of Life Sciences, Ulsan National Institute of Science and Technology, Ulsan, Republic of Korea 5

2Department of Biochemistry and Molecular Biology, Rutgers University, Robert Wood Johnson Medical 6

School, Piscataway, NJ 08854, USA 7

3Center for Genomic Integrity, Institute for Basic Science, Ulsan, Republic of Korea 8

* These authors contributed equally to this work. Correspondence and requests for materials should be 9

addressed to S.S.P. (email: [email protected]) or to H.K. (email: [email protected]). 10

11

Abstract 12

Controlling efficiency and fidelity in the early stage of mitochondrial DNA transcription is 13

crucial for regulating cellular energy metabolism. Studies of bacteriophage and bacterial 14

systems have revealed that transcription occurs through a series of conformational transitions 15

during the initiation and elongation stages; however, how the conformational dynamics 16

progress throughout these stages remains unknown. Here, we used single-molecule 17

fluorescence resonance energy transfer techniques to examine the conformational dynamics 18

of the two-component transcription system of yeast mitochondria with single-base resolution. 19

We show that, unlike its single-component homologue in bacteriophages, the yeast 20

mitochondrial transcription initiation complex dynamically transitions between closed, open, 21

and scrunched conformations throughout the initiation stage, and then makes a sharp 22

irreversible transition to an unbent conformation by promoter release at position +8. 23

Remarkably, stalling the initiation complex revealed unscrunching dynamics without 24

preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for thisthis version posted December 17, 2019. ; https://doi.org/10.1101/2019.12.16.877878doi: bioRxiv preprint

https://doi.org/10.1101/2019.12.16.877878

2

dissociating the RNA transcript, manifesting the existence of backtracking transitions with 1

possible regulatory roles. The dynamic landscape of transcription initiation revealed here 2

suggests a kinetically driven regulation of mitochondrial transcription. 3

4

Introduction 5

Recent studies of transcription machinery have found that transcription initiation is not a 6

unidirectional process that invariably leads to elongation, but is rather a stochastic process 7

that involves divergent pathways such as abortive initiation, backtracking, and pausing in 8

addition to the progression to elongation1-6. These findings suggest that clearing initiation and 9

progressing to elongation might be rate-determining steps that control transcription 10

efficiency, and they have been suggested to be targets of transcription regulation3,7-9. 11

Transcription systems across lineages with different levels of complexity show highly 12

variable initiation efficiencies that depend on specific DNA elements10,11. The initiation stage 13

and transition to elongation are regulatory targets for many proteins and small molecules8,12. 14

Thus, investigating conformational dynamics during the early stage of transcription is crucial 15

to understanding the regulation of transcription efficiency and fidelity. 16

While multi-subunit RNAPs have been studied in great detail, we lack such deep 17

understanding of the mitochondrial transcription systems that share homology with 18

bacteriophage transcription systems. T7 RNA polymerase (RNAP), the single-subunit 19

transcription machinery of bacteriophages, is homologous to the yeast mitochondrial RNAP 20

(Rpo41) and the human mitochondrial RNAP (POLRMT)13-15. Transcription systems in 21

bacteriophages and mitochondria also share common promoter recognition mechanisms15. 22

While T7 RNAP does not require additional proteins to initiate transcription, yeast 23

mitochondrial transcription requires the initiation factor Mtf1, which is responsible for 24


https://doi.org/10.1101/2019.12.16.877878

3

stabilizing open promoter regions6,16-18. Similarly, human mitochondrial transcription 1

requires the initiation factors TFAM and TFB2M19-21. Mtf1 is structurally and functionally 2

homologous to TFB2M19,22, and is functionally similar to the bacterial sigma factor23-25. To 3

regulate transcription efficiency at various promoters, these transcription systems have 4

developed a set of molecular mechanisms, in which they share several key features. Both 5

bacteriophage and bacterial RNAPs show scrunching of the downstream DNA into the active 6

site as the RNA-DNA hybrid and the transcription bubble grow during initiation. After a 7

stable full-length RNA-DNA hybrid is formed, the RNAP releases upstream promoter 8

contacts and the initiation bubble collapses to drive the transition into elongation26-32. A 9

similar mechanism is also thought to exist in higher organisms33,34. More recently, branching 10

between competing pathways and pausing during initiation have been observed in both 11

bacteriophages and bacteria and may play crucial roles in regulating transcription 12

activity1,3,4,35. 13

In yeast mitochondria, transcription initiates with the assembly of Rpo41 and Mtf1 at 14

conserved promoter sequences located at positions −8 to +1 relative to the transcription start 15

site. The 2-aminopurine (2AP) fluorescence and protein-DNA crosslinking experiments have 16

shown that Mtf1 facilitates promoter melting at positions −4 to +2 by trapping the non-17

template strand24,25,36. The structures of T7 and human mitochondrial RNAPs show that the 18

promoter DNA is severely bent around the start-site in the open complex37,38. Single-19

molecule studies of the yeast mitochondrial RNAP have shown that the open promoter 20

dynamically switches between bent and unbent conformations6. The way in which the yeast 21

mitochondrial transcription initiation complex (TIC) transitions from initiation to elongation 22

has not been observed directly, but its single-subunit relative, T7 TIC, exhibits a concerted 23

motion of DNA scrunching and rotation during initiation, and the promoter unbends upon 24

transition to the elongation complex30,32. During transcription initiation by T7 RNAP, the 25


https://doi.org/10.1101/2019.12.16.877878

4

complex adopts a rather static form, represented by a dominant population of conformation at 1

each step. Ensemble-level and single-molecule studies of the T7 transcription system show 2

that transition to the elongation stage occurs through multiple steps, gradually over positions 3

+8 to +1230,39,40. 4

In this study, we used single-molecule fluorescence resonance energy transfer (smFRET) 5

techniques and ensemble biochemical assays to reveal the complex conformational dynamics 6

of the yeast mitochondrial transcription throughout the initiation stage and transition to the 7

elongation stage. As expected, we found that the DNA template progressively bends and 8

scrunches during initiation; however, in contrast to the T7 transcription system, it continues 9

to show transition between closed, open, and scrunched conformations throughout the whole 10

initiation stage. Intriguingly, reversible scrunching and unscrunching transitions in the stalled 11

complexes revealed complex branching kinetics during transcription initiation. The 12

unscrunching transitions were not necessarily accompanied by dissociation of the RNA 13

transcript and appear to be backtracked initiation complexes. At position +8, a sharp 14

conformational transition was observed, marked by the transformation of the upstream DNA 15

into a stable unbent form. The unbending conformational transition at +8 was then followed 16

by a gradual collapse of the initiation bubble to complete the transition into the elongation 17

stage. These findings are in stark contrast to the T7 transcription system, which exhibits more 18

static initial complexes, and synchronous but a gradual unbending and bubble collapse 19

transition over several base positions to the elongation complex. Thus, our results reveal 20

novel conformational dynamics during initiation by the mitochondrial RNAP that could be 21

vital as checkpoints for regulating mitochondrial DNA transcription efficiency and promoter 22

selection. 23

24


https://doi.org/10.1101/2019.12.16.877878

5

Results 1

Transcription initiation progresses through dynamic conformational ensembles 2

In order to probe the conformational dynamics of the yeast mitochondrial TIC using smFRET 3

techniques, we designed a 50-basepair DNA template containing the yeast mitochondrial 4

promoter sequence and fluorescently labeled at specific positions upstream and downstream 5

of the transcription start site (Fig. 1a). The DNA was extended to position −34 and modified 6

with biotin at the 3’ end of the template strand for surface immobilization. Position −16 of 7

the non-template strand was labeled with Cy5 and position +16 of the template strand was 8

labeled with Cy3 (Fig. 1a and 1b), such that the FRET signal between the dyes reported 9

bending and scrunching of the template in real time. The coding sequence was designed to 10

stall transcription at positions +2, +3, +5, and +6 by using a combination of ribonucleotides 11

and 3’-deoxyribonucleotides (DNA template I; Fig. 1b). Another template (DNA template II) 12

was designed to stall transcription at positions +7 and +8. 13

The FRET efficiency distribution at each transcription stalling position was obtained from a 14

large number of single-molecule traces (Fig. 1c). Bare DNA template I exhibited a single 15

peak at low FRET efficiency (EFRET = 0.14). When complexed with Rpo41 and Mtf1, the 16

DNA showed two peaks, one at a low EFRET (0.14) and the other at a mid EFRET (0.38). The 17

low FRET population does not represent bare DNA, because time traces showed dynamic 18

transitions between the low and mid FRET levels (Fig. 1d). Moreover, these transitions were 19

not due to binding and dissociation of proteins, as the same dynamics were observed when 20

unbound proteins were washed out, consistent with a previous report6. Such persistent FRET 21

dynamics in DNA complexed with Rpo41 + Mtf1 represent conformational transitions 22

between closed (low FRET) and open (mid FRET) promoter states6. 23


https://doi.org/10.1101/2019.12.16.877878

6

As transcription was progressed to position +2 by equilibrating the TIC of DNA template I 1

with ATP and GTP (0.5 mM each), we observed a higher FRET state (EFRET = 0.56) that 2

dominated the trace but exhibited transitions to the previously observed low and mid FRET 3

states (Fig. 1c and 1d). The high FRET state presumably represents the scrunched DNA 4

template at position +2, and our results suggest that the scrunched TIC can become 5

unscrunched, switching to a conformation similar to that of the open promoter state, and can 6

sometimes even switch back to the closed promoter state, presumably following the 7

dissociation of RNA product by abortive initiation. Such scrunching-unscrunching dynamics 8

during transcription initiation were recently observed in bacterial transcription machinery and 9

were suggested to provide a paused checkpoint for abortive and productive RNA synthesis3. 10

Upon stalling the TIC at positions +3, +5, +6, and +7, the major FRET population 11

progressively rose to higher FRET levels of 0.63, 0.66, 0.76, and 0.79, respectively. The low 12

and mid FRET populations remained small but switching between the three FRET states 13

persisted (Fig. 1c and 1d). As the concentration of ribonucleotide mix (NTP) was raised at 14

position +7, the high FRET population increased but its FRET level did not change 15

(Supplementary Fig. 1). At a lower NTP concentration of 50 µM, the high FRET population 16

decreased and the TIC exhibited an extended stay at the mid FRET state. At 5 µM NTP, the 17

TIC no longer progressed to the high FRET state. Thus, the high FRET state observed at each 18

stalling position likely represents the major conformation of the TIC stalled at the desired 19

position. Notably, upon stalling the TIC at position +8, the high FRET population 20

disappeared almost completely, and a low FRET population became dominant (Fig. 1c). 21

Under run-off conditions with all ribonucleotides supplied, the FRET distribution was similar 22

to that at position +8. 23

Overall, these results show that the TIC progresses through a series of dynamic 24

conformational ensembles during transcription initiation. The FRET level of the major 25


https://doi.org/10.1101/2019.12.16.877878

7

population gradually increased upon progression from position +2 to +7, followed by an 1

abrupt drop at position +8 (Fig. 1e). At all steps, the TIC continued to show dynamic 2

transitions between distinct FRET states. Based on the changing FRET distribution, we 3

propose that the TIC gradually scrunches up to position +7, but keeps switching between 4

several conformations. Subsequently, the tension caused by scrunching is suddenly released 5

at position +8, allowing the DNA template to form an extended form (Fig. 1a). 6

The FRET level does not precisely represent the bending and scrunching motions of duplex 7

DNA, because it is affected by the DNA twisting motion that accompanies the insertion of 8

the downstream DNA into the transcription site. Hence, we generated alternative DNA 9

templates I and II in which the downstream Cy3 label was positioned on the non-template 10

strand instead of the template strand (DNA templates I NT and II NT; Supplementary Fig. 2). 11

Like those generated from DNA templates I and II, the FRET histograms generated from 12

DNA templates I NT and II NT displayed a gradual increase in the FRET level up to position 13

+7 and a sudden drop at position +8 (Supplementary Fig. 2). By taking an average of the 14

FRET levels from these two sets of DNA templates, we obtained the distances (RD-A) 15

between position −16 of the non-template strand and the center of the downstream DNA at 16

position +16 at each stalling position (Fig. 1f). These distances were compared with those 17

calculated using the crystal structure of the human mitochondrial TIC (PDB: 6ERP; 18

Supplementary Fig. 2)41. Because 6ERP provides the structure of the initiation complex at 19

position 0 (IC0), we calculated the distances at other stalling positions by assuming that the 20

angle between the upstream and downstream DNA arms is fixed, and that the downstream 21

DNA only scrunches and twists during initiation. The RD-A of IC0 matched well between the 22

smFRET data and the crystal structure but showed discrepancies at further stalling positions; 23

specifically, the crystal structure estimated the distance to be larger (Supplementary Fig. 2). 24

This finding implies that the DNA arms gradually bend during initiation, which places the 25


https://doi.org/10.1101/2019.12.16.877878

8

dye pair in closer proximity. The bending angle at each stalling position calculated from the 1

smFRET data started at 110 degrees, gradually increased to 124 degrees at position +7, and 2

then dropped abruptly to 83 degrees at position +8, presumably representing the less bent 3

form of DNA in elongation complex (EC) (Supplementary Fig. 2). 4

5

Transition to the elongation stage occurs with large, abrupt conformational changes 6

To examine the transition from initiation to elongation between +7 and +8, we designed 7

another set of experiments in which we recorded smFRET movies while flowing the 8

ribonucleotide mixture into IC0. Such flow-in measurements allowed us to track the FRET 9

transitions in real time. When the ribonucleotide mixture (0.5 mM each of ATP, GTP, and 10

UTP) was flowed in to progress the TIC to position +7, the initial mid FRET state switched 11

to the high FRET state within several seconds and stayed there for a while. Subsequently, it 12

transitioned back to the low or mid FRET state, followed by another rise to the high FRET 13

state (Fig. 2a). These dynamics continued, presumably reflecting either the scrunching-14

unscrunching dynamics of the TIC or abortive initiation followed by rounds of re-initiation. 15

Similar dynamics were observed during progression to position +8 (promoted by flowing in 16

0.5 mM each of ATP, GTP, UTP, and 3′dCTP), including extended stays at the high FRET 17

state and transitions back to the low/mid FRET state. However, the high FRET state 18

eventually switched abruptly to a prolonged low FRET state (Fig. 2a). The level of this low 19

FRET state matched that of the major population in the equilibrium measurements (Fig. 1c). 20

Therefore, the low FRET state represents the equilibrium structure of EC at position +8 21

(EC8). Flow-in measurements with all ribonucleotides to promote run-off transcription (0.5 22

mM each of ATP, GTP, UTP, and CTP) showed a similar pattern of traces, but in this case, 23

the long-lived low FRET state repeatedly returned to the mid and high FRET levels (Fig. 2a). 24


https://doi.org/10.1101/2019.12.16.877878

9

This finding plausibly represents transcription re-initiation with a new protein complex after 1

run-off synthesis of the previous transcript. The complex stalled at positions +7 and +8 and 2

under run-off conditions showed the same dynamic behaviors at equilibrium as those in the 3

flow-in measurements (Supplementary Fig. 3). However, the FRET dynamics at position +8 4

were rarely observed due to long stalling at the low FRET state. 5

Under run-off conditions, the Cy3 signal increased immediately after the abrupt drop in the 6

FRET level (Supplementary Fig. 4). This protein-induced fluorescence enhancement42 7

accompanying run-off RNA synthesis was attributable to Rpo41 + Mtf1 translocating over 8

the Cy3 fluorophore in the downstream DNA. Comparison of the fluorescence intensity 9

histograms at stalling position +2 and under run-off conditions confirmed the protein-induced 10

fluorescence enhancement effect by revealing the presence of an additional peak at a higher 11

intensity for run-off transcription (Supplementary Fig. 4). These results indicate that Rpo41 + 12

Mtf1 translocates all the way to the end of the DNA template when supplied with all 13

ribonucleotides, further supporting that the abrupt drop in the FRET level reflects a transition 14

to the elongation stage. 15

To quantitatively assess the non-equilibrium transcription dynamics, we constructed FRET 16

population maps by synchronizing smFRET traces at the moment when the FRET level 17

exceeded 0.5 for the first time (time zero) (Fig. 2b). The FRET population map from flow-in 18

measurements for progression to position +7 clearly showed that the low and mid FRET 19

states coexisted before time zero, and the high FRET state dominated afterwards. Notably, 20

the mid FRET population was dominant over the low FRET population immediately before 21

time zero, indicating that the open promoter complex, but not the closed one, can proceed to 22

transcribe and scrunch the DNA. After crossing 0.5, the high FRET state persisted for up to 23

10 seconds, reflecting the conformational stability of scrunched IC7. By contrast, the FRET 24


https://doi.org/10.1101/2019.12.16.877878

10

population map from flow-in for progression to position +8 revealed an earlier transition 1

from the high FRET state back to the mid or low FRET state, as demonstrated by the 2

coexistence of these states after time zero (Fig. 2b). The FRET population map from flow-in 3

for run-off revealed a similar behavior to that seen in the 0 to +8 measurements, but with the 4

low FRET state dominating more at the end, possibly due to differences in the efficiency of 5

incorporating 3’dCTP and CTP. 6

The dominant FRET population at position +8 and under run-off conditions was 7

indistinguishable from that of bare DNA (Fig. 1c and 2b), possibly because DNA templates 8

I/II happened to have similar RD-A values for bare DNA and the elongation complex. This 9

finding made it difficult to judge if the observed high-to-low FRET transition represented 10

initiation-to-elongation transition or abortive initiation. To answer this question, we designed 11

another DNA template +11/−11 that had the same sequence as DNA template II but different 12

labeling positions, i.e., at positions −11 of the non-template strand and +11 of the template 13

strand to enable better resolution in the low FRET range (Fig. 2c). Using this template, bare 14

DNA and the open promoter (IC0) showed FRET levels of 0.32 and 0.75, respectively (Fig. 15

2d). IC7 showed a major FRET level of 0.64, which was lower than that of the open 16

promoter; this finding is reasonable if we consider twisting of the downstream DNA arm, 17

which would position the dye away from the transcription site at this stalling position. In 18

addition, IC7 showed frequent transitions to a low FRET state, whose level matches that of 19

the closed state in IC0 (Fig. 2d, Supplementary Fig. 3). The TIC stalled at position +8 20

showed a dominant FRET level of 0.44, which was different from that of bare DNA, and 21

stayed at this level for a long time, just as the TIC at position +8 on DNA template II 22

displayed a prolonged low FRET state (Fig. 2d, Supplementary Fig. 3). These results confirm 23

that the low FRET state observed at position +8 with DNA template II is distinct from the 24

low FRET state of bare DNA. Thus, we conclude that the TIC switches to the elongation 25


https://doi.org/10.1101/2019.12.16.877878

11

complex at position +8 (EC8), with a large and abrupt change of conformation. As expected, 1

under run-off conditions, DNA template +11/−11 displayed recovery of the FRET level to 2

that of bare DNA, with a small remaining FRET population representing the TIC at 3

intermediate steps (Fig. 2d). 4

5

The transcription initiation bubble collapses upon transition to elongation 6

To obtain further support for our proposal that the transcription complex at +8 represents the 7

elongation complex, we measured the kinetics of initiation bubble collapse. Figure 3a shows 8

a model in which the initiation region from −4 to −1 remains melted up to position +7, and 9

the initiation bubble collapses upon transition to elongation at position +8, reannealing the 10

−4 to −1 region into duplex DNA (Fig. 3a). To monitor the transition from initiation to 11

elongation, we substituted an adenosine at position −4 of the non-template strand with a 2AP 12

residue, which emits fluorescence at 370 nm that is quenched when it pairs with a thymine 13

residue (see online Methods)36. The fluorescence intensity of 2AP at position −4 was high in 14

the open complex as the −4 basepair was melted, which was expected to decrease upon 15

collapse of the initiation bubble. Thus, real-time monitoring of the fluorescence intensity 16

during an in vitro transcription assay on two walking templates (Fig. 3b) allowed us to 17

measure how the kinetics of initiation bubble collapse depends on the transcription position. 18

Upon walking to position +7, the fluorescence of 2AP remained constant for the total 19

observation time (Fig. 3c). However, upon walking to position +8, the fluorescence of 2AP 20

decreased to a lower level at a rate of 0.004 s-1. Similarly, upon walking to positions +9 and 21

+10, the fluorescence intensity decreased to even lower levels at higher rates of 0.0165 s-1 22

and 0.027 s-1, respectively (Fig. 3c and 3d). These results are consistent with our 23

interpretation of the single-molecule data that the complex at position +7 is an initiation 24


https://doi.org/10.1101/2019.12.16.877878

12

complex with an open upstream bubble, and complexes from position +8 onward represent 1

elongation complexes. The results also imply that the rate of transition to elongation 2

increases with increasing length of the RNA/DNA hybrid from +8 to +10. 3

The progression of the major TIC conformation observed here is consistent with the known 4

crystal structures of T7 and the human mitochondrial transcription machinery (Fig. 3e). The 5

crystal structure of the yeast mitochondrial transcription machinery has not been determined; 6

therefore, to represent IC0, we modeled the TIC structure of human mitochondrial RNAP 7

(POLRMT) in complex with transcription factors (TFAM and TFB2M) (PDB: 6ERP)41. The 8

promoter DNA in the TIC shows a sharply bent conformation, leading to a decrease in 9

distance between the FRET dye pair at positions +16 and −16. For IC7, we modeled the 10

known structure of the bacteriophage T7 RNAP in complex with the promoter DNA (PDB: 11

3E2E)37, which exhibits a further bent conformation, consistent with our smFRET data. For 12

the elongation complex, we modeled EC9 of the human mitochondrial transcription complex 13

with DNA (PDB: 4BOC)38, which shows a relaxed conformation of DNA. 14

15

Landscape of conformational dynamics during transcription initiation and elongation 16

Different FRET states representing unbent, bent, and scrunched TIC conformations were well 17

distinguished by our FRET histograms and traces (Fig. 1c and 1d). We used hidden Markov 18

modeling (HMM) to extract kinetic information from the smFRET data (see online 19

Methods)43. Figure 4A shows representative smFRET traces of IC2 and IC7 along with 20

hidden state dynamics from the HMM analysis, assuming three hidden states. The high FRET 21

state (scrunched conformation) frequently switched to the mid FRET state (unscrunched 22

conformation) or the low FRET state (closed promoter), but mainly transitioned through the 23

mid FRET state to reach the low FRET state, consistent with what we observed in 24


https://doi.org/10.1101/2019.12.16.877878

13

synchronized FRET population maps (Fig. 2b). It is also worth noting that the unscrunching 1

events were rare in IC7 compared with IC2, reflecting higher stability of the scrunched TIC 2

at a later stage of transcription. The unscrunching rate revealed by the HMM analysis was 3

0.31 at position +2, and gradually decreased to 0.065 at position +7 during the initiation 4

phase (Fig. 4b). 5

Next, we constructed transition density plots (TDPs) from the HMM analysis at each stalling 6

position (Fig. 4c). The TDP at position 0 clearly shows the dynamics of promoter opening 7

and closing (transition between low and mid FRET states). In IC2, the dominant events are 8

the scrunching-unscrunching events (transition between mid and high FRET states) with rare 9

promoter opening-closing events. After proceeding to positions +3, +5, +6, and +7, the level 10

of the high FRET population gradually increased, consistent with the corresponding FRET 11

histograms. At positions +5, +6, and +7, the relative density of the low-mid FRET transition 12

became higher, which was due to a reduction in mid-high FRET transition events at later 13

stages. At position +8, the high FRET population disappeared almost completely and low-14

mid FRET transitions dominated. Under run-off conditions, diverse FRET states coexisted, 15

and transitions between them resulted in a complex TDP. The transformations of the TDP 16

throughout the initiation and elongation stages highlight the transforming landscape of 17

conformational dynamics throughout the early stage of transcription. 18

19

The stalled initiation complex makes unscrunching transitions without dissociating 20

RNA transcript 21

A straightforward interpretation of the frequent drops in the FRET level for stalled initiation 22

complexes at positions +2 to +7 is that they represent dissociation of the RNA transcript, 23

followed by unscrunching of the DNA (high-to-mid FRET transition), i.e., abortive initiation, 24


https://doi.org/10.1101/2019.12.16.877878

14

and then the re-initiation of transcription using fresh NTP molecules (mid-to-high FRET 1

transition), occasionally intervened by full closing and re-opening of the promoter 2

(transitions to low FRET level). As we constantly supplied NTP mix to keep the reaction at 3

equilibrium in the experiments described above, it was not clear if the drops and rises in the 4

FRET level truly represented the abortion and re-initiation of transcription. Thus, we 5

performed a different set of experiments in which we washed out the NTP mix, Rpo41, and 6

Mtf1, and tracked changes in the FRET distribution over time. At position +2, in just 1 min 7

after NTP wash-out, the scrunched population (high FRET) disappeared almost completely, 8

suggesting rapid dissociation of the dinucleotide transcript (Fig. 5a and 5b). By contrast, at 9

position +7, the scrunched population decreased much slower, with a half-life of 10

approximately 5 min, reflecting the higher stability of IC7 compared with IC2 (Fig. 5a and 11

5c). This finding is consistent with the fact that exit of RNAP from the late initiation stage is 12

markedly slower than that from earlier stages during bacterial transcription35. 13

DNA template II could not distinguish EC8 from the bare DNA at position +8, so we used 14

DNA template +11/−11 to examine conformational changes at this position. Upon NTP 15

wash-out, the scrunched population at position +8 diminished even slower than it did at 16

position +7, demonstrating the high stability of EC8, which is typical of the elongation 17

complex (Fig. 5a and 5d)44. To examine conformational changes under run-off conditions, we 18

traced the open promoter population in DNA template II (Fig. 5a and 5e). The closed 19

conformation dominated at equilibrium, indicating that once the open TIC was formed, 20

transcription occurred relatively fast compared to the process of protein assembly and 21

promoter opening. After NTP wash-out, the open promoter population gradually increased 22

and saturated at a ratio of 0.6, which reflects the equilibrium ratio of the open promoter 23

population in IC0, and the time delay indicates the time required for abortive initiation at 24

mixed positions plus the time for new protein binding. 25


https://doi.org/10.1101/2019.12.16.877878

15

Next, we examined whether the conformational dynamics of the TIC disappeared in the 1

absence of NTP mix to re-initiate transcription with. The NTP mix was washed out from the 2

TIC equilibrated at position +7 and, in most traces, the FRET level dropped a little while 3

after the wash-out, possibly representing an abortive initiation event. However, to our 4

surprise, many traces showing a drop in the FRET level subsequently returned to the high 5

FRET level (Fig. 6a, Supplementary Fig. 5), which must have happened without dissociating 6

RNA strands and synthesizing new ones because there was no NTP substrate remaining. This 7

observation demonstrates that the TIC makes conformational transitions not necessarily by 8

aborting RNA synthesis. As such dynamics occurred with bound RNA strands, the observed 9

mid or low FRET level should not represent the conformation of the open promoter or the 10

bare DNA template. 11

Compared with that in the presence of NTP, the dwell time of the high FRET state in the 12

absence of NTP was markedly longer and displayed a non-exponential distribution, further 13

supporting the proposal that the dynamics of conformational changes in the absence of NTP 14

are distinct from those of abortive initiation (Fig. 6b). The duration that the TIC spent out of 15

the high FRET state was also much longer in the absence of NTP than in the presence of 0.5 16

mM NTP (Fig. 6c). As the majority of NTP-independent transitions occurred to and from a 17

mid FRET level (Supplementary Fig. 5), we measured the high-to-mid and mid-to-high 18

transition rates as if they represented unscrunching and scrunching kinetics, respectively, 19

occurring with bound RNA strands. In the absence of NTP, both transition rates were much 20

lower than those in the presence of NTP, indicating that in the absence of NTP, the TIC goes 21

through slower transitions that are distinct from those of abortive transcription and re-22

initiation (Fig. 6d). 23


https://doi.org/10.1101/2019.12.16.877878

16

After stalling the TIC at position +7 without NTP for longer than 2 min, we flowed in 0.5 1

mM 3’dCTP to see if the TIC could still progress to the elongation stage. Soon after the flow-2

in, the FRET level dropped to that of EC8 (Fig. 6a, Supplementary Fig. 5). This occurred 3

consistently in most traces and a FRET population map generated from the traces 4

synchronized at the moment of 3’dCTP flow-in clearly showed the high-to-low FRET 5

transition occurring in 5 seconds (Fig. 6e). As DNA template II could not distinguish the 6

conformation of EC8 from that of bare DNA, we repeated the same measurement using DNA 7

template +11/−11, and the majority of the traces displayed transitions to the FRET level of 8

EC8 (Fig. 6f). These results show that the TIC can be stalled at a late stage of initiation, make 9

multi-step conformational transitions to unbent or unscrunched DNA conformations without 10

completely dissociating RNA strands, and then resume transcription to progress to the 11

elongation stage. 12

As shown above, the transient drop of FRET level in stalled IC7 should not represent 13

unscrunching of IC7 by abortive dissociation of RNA. Another possibility is that it represents 14

temporary transition forward to an EC-like structure where the upstream promoter is released 15

prior to the addition of the 8th nucleotide and the promoter is unbent. FRET histogram was 16

built from low-FRET events in IC7 with DNA template +11/−11 after NTP was washed out. 17

Then it was compared to the FRET histogram of EC8 with DNA template +11/−11 (Fig. 6g). 18

Major FRET level of the transient drops was distinguishably lower than that of EC8, 19

suggesting that it represents a structure distinct from EC8. Thus, we conclude that IC7 20

branches into a conformation, which represents neither unscrunching by RNA dissociation 21

nor an EC-like structure. 30% of smFRET traces from stalled IC7 showed transient drops of 22

FRET level while 64% showed an irreversible drop (Sup. Fig. 6). Branching ratio between 23

them is in rough agreement with the ratio found from the decay rates of high FRET state 24

before and after NTP wash-out (0.026 vs (0.067−0.026); Fig. 6b). The only possibility is that 25


https://doi.org/10.1101/2019.12.16.877878

17

this distinct transient conformation represents an unscrunched downstream DNA that still has 1

an RNA bound, which can be elongated further. Consequently, downstream DNA 2

unscrunching would destabilize the RNA-DNA hybrid and fray the 3’-end of the RNA, 3

resembling a backtracked complex. 4

5

Discussion 6

In this study, we combined single-molecule techniques with ensemble biochemical assays to 7

dissect the conformational dynamics of the mitochondrial TIC throughout the initiation and 8

elongation stages. At each nucleotide step, the TIC did not adopt a stationary conformation, 9

but rather exhibited dynamic transitions between closed, open, and scrunched conformations. 10

These dynamics persisted but gradually diminished along the initiation stage, culminating in 11

stabilization of the scrunched conformation toward the end of the initiation stage. The 12

downward FRET transitions of the scrunched TIC represent not only abortive initiation 13

events, accompanied by the dissociation and new synthesis of RNA strands, but also pure 14

conformational dynamics without the dissociation of RNA strands. The rate of abortive 15

initiation at position +7, measured as the rate at which the scrunched population decreased 16

after washing out NTP mix (0.0033 s-1; Fig. 5c) was much lower than the unscrunching rate 17

determined via a hidden Markov analysis (0.065 s-1; Fig. 4b), indicating that a large part of 18

the downward FRET transitions were not accompanied by RNA dissociation. 19

This finding is reminiscent of the NTP-independent scrunching-unscrunching dynamics of 20

bacterial transcription systems3. The unscrunching motion in bacterial transcription 21

mechanistically resembles backtracking that leads to long-lived catalytically inactive 22

initiation complexes; this process is thought to play a regulatory role by maintaining an 23

“elongation-ready” initiation complex that can be conditionally triggered. Backtracking 24


https://doi.org/10.1101/2019.12.16.877878

18

during transcription is known to occur by extruding the 3’ end of nascent RNA through the 1

secondary channel45. There is yet to be any evidence that mitochondrial RNAP has a 2

secondary channel like multi-subunit RNAPs. The absence of a distinct secondary channel in 3

mitochondrial RNAP might explain why the lifespan of the unscrunched state at position +7 4

in the Rpo41-Mtf1 complex was relatively short compared to what was found in the bacterial 5

system. However, the structure of human mitochondrial RNAP suggests that there is room for 6

3’-end extrusion near the active site. Thus, the NTP-independent unscrunching motion may 7

represent transient backtracking during initiation that could regulate transcription efficiency. 8

Future experiments on the basepairing state of RNA and the unscrunched structure of TIC 9

would reveal the identity of the transiently unscrunched state found here. 10

Hidden Markov analysis of single-molecule traces allowed us to quantify the conformational 11

transition rates. The unscrunching rate decreased more than 4-fold as transcription initiation 12

proceeded from position +2 to +7, implying that the conformational stability of scrunched 13

DNA is highly sensitive to changes in the TIC structure. The sharp dependence of the 14

unscrunching rate on the transcript length might stem from differences in the stability of 15

RNA-DNA hybrid, which may provide a mechanism to prevent incorrectly transcribed RNA 16

primers entering the elongation stage due to lower stability of the RNA-DNA hybrid. It 17

further relates to the observation that mitochondrial transcription efficiency varies up to ~ 18

100-fold between different initiating nucleotide sequences at positions +1 and +210, 19

suggesting that the scrunched TIC conformation is differentially stabilized by different 20

initiating sequences. Taken together, these results suggest that the initiation stage may 21

function as a regulatory step to control transcription kinetics depending on promoter 22

sequences and biochemical circumstances. In bacteriophage and bacterial transcription 23

systems, the progression through transcription initiation serves as a rate-determining step in 24

transcription3,30. 25


https://doi.org/10.1101/2019.12.16.877878

19

It is intriguing that the conformational progression of the TIC within the initiation stage was 1

more reversible in this two-protein transcription system of yeast mitochondria than in the 2

more primitive, single-protein transcription system of T7 bacteriophage. While transcription 3

initiation by T7 RNAP shows a single dominant FRET population at each step representing 4

one stable conformation30, Rpo41 and Mtf1 showed highly reversible dynamics between 5

distinct conformations. Rpo41 is homologous to T7 RNAP, but requires Mtf1 to initiate 6

transcription13,14,46. Mtf1 is thought to stabilize the open promoter complex18,24,36, but our 7

results suggest that Mtf1 in complex with Rpo41 allows dynamic exchange between 8

scrunched and unscrunched conformations, which might result in enhanced production of 9

abortive transcripts. This proposal resonates with the observation that the addition of Mtf1 10

increases the production of abortive transcripts by Rpo41 on pre-melted DNA18. Thus, our 11

observations suggest novel roles of initiation factors in facilitating conformational transitions 12

of the TIC, thereby providing proofreading steps or conditional gates that determine 13

progression to the elongation stage. 14

Transition to the elongation stage was found from smFRET measurements to occur in a 15

single step precisely at position +8, as indicated by a large change in the FRET level and the 16

disappearance of conformational fluctuations, setting the TIC in a stable and less bent 17

conformation. This contrasts with the smFRET observation on the single-subunit T7 18

transcription system, in which the transition occurs gradually over positions +8 to +1230,39. 19

Ensemble-level biochemical studies and crystal structure analyses have also suggested that 20

transition of T7 RNAP to the elongation stage occurs in multiple steps with a series of 21

conformational transitions, producing abortive transcripts of at least up to 20 bases37,39,40,47. 22

The interplay between RNAP and initiation factors in yeast mitochondria appears to make an 23

abrupt release of the promoter at a sharply defined position, which is not reversible. This 24

process prevents the elongation complex from reversing to the initiation stage or escaping 25


https://doi.org/10.1101/2019.12.16.877878

20

through an abortive pathway. Irreversible dissociation of Mtf1 in the elongation stage 1

possibly functions as a kinetic latch to prevent such non-productive pathways. Though Mtf1 2

is known to dissociate after transcribing 13 nucleotides48, it is not clear whether it dissociates 3

at or after the unbending transition at position +8. On the other hand, 2AP measurements 4

showed the collapse of the initiation bubble starting at position +8, but the bubble appeared to 5

gradually collapse over positions +8 to +10 (Fig. 3c). In case of T7 RNAP, promoter release 6

and bubble collapse occur synchronously. This does not appear to be the case in 7

mitochondrial transcription, where the TIC takes further steps until the initiation bubble fully 8

zips up. Our results suggest that promoter release occurs first to form an unbent EC-like state 9

and then bubble collapse follows to complete transition to elongation. 10

Integrating the conformational transitions identified in this study, we constructed a kinetic 11

model of mitochondrial transcription initiation (Fig. 7). Initial bound complex of 12

DNA/Rpo41/Mtf1 transitions between closed and open promoter states (IC0closed and IC0open). 13

Upon incorporation of the initiating nucleotides, IC0open starts scrunching in stepwise manner 14

(ICnscrunched), but it often reverts to IC0open and even to IC0closed by dissociating RNA to re-15

initiate transcription. The rate of abortive transcription greatly decreases with increasing 16

length of RNA, making the scrunched TIC increasingly stable. In addition to the abortive 17

transcription, IC7scrunched makes slower, reversible transitions to an unscrunched conformation 18

(IC7unscrunched), which may also occur at earlier positions. In these states, the transcript 19

remains bound to the complex, possibly with its 3’-end extruding from the complex. Then, 20

IC7scrunched makes a large irreversible conformational transition at position +8 by releasing the 21

upstream DNA that might be accompanied by dissociation of Mtf1 (EC8). It is followed by 22

gradual zipping of the upstream bubble in the following steps. 23


https://doi.org/10.1101/2019.12.16.877878

21

In conclusion, our study reveals the highly dynamic and reversible nature of mitochondrial 1

transcription initiation. We propose that the dynamic initiation stage and irreversible 2

transition to the elongation stage serve as key features that distinguish multi-subunit 3

transcription machineries from simpler single-subunit systems. Our findings provide novel 4

mechanistic perspectives on how transcription machinery regulates the progression of 5

transcription initiation, and form a basis for studies of more sophisticated transcription 6

machineries of higher organisms. 7

8

Online Methods 9

Preparation of DNA templates 10

DNA oligonucleotides were custom synthesized with biotin and amino modifications, and 11

were purified by HPLC (Integrated DNA Technologies, USA). The oligonucleotides were 12

fluorescently labeled at the amine groups by standard assays using Cy3 or Cy5 NHS esters 13

(Lumiprobe, USA), and unreacted dyes were removed by ethanol precipitation. To generate 14

duplex DNA molecules, single-stranded DNAs were mixed in a 1:1 ratio, annealed at 95°C 15

for 1 min, and then slowly cooled to room temperature for 1 h. 16

Single-molecule measurements 17

Single-molecule fluorescence signals were detected using a custom-built total internal 18

reflection fluorescence (TIRF) microscope49. The sample surface was prepared by coating 19

quartz slides (Finkenbeiner, USA) with a 40:1 mixture of mPEG-SVA (MW 5,000) and 20

biotin-PEG-SVA (MW 5,000) (Laysan Bio, USA) after treatment with (3-21

aminopropyl)trimethoxysilane (Sigma, USA). The surface was coated with NeutrAvidin 22

(ThermoFisher Scientific, USA) and DNA templates were immobilized via the biotin-23


https://doi.org/10.1101/2019.12.16.877878

22

NeutrAvidin interaction. Rpo41 (100 nM) and Mtf1 (100 nM) were flowed into the chamber 1

and incubated with the DNA templates for 3 min. Excess unbound proteins were then washed 2

away and imaging buffer (100 mM Tris-acetate pH 7.5, 50 mM potassium glutamate, 10 mM 3

magnesium acetate, 0.6% glucose, 1 mg/ml glucose oxidase (from Aspergillus niger VII; 4

Sigma, USA), 0.04 mg/ml catalase (from bovine liver; Sigma), ~3 mM Trolox, and controlled 5

concentrations of various combinations of NTPs) was added to stall the TIC at varying 6

positions. Fluorescence movies of the donor and acceptor channels were recorded using an 7

EMCCD camera (iXon Ultra 897; Oxford Instruments, UK). All measurements were 8

performed at 25°C. 9

Single-molecule data analysis 10

Movies obtained using the TIRF microscope were analyzed using custom software to extract 11

single-molecule fluorescence traces, as described previously6. The FRET efficiency was 12

calculated with background and leakage correction as EFRET = (IA − 0.08 × ID)/(ID + IA), 13

where ID and IA are the background-subtracted intensities of the donor and acceptor dyes, 14

respectively. The acceptor dyes were briefly excited at the beginning and end of each movie 15

to exclude traces lacking acceptor dyes from further analysis. Each FRET histogram was 16

built from more than 50 movies by selecting traces with a single pair of Cy3 and Cy5 dyes 17

and representing each trace by EFRET averaged over five frames. Hidden Markov analysis was 18

performed using ebFRET software developed by the Gonzalez group43. 19

2-Aminopurine fluorescence assay 20

Steady-state fluorescence measurements were carried out at 25°C using a Fluoro-Max-2 21

spectrofluorometer (Jobin Yvon Spex Instruments S.A., Inc., USA) in buffer containing 50 22

mM Tris-acetate (pH 7.5), 100 mM potassium glutamate, and 10 mM magnesium acetate. 23

The fluorescence spectra of 200 nM 2AP-incorporated duplex promoters were collected from 24


https://doi.org/10.1101/2019.12.16.877878

23

350 to 420 nm (6 nm bandwidth) with excitation at 315 nm (2 nm bandwidth) after the 1

sequential addition of Rpo41 (400 nM), Mtf1 (400 nM), and initiating +1 +2 NTPs (1 mM). 2

After subtracting the contributions of the buffer and proteins in the presence of unmodified 3

DNA, the corrected 2AP fluorescence intensities between 360 nm and 380 nm were 4

integrated for comparison. 5

6

Acknowledgements 7

This work was supported by the National Research Foundation of Korea 8

(2017R1D1A1B03036239, 2017M3A9E2062181, and 2018R1A5A1024340) and the 9

Institute for Basic Science (IBS-R022-D1) to H.K.; the National Institute of Health grant R35 10

GM118086 to S.S.P.; American Heart Association 16PRE30400001 and Louis Bevier 11

Dissertation Completion Fellowship from Rutgers University to U.B. 12

13

Author contributions 14

H.K. and S.P. conceived the project. B.S., U.B., S.L., H.C., J.S., and A.D. performed the 15

experiments and analyzed the data. B.S., H.K., U.B., and S.P. wrote the manuscript. 16

17

Competing interests 18

The authors declare no competing interests. 19

20

References 21


https://doi.org/10.1101/2019.12.16.877878

24

1. Lerner, E. et al. Backtracked and paused transcription initiation intermediate of 1 Escherichia coli RNA polymerase. Proceedings of the National Academy of Sciences 2 113, E6562-E6571 (2016). 3

2. Duchi, D. et al. Conformational heterogeneity and bubble dynamics in single bacterial 4 transcription initiation complexes. Nucleic Acids Res 46, 677-688 (2018). 5

3. Dulin, D. et al. Pausing controls branching between productive and non-productive 6 pathways during initial transcription in bacteria. Nature Communications 9, 1478 7 (2018). 8

4. Koh, H.R. et al. Correlating Transcription Initiation and Conformational Changes by a 9 Single-Subunit RNA Polymerase with Near Base-Pair Resolution. Mol Cell 70, 695-10 706 e5 (2018). 11

5. Duchi, D. et al. RNA Polymerase Pausing during Initial Transcription. Mol Cell 63, 12 939-50 (2016). 13

6. Kim, H., Tang, G.Q., Patel, S.S. & Ha, T. Opening-closing dynamics of the 14 mitochondrial transcription pre-initiation complex. Nucleic Acids Res 40, 371-80 15 (2012). 16

7. Reppas, N.B., Wade, J.T., Church, G.M. & Struhl, K. The transition between 17 transcriptional initiation and elongation in E. coli is highly variable and often rate 18 limiting. Mol Cell 24, 747-757 (2006). 19

8. Wade, J.T. & Struhl, K. The transition from transcriptional initiation to elongation. 20 Curr Opin Genet Dev 18, 130-6 (2008). 21

9. Bestwick, M.L. & Shadel, G.S. Accessorizing the human mitochondrial transcription 22 machinery. Trends in Biochemical Sciences 38, 283-291 (2013). 23

10. Deshpande, A.P. & Patel, S.S. Interactions of the yeast mitochondrial RNA 24 polymerase with the +1 and +2 promoter bases dictate transcription initiation 25 efficiency. Nucleic Acids Research 42, 11721-11732 (2014). 26

11. Vo, N.V., Hsu, L.M., Kane, C.M. & Chamberlin, M.J. In Vitro Studies of Transcript 27 Initiation by Escherichia coli RNA Polymerase. 3. Influences of Individual DNA 28 Elements within the Promoter Recognition Region on Abortive Initiation and 29 Promoter Escape. Biochemistry 42, 3798-3811 (2003). 30

12. Saunders, A., Core, L.J. & Lis, J.T. Breaking barriers to transcription elongation. 31 Nature Reviews Molecular Cell Biology 7, 557 (2006). 32

13. Masters, B.S., Stohl, L.L. & Clayton, D.A. Yeast mitochondrial RNA polymerase is 33 homologous to those encoded by bacteriophages T3 and T7. Cell 51, 89-99 (1987). 34

14. Cermakian, N., Ikeda, T.M., Cedergren, R. & Gray, M.W. Sequences homologous to 35 yeast mitochondrial and bacteriophage T3 and T7 RNA polymerases are widespread 36 throughout the eukaryotic lineage. Nucleic Acids Research 24, 648-654 (1996). 37

15. Nayak, D., Guo, Q. & Sousa, R. A promoter recognition mechanism common to yeast 38 mitochondrial and phage t7 RNA polymerases. J Biol Chem 284, 13641-7 (2009). 39

16. Cermakian, N. et al. On the Evolution of the Single-Subunit RNA Polymerases. 40 Journal of Molecular Evolution 45, 671-681 (1997). 41

17. Deshpande, A.P. & Patel, S.S. Mechanism of transcription initiation by the yeast 42 mitochondrial RNA polymerase. Biochimica et Biophysica Acta (BBA) - Gene 43 Regulatory Mechanisms 1819, 930-938 (2012). 44

18. Matsunaga, M. & Jaehning, J.A. Intrinsic promoter recognition by a "core" RNA 45 polymerase. Journal of Biological Chemistry 279, 44239-44242 (2004). 46

19. Posse, V. & Gustafsson, C.M. Human Mitochondrial Transcription Factor B2 Is 47 Required for Promoter Melting during Initiation of Transcription. Journal of 48 Biological Chemistry 292, 2637-2645 (2017). 49


https://doi.org/10.1101/2019.12.16.877878

25

20. Ramachandran, A., Nandakumar, D., Sultana, S., Patel, S.S. & Basu, U. Human 1 mitochondrial transcription factors TFAM and TFB2M work synergistically in 2 promoter melting during transcription initiation. Nucleic Acids Research 45, 861-874 3 (2016). 4

21. Parshin, A.V. et al. A model for transcription initiation in human mitochondria. 5 Nucleic Acids Research 43, 3726-3735 (2015). 6

22. Falkenberg, M. et al. Mitochondrial transcription factors B1 and B2 activate 7 transcription of human mtDNA. Nat Genet 31, 289-94 (2002). 8

23. Jang, S.H. & Jaehning, J.A. The yeast mitochondrial RNA polymerase specificity 9 factor, MTF1, is similar to bacterial sigma factors. J Biol Chem 266, 22671-7 (1991). 10

24. Paratkar, S. & Patel, S.S. Mitochondrial Transcription Factor Mtf1 Traps the 11 Unwound Non-template Strand to Facilitate Open Complex Formation. Journal of 12 Biological Chemistry 285, 3949-3956 (2010). 13

25. Savkina, M., Temiakov, D., McAllister, W.T. & Anikin, M. Multiple Functions of 14 Yeast Mitochondrial Transcription Factor Mtf1p during Initiation. Journal of 15 Biological Chemistry 285, 3957-3964 (2010). 16

26. Revyakin, A., Liu, C., Ebright, R.H. & Strick, T.R. Abortive Initiation and Productive 17 Initiation by RNA Polymerase Involve DNA Scrunching. Science 314, 1139-1143 18 (2006). 19

27. Kapanidis, A.N. et al. Initial transcription by RNA polymerase proceeds through a 20 DNA-scrunching mechanism. Science 314, 1144-7 (2006). 21

28. Cheetham, G.M. & Steitz, T.A. Structure of a transcribing T7 RNA polymerase 22 initiation complex. Science 286, 2305-9 (1999). 23

29. Brieba, L.G. & Sousa, R. T7 promoter release mediated by DNA scrunching. EMBO J 24 20, 6826-35 (2001). 25

30. Tang, G.Q., Roy, R., Bandwar, R.P., Ha, T. & Patel, S.S. Real-time observation of the 26 transition from transcription initiation to elongation of the RNA polymerase. Proc 27 Natl Acad Sci U S A 106, 22175-80 (2009). 28

31. Margeat, E. et al. Direct Observation of Abortive Initiation and Promoter Escape 29 within Single Immobilized Transcription Complexes. Biophysical Journal 90, 1419-30 1431 (2006). 31

32. Tang, G.-Q., Roy, R., Ha, T. & Patel, S.S. Transcription Initiation in a Single-Subunit 32 RNA Polymerase Proceeds through DNA Scrunching and Rotation of the N-Terminal 33 Subdomains. Molecular Cell 30, 567-577 (2008). 34

33. Liu, X., Bushnell, D.A., Wang, D., Calero, G. & Kornberg, R.D. Structure of an RNA 35 Polymerase II–TFIIB Complex and the Transcription Initiation Mechanism. Science 36 327, 206-209 (2010). 37

34. Cheung, Alan C.M. & Cramer, P. A Movie of RNA Polymerase II Transcription. Cell 38 149, 1431-1437 (2012). 39

35. Lerner, E. et al. A Novel Initiation Pathway in Escherichia Coli Transcription. 40 bioRxiv, 042432 (2016). 41

36. Tang, G.Q., Paratkar, S. & Patel, S.S. Fluorescence mapping of the open complex of 42 yeast mitochondrial RNA polymerase. J Biol Chem 284, 5514-22 (2009). 43

37. Durniak, K.J., Bailey, S. & Steitz, T.A. The structure of a transcribing T7 RNA 44 polymerase in transition from initiation to elongation. Science 322, 553-7 (2008). 45

38. Schwinghammer, K. et al. Structure of human mitochondrial RNA polymerase 46 elongation complex. Nature Structural &Amp; Molecular Biology 20, 1298 (2013). 47

39. Bandwar, R.P., Tang, G.-Q. & Patel, S.S. Sequential Release of Promoter Contacts 48 during Transcription Initiation to Elongation Transition. Journal of Molecular 49 Biology 360, 466-483 (2006). 50


https://doi.org/10.1101/2019.12.16.877878

26

40. Bandwar, R.P. et al. The transition to an elongation complex by T7 RNA polymerase 1 is a multistep process. J Biol Chem 282, 22879-86 (2007). 2

41. Hillen, H.S., Morozov, Y.I., Sarfallah, A., Temiakov, D. & Cramer, P. Structural 3 Basis of Mitochondrial Transcription Initiation. Cell 171, 1072-1081.e10 (2017). 4

42. Hwang, H. & Myong, S. Protein induced fluorescence enhancement (PIFE) for 5 probing protein-nucleic acid interactions. Chem Soc Rev 43, 1221-9 (2014). 6

43. van de Meent, J.-W., Bronson, J.E., Wood, F., Gonzalez, R.L., Jr. & Wiggins, C.H. 7 Hierarchically-coupled hidden Markov models for learning kinetic rates from single-8 molecule data. JMLR workshop and conference proceedings 28, 361-369 (2013). 9

44. Sultana, S., Solotchi, M., Ramachandran, A. & Patel, S.S. Transcriptional fidelities of 10 human mitochondrial POLRMT, yeast mitochondrial Rpo41, and phage T7 single-11 subunit RNA polymerases. Journal of Biological Chemistry 292, 18145-18160 12 (2017). 13

45. Nickels, B.E. & Hochschild, A. Regulation of RNA Polymerase through the 14 Secondary Channel. Cell 118, 281-284 (2004). 15

46. Xu, B. & Clayton, D.A. Assignment of a yeast protein necessary for mitochondrial 16 transcription initiation. Nucleic Acids Res 20, 1053-9 (1992). 17

47. Yin, Y.W. & Steitz, T.A. Structural basis for the transition from initiation to 18 elongation transcription in T7 RNA polymerase. Science 298, 1387-95 (2002). 19

48. Mangus, D.A., Jang, S.H. & Jaehning, J.A. Release of the yeast mitochondrial RNA 20 polymerase specificity factor from transcription complexes. J Biol Chem 269, 26568-21 74 (1994). 22

49. Kang, H. et al. Sequence-dependent DNA condensation as a driving force of DNA 23 phase separation. Nucleic Acids Research 46, 9401-9413 (2018). 24

25

26

Figure legends 27

Figure 1. Transcription initiation occurs through dynamic conformational changes of 28

the initiation complex. 29

a, Single-molecule measurements of transcription initiation dynamics. The dual-labeled DNA 30

template complexed with Rpo41 and Mtf1 was observed using a total internal reflection 31

fluorescence microscope. b, DNA templates used in basepair-wise measurements of initiation 32

complex dynamics. DNA template I could be stalled at positions +2, +3, +5, and +6, while 33

DNA template II, which differed from DNA template I by four basepairs (blue), could be 34

stalled at positions +7 and +8. Both templates were labeled with Cy5 at position −16 of the 35

non-template strand (magenta) and Cy3 at position +16 of template strand (green). The 36


https://doi.org/10.1101/2019.12.16.877878

27

transcription promoter (underscored) and start site (arrow) are indicated. c, FRET histograms 1

from single-molecule traces with colocalized Cy3 and Cy5 signals at each stalling position. 2

Histograms were fit to single, double, or triple Gaussian peaks. The brown, green, and 3

magenta curves represent low, mid, and high FRET populations, respectively. d, 4

Representative smFRET traces at positions 0, +2, and +6 showing the Cy3 (green) and Cy5 5

(magenta) signals and the FRET efficiency traces (navy). e, The FRET level of the major 6

population in (c) shown for each stalling position as the center of the major Gaussian peak. 7

Error bars represent the error in Gaussian fitting. f, The Cy3-to-Cy5 distance at each stalling 8

position calculated from the average between major FRET levels from DNA templates I/II (e) 9

and I/II NT (Supplementary Fig. 1c). Error bars represent propagation of the errors in FRET 10

levels. 11

12

Figure 2. Transition to elongation occurs via a large, abrupt conformational change at 13

position +8. 14

a, Representative smFRET traces from flow-in measurements. The point at which 15

combinations of NTPs were added to stall the initiation complex at position +7 or +8 or to 16

enable run-off is shown as a vertical dotted line. b, FRET evolution maps constructed by 17

overlaying multiple traces synchronized at the moment the FRET signal reached 0.5 (0 18

second). 176, 181, and 160 traces were used to generate maps for progression to positions +7 19

and +8 and run-off, respectively. c, Schematic design of DNA template +11/−11 used to 20

distinguish between the conformations of the elongation complex and DNA only. d, FRET 21

histograms from DNA template +11/−11. Single, double, or triple Gaussian fitting to each 22

histogram is shown. 23

24


https://doi.org/10.1101/2019.12.16.877878

28

Figure 3. Transcription initiation bubble collapses upon transition to elongation. 1

a, Schematic illustration showing IC7 with the initiation bubble and a 7-nt RNA (magenta) 2

annealed to the template DNA from positions +1 to +7. The template bases from −4 to −1 are 3

single-stranded, resulting in a strong fluorescence signal of 2AP at position −4 of the non-4

template strand (green). At position +8, EC8 is shown where the initiation bubble has 5

collapsed and the −4 to −1 region is reannealed, resulting in the quenching of 2AP 6

fluorescence. b, Design of DNA templates used for 2AP fluorescence measurements, to be 7

stalled at positions +7, +8, +9, and +10. c, Changes in 2AP fluorescence measured along in 8

vitro transcription reactions to the indicated positions, normalized against the initial intensity. 9

The intensity traces were fit to a single exponential decay curve to determine the transition 10

rates. d, Fluorescence decay rates measured from (c) at different walking positions. e, Models 11

of the IC0, IC7, and EC9 structures generated using PyMOL (Schrödinger, USA). IC0 was 12

modeled using PDB 6erp (human mitochondrial RNA polymerase initiation complex), IC7 13

was modeled using PDB 3e2e (bacteriophage T7 RNA polymerase initiation complex with 7 14

bp RNA:DNA), and EC9 was modeled using PDB 4boc (human mitochondrial RNA 15

polymerase elongation complex with 9 bp RNA:DNA). The green and red balls represent the 16

Cy3 and Cy5 fluorophores at positions +11 and −11, respectively. The double-stranded DNA 17

and RNA:DNA hybrid (RNA in green) is highlighted as bound to the protein in the 18

background. 19

20

Figure 4. Hidden Markov analysis of smFRET traces throughout the initiation and 21

elongation stages. 22

a, Representative smFRET traces (gray) at positions +2 and +7 shown alongside hidden state 23

traces (navy) from hidden Markov modeling assuming three hidden states. b, Unscrunching 24


https://doi.org/10.1101/2019.12.16.877878

29

rates obtained from the hidden Markov analysis at each stalling position during initiation. c, 1

Transition density plots from hidden Markov analyses of traces at each stalling position. 509, 2

184, 162, 45, 98, 51, 67, and 27 traces were used for positions 0, +2, +3, +5, +6, +7, +8, and 3

run-off conditions, respectively. 4

5

Figure 5. The rate of abortive initiation sharply depends on the transcription position. 6

a, FRET histograms obtained at equilibrium and after washing out the NTP mixture for 7

positions +2, +7, and +8, and run-off conditions. For position +8, results from DNA template 8

+11/−11 are included to distinguish between the populations of the elongation complex and 9

DNA only. Each histogram was obtained from 12 short movies taken during each minute 10

after washing out the NTP mixture. b,c, The relative population of the high FRET state 11

(scrunched complex) obtained from histograms at positions +2 (b) and +7 (c) shown relative 12

to time. Each graph was fit to a single exponential decay curve, and the half-life is shown. d, 13

The relative population of the mid FRET state (elongation complex) obtained from 14

histograms at position +8 on DNA template +11/−11 shown relative to time. e, The relative 15

population of the mid FRET state (open complex) obtained from histograms under run-off 16

conditions shown relative to time. 17

18

Figure 6. The stalled initiation complex makes conformational transitions without 19

dissociating the RNA transcript. 20

a, Representative smFRET trace showing the conformational dynamics of the TIC of DNA 21

template II equilibrated at position +7 (gray region; 0.5 mM each of ATP, GTP, and UTP) 22

after washing out the NTP mix (first arrow). Subsequently, 0.5 mM 3’dCTP was added to 23

promote progression to position +8 (second arrow). The abrupt drop in the FRET efficiency 24


https://doi.org/10.1101/2019.12.16.877878

30

indicates successful progression to position +8. b, Dwell time histogram of the high FRET 1

(scrunched) state in the presence of NTP mix (grey; 809 events) and after NTP wash-out 2

(magenta; 214 events). c, The time taken to recover the high FRET state after dropping to 3

lower FRET levels (blue arrow in (a)) in the presence of NTP mix (grey; 843 events) and 4

after NTP wash-out (magenta; 284 events). d, Comparison of unscrunching and scrunching 5

rates in the presence of NTP mix and after NTP wash-out, measured as the inverse of average 6

dwell times in (b) and (c). e,f, FRET evolution maps generated from the traces supplied with 7

0.5 mM 3’dCTP after long stalling at position +7 by washing out the NTP mix, synchronized 8

at the moment of flowing in 3’dCTP (0 seconds). 53 and 41 traces were used for the maps 9

generated for DNA templates II and +11/−11, respectively. g, Using DNA template 10

+11/−11, FRET histogram of low-FRET events after NTP wash-out at position +7 (magenta) 11

was compared to that of position +8 (grey, from Fig. 2d). 12

13

Figure 7. Kinetic model of mitochondrial transcription initiation 14

Conformational states and their transition kinetics identified in this study were integrated into 15

this model. Measured transition rates were marked and also reflected in the thickness of 16

arrows. Blank arrows represent indistinguishable transitions or transitions whose rates depend 17

on NTP concentration. Unidentified states (IC6unscrunched) or existence of molecules (Mtf1 in 18

EC8) were expressed semi-transparent. DNA/RNA oligos and proteins were drawn as in Fig. 19

1a. 20


https://doi.org/10.1101/2019.12.16.877878

5’TGGCCACGGCAGCGAGGCTATTATATATATAAGTAGTTAATCGTAGAATA 3’NT

3’ACCGGTGCCGTCGCTCCGATAATATATATATTCATCAATTAGCATCTTAT 5’T

5’TGGCCACGGCAGCGAGGCTATTATATATATAAGTAGTAACAAGTAGAATA 3’NT

3’ACCGGTGCCGTCGCTCCGATAATATATATATTCATCATTGTTCATCTTAT 5’T

+3

+2

+5

+6

+7

+8

Run-off

ATP, GTP

ATP, GTP, 3′dUTP

ATP, GTP, UTP

ATP, GTP, UTP, 3′dCTP

Transcription Start Site

ATP, GTP, UTP


ATP, GTP, UTP, CTP

DNA Template Ⅰ

DNA TemplateⅡ

a b

c d e

f

Quartz Slide

Cy3 Cy5

0 +2 +3 +5 +6 +7 +8

Transcription Position

Mtf1

PEG BiotinNeutravidin

Rpo41

Nascent RNA

0

12000

0

15000

0

20000

0

20000

0

15000

Counts

0

15000

0

12000

DNA only

DNA + Rpo41/Mtf1

Position +2

Position +3

Position +5

Position +6

Position +7

Position +8

Run-off0

10000

0.0 0.5 1.0

0

12000

EFRET

DNA

only

0 +2 +3 +5 +6 +7 +8 Run-

off

0.0

0.2

0.4

0.6

0.8

FR

ET

Level of

Majo

r P

opula

tion

Transcription Position (bases)

DNA

only

0 +2 +3 +5 +6 +7 +8 Run-

off

0

1

2

3

4

5

6

7

8

9

Cy3-C

y5 D

ista

nce (

nm

)


0

2500

5000

0 20 40 60

0.0

0.5

1.0

Flu

ore

scence

Inte

nsi

ty (

a. u.) Position +6

EF

RE

T

Time (sec)

0

2000

4000

0 30 60 90 120

0.0

0.5

1.0

Flu

ore

scence

Inte

nsi

ty (

a. u.) Position +2

EF

RE

T

0

5000

40 80 120 1600

0.0

0.5

1.0

Flu

ore

scence

Inte

nsi

ty (

a. u.)

Cy3

Cy5

Position 0

EF

RE

T

EFRET

Figure 1

Figure 1. Transcription initiation occurs through dynamic conformational changes of the initiation complex.a, Single-molecule measurements of transcription initiation dynamics. The dual-labeled DNA template complexed with Rpo41 and Mtf1 was observed using a total internal reflection fluorescence microscope. b, DNA templates used in basepair-wise measurements of initiation complex dynamics. DNA template I could be stalled at positions +2, +3, +5, and +6, while DNA template II, which differed from DNA template I by four basepairs (blue), could be stalled at positions +7 and +8. Both templates were labeled with Cy5 at position −16 of the non-template strand (magenta) and Cy3 at position +16 of template strand (green). The transcription promoter (underscored) and start site (arrow) are indicated. c, FRET histograms from single-molecule traces with colocalized Cy3 and Cy5 signals at each stalling position. Histograms were fit to single, double, or triple Gaussian peaks. The brown, green, and magenta curves represent low, mid, and high FRET populations, respectively. d, Representative smFRET traces at positions 0, +2, and +6 showing the Cy3 (green) and Cy5 (magenta) signals and the FRET efficiency traces (navy). e, The FRET level of the major population in (c) shown for each stalling position as the center of the major Gaussian peak. Error bars represent the error in Gaussian fitting. f, The Cy3-to-Cy5 distance at each stalling position calculated from the average between major FRET levels from DNA templates I/II (e) and I/II NT (Supplementary Fig. 1c). Error bars represent propagation of the errors in FRET levels.


https://doi.org/10.1101/2019.12.16.877878

Figure 2

a

0

2500

5000

20 40 60 80 1000

0.0

0.5

1.0

Cy3

Cy5

Flu

ore

scen

ce

Inte

nsity (

a.

u.)

ATP, GTP, UTPPosition 0 to +7

EFRET

EF

RE

T

0

2500

5000

20 40 60 800

0.0

0.5

1.0

Flu

ore

scence

Inte

nsity (

a. u.)

Position 0 to +8ATP, GTP, UTP, 3'dCTP

EF

RE

T

0

2500

5000

20 40 60 800

0.0

0.5

1.0

Flu

ore

scence

Inte

nsity (

a. u.)

Position 0 to Run-offATP, GTP, UTP, CTP

EF

RE

T

Time (sec)

c

+7

+8

Run-offTranscription Start Site

DNA Template +11/−115’TGGCCACGGCAGCGAGGCTATTATATATATAAGTAGTTAATCGTAGAATA 3’NT

3’ACCGGTGCCGTCGCTCCGATAATATATATATTCATCAATTAGCATCTTAT 5’T

ATP, GTP, UTP


ATP, GTP, UTP, CTP

d

b

0

800

1600DNA only

DNA + Rpo41/Mtf1

Position +7

Position +8

Run-off

0

500

0

400

800

Co

un

ts

0

500

0.0 0.5 1.00

500

EFRET

Figure 2. Transition to elongation occurs via a large, abrupt conformational change at position +8.a, Representative smFRET traces from flow-in measurements. The point at which combinations of NTPs were added to stall the initiation complex at position +7 or +8 or to enable run-off is shown as a vertical dotted line. b, FRET evolution maps constructed by overlaying multiple traces synchronized at the moment the FRET signal reached 0.5 (0 second). 176, 181, and 160 traces were used to generate maps for progression to positions +7 and +8, and run-off, respectively. c, Schematic design of DNA template +11/−11 used to distinguish between the conformations of the elongation complex and DNA only. d, FRET histograms from DNA template +11/−11. Single, double, or triple Gaussian fitting to each histogram is shown.


https://doi.org/10.1101/2019.12.16.877878

Figure 3

5’TATTATATATATAAGTAGTAAATCGTAGAATA 3’NT

3’ATAATATATATATTCATCATTTAGCATCTTAT 5’T

5’TATTATATATATAAGTAGTAAGAATCAGAATA 3’NT

3’ATAATATATATATTCATCATTCTTAGTCTTAT 5’T

+10

+9

+7

+8

ATP, UPT, CTP

ATP, UTP, CTP, 3′dGTP

Transcription Start Site

ATP, UTP, CTP

ATP, UTP, CTP, 3′dGTP

e

b d

a−4

+7 +8+1

IC7 EC8

−4

+1

7 8 9 100.000

0.005

0.010

0.015

0.020

0.025

0.030

Nucleotide Position

Flu

ore

scen

ce

Decay R

ate

(s

-1)

c

0 200 400 600 8000.0

0.2

0.4

0.6

0.8

1.0

2A

P F

luo

resce

nce

In

ten

sity

(No

rma

lize

d)

Time (s)

Walk to +7

Walk to +8

Walk to +9

Walk to +10

IC0

Downstream Arm

Upstream Arm

IC7

Downstream Arm Upstream Arm

EC9

Downstream Arm

Upstream Arm

Figure 3. Transcription initiation bubble collapses upon transition to elongation.a, Schematic illustration showing IC7 with the initiation bubble and a 7-nt RNA (magenta) annealed to the template DNA from positions +1 to +7. The template bases from −4 to −1 are single-stranded, resulting in a strong fluorescence signal of 2AP at position −4 of the non-template strand (green). At position +8, EC8 is shown where the initiation bubble has collapsed and the −4 to −1 region is reannealed, resulting in the quenching of 2AP fluorescence. b, Design of DNA templates used for 2AP fluorescence measurements, to be stalled at positions +7, +8, +9, and +10. c, Changes in 2AP fluorescence measured along in vitrotranscription reactions to the indicated positions, normalized against the initial intensity. The intensity traces were fit to a single exponential decay curve to determine the transition rates. d, Fluorescence decay rates measured from (c) at different walking positions. e, Models of the IC0, IC7, and EC9 structures generated using PyMOL (Schrödinger, USA). IC0 was modeled using PDB 6erp (human mitochondrial RNA polymerase initiation complex), IC7 was modeled using PDB 3e2e (bacteriophage T7 RNA polymerase initiation complex with 7 bp RNA:DNA), and EC9 was modeled using PDB 4boc (human mitochondrial RNA polymerase elongation complex with 9 bp RNA:DNA). The green and red balls represent the Cy3 and Cy5 fluorophores at positions +11 and −11, respectively. The double-stranded DNA and RNA:DNA hybrid (RNA in green) is highlighted as bound to the protein in the background.


https://doi.org/10.1101/2019.12.16.877878

0 20 40 60 800.00.20.40.60.81.0

EF

RE

T

EFRET

HMM trace

Position +2

0 20 40 60 800.00.20.40.60.81.0

EF

RE

T

Position +7

a

Time (sec)

c

b

EF

RE

TA

fte

r T

ran

sitio

n

EFRET Before Transition

0.2 0.4 0.6 0.80 1

0.2

0.4

0.6

0.8

0

1Position 0

0.2 0.4 0.6 0.80 1

Position +2

0.2 0.4 0.6 0.80 1

Position +3

0.2 0.4 0.6 0.80 1

Position +5

0.2 0.4 0.6 0.80 1

Position +6

0.2 0.4 0.6 0.80 1

Position +7

0.2 0.4 0.6 0.80 1

Position +8

0.2 0.4 0.6 0.80 1

Run-off High

Low

0.0

0.1

0.2

0.3

+7+3

Un

scru

nch

ing

Ra

te (

s-1)

Transcription Position

+2 +6+5

Figure 4

Figure 4. Hidden Markov analysis of smFRET traces throughout the initiation and elongation stages.a, Representative smFRET traces (gray) at positions +2 and +7 shown alongside hidden state traces (navy) from hidden Markov modeling assuming three hidden states. b, Unscrunching rates obtained from the hidden Markov analysis at each stalling position during initiation. c, Transition density plots from hidden Markov analyses of traces at each stalling position. 509, 184, 162, 45, 98, 51, 67, and 27 traces were used for positions 0, +2, +3, +5, +6, +7, +8, and run-off conditions, respectively.


https://doi.org/10.1101/2019.12.16.877878

Figure 5

a

b c d e

0 1 2 3 4 5

0.0

0.2

0.4

0.6

0.8

1.0

Time (min)

t1/2

= 5.1 ± 0.4 min

Re

lative

Scru

nch

ed

Po

pu

latio

n Position +7

0 1 2 3 4 5

0.0

0.2

0.4

0.6

0.8

1.0

Time (min)

t1/2

= 0.063 ± 0.009 min

Rela

tive S

cru

nched

Popula

tion Position +2

0 1 2 3 4 5

0.0

0.2

0.4

0.6

0.8

1.0

Time (min)

Rela

tive P

opula

tion o

f

Elo

nga

tion C

om

ple

x

Position +8 (+11/−11)

0 1 2 3 4 5

0.0

0.2

0.4

0.6

0.8

1.0

Time (min)

Rela

tive P

opula

tion o

f

Open C

om

ple

x

Run-off

0.0 0.5 1.00

700

Run-off+8 (+11/-11)+8+7+2

0.0 0.5 1.0

800

0.0 0.5 1.0

1500

Wash out NTP

5 min

4 min

3 min

2 min

1 min

Equilibrium

(0 min)

0.0 0.5 1.0

700

0.0 0.5 1.0

2000


EFRET

0

150

100 300 100300

0

150

Counts

150

300100

300

0

150

100400 100 200

0

150 100300

100150

0.0 0.5 1.00

150

0.0 0.5 1.0

100

0.0 0.5 1.0

400

0.0 0.5 1.0

100

0.0 0.5 1.0

150

Figure 5. The rate of abortive initiation sharply depends on the transcription position.a, FRET histograms obtained at equilibrium and after washing out the NTP mixture for positions +2, +7, and +8, and run-off conditions. For position +8, results from DNA template +11/−11 are included to distinguish between the populations of the elongation complex and DNA only. Each histogram was obtained from 12 short movies taken during each minute after washing out the NTP mixture. b,c, The relative population of the high FRET state (scrunched complex) obtained from histograms at positions +2 (b) and +7 (c) shown relative to time. Each graph was fit to a single exponential decay curve, and the half-life is shown. d, The relative population of the mid FRET state (elongation complex) obtained from histograms at position +8 on DNA template +11/−11 shown relative to time. e, The relative population of the mid FRET state (open complex) obtained from histograms under run-off conditions shown relative to time.


https://doi.org/10.1101/2019.12.16.877878

Figure 6

Figure 6. The stalled initiation complex makes conformational transitions without dissociating the RNA transcript.a, Representative smFRET trace showing the conformational dynamics of the TIC of DNA template II equilibrated at position +7 (gray region; 0.5 mM each of ATP, GTP, and UTP) after washing out the NTP mix (first arrow). Subsequently, 0.5 mM 3’dCTP was added to promote progression to position +8 (second arrow). The abrupt drop in the FRET efficiency indicates successful progression to position +8. b, Dwell time histogram of the high FRET (scrunched) state in the presence of NTP mix (grey; 809 events) and after NTP wash-out (magenta; 214 events). c, The time taken to recover the high FRET state after dropping to lower FRET levels (blue arrow in (a)) in the presence of NTP mix (grey; 843 events) and after NTP wash-out (magenta; 284 events). d, Comparison of unscrunching and scrunching rates in the presence of NTP mix and after NTP wash-out, measured as the inverse of average dwell times in (b) and (c). e,f, FRET evolution maps generated from the traces supplied with 0.5 mM 3’dCTP after long stalling at position +7 by washing out the NTP mix, synchronized at the moment of flowing in 3’dCTP (0 seconds). 53 and 41 traces were used for the maps generated for DNA templates II and +11/−11, respectively. g, Using DNA template +11/−11, FRET histogram of low-FRET events after NTP wash-out at position +7 (magenta) was compared to that of position +8 (grey, from Fig. 2d).

0

1000

2000

40 80 120 160 2000

0.0

0.5

1.0

Flu

ore

sce

nce

Inte

nsity (

a. u.) Cy3

Cy5

EF

RE

T

EFRET

Time (sec)

a Add 3’dCTPWash out NTP/Rpo41/Mtf1Stalled at +7 b cHigh FRET

Dwell Time

High FRET

Recovery Time

0 50 100 1500

10

20

30

40

50With NTP Mix (+7)

11 ± 0.6 sec

After NTP Wash-Out

26 ± 1.6 sec

Time(s)

Perc

enta

ge (

%)

0 50 100 1500

10

20

30

40

Time(s)

Perc

enta

ge (

%)

With NTP Mix (+7)

15 ± 0.6 sec

After NTP Wash-Out

39 ± 1.9 sec

d

With

NTP M

ix

After W

ash-Out

0.00

0.02

0.04

0.06

0.08

Tra

nsitio

n R

ate

(s

-1)

Scrunching(Mid to High FRET)

Tra

nsitio

n R

ate

(s

-1)

Unscrunching(High to Mid FRET)

With

NTP M

ix

After W

ash-Out

0.00

0.05

0.10

0.15

0.20

0.25

e

-10 -5 0 5 10 15 20

0.0

0.2

0.4

0.6

0.8

1.0

EF

RE

T

Time (sec)

High

Low

Add 3’dCTP

DNA Template +11/−11

-10 -5 0 5 10 15 20

0.0

0.2

0.4

0.6

0.8

1.0

Time (sec)

EF

RE

T

High

Low

Add 3’dCTP

DNA Template Ⅱ f g

0.0 0.5 1.00

200

400

600

800

1000

Co

un

tsE

FRET

Position +8

Low FRET after NTP Wash-Out at Position +7


https://doi.org/10.1101/2019.12.16.877878

Figure 7

Figure 7. Kinetic model of mitochondrial transcription initiation.Conformational states and their transition kinetics identified in this study were integrated into the model. Measured transition rates were marked which were reflected in the thickness of arrows. Blank arrows represent indistinguishable transitions or transitions whose rates depend on NTP concentration. Unidentified states (IC6unscrunched) or molecules (Mtf1 in EC8) were expressed semi-transparent. DNA/RNA oligos and proteins were drawn as in Fig. 1a.

IC0open

IC1scrunched IC7scrunched EC8

…………

IC0closed ……

IC7unscrunched

0.25 s-1

0.12 s-1

0.3

0 s

-1

0.2

1 s

-1

0.0

89

s-1

0.0

26

s-1

0.0

38

s-1

< 0

.06

5 s

-1IC6scrunched

IC6unscrunched

IC3IC2

……

Upstr

eam

EC12


https://doi.org/10.1101/2019.12.16.877878

the dynamic landscape of transcription initiation in yeast ... · 16.12.2019 · 8 dissociation of...

Documents