mention : biologie et sciences de la santé présentée par
TRANSCRIPT
THÈSE / UNIVERSITÉ DE RENNES 1 sous le sceau de l’Université Européenne de Bretagne
pour le grade de
DOCTEUR DE L’UNIVERSITÉ DE RENNES 1
Mention : Biologie et Sciences de la Santé
Ecole doctorale Vie-Agro-Santé
présentée par
Anaïs MICHAUT
Préparée dans l’Unité de Recherche INSERM UMR 991 « Foie, Métabolismes et Cancer »
Faculté des Sciences Pharmaceutiques et Biologiques
Thèse soutenue à Rennes le 9 Juillet 2015
devant le jury composé de :
Pr Marie-Anne LORIOT Professeur des Universités Université Paris-Descartes / rapporteur
Pr Bruno MEGARBANE Professeur des Universités Université de Paris-Diderot / rapporteur
Dr Isabelle DE WAZIERS Chargée de recherche Université de Paris-Descartes / examinateur
Dr Dominique LAGADIC-GOSSMANN Directeur de Recherches INSERM Université de Rennes-1 / examinateur Pr André GUILLOUZO Professeur des Universités Université de Rennes-1 / examinateur
Dr Bernard FROMENTY Directeur de Recherches INSERM Université de Rennes-1 / directeur de thèse
Mise au point d’un
modèle cellulaire de
stéatose hépatique
liée à l’obésité:
Application à l’étude
de la toxicité du
paracétamol
ANNEE 2015
REMERCIEMENTS
Je souhaite tout d’abord remercier Monsieur le Docteur Bernard Fromenty, mon
directeur de thèse, pour ces 3 ans et demi d’accompagnement. Tu as toujours manifesté un
grand intérêt pour mon travail et m’a toujours fait confiance. Merci pour tes
encouragements dans les moments de doutes et ta disponibilité à tout instant.
Je remercie Madame le Professeur Marie-Anne Loriot et Monsieur le Professeur
Bruno Mégarbane d’avoir accepté d’évaluer ma thèse en tant que rapporteur et d’apporter
vos regards d’expert sur ce travail. Merci également à Madame le Docteur Isabelle de
Waziers, Madame Dominique Lagadic-Gossmann et Monsieur le Professeur André Guillouzo
de me faire l’honneur de votre présence au sein de mon jury de thèse.
Merci à Madame le Professeur Odile Sergent et Madame le Professeur Lydie Sparfel,
qui se sont intéressées à mon travail depuis le début, en participant notamment à mes 2
comités de thèse et dont les remarques pertinentes m’ont permis d’avancer. Je remercie
également Madame le Docteur Nathalie Dejucq-Rainsford pour avoir accepté et accompli le
rôle de tuteur de thèse vis-à-vis de l’école doctorale VAS.
Je tiens à remercier Madame le Docteur Caroline Moreau pour ton aide et ta
sympathie. Depuis ton arrivée dans l’unité, tu as toujours été disponible pour moi malgré
ton emploi du temps surchargé. Tu étais à mes côtés lors des difficultés expérimentales et
ensemble, nous avons pu trouver des solutions pour avancer dans les travaux. C’est
également dans ce cadre que je remercie Monsieur le Docteur Claude Bendavid pour votre
aide précieuse.
De même, je tiens également à remercier Madame le Docteur Marie-Anne Robin, qui
était très présente dans l’équipe ainsi que dans mon projet. La maladie t’a emporté voilà
presque un an, et j’admire ton courage. Jusqu’au dernier instant, tu es restée souriante,
confiante et disponible pour ton équipe.
Cette thèse m’a également permis de faire de belles rencontres. Un grand merci à
Karine, j’ai énormément apprécié travailler dans le même laboratoire, nos petites pauses
sur la « terrasse » du bâtiment 8, et il en est né une belle amitié. Merci à Dounia pour ton
aide précieuse, ton soutien moral et ton écoute. Je remercie aussi tous ceux qui ont rendu
ma thèse bien plus agréable, notamment Tatiana et Nicolas qui étaient là dès mon arrivée et
m’ont soutenue dans les difficultés. Simon, j’ai énormément apprécié ta gentillesse, ta
bonne humeur, et ton accent qui me rappelle ma région. Matthew, nous nous sommes
rencontrés en stage au CIT à Evreux et le destin a voulu encore une fois nous réunir à
Rennes. Sans oublier Sophie, Patricia, Sacha, Aude, je n’oublierai pas votre bonne humeur et
nos fous-rire durant la pause déjeuner.
Merci également à l’équipe INSERM UMR991, notamment Ahmad et Houssein, pour
vos disponibilités à chaque instant, Thomas G. et Isabelle Morel, Audrey, Eva, Pascal Loyer,
Anne Corlu, Ghislaine, Denise, Isabelle... J’ai également une pensée pour les anciens
membres de l’équipe, dont Pegah, Camille, Amina, Carine, la petite Florence, et les autres.
Je souhaite également remercier toutes les personnes extérieures avec qui j’ai pu
travailler, Nicolas Mouchet, Medjda et Jacques Le Seyec. Merci à toute l’équipe
d’enseignants, Michelle Lesimple, Céline Raguenes-Nicol, Claire Piquet-Pellorce, Thierry
Guillaudeux, Patricia, Pascale, Colette...
Un merci particulier à ma famille, si importante pour moi. Maman, tu m’as toujours
soutenu dans tous mes projets quels qu’ils soient. Tu es présente à chaque épreuve et
j’espère aujourd’hui que tu es fière de mon parcours. Merci à Rémy et Lylou, votre joie et
votre amour me renforce. Merci à Daniel et Françoise de votre soutien dans mes études,
particulièrement au cours de mon année rouennaise. Merci papa de croire en moi et à ma
réussite.
Mathieu, un grand merci pour ta présence à mes côtés au quotidien et ta ténacité à
me supporter durant ces moments de stress et de découragement. Ton enthousiasme, ta
sérénité et ton amour m’auront permis de tenir bon jusqu’au bout et d’avancer avec
confiance dans mes projets. Que les années à venir nous réservent de belles surprises…
1
SOMMAIRE
LISTE DES PRINCIPALES ABREVIATIONS ............................................................................. 5
INDEX DES FIGURES ET TABLEAUX ..................................................................................... 7
AVANT-PROPOS ................................................................................................................ 9
INTRODUCTION
I/ Obésité et complications associées .......................................................................... 11
A. Introduction .............................................................................................................. 11
1. L’obésité ................................................................................................................... 11
2. Des chiffres alarmants .............................................................................................. 11
3. Complications associées à l’obésité ......................................................................... 13
B. Stéatoses et stéatohépatites non alcooliques .............................................................. 15
1. Introduction .............................................................................................................. 15
2. Epidémiologie ........................................................................................................... 16
3. Physiopathologie des NAFLD .................................................................................... 17
II/ Les cytochromes P450 2E1 et 3A4 ............................................................................ 21
A. Généralités sur les CYPs ................................................................................................ 21
1. Cycle catalytique ...................................................................................................... 21
2. Nomenclature et classification ................................................................................. 23
3. Rôle physiologique des CYPs .................................................................................... 26
B. Le CYP2E1 ...................................................................................................................... 30
1. Généralités sur le CYP2E1 ........................................................................................ 30
2
2. Les substrats endogènes et exogènes du CYP2E1.................................................... 33
3. Altération de l’expression et/ou de l’activité du CYP2E1 en conditions
physiopathologiques .................................................................................................... 35
C. Le CYP3A4 ..................................................................................................................... 45
1. Généralités sur le CYP3A4 ........................................................................................ 45
2. Les substrats endogènes et exogènes du CYP3A4 .................................................. 47
3. Altération de l’expression et/ou de l’activité du CYP3A4 en conditions
physiopathologiques .................................................................................................... 50
III/ Le paracétamol ...................................................................................................... 56
A. Introduction .................................................................................................................. 56
1. Structure et propriétés chimiques ........................................................................... 56
2. Pharmacologie .......................................................................................................... 57
3. Galénique et posologies ........................................................................................... 57
4. Données pharmacocinétiques .................................................................................. 58
B. Métabolisme ................................................................................................................. 60
1. Les réactions de phase 1 et les cytochromes P450 .................................................. 62
2. Les réactions de conjugaison ................................................................................... 62
3. Le métabolisme de phase 3 ...................................................................................... 66
C. Toxicité hépatique du paracétamol .............................................................................. 67
1. La phase d’initiation ................................................................................................. 68
2. La phase d’amplification et de propagation des lésions .......................................... 71
3. Régénération et réparation tissulaire ...................................................................... 80
3
D. Prise en charge médicale de l’intoxication au paracétamol ........................................ 83
1. Symptômes ............................................................................................................... 83
2. Traitements .............................................................................................................. 84
3. Diagnostic ................................................................................................................. 85
E. Facteurs de susceptibilité à la toxicité du paracétamol ................................................ 87
1. Obésité et pathologies hépatiques associées .......................................................... 89
2. Alcoolisme et maladies hépatiques liées à l’alcool .................................................. 98
3. Jeûne prolongé et dénutrition ................................................................................. 99
4. Autres facteurs de risques ...................................................................................... 101
F. Réglementation concernant la délivrance .................................................................. 105
ARTICLE 1 ...................................................................................................................... 107
ARTICLE 2 ...................................................................................................................... 119
DISCUSSION, CLONCLUSION ET PERSPECTIVES ................................................................ 164
BIBLIOGRAPHIE .............................................................................................................. 179
4
5
LISTE DES PRINCIPALES ABREVIATIONS
ACACA Acetyl-CoA Carboxylase α (ACC)
AG Acides Gras
AMPK AMP-activated Protein Kinase
APAP Paracétamol
APO A4 Apolipoprotéine A4
C18:0 acide stéarique
C18:1 acide oléique
ChREBP Carbohydrate Responsive Element-Binding Protein
CMZ Chlorméthiazole
CYPs Cytochromes P450
CZX Chlorzoxazone
DMSO Diméthylsulfoxyde
ERO Espèces Réactives de l’Oxygène
FABP4 Fatty Acid Binding Protein 4
FASN Fatty Acid Synthase
GCLC Glutamate Cysteine Ligase (γGCS)
GSH Glutathion
GSTs Glutathion-S-Transférases
HNF Hepatic Nuclear Factor
HSPs Heat Chock Proteins
HMOX1 Heme Oxygenase 1 (HO-1)
IL Interleukine
IMC Indice de Masse Corporelle
NAC N-Acétylcystéine
NAFLD Nonalcoholic Fatty Liver Diseases
NAPQI N-Acétyl-p-benzoquinone-Imine
NASH Nonalcoholic Steatohepatitis
NRF2 Nuclear factor (erythroid-derived 2)-like 2
PDK4 Pyruvate Dehydrogenase Kinase
PLIN1 Perilipine 1
PLIN2 Adipose Differenciation-related Protein (ADFP)
PNPLA3 Patatin-like phospholipase domain-containing 3
PPAR Peroxisome Proliferator-Activated Receptor
PXR Pregnane X receptor
SCD1 Stearoyl-CoA Desaturase 1
SREBF1 Sterol Regulatory Element-Binding Protein-1c (SREBP1c)
6
SULTs Sulfotransférases
TNFα Tumor Necrosis Factor-α
TRIB3 Tribbles Pseudokinase 3
UGTs UDP-Glucuronosyltransférases
7
INDEX DES FIGURES ET TABLEAUX
Figure 1: Prévalence de l’obésité (IMC>30) dans le monde en 2009. ..................................... 12
Figure 2: Répartition des niveaux d’IMC des personnes de plus de 18 ans en France en 2012
(selon l’étude ObEpi). ............................................................................................................... 13
Figure 3: Physiopathologie de NAFLD : mécanisme impliqué dans le développement d’une
stéatose et dans sa progression en stéatohépatite (NASH).. .................................................. 20
Figure 4: Structure du groupement prosthétique des CYPs .................................................... 21
Figure 5: Représentation shématique du cycle catalytique des CYPs. .................................... 23
Figure 6: Métabolisme d’un xénobiotique au niveau de l’hépatocyte. ................................... 27
Figure 7: Les principaux CYPs des familles 1, 2 et 3 impliqués dans le métabolisme des
médicaments utilisés en clinique ainsi que les facteurs influençant la variabilité de ces
enzymes .................................................................................................................................... 28
Figure 8: Les CYPs impliqués dans le métabolisme de molécules endogènes. ....................... 29
Figure 9: structures chimiques de l’acétanilide, du paracétamol et de la phénacétine. ........ 56
Figure 10: Les principales voies métaboliques du paracétamol après administration d’une
dose thérapeutique.. ................................................................................................................ 61
Figure 11: Phase d’initiation de la toxicité du paracétamol : la bioactivation. ....................... 70
Figure 12: Lésions mitochondriales et stress oxydant induits par le NAPQI. .......................... 73
Figure 13: Activation de la voie de la c-jun-N-terminal kinase (JNK) par les ERO suite à une
intoxication au paracétamol. ................................................................................................... 77
Figure 14: Différences morphologiques entre la mort cellulaire par apoptose et par nécrose
observées après coloration à l’hématoxyline-éosine de coupes de foie de souris.. ............... 79
8
Figure 15: Réponse innée au cours de l’intoxication hépatique au paracétamol.. ................. 82
Figure 16: Nomogramme de Rumack et Matthew, représentant la concentration
plasmatique (mg/l) du paracétamol en fonction du temps après ingestion. .......................... 86
Figure 17: Facteurs pouvant moduler le risque et la sévérité de l’hépatotoxicité induite par le
paracétamol dans un contexte d’obésité et de NAFLD. ......................................................... 96
Tableau 1: Classification des CYPs en fonction de leur classe de substrat majoritaire ........... 26
Tableau 2: Altération de l’expression et/ou de l’activité du CYP2E1 lors de la stéatose et de la
NASH dans des foies humains : Investigations Ex vivo et mesure In vivo de l’activité du
CYP2E1. ..................................................................................................................................... 38
Tableau 3: Régulation du CYP2E1 par les AG dans des hépatocytes humains in vitro ............ 39
Tableau 4: Médicaments substrats du CYP3A4 (stéroïdes inclus) ........................................... 49
Tableau 5: Altération de l’expression et/ou de l’activité du CYP3A4 lors de la stéatose et de
la NASH dans des foies humains. ............................................................................................. 51
Tableau 6: Régulation du CYP2E1 par les AG dans des hépatocytes humains in vitro. ........... 53
Tableau 7: Posologies du paracétamol recommandées en France, d’après le dictionnaire
VIDAL. ....................................................................................................................................... 58
9
AVANT-PROPOS
L’obésité et ses maladies dysmétaboliques associées telles que le diabète de type 2 et
les maladies hépatiques stéatosiques constituent un problème croissant et préoccupant
dans nos sociétés modernes. En effet, ces pathologies réduisent significativement
l’espérance de vie des patients et augmentent considérablement les dépenses de santé.
Concernant les maladies hépatiques stéatosiques liées au surpoids et à l’obésité
(Nonalcoholic Fatty Liver Diseases ou NAFLD pour les anglo-saxons), il est maintenant
reconnu qu’elles peuvent être à l’origine de cirrhoses et de carcinomes hépatocellulaires
chez des individus qui ne consomment pas (ou peu) d’alcool. Un aspect moins connu du
problème de la présence d’une NAFLD chez les sujets obèses est la susceptibilité accrue de
leur foie à certains xénobiotiques et en particulier à des médicaments. Cela semble être le
cas du paracétamol, un antalgique et antipyrétique consommé chaque jour par des millions
de personnes. Dans ce contexte, mes travaux de Thèse ont eu pour but de mettre au point
un modèle cellulaire pertinent de NAFLD et d’utiliser dans un deuxième temps ce modèle
expérimental pour mieux comprendre pourquoi le paracétamol pourrait être plus toxique
sur un foie stéatosique.
10
11
I/ Obésité et complications associées
A. Introduction
1. L’obésité
Selon l’OMS, le surpoids et l’obésité se définissent comme une accumulation
anormale et excessive de graisses corporelles qui peut nuire à la santé des individus. Chez
l’adulte, une estimation simple d’une éventuelle surcharge lipidique peut être réalisée grâce
à l’indice de masse corporelle (IMC, ou BMI en anglais pour « Body Mass Index ») qui
correspond au poids divisé par le carré de la taille. Un IMC normal est inférieur à 25 kg/m2.
Le surpoids est défini par un IMC compris entre 25 et 30, l’obésité par un IMC supérieur à 30
et l’obésité morbide (ou de classe III) par un IMC supérieur à 40. L’IMC permet une
estimation facile du surpoids et de l’obésité chez l’adulte car l’échelle de mesures est la
même quel que soit le sexe ou l’âge du sujet. Cet indice donne toutefois une indication
approximative car il ne correspond pas nécessairement au degré d’adiposité d’un individu à
l’autre (Flegal et al., 2009; Romero-Corral et al., 2008). De plus, l’IMC ne donne aucune
indication concernant la proportion de graisses sous-cutanées et viscérales qui présentent
des propriétés métaboliques et hormonales distinctes (Booth et al., 2014).
2. Des chiffres alarmants
Le surpoids et l’obésité constituent un problème majeur de santé publique en France
et dans de nombreux pays industrialisés (Fig. 1). Le surpoids concerne aujourd’hui 1,4
milliards de personnes de plus de 20 ans, parmi lesquelles 35% sont obèses. En 2008, une
méta-analyse effectuée sur 49 articles publiés entre 1990 et 2008 révèle le doublement de la
prévalence de l’obésité en Europe, passant ainsi de 15% à 30% en une vingtaine d’années
(Berghöfer et al., 2008). Dans notre pays, l’enquête épidémiologique ObEpi, réalisée tous les
3 ans depuis 1997, permet de suivre l’évolution du surpoids et de l’obésité dans la
population adulte. En 2012, 32% de la population française de plus de 18 ans était en
surpoids et 15% présentaient une obésité (Fig. 2).
12
L’obésité est malheureusement un problème qui touche également une forte
proportion d’enfants et d’adolescents. D’après l’OMS, il y a eu dans le monde une
augmentation spectaculaire entre 1990 et 2013 du nombre d’enfants obèses de moins 5 ans,
passant de 32 millions à 42 millions, ce qui représente aujourd’hui 7% de cette population.
Cependant, Ogden et coll. (2014) n’ont pas constaté cette augmentation aux États-Unis en
2011-2012 par rapport à 2004, mais au contraire une diminution de 5,5% du nombre
d’enfants obèses de moins de 5 ans (Ogden et al., 2014). Aux Etats-Unis, 17% des 2-19ans
sont obèses (Ogden et al., 2014), tandis que ce chiffre est de 3% en France pour les 3-17ans
(enquête INCA2 2006/2007 de l’ANSES). En ce qui concerne les pays émergents, les chiffres
récents sont également alarmants. Ainsi, la prévalence de l’obésité chez les jeunes âgés de 5
à 19 ans est de 19,3% en Argentine, 22% en Inde, 22,1% au Brésil et 11,7% en Inde et allant
jusqu’à 41,8% au Mexique (Gupta et al., 2012).
L’incidence de l’obésité est en constante progression au niveau mondial, même si
cette augmentation semble s’infléchir ces dernières années dans certains pays. Cette
« épidémie » d’obésité est liée à l’évolution des habitudes en matière d’alimentation et
d’exercice physique, conduisant à une consommation plus importante d’aliments très
caloriques (notamment riches en graisses et en sucres) et à une diminution d’activité
physique en raison de la nature de plus en plus sédentaire du travail, des transports et de
l’urbanisation.
Figure 1: Prévalence de l’obésité (IMC>30) dans le monde en 2009 (cartographie de l’OMS).
% d’adultes
13
Figure 2: Répartition des niveaux d’IMC des personnes de plus de 18 ans en France en 2012 (selon l’étude ObEpi).
3. Complications associées à l’obésité
Le surpoids et l’obésité ne sont pas uniquement un problème esthétique pour ceux
qui en souffrent. En effet, l’obésité est responsable de diverses pathologies qui peuvent être
graves et entraîner le décès prématuré du patient. Plusieurs études estiment que l’obésité
diminue l’espérance de vie de 1 à 7 ans (Anstey et al., 2014; Peeters et al., 2003), tandis que
cette diminution peut atteindre 7 à 13 ans en cas d’obésité morbide via l’augmentation du
nombre de décès secondaires aux maladies cardio-vasculaires, aux cancers et au diabète
(Kitahara et al., 2014). En effet, l’un des principaux risques de l’obésité est le développement
d’un syndrome d’insulinorésistance conduisant au diabète de type 2 (Meisinger et al., 2006).
Ainsi, 80% des cas de diabète de type 2 peuvent être attribués à l’obésité, le risque
augmentant proportionnellement à l’augmentation de l’IMC (Colditz et al., 1995). De plus,
l’augmentation de l’IMC chez les patients diabétiques est associée à une élévation à long
terme du risque de mortalité cardiovasculaire (Bodegard et al., 2013).
Outre les troubles du métabolisme des glucides (insulinorésistance et diabète de type
2), l’obésité s’accompagne très fréquemment de troubles du métabolisme des lipides, en
particulier au niveau hépatique. Cela se traduit notamment par le développement d’une
14
stéatose qui correspond à une accumulation de lipides dans le foie. Bien que bénigne à court
terme, la stéatose peut cependant évoluer à long terme en stéatohépatite ou en cirrhose,
voire en carcinome hépatocellulaire chez certains patients (Farrell and Larter, 2006; Larter et
al., 2010; McPherson et al., 2014; Starley et al., 2010). La physiopathologie de la stéatose et
de la stéatohépatite sera développée plus en détail dans la section suivante.
L’obésité augmente aussi très fortement le risque d’accidents cardiovasculaires, en
particulier coronaropathies et infarctus du myocarde (Galinier et al., 2005). Ce risque
cardiovasculaire accru est lié en grande partie à l’hypertension artérielle, au diabète de type
2 et à l’hyperlipidémie. L’augmentation chronique du travail cardiaque due à l’excès de
masse corporelle accentue de plus le risque d’insuffisance cardiaque (Alpert and Hashimi,
1993).
Par ailleurs, l’insuffisance respiratoire, l’apnée du sommeil, les troubles musculo-
squelettiques, l’arthrose et des troubles psychologiques (e.g. dépression et stress) sont aussi
plus fréquents chez les sujets obèses (Muzumdar and Rao, 2006; Opel et al., 2014; Pelajo et
al., 2012). Le surpoids et l’obésité augmentent également le risque de développer un certain
nombre de cancers hormono-dépendants (sein, ovaires, prostate) et gastro-intestinaux
(œsophage, côlon, rectum) ainsi que des cancers du pancréas, des reins et du foie, comme
précédemment mentionné (Song et al., 2015; Calle et al., 2003; Cheskin and Prosser, 2007;
Gallagher and LeRoith, 2013; Renehan et al., 2008; Wolin et al., 2010).
Enfin, il est important de souligner que les sujets obèses consomment en moyenne
plus de médicaments par rapport aux sujets non obèses, notamment pour le traitement de
leur obésité et des pathologies associées telles que les dyslipidémies et le diabète de type 2
(Finkelstein et al., 2009; Stuart et al., 2008; Trasande and Chatterjee, 2009). Plusieurs études
rapportent également chez les sujets obèses une consommation importante d’anti-
inflammatoires non stéroïdiens (AINS) et d’analgésiques incluant le paracétamol, en
particulier pour le traitement des maladies ostéoarticulaires (Amundsen et al., 2010; Kit et
al., 2012; Narbro et al., 2002).
15
B. Stéatoses et stéatohépatites non alcooliques
1. Introduction
Décrites pour la première fois chez les sujets obèses par Ludwig en 1980, les maladies
hépatiques stéatosiques non-alcooliques (Nonalcoholic Fatty Liver Diseases ou NAFLD pour
les anglo-saxons) couvrent un large spectre de lésions hépatiques incluant la simple
stéatose, la stéatohépatite non alcoolique (Nonalcoholic Steatohepatitis ou NASH) et la
cirrhose (Ludwig et al., 1980). Ces lésions surviennent en dehors de toute consommation
excessive d’alcool et peuvent évoluer chez certains patients en carcinome hépatocellulaire
(Jiang et al., 2014). La présence de NAFLD est également associée à un risque accru de
développer un diabète de type 2, une dyslipidémie et une hypertension artérielle (Adams et
al., 2009).
La stéatose correspond à une accumulation de lipides stockés sous forme de vacuoles
dans les hépatocytes. Il est classiquement considéré que la simple stéatose est bénigne,
même si cette lésion peut être accompagnée d’une petite élévation des transaminases
(ALAT, ASAT) au niveau plasmatique, reflétant la cytolyse de quelques hépatocytes
(Loguercio et al., 2004). Cependant, la stéatose peut évoluer à long terme en NASH chez 10 à
20% des patients. La NASH se distingue de la stéatose par la présence d’une nécro-
inflammation, d’une augmentation de la taille des hépatocytes (« hepatocyte ballooning »)
et d’un dépôt de collagène plus ou moins important reflétant la présence d’une fibrose (Yeh
and Brunt, 2014).
Au cours de la NAFLD, la stéatose est principalement macrovacuolaire avec la
présence d’une volumineuse vacuole intracytoplasmique repoussant le noyau vers la
périphérie de la cellule. Cependant, une stéatose microvésiculaire peut être parfois observée
concomitamment à la stéatose macrovacuolaire. Cette stéatose est caractérisée par la
présence de petites gouttelettes lipidiques laissant le noyau en position centrale. La
16
présence d’une stéatose microvésiculaire au cours de la NAFLD pourrait refléter une maladie
hépatique plus sévère (Söderberg et al., 2011; Tandra et al., 2011).
Les lipides hépatiques stockés dans les vacuoles sont principalement des
triglycérides, espèces lipidiques étant considérées comme non délétères pour les
hépatocytes (Puri et al., 2007). Cependant, d’autres types de lipides peuvent s’accumuler au
cours de la NAFLD, tels que les diacylglycérols (DAG, ou diglycérides) qui pourraient avoir un
rôle pathogénique important (Magkos et al., 2012; Puri et al., 2007). En effet, les DAG sont
impliqués dans la physiopathologie de l’insulinorésistance, non seulement dans le foie mais
aussi dans d’autres tissus comme le muscle et le tissu adipeux (Byrne and Targher, 2014;
Perry et al., 2014). Enfin, il est important de noter que les vacuoles lipidiques sont
recouvertes à leur surface de protéines qui semblent jouer un rôle important dans leur
maturation et leur métabolisme. Les plus abondantes de ces protéines sont la périlipine
(codée par le gène PLIN1), l’adipophiline (codée par le gène PLIN2) et TIP47 (Tail Interacting
Protein of 47 kDa, codée par le gène PLIN3) (Fujii et al., 2009; Pawella et al., 2014).
2. Epidémiologie
Dans certains pays occidentaux tels que les Etats-Unis, on estime que la prévalence
des NAFLD dans la population générale est comprise entre 20% à 30% chez les adultes et
10% chez les enfants et adolescents (Berardis and Sokal, 2014; Lazo et al., 2013; Smith and
Adams, 2011). La plupart des études épidémiologiques réalisées pour estimer la prévalence
des NAFLD utilise l’échographie hépatique pour le diagnostic. Cependant, cette technique
semble sous-estimer les chiffres et de plus, elle ne permet pas de faire la distinction entre la
simple stéatose et la NASH. En réalité, cette distinction ne peut se faire que grâce à l’analyse
anatomopathologique d’une biopsie hépatique (Brunt et al., 2011; Brunt and Tiniakos,
2010). L’étude de Minervini en 2009 sur des ponctions-biopsies hépatiques réalisées chez
des patients apparemment sains révèle que plus de 50% des sujets présentent une NAFLD,
et parmi eux 1/3 sont au stade de NASH (Minervini et al., 2009).
En ce qui concerne les populations à risque, les études épidémiologiques bénéficient
des analyses anatomopathologiques des biopsies hépatiques. Ainsi, ces études démontrent
17
que la majorité des personnes en surpoids ou obèses développe des NAFLD, et que dans un
contexte d’obésité morbide, les NAFLD sont rapportées chez 93% des sujets, dont 26%
présentent une NASH (Clark, 2006; Ong et al., 2005).
Concernant la distribution par sexe, les études montrent que les NAFLD seraient
légèrement plus fréquentes chez les hommes. La moindre prévalence chez les femmes
pourrait être due, au moins en partie, à l’action protectrice des hormones féminines telles
que les œstrogènes. Les NAFLD sont décrites à tout âge mais la prévalence augmente au
cours de la vie et en particulier après la ménopause chez les femmes (Clark, 2006). Enfin, des
différences ethniques sont rapportées. Ainsi, aux Etats-Unis, les personnes d’origine
hispanique sont plus prédisposées à développer une NAFLD que celles d’origine caucasienne
ou afro-américaine (45%, 33% et 24% de NAFLD respectivement parmi ces trois populations)
(Browning et al., 2004).
3. Physiopathologie des NAFLD
En ce qui concerne la physiopathologie des NAFLD, il faut distinguer d’une part
l’apparition de la stéatose hépatique, et d’autre part la progression de la stéatose en NASH.
• Développement de la stéatose hépatique
Les deux principaux mécanismes de l’accumulation des lipides hépatiques chez les
sujets obèses sont l’augmentation de la lipogenèse de novo et l’entrée accrue des acides
gras libres dans le foie. Ces deux évènements sont en fait intimement liés à la présence
d’une insulinorésistance qui s’établit usuellement chez les sujets obèses dans différents
tissus, principalement tissu adipeux, muscles et foie (Begriche et al., 2013; Postic and Girard,
2008; Tamura et al., 2005; Wieckowska et al., 2007).
En effet, la présence de l’insulinorésistance au niveau du tissu adipeux favorise
l’hydrolyse des triglycérides en glycérol et acides gras libres (AGL) du fait de la moindre
inhibition par l’insuline des lipases hormono-sensibles ATGL (Adipose Triglyceride Lipase) et
18
HSL (Hormone Sensitive Lipase) (Hsiao et al., 2013; Jocken et al., 2007). Ainsi, la libération
des AGL dans la circulation aboutit à une redistribution de ces dérivés entre le tissu adipeux
et le foie. Les AGL pénètrent en effet librement dans les hépatocytes grâce à différents
transporteurs membranaires « non saturables » tels que les FATPs (Fatty Acid Transport
Proteins) et la FAT/CD36 (Fatty Acid Translocase). Après estérification (conversion des AGL
en triglycérides), les triglycérides sont stockés sous forme de gouttelettes lipidiques dans les
hépatocytes ou sécrétés dans le sang sous forme de VLDL (Very Low Density Lipoprotein).
De plus, l’hyperinsulinémie associée à l’insulinorésistance stimule la lipogenèse de
novo au sein des hépatocytes, c’est-à-dire la conversion des glucides simples (e.g. glucose,
fructose) en lipides. En effet, l’augmentation de l’insulinémie active dans le foie le facteur de
transcription SREBP1c (Sterol Regulatory Element-Binding Protein-1c) qui gouverne
l’expression de nombreuses enzymes impliquées dans la glycolyse et la synthèse des lipides
telles que la glucokinase (GK), la fatty acid synthase (FASN), l’acetyl-CoA carboxylase (ACC)
ou encore la stearoyl-CoA desaturase 1 (SCD1) (Postic and Girard, 2008). Lorsqu’un diabète
de type 2 est installé, l’hyperglycémie contribue également à la stimulation de la lipogenèse
par l’intermédiaire de l’activation du facteur de transcription ChREBP (Carbohydrate
Responsive Element-Binding Protein) (Denechaud et al., 2008).
La présence d’une stéatose est un marqueur important d’une résistance à l’insuline
multi-tissulaire, et ce indépendamment de l’IMC (Bugianesi et al., 2005; Fabbrini et al., 2009;
Korenblat et al., 2008; Seppälä-Lindroos et al., 2002; Vega et al., 2007). Cependant, il n’est
pas clairement établi actuellement si la stéatose liée à l’obésité est une cause ou une
conséquence de l’insulinorésistance.
• Transition stéatose/NASH
Comme il a été mentionné plus haut, la stéatose peut progresser à long terme en
NASH chez environ 10 à 20% des patients. De très nombreuses investigations expérimentales
et cliniques ont été réalisées afin de connaître les mécanismes de cette transition. Même si
de nombreux facteurs ont pu être identifiés, les principaux mécanismes impliqués dans la
19
physiopathologie de la NASH semblent être le stress oxydant et la peroxydation lipidique
(générant des aldéhydes toxiques tels que le malondialdéhyde et le 4-hydroxynonénal), les
dysfonctions mitochondriales ainsi que la surproduction de cytokines proinflammatoires et
profibrotiques comme TNFα (Tumor Necrosis Factor-α), IL6 (Interleukine-6) et TGFβ
(Transforming Growth Factor-β) (Begriche et al., 2013; Fabbrini et al., 2010; Tilg and
Moschen, 2010). La présence de prédispositions génétiques explique aussi probablement
pourquoi certains sujets ont plus de risques de développer une NASH. Parmi les nombreux
gènes de susceptibilité étudiés, PNPLA3 (Patatin-like Phospholipase domain-containing 3) est
le plus fréquemment retrouvé dans plusieurs études indépendantes avec notamment la
présence d’un polymorphisme particulier (rs738409/I148M) qui augmente le risque de
survenue de la NASH (Anstee and Day, 2013; Cohen et al., 2011; Verrijken et al., 2013). De
façon intéressante, ce polymorphisme semble favoriser non seulement l’accumulation des
triglycérides mais également le stress oxydant (Min et al., 2014; Smagris et al., 2015). Il est à
noter aussi qu’un polymorphisme particulier dans le gène CYP2E1 (« allèle c2 ») a été associé
à un risque accru de NASH dans une étude effectuée chez des femmes obèses (Varela et al.,
2008).
Concernant le stress oxydant, plusieurs mécanismes sont simultanément impliqués.
Premièrement, il y a une surproduction des espèces réactives de l’oxygène (ERO) par la
chaîne respiratoire qui est défectueuse, mais également par le cytochrome P450 2E1
(CYP2E1), une enzyme du métabolisme de phase I, dont l’activité est augmentée au cours de
la NAFLD (Aubert et al., 2011; Begriche et al., 2011; Butura et al., 2009; Dey and Kumar,
2011). Deuxièmement, une réduction des défenses antioxydantes peut être observée avec
par exemple une diminution des concentrations intra-hépatiques de glutathion et de
l’activité de la glutathion peroxydase (GPx) (Begriche et al., 2013; Kathirvel et al., 2010;
Videla et al., 2004).
L’induction du CYP2E1 dans le contexte des NAFLD a été documentée dans de
nombreuses investigations réalisées chez l’Homme ou l’animal (Abdelmegeed et al., 2012;
Aubert et al., 2011; Leung and Nieto, 2013). Or, le CYP2E1 est capable de produire des ERO
20
au cours de son cycle catalytique. Cette surproduction d’ERO par le CYP2E1 semble non
seulement être impliquée dans la progression de la stéatose en NASH mais également dans
le développement de l’insulinorésistance. En effet, la surexpression hépatocytaire du CYP2E1
perturbe la signalisation insulinique avec notamment une diminution de la phosphorylation
des IRS (Insulin Receptor Substrates) 1 et 2 et de la protéine kinase B (PKB/Akt) (Kathirvel et
al., 2010; Kathirvel et al., 2009; Schattenberg et al., 2005). Inversement, les souris KO
(Knockout) pour le CYP2E1 sont protégées vis-à-vis du développement de l’insulinorésistance
secondaire à une alimentation riche en graisses (Abdelmegeed et al., 2012; Zong et al.,
2012).
Figure 3: Physiopathologie de NAFLD : mécanisme impliqué dans le développement d’une
stéatose et dans sa progression en stéatohépatite (NASH). La stéatose semble être le résultat de plusieurs évènements importants : d’une part, l’insulinorésistance au niveau du tissu adipeux active la lipolyse, libérant ainsi les acides gras libres captés librement par le foie ; d’autre part, l’hyperinsulinémie associée à l’insulinorésistance active la lipogenèse dans le foie via le facteur de transcription SREBP1c. Enfin, quand un diabète de type 2 est installé, l’hyperglycémie active également la lipogenèse via le facteur de transcription ChREBP. Chez certains patients, la stéatose peut évoluer en NASH sous l’influence de facteurs additionnels, tels que le stress oxydant, un dysfonctionnement mitochondrial, la lipotoxicité ou l’action de cytokines pro-inflammatoires.
21
II/ Les cytochromes P450 2E1 et 3A4
A. Généralités sur les CYPs
De par notre environnement, nous sommes constamment et inévitablement exposés
aux xénobiotiques, qu’ils soient d’origine médicamenteuse, industrielle ou alimentaire, et
qui peuvent avoir des effets néfastes selon leur absorption, distribution, métabolisation et
élimination (ADME). Notre organisme dispose de systèmes enzymatiques capables de
neutraliser ces composés, le plus souvent hydrophobes, en les rendant hydrosolubles pour
qu’ils puissent être éliminés dans les liquides biologiques, bile ou urine notamment. Les
cytochromes P450 (CYPs) font partie de ces enzymes du métabolisme des xénobiotiques. Ces
enzymes sont ubiquitaires mais sont principalement localisées dans le foie, et en plus faible
quantité dans plusieurs organes tels que les reins, les poumons, l’intestin ou la peau.
1. Cycle catalytique
Les CYPs sont des apoprotéines d’environ 500 acides aminés et de masse moléculaire
comprise entre 45 et 62kDa. Ils appartiennent à la famille des hémoprotéines. Le
groupement prosthétique de l’hème est composé de 4 azotes (protoporphirine IX) liés à un
atome de fer, lui-même coordonné à la chaine polypeptidique par un groupement thiol
d’une cystéine (Fig. 4). La sixième position de coordination du fer est libre et permet la
fixation de l’oxygène au cours du cycle catalytique.
Figure 4: Structure du groupement prosthétique des CYPs
22
A l’état de « bas spin », l’atome de fer est sous forme ferrique (Fe3+) et possède 6
liaisons, le centre actif de l’enzyme est plan et ne consomme pas d’énergie. La fixation d’un
substrat (RH dans la Fig. 5) provoque un changement conformationnel, ce qui transforme
l’état « bas spin » en état « haut spin », et l’enzyme devient alors fonctionnelle. L’électron
apporté par le système donneur d’électrons à partir du NAD(P)H et d’une réductase permet
la réduction du fer ferrique en fer ferreux (Fe2+), laissant la 6ème position de coordination du
fer libre de fixer l’oxygène. On obtient ainsi un complexe oxygéné. L’apport d’un autre
électron va ensuite permettre une réduction du complexe. Cette réaction initie l’étape
catalytique et l’activation de l’oxygène, conduisant à la libération du substrat hydroxylé, si
l’on prend l’exemple d’une réaction d’hydroxylation (Fig. 5). Pour résumer, l’oxygène
moléculaire va être réduit, formant l’entité peroxy-ferrique Fe3-OO- qui, par protonation,
donne ensuite un complexe hydroperoxo Fe3-OOH. Une seconde protonation provoque la
rupture de la liaison O-O, libérant ainsi une molécule d’eau et le composé Fer-oxo
hautement oxydant, qui peut transférer son atome d’oxygène au substrat. Après libération
du produit, l’enzyme est retrouvée libre sous forme ferrique, à l’état de « bas spin » (Lewis,
2003).
Dans certains cas particuliers, les CYPs s’affranchissent de l’apport d’un second
électron en utilisant des agents oxydants tels que les peracides ou les hydroperoxydes. Ce
cycle court est appelé « peroxyde shunt » (Guengerich and Munro, 2013). La synchronisation
entre les CYPs et leurs partenaires redox est primordiale. En effet, lorsque le couplage n’est
pas réalisé, les CYPs entrent dans des voies abortives conduisant à la décomposition du
complexe fer-oxygène et la production soit d’eau, soit d’espèces réactives de l’oxygène
(ERO) telles que le peroxyde d’hydrogène (H2O2) ou l’anion superoxyde (O2.-). La fréquence
de ces réactions indésirable dépend de nombreux paramètres dont la vitesse de transfert
d’électrons ou de protons, le mauvais positionnement des substrats dans le site catalytique,
ou encore la qualité de la reconnaissance et des interactions entre le CYP et ses partenaires
redox.
23
Figure 5: Représentation shématique du cycle catalytique des CYPs. La fixation d’un substrat RH sur le CYP en état de « bas spin » rend l’enzyme fonctionnelle. Un électron permet la réduction du fer ferrique (Fe3+) en fer ferreux (Fe2+), permettant ainsi au métal de fixer l’oxygène. L’apport d’un second électron va permettre une réduction du complexe oxygéné. L’oxygène moléculaire va être réduit, formant l’entité peroxy-ferrique Fe3-OO-. Une première protonation donne ensuite un complexe hydroperoxo Fe3-OOH, puis une seconde protonation provoque la rupture de la liaison O-O, libérant ainsi une molécule d’eau et le composé Fer-oxo hautement oxydant, qui peut transférer son atome d’oxygène au substrat. Après libération du produit, l’enzyme est retrouvée libre sous forme ferrique, à l’état de « bas spin ». D’après Lewis, 2003 (LS : Low-spin; HS : High-spin ; RH: substrat ; ROH : métabolite hydroxylé).
2. Nomenclature et classification
A partir d’informations basées sur des alignements de séquences et d’arbres
phylogénétiques d’évolution, Nelson a émis l’hypothèse d’un gène ancestral apparu il y a
environ 3,5 milliards d’années chez la bactérie. Ce dernier coderait pour une protéine qui
serait très proche du seul CYP retrouvé dans tous les organismes: le CYP51 qui catalyse la 14-
24
α-déméthylation du lanostérol, un intermédiaire dans les premières phases de la chaine de
synthèse des stérols (Nelson et al., 1996).
Les CYPs doivent leur nom à leur propriété d’absorbance à 450 nm. En effet, en 1962,
Sato et Omura ont appelé « pigment 450 » le composé responsable du pic d’absorbance à
450 nm qui apparaît lorsqu’on sature en monoxyde de carbone une préparation
subcellulaire de glandes surrénales (Omura and Sato, 1962).
La nomenclature utilisée pour désigner les différents CYPs repose sur la règle
suivante : l’abréviation CYP (pour cytochrome P450) est suivie d’un chiffre arabe désignant la
famille, puis d’une lettre désignant la sous famille, et enfin d’un nombre désignant les
variants alléliques d’un gène (Nebert et al., 1987; Nelson et al., 1996).
- Pour faire partie d’une même famille, les CYPs doivent présenter au moins 40%
d’homologie entre leurs séquences primaires en acides aminés constitutifs.
- Pour appartenir à la même sous-famille, il faut une homologie de séquence
supérieure à 55%.
- Les CYPs présentant une divergence inférieure à 3% sont considérés comme variants
alléliques.
Les CYPs font l’objet d’une classification internationale et leur nombre augmente
chaque année. En 2009, Nelson dénombrait 11 294 séquences différentes dont 3 282 chez
les animaux. Trois ans plus tard, ces chiffres sont passés à 18 687 séquences dont 5 442 chez
l’animal (http://drnelson.uthsc.edu) (Nebert et al., 2013).
Chez l’Homme, 18 familles de CYPs regroupant 57 CYPs sont répertoriées à ce jour, et
3 d’entre elles sont importantes pour le métabolisme des médicaments : les CYP1, CYP2 et
CYP3 (Nebert et al., 2013). Bien que les CYPs puissent se distinguer par leur spécificité de
substrat, cette dernière caractéristique peut être chevauchante : un CYP peut métaboliser
plusieurs substrats et un substrat peut être métabolisé par plusieurs CYPs.
25
Comme rappelé précédemment, les CYPs ont besoin pour leur activité catalytique
d’une source d’électrons transférés à partir du NAD(P)H (Nicotinamide Adénine Dinucléotide
Phosphate) par une protéine partenaire, une réductase. Il existe 4 classes de CYPs basées sur
leur système donneur d’électrons et suivant leur localisation microsomale ou mitochondriale
(Aguiar et al., 2005; Guengerich and Munro, 2013; Hannemann et al., 2007; Lamb and
Waterman, 2013).
- La classe I comprend les CYPs bactériens et mitochondriaux qui utilisent une chaine
d’électrons à 2 composants : une ferrédoxine réductase (FDR) à flavine FAD (Flavine-
Adénine Dinucléotide) et une ferrédoxine à centre fer-souffre Fe2S2 (Fdx). Chez les
eucaryotes, la FDR et la Fdx sont associées à la membrane interne des mitochondries.
- La classe II caractérise les CYPs microsomaux. Le système de transfert d’électrons, la
cytochrome P450 réductase (CPR ou POR pour «P450 oxydoréductase»), est ancrée
dans la membrane du réticulum endoplasmique et comporte 2 flavines : la FAD et la
FMN (Flavine Mononucléotide).
- Les CYPs de la classe III catalysent des isomérisations ou des déshydratations et
fonctionnent sans apport d’électrons extérieurs ni d’oxygène.
- La classe IV ne possède qu’un seul représentant : Le CYPnor qui catalyse la réduction
du monoxyde d’azote en recevant ses électrons directement du NADH sans protéines
intermédiaires (Takaya et al., 1999).
Cette classification est la plus connue et est admise par toute la communauté
scientifique. Néanmoins, il existe des cas particuliers, notamment pour les CYPs bactériens.
Ainsi, Hannemann a proposé une nouvelle classification plus précise, mais toujours basée sur
le transfert d’électrons (Hannemann et al., 2007).
26
3. Rôle physiologique des CYPs
Une des caractéristiques des CYPs est le grand nombre et la diversité des classes
chimiques de leurs substrats. C’est ainsi que les 57 CYPs actuellement découverts chez
l’Homme peuvent métaboliser des xénobiotiques (polluants, toxiques, médicaments…) mais
également participer au métabolisme de nombreuses molécules endogènes (hormones
stéroïdes, acides gras, acides biliaires, vitamine D3…) (Tab. 1) (Guengerich and Cheng, 2011).
Tableau 1: Classification des CYPs en fonction de leur classe de substrat majoritaire
(d’après Guengerich and Cheng, 2011).
• Métabolisme des xénobiotiques
Les CYPs interviennent dans la phase I du métabolisme des xénobiotiques. Les
réactions de phase I, dites de fonctionnalisation, permettent l’introduction d’une fonction
chimique nouvelle (-OH, NH2, COOH), rendant ainsi la molécule plus polaire. Le plus souvent,
il s’agit de réaction d’oxydation par l’introduction d’une fonction hydroxyle, mais il existe
également des réactions d’hydrolyse et de réduction. Les CYPs contribuent à
approximativement 80% des réactions de phase I (Evans and Relling, 1999). Les réactions de
phase II (réactions de conjugaison) ont lieu généralement après la phase I. Les métabolites
formés par les CYPs sont alors conjugués à un groupement polaire (glutathion, acétyle,
méthyle) par des enzymes de phase II (glucuronosyltransférase, sulfotransférase, glutathion
S-transférase..) pour augmenter leur solubilité. Enfin, le métabolite obtenu (ou le produit
27
parent inchangé) est transporté à travers la membrane cellulaire via des protéines de phase
III afin d’être éliminé par la bile ou l’urine (Fig. 6).
Figure 6: Métabolisme d’un xénobiotique au niveau de l’hépatocyte.
Chez l’Homme, le métabolisme des xénobiotiques fait intervenir la plupart du temps
plusieurs CYPs et un CYP peut métaboliser de nombreux xénobiotiques. Les CYPs impliqués
appartiennent aux familles 1, 2 et 3 principalement. D’un point de vue fonctionnel, le
CYP3A4 constitue l’enzyme la plus abondante exprimée au niveau hépatique (jusqu’à 37%
des CYPs) et la plus impliquée dans la biotransformation des médicaments utilisés en
clinique (30%). Le CYP2E1 quant à lui, représente 5 à 16% des CYPs hépatiques et métabolise
seulement 3% des médicaments (Guengerich, 2006; Zanger and Schwab, 2013).
Même si la plupart des réactions dans lesquelles interviennent les CYPs sont des
processus de détoxification, certains composés peuvent devenir toxiques à la suite du
métabolisme du composé d’origine. C’est notamment le cas du paracétamol, métabolisé par
le CYP2E1 et le CYP3A4 en N-Acétyl-p-benzoquinone-Imine (NAPQI), dérivé hautement
réactif capable de former des adduits aux protéines et à l’ADN (Corcoran et al., 1985; Jollow
et al., 1973; Rogers et al., 1997; Streeter et al., 1984). De plus, l’activité même de certains
CYPs génère la production d’ERO, délétères pour les cellules, comme c’est le cas pour le
CYP2E1. Enfin, il est à noter qu’il existe des variations interindividuelles importantes dans
l’expression des CYPs, liées à différents facteurs endogènes (sexe, âge, pathologies,
hormones, et facteurs génétiques) ou exogènes (médicaments, polluants, alcool,
28
alimentation..) et pouvant affecter significativement le métabolisme des médicaments
(Zanger and Schwab, 2013).
Figure 7: Les principaux CYPs des familles 1, 2 et 3 impliqués dans le métabolisme des
médicaments utilisés en clinique ainsi que les facteurs influençant la variabilité de ces
enzymes (d’après Zanger and Schwab, 2013). Les CYPs sont responsables de la majorité des réactions de biotransformation des médicaments. Chez l’Homme, les CYP1, CYP2 et CYP3 constituent les familles les plus importantes dans le métabolisme des agents pharmacologiques. Des changements et des différences dans l’activité des CYPs peuvent affecter la biodisponibilité, l’efficacité ou la toxicité des xénobiotiques. Des facteurs génétiques et environnementaux peuvent causer des différences intra-individuelles et interindividuelles dans la biotransformation des médicaments, pouvant affecter l’équilibre entre la détoxification et la toxicité.
• Métabolisme des molécules endogènes
Les CYPs, essentiellement des familles 4 à 51 (Tab. 1), sont impliqués dans la
biosynthèse et la métabolisation de molécules endogènes telles que le cholestérol, les acides
biliaires, les acides gras, les hormones stéroïdiennes, les eicosanoïdes et les vitamines (Fig. 8)
(McLean et al., 2012; Nebert et al., 2013). Les CYPs qui participent à cette voie de
métabolisation de molécules endogènes sont très sélectifs pour leur substrat. Néanmoins,
certains des CYPs métabolisant les xénobiotiques, beaucoup moins spécifiques pour leurs
29
substrats, peuvent également métaboliser des molécules endogènes, comme c’est le cas
pour le CYP2E1 et le CYP3A4.
Figure 8: Les CYPs impliqués dans le métabolisme de molécules endogènes (d’après Zanger and Schwab, 2013). A. la biosynthèse des hormones stéroïdiennes. L’aldostérone, le cortisol et la corticostérone sont synthétisés dans les glandes surrénales, la testostérone dans les testicules et les œstrogènes dans les ovaires. D’autres CYPs participent au catabolisme des hormones stéroïdiennes, notamment le CYP3A qui réalise la 6-β-hydroxylation des stéroïdes et la 16-α-hydroxylation de la testostérone, permettant leur élimination urinaire après conjugaison. B. la synthèse des eicosanoïdes à partir de l’acide arachidonique. C. la
biosynthèse du cholestérol et des acides biliaires. Cette voie est exclusivement hépatique D. la transformation de la vitamine D3. Pour être active, la vitamine D3 doit être hydroxylée en 25-hydroxy-vitamine D3 au niveau hépatique puis en 1-α, 25-dihydroxy-vitamine D3 au niveau rénal. Outre ces 4 grandes voies métaboliques, les CYPs de la famille 4A réalisent l’ω-hydroxylation des acides gras permettant leur dégradation et leur élimination.
30
B. Le CYP2E1
1. Généralités sur le CYP2E1
Le gène humain du CYP2E1 a été cloné et séquencé en 1988. Il est situé sur le
chromosome 10 en position 10q24.3. Sa partie codante comporte 9 exons et exprime une
protéine de 493 acides aminés (Umeno et al., 1988). Ce cytochrome P450 est principalement
exprimé au niveau du foie où il représente 6 à 10% des CYPs totaux, mais il a également été
mis en évidence au sein d’autres organes tels que le poumon (Hukkanen et al., 2002), le
colon (Plewka et al., 2014), le cœur (Sidorik et al., 2005) et le cerveau (Dutheil et al., 2009;
Upadhya et al., 2000) et le tissu adipeux (Ellero et al., 2010) chez l’Homme.
En ce qui concerne sa localisation subcellulaire, elle est principalement microsomale,
comme tous les CYPs qui métabolisent des xénobiotiques. Toutefois, il a été également
purifié et caractérisé dans des mitochondries hépatiques chez l’Homme (Bansal et al., 2013)
et chez le rat (Robin et al., 2001). Le CYP2E1 mitochondrial représente jusqu’à 40% du
CYP2E1 total. Les CYP2E1 d’origine mitochondriale et microsomale possèdent la même
structure primaire mais diffèrent par leur structure secondaire. En effet, le CYP2E1
mitochondrial présente un degré d’hélicité plus faible que celui d’origine microsomale,
suggérant une structure moins compacte et moins repliée. Une autre différence majeure
entre les deux formes est le degré de phosphorylation, plus important pour le CYP2E1
mitochondrial. Enfin, selon leur localisation, les deux formes du CYP2E1 requièrent pour leur
activité des systèmes donneurs d’électrons différents. Le CYP2E1 mitochondrial n’est actif
qu’en présence d’adrénodoxine et d’adrénodoxine réductase alors que le CYP2E1
microsomal reçoit ses électrons de la NADPH CYP réductase ( Robin et al., 2001). Le CYP2E1 a
également été localisé au niveau de la membrane plasmique, notamment lors d’hépatites
auto-immunes induites par l’halothane (Eliasson and Kenna, 1996) ou lors d’infection par le
virus de l’hépatite C (Vidali et al., 2007), au sein des peroxysomes (Pahan et al., 1997), de
l’appareil de Golgi (Neve et al., 1996), et des lysosomes (Ronis et al., 1992). Quelle que soit
31
sa localisation, le CYP2E1 est fonctionnel et inductible (Loeper et al., 1993; Pahan et al.,
1997; Robin et al., 1997; Wu and Cederbaum, 1992).
L’expression hépatique du CYP2E1 est soumise à une régulation intervenant à
différents niveaux : transcriptionnel, post-transcriptionnel, traductionnel et post-
traductionnel (Aguiar et al., 2005; Ingelman-Sundberg et al., 1994; Novak and Woodcroft,
2000; Oesch-Bartlomowicz and Oesch, 2005). Cette régulation du CYP2E1 est donc complexe
et semble de plus spécifique à chaque espèce.
Au niveau transcriptionnel, l’expression constitutive du CYP2E1 peut être induite par
différents facteurs de transcription selon l’espèce étudiée : HNF-1α (hepatocyte Nuclear
Factor-1α) chez la souris, le rat et l’Homme (Akiyama and Gonzalez, 2003; Cheung et al.,
2003; Hakkola et al., 2003; Liu and Gonzalez, 1995; Matsunaga et al., 2008) et Sp1 et NFκB
(Nuclear Factor-kappa B) chez le lapin (Peng and Coon, 2000). En effet, le site de fixation du
facteur Sp1 au niveau de la région promotrice du CYP2E1 chez le lapin n’est pas conservé
chez le rat et l’Homme (Peng and Coon, 2000). Une étude récente montre également que
l’expression du CYP2E1 chez la souris et l’Homme est régulée indirectement par le facteur de
transcription ATF4 par l’intermédiaire du facteur de transcription CREB (c-AMP Response
Element-Binding protein), qui se fixe à la séquence CRE (c-AMP Responsive Element) du
promoteur du CYP2E1 (Wang et al., 2014). Enfin, une autre étude récente montre que
l’expression du CYP2E1 chez l’Homme peut être régulée par la voie Wnt/β-caténine (Gerbal-
Chaloin et al., 2014).
Au niveau post-transcriptionnel, il a été montré que l’expression du CYP2E1 peut être
régulée par des microRNAs (miRNAs). Par exemple, le CYP2E1 peut être régulé négativement
par le miRNA-378 (Mohri et al., 2010). Dans ce travail, l’étude de 25 biopsies hépatiques
humaines n’a pas montré de corrélation entre les niveaux d’ARNm et protéiques du CYP2E1,
indiquant une régulation post-transcriptionnelle de cette enzyme. Les niveaux de miRNA-378
étaient quant à eux inversement proportionnels aux niveaux d’ARNm, aux niveaux
protéiques du CYP2E1 et à l’efficacité de la traduction (Mohri et al., 2010). Plus récemment,
32
Takahashi et coll. (2014) ont étudié l’effet du le miR-223 sur le CYP2E1 et ont démontré qu’il
inhibait l’activité du CYP2E1 sans affecter l’expression protéique de l’enzyme. Cette
inhibition de l’activité se ferait via l’inhibition de l’expression protéique de la protéine du
cytochrome b5 (Takahashi et al., 2014).
Au niveau post-traductionnel, le CYP2E1 peut subir plusieurs types de modifications
notamment par phosphorylation. Cependant, la plus étudiée est la phosphorylation de sa
sérine en position 129 (Ser129) par reconnaissance du motif Arg-Arg-Phe-Ser129 par la
protéine kinase A (PKA), elle-même activée par l’AMPc. La phosphorylation du CYP2E1 sur la
Ser129 entraîne une réduction rapide de l’activité de ce cytochrome P450, ainsi que sa
dégradation (Eliasson et al., 1990; Eliasson et al., 1992; Oesch-Bartlomowicz and Oesch,
2005; Oesch-Bartlomowicz et al., 1998). Il est à noter que la phosphorylation de la Ser129 a
été également décrite comme étant importante pour l’adressage du CYP2E1 dans les
mitochondries (Robin et al., 2002).
Bien qu’il y ait un grand polymorphisme au niveau du gène CYP2E1 (Carrière et al.,
1996), il n’existe pas de polymorphisme connu conduisant à un CYP2E1 inactif chez l’Homme
ou d’autres espèces animales (Gonzalez, 2007). Cependant, certains polymorphismes chez
l’Homme peuvent modifier significativement l’efficacité de la transcription (e.g. CYP2E1*5B)
ou l’efficacité catalytique de l’enzyme (e.g. CYP2E1*6) (Hayashi et al., 1991). McCarver et
coll. (1998) ont quant à eux étudié une mutation par insertion dans le gène du CYP2E1,
présente chez 31% des patients étudiés. Ils ont observé une corrélation entre augmentation
de l’activité du CYP2E1 et la mutation seulement chez les patients obèses ou ayant
consommé de l’alcool. Il semblerait également que cette mutation soit plus fréquente chez
les patients d’origine afro-américaine (31%) que chez les caucasiens (6.9%) (McCarver et al.,
1998). Une étude récente a également montré chez l’Homme que des mutations dans la
partie N-terminale du CYP2E1 modifiaient de façon importante l’adressage mitochondrial du
CYP2E1 (Bansal et al., 2013).
33
2. Les substrats endogènes et exogènes du CYP2E1
Le CYP2E1 intervient dans la biotransformation de composés endogènes comme les
corps cétoniques, le glycérol et certains acides gras (Caro and Cederbaum, 2001; Laethem et
al., 1993; Porubsky et al., 2008). De plus, il catalyse la biotransformation de nombreux
xénobiotiques comme le paracétamol, certains anesthésiques volatiles (enflurane,
isoflurane, halothane), l’éthanol ainsi qu’un large spectre de composés hydrophobes pro-
carcinogènes comme le tétrachlorure de carbone (CCl4), les nitrosamines, le benzène,
l’aniline ou la pyridine (Gonzalez, 2005; Koop, 1992). Au total, il a été montré que le CYP2E1
pouvait métaboliser plus de 70 substrats (Koop, 1992; Porubsky et al., 2008; Rendic and Di
Carlo, 1997; Tanaka et al., 2000).
• Le paracétamol
Le CYP2E1 est capable de convertir le paracétamol en N-acétyl-p-benzoquinone-
imine (NAPQI), un métabolite très réactif et cytotoxique. Le paracétamol, son métabolisme
et sa toxicité seront abordés en détail dans la dernière partie de l’introduction.
• L’alcool éthylique (éthanol)
Il existe 3 voies métaboliques d’oxydation de l’éthanol dans le foie : l’alcool
déshydrogénase (ADH) cytosolique, la catalase peroxisomale et le système microsomal
d’oxydation de l’éthanol (MEOS : Microsomal Ethanol Oxidizing System) (Tanaka et al.,
2000). L’ADH est la principale enzyme impliquée dans la conversion de l’éthanol en
acétaldéhyde. Le MEOS, dont le CYP2E1 appartient, est également impliqué lors d’une forte
ingestion d’alcool, et dans ce contexte d’intoxication alcoolique ce système métabolise plus
de 10% de la dose d’alcool. L’acétaldéhyde formé est ensuite dégradé en acétate par
l’aldéhyde déshydrogénase (ALDH), localisée principalement dans les mitochondries. Il est
important de préciser que la métabolisation de l’alcool par le CYP2E1 génère également le
radical 1-hydroxyéthyl qui est très réactif et délétère au niveau cellulaire (Das and
Vasudevan, 2007; Lu and Cederbaum, 2008). L’induction du CYP2E1 par l’intoxication
alcoolique est abordée ci-dessous.
34
• La chlorzoxazone
La chlorzoxazone est un myorelaxant d’action centrale. Plusieurs études ont
démontré que l’hydroxylation de la chlorzoxazone (CZX) en 6-hydroxychlorzoxazone peut
être utilisée comme un indicateur de l’activité du CYP2E1, que ce soit in vitro ou in vivo
(Bachmann and Sarver, 1996; Mishin et al., 1998; Peter et al., 1990; Vesell et al., 1995).
L’utilisation de la chlorzoxazone comme « sonde » spécifique du CYP2E1 a permis de mettre
en évidence des différences interindividuelles de l’activité de cette enzyme, comme
l’augmentation de l’activité du CYP2E1 chez des patients atteints de NAFLD, partie
développée dans le prochain paragraphe (Tab. 2) (Lucas et al., 1998; Varela et al., 2008), ou
encore des variations interraciales. C’est ainsi que Kim et coll. (1996) ont trouvé que les
concentrations plasmatiques de chlorzoxazone étaient significativement plus élevées et le
taux d’élimination plus faible chez les japonais que chez les hommes caucasien in vivo (Kim
et al., 1996). Ces résultats ont été confirmés in vitro en utilisant les microsomes hépatiques
issus de ces deux groupes raciaux.
• CYP2E1, stress oxydant et formation de métabolites réactifs
Le CYP2E1 présente la propriété quasiment unique de produire des quantités
significatives d’ERO au cours de son cycle catalytique (Aubert et al., 2011; Cederbaum, 2014;
Wu and Cederbaum, 2008).
Ainsi, l’induction de cette enzyme dans différentes circonstances
physiopathologiques (e.g. intoxication alcoolique, NAFLD) va entraîner un stress oxydant et
des dommages oxydatifs de nombreux constituants cellulaires. En effet, les ERO peuvent
attaquer différentes macromolécules comme les acides nucléiques, les protéines et les
acides gras insaturés. L’attaque oxydative de ces acides gras est à l’origine de la
peroxydation lipidique qui aboutit à la génération d’aldéhyde hautement réactifs tels que le
malondialdéhyde et le 4-hydroxynonénal (Aubert et al., 2011). Les ERO et les produits de la
peroxydation lipidique peuvent aussi altérer certains composants mitochondriaux tels que
l’ADN mitochondrial et la cytochrome c oxydase (Cahill et al., 2002; Demeilliers et al., 2002).
Enfin, il est important de souligner que le CYP2E1 transforme un certain nombre de toxiques
35
ou de médicaments en métabolites très réactifs et délétères pour les cellules exprimant ce
CYP. Pour les toxiques, on peut citer l’alcool éthylique, le CCl4, le thioacétamide et
l’azoxyméthane (Chilakapati et al., 2007; Gonzalez, 2007; Koop, 1992) et pour les
médicaments, l’halothane, l’acide salicylique et le paracétamol, comme cela a été déjà
mentionné (Aubert et al., 2011; Doi and Horie, 2010; Dupont et al., 1999).
2. Altération de l’expression et/ou de l’activité du CYP2E1 en conditions
physiopathologiques
De nombreuses études expérimentales ou cliniques ont montré une augmentation de
l’expression (ARNm ou protéine) et/ou de l’activité du CYP2E1 au niveau hépatique dans
différentes conditions physiopathologiques comme ou le jeûne (O’Shea et al., 1994),
l’obésité et la NAFLD (O’Shea et al., 1994; Raucy et al., 1991), ainsi que le diabète de type 1
ou de type 2 (Dong et al., 1988; Wang et al., 2003). De plus, lors d’une intoxication
alcoolique, les taux protéiques de CYP2E1 sont significativement augmentés dans le foie
(Roberts et al., 1995; Song, 1996). A l’inverse, des situations d’inflammation aiguë réduisent
l’expression et l’activité du CYP2E1 hépatique (Projean et al., 2005; Sewer et al., 1996). Enfin,
certains médicaments comme le chlorméthiazole et le disulfirame peuvent altérer
l’expression et/ou de l’activité du CYP2E1 (Frye et al., 1999; Simi and Ingelman-Sundberg,
1999). Les situations d’obésité, de NAFLD et de diabètes seront plus particulièrement
discutées dans cette partie.
• Obésité et NAFLD
De nombreux travaux expérimentaux et cliniques ont montré une augmentation de
l’expression (ARNm, protéine) et/ou de l’activité du CYP2E1 hépatique dans un contexte
d’obésité et de NAFLD (Aubert et al., 2011; Chalasani et al., 2003; Emery et al., 2003;
Khemawoot et al., 2007; O’Shea et al., 1994; Raucy et al., 1991; Videla et al., 2004; Zou et al.,
2006).
Chez l’Homme, 9 études réalisées chez des patients souffrants de NAFLD ont montré
une corrélation nette entre le degré de stéatose hépatique et l’expression et/ou l’activité du
36
CYP2E1 (Tab. 2) (Baker et al., 2010; Chalasani et al., 2003; Chtioui et al., 2007; Donato et al.,
2006; Emery et al., 2003; Kohjima et al., 2007; Mitsuyoshi et al., 2009; Varela et al., 2008;
Videla et al., 2004; Weltman et al., 1998). Dans l’étude la plus récente de 2010, Bell et coll.
ont constaté chez des patients obèses ayant subi une chirurgie bariatrique une diminution
de l’expression protéique du CYP2E1 hépatique en corrélation avec l’amélioration de la
dyslipidémie (Bell et al., 2010).
Avant d’aborder les facteurs qui seraient responsables de l’augmentation du CYP2E1,
il est intéressant de souligner que différentes investigations in vitro et in vivo suggèrent que
cette induction pourrait jouer un rôle dans l’altération de la signalisation insulinique et la
survenue de l’insulinorésistance, une anomalie métabolique associée fréquemment à la
NAFLD (Kathirvel et al., 2009; Schattenberg et al., 2005; Zong et al., 2012).
Les facteurs et les mécanismes impliqués dans l’induction du CYP2E1 hépatique au
cours de l’obésité et de la NAFLD restent encore inconnus, mais plusieurs hypothèses
pourraient être avancées (Aubert et al., 2011).
- Une première hypothèse pourrait être l’implication de certains lipides, et en
particulier certains acides gras. Il a été montré à de nombreuses reprises que l’expression
et/ou l’activité du CYP2E1 étaient augmentées par un régime alimentaire riche en lipides in
vivo chez l’animal (Abdelmegeed et al., 2012; Khemawoot et al., 2007; Maksymchuk, 2014;
Osabe et al., 2008; Puccinelli et al., 2013). Néanmoins, certaines études réalisées chez le
canard, le rat et la souris et ont constaté une diminution de l’expression et/ou de l’activité
du CYP2E1 suite à un régime riche en lipides (Ito et al., 2006; Leclercq et al., 1998; Sugatani
et al., 2006). De plus, Yoshinari et coll. (2006), ainsi que Ghose et coll. (2011), ont constaté
quant à eux qu’un régime riche en lipides ne modifiait pas l’expression protéique et/ou
d’ARNm du CYP2E1 chez la souris (Ghose et al., 2011; Yoshinari et al., 2006). Une étude
menée chez le rat a évalué l’effet de 2 régimes hyperlipidiques différents sur l’expression
protéique du CYP2E1. Le premier régime (HF1) est composé principalement de sucrose (60%
de sucrose et 10% de lard) alors que le second régime (HF2) est surtout riche en graisse
37
(19.8% d’huile de maïs, 19.8% de lard et 24.1% de sucrose). Bien que le premier régime riche
en sucrose (HF1) induise une accumulation plus importante de triglycérides et d’acides gras
libres intra-hépatiques que le second régime (HF2), il ne modifie pas l’expression protéique
du CYP2E1, contrairement au second régime qui l’induit (Osabe et al., 2008). De façon
intéressante, grâce à l’utilisation de souris wild-type et de souris génétiquement obèses des
deux sexes, Aubert et coll. (2012) ont montré que l’activité du CYP2E1 hépatique n’était
augmentée significativement que chez les souris db/db femelles, alors que le degré de
stéatose hépatique chez ces souris était moindre comparé aux souris ob/ob du même sexe.
L’ensemble de ces résultats suggère que ce n’est pas la quantité globale de lipides qui joue
un rôle dans l’augmentation de l’expression et/ou de l’activité du CYP2E1 mais le type
d’acides gras s’accumulant dans les hépatocytes (Aubert et al., 2012).
Certaines études in vitro ont été réalisées sur des cellules hépatiques humaines et
animales traitées par différents types d’acides gras. Cependant, les protocoles
expérimentaux (durée d’incubation, concentrations des acides gras…) sont très variables et il
est difficile donc de tirer des conclusions définitives quant aux espèces lipidiques qui
pourraient être responsable de l’induction du CYP2E1. Par exemple, Zangar et Novak (1997)
ont étudié sur des hépatocytes de rat l’effet d’acides gras saturés à chaine courte ou
moyenne (C6-C10), ainsi que l’effet de l’acide palmitique, et n’ont constaté aucun effet de ces
acides gras sur l’expression des ARNm du CYP2E1 (Zangar and Novak, 1997). Quatre études
in vitro sur des cellules hépatiques humaines ont évalué l’effet individuel de certains acides
gras sur l’expression du CYP2E1 (Tab. 3). L’acide oléique et l’acide palmitique semblent
isolément augmenter l’expression (ARNm ou protéines) du CYP2E1 (Sung et al., 2004 ; Raucy
et al., 2004 ; Anthérieu et al., 2011) (Anthérieu et al., 2011; Raucy et al., 2004; Sung et al.,
2004). En revanche, en mélange, ces deux acides gras diminueraient les ARNm et l’activité
de l’enzyme ( Donato et al., 2007). Il est à noter que l’activité du CYP2E1 n’a pas été mesurée
dans les études montrant une augmentation de l’expression de ce CYP (Anthérieu et al.,
2011; Raucy et al., 2004).
38
Tableau 2: Altération de l’expression et/ou de l’activité du CYP2E1 lors de la stéatose et de
la NASH dans des foies humains : Investigations Ex vivo et mesure In vivo de l’activité du
CYP2E1. (1) Détermination de l’activité du CYP2E1 via la clearance plasmatique de la chlorzoxazone et de son métabolite 6-hydroxylé ; (2) Détermination de l’activité du CYP2E1 via la clearance plasmatique et urinaire de la chlorzoxazone et de son métabolite 6-hydroxylé.
Auteurs Conditions physiopathologiques investigations ARNm Protéines Activité
O’shea et al., 1994 Patients obèses versus patients sains (NAFLD non précisée)
Mesure In vivo (1) - - ↗
Weltman et al.,
1998
NASH (50% de sujets obèses) versus foies sains
(IMC des patients non précisé) Immunohistochimie - ↗ -
Lucas et al., 1998 Patients obèses versus patients sains (NAFLD non précisée)
Mesure In vivo - - ↗ ca 40%
Emery et al., 2003 Patients souffrant d’obésité morbide et à différents stades de NAFLD versus patients sains
Mesure In vivo(2) - - ↗
Chalasani et al.,
2003
Patients obèses non-diabétiques souffrant de NASH versus patients obèses sans NAFLD
Mesure In vivo (2) - - ↗
Videla et al., 2004
Patients obèses souffrants de stéatose ou NASH versus patients sains
Microsomes -
↗ ns 70%
steatose
↗ ca 142% NASH
↗ ns
stéatose
↗ ca 52% NASH
Chtioui et al., 2007
Patients obèses souffrants de NASH versus patients obèses souffrants de stéatose
Mesure In vivo (1) - - ↗
Donato et al., 2006
Foies stéatosés versus foies sains (IMC des patients non précisé)
Microsomes - - →
Kohjima et al., 2007 Foies stéatosés ou au stade NASH versus foies sains (IMC des patients non précisé)
Homogénat total ↗ ca 14X - -
Varela et al., 2008
Patients obèses non-diabétiques souffrant de NAFLD versus patients obèses sans NAFLD
Mesure In vivo (1) - -
↗ ns stéatose
↗ ca 35% NASH
Fisher et al., 2009 Foies stéatosés ou au stade NASH versus foies sains (IMC des patients non précisé)
microsomes -
↗ ca 22% stéatose
↗ ca 45% NASH
-
Homogénat total
↘ ca 50% stéatose
↘ ca 80% NASH
- -
Mitsuyoshi et al.,
2009
Patients non obèses souffrants de stéatose ou NASH versus patients sains
Microsomes -
→
stéatose
↘ ca 40% NASH
↗ ns stéatose
→
NASH
Homogénat total
↗ ca 8X stéatose
↗ ca 6.2X NASH
- -
Baker et al., 2010 Patients obèses souffrants de NASH versus patients sains
Homogénat total ↗ 2.17X - -
Bell et al., 2010
Patients obèses ayant suivis une chirurgie bariatrique : comparaison avant leur perte de poids
Immunohistochimie - ↗ -
39
Tableau 3: Régulation du CYP2E1 par les AG dans des hépatocytes humains in vitro. C16:0 acide palmitique ; C18:1 acide oléique ; C18:2 acide linoleïque ; C18:3 acide linolénique ; C22:6 DHA (acide docosahexaénoïque) ; * : protéines non quantifiées ; ns: non significatif.
- La seconde hypothèse pouvant expliquer l’induction du CYP2E1 au cours de
l’obésité et de la NAFLD serait la présence concomitante d’une résistance intra-hépatique à
l’insuline, ou d’un diabète de type 2. Ces facteurs seront discutés ci-dessous dans le
paragraphe « Diabètes de type 1 et de type 2 ».
- La troisième hypothèse qui expliquerait l’induction du CYP2E1 hépatique pourrait
être l’implication d’une perturbation des taux circulants de leptine et d’adiponectine, deux
adipokines majeures produites par le tissu adipeux blanc (Aubert et al., 2011). Plus
précisément, les concentrations plasmatiques de leptine et d’adiponectine sont
respectivement augmentées et diminuées au cours de l’obésité et la NAFLD (Begriche et al.,
2013; Stojsavljević et al., 2014). Il a été montré par exemple que l’administration de leptine à
des souris ob/ob (qui sont totalement déficientes en leptine) entraîne une augmentation de
Auteurs Models Conditions
de culture Acides gras temps Concentration ARNm Proteines Activité
Sung et al.,
2004
HepG2
Sans insuline
C16:0
12h 20µM
- → -
C18:1 - ↗ * -
C18:2 - → -
C18:3 - → -
C22:6 - → -
Raucy et al.,
2004
Hépatocytes primaires humains
5.8µg/ml insuline (10
-6M)
C16:0 48h 200µM ↗ ca 3.2X
- -
Donato et al.,
2006
Hépatocytes primaires humains
0,06µg/ml insuline (10
-8M)
Mélange de C18:1/C16:0
(2:1) 14h
500µM total ↘ ns - ↘ ns
1mM total ↘ ca 45%
- ↘ ns
2mM total - - ↘ ca 50%
Anthérieu et
al., 2011
HepaRG
2%DMSO 5µg/ml insuline
C18:1
24h 250µM → - -
500µM → - -
48h 500µM - → -
14 jours
250µM ↗ ca 58%
- -
500µM ↗ ca 89% ↗ ca 50% -
40
l’expression protéique en CYP2E1 par un mécanisme qui ne dépend pas uniquement de la
réduction de la prise alimentaire (Leclercq et al., 2000). Des travaux suggèrent également
que la leptine semble importante pour l’importation du CYP2E1 dans le compartiment
mitochondrial (Robin et al., 2005). Enfin, une étude montre que l’expression du CYP2E1
hépatique est augmentée chez des souris déficientes en adiponectine tandis qu’elle est
diminuée chez des souris surexprimant l’adiponectine (Kamada et al., 2007).
• Diabètes de type 1 et de type 2
Le diabète de type 1 est caractérisée par un déficit profond de la sécrétion d’insuline
par les cellules bêta du pancréas, ayant pour conséquence un défaut d’utilisation du glucose
et une hyperglycémie sévère. Chez l’homme, il a été montré que le diabète de type 1 était
associé à une activité plus élevée du CYP2E1, mais la différence n’était pas significative avec
les sujets témoins (Wang et al., 2003). Cependant, il est à noter que tous ces patients étaient
traités par l’insuline. Chez l’animal, il est possible d’induire un diabète de type 1 par
l’injection de streptozotocine, un agent alkylant qui détruit spécifiquement les cellules bêta
pancréatiques. Plusieurs études réalisées chez des rongeurs traités par la streptozotocine
ont ainsi montré une augmentation importante de l’expression et l’activité du CYP2E1
hépatique, qui était normalisée par l’injection d’insuline (Kataoka et al., 2005; Raza et al.,
2004; Sindhu et al., 2006)
Bien que ces études in vivo suggèrent un rôle de l’insuline sur l’expression et l’activité
du CYP2E1, il est possible que d’autres facteurs liés au diabète puissent être impliqués tels
que l’hyperglycémie et l’augmentation des corps cétoniques (hypercétonémie) secondaire
au catabolisme accru des acides gras. Concernant l’hyperglycémie, l’étude de Wang et coll.
(2003) effectuée chez des sujets présentant un diabète de type 1 ou de type 2 montre une
corrélation significative et positive entre l’activité du CYP2E1 et la glycémie (Wang et al.,
2003). De plus, l’étude de Aubert et coll. (2012) a montré chez des souris db/db femelles que
la forte activité du CYP2E1 hépatique est corrélée positivement et significativement (p<0.01)
à la glycémie, qui est particulièrement élevée chez ces souris diabétiques (Aubert et al.,
2012). Il est enfin intéressant de noter que l’administration de sulfate de vanadyl à des rats
41
prétraités par la streptozotocine est capable de réduire la glycémie et de diminuer
l’expression du CYP2E1 hépatique (Kataoka et al., 2005).
Concernant, l’hypercétonémie, il est important de mentionner que l’acétone est un
puissant inducteur du CYP2E1, par un mécanisme qui serait lié à la stabilisation de la
protéine (Forkert et al., 1994; Gonzalez, 2005). Cependant, les investigations de Woodcroft
et coll. (2002) chez des animaux diabétiques, ainsi que celles de Zangar et Novak (1997) sur
hépatocytes primaires de rat, ont montré que les corps cétoniques ne sont pas directement
responsables de l’augmentation de l’expression du CYP2E1. L’altération de la voie de
signalisation de l’insuline pourrait être à l’origine de cette induction (Woodcroft et al., 2002;
Zangar and Novak, 1997). Woodcroft et coll. ont également montré sur hépatocytes
primaires de rat que l’hydroxybutyrate et l’acétoacétate inhibent l’expression des ARNm du
CYP2E1 (Woodcroft et al., 2002).
Le diabète de type 2 est une des nombreuses anomalies métaboliques pouvant
survenir dans un contexte d’obésité. Il survient généralement après plusieurs d’années de
présence d’une insulinorésistance et de maintien d’une glycémie normale par augmentation
compensatrice de la sécrétion d’insuline. A long-terme, les patients présentant une
insulinorésistance peuvent cependant développer un diabète et nécessiter un traitement par
l’insuline en conséquence de la défaillance et de la destruction des cellules bêta. Deux
études indépendantes ont montré une augmentation de l’activité du CYP2E1 chez des
patients obèses présentant un diabète de type 2 (Lucas et al., 1998; Wang et al., 2003).
Cependant, il est important de noter que les investigateurs n’ont pas déterminé si les
patients présentaient une NAFLD.
L’ensemble de ces études suggère ainsi que la moindre sécrétion d’insuline (ou une
signalisation insulinique défectueuse) et/ou d’autres anomalies hormonales et métaboliques
associées pourraient jouer un rôle important dans l’induction du CYP2E1 hépatique. Dans ce
cadre, il est à noter que des investigations réalisées sur des cellules hépatiques de rat ont
montré que l’insuline inhibait l’expression du CYP2E1 en diminuant la stabilité des ARNm du
42
CYP2E1 (Moncion et al., 2002; Shukla et al., 2013; Woodcroft and Novak, 1999a; Woodcroft
et al., 2002), dont la demi-vie passe de 8,5h sans insuline à 3,3h en présence d’insuline (De
Waziers et al., 1995). Une séquence de 16 nucléotides au niveau de la région 5’ proximale de
l’ARNm du CYP2E1 interviendrait dans la régulation du CYP2E1 par l’insuline (Moncion et al.,
2002), mais les protéines se liant à ces séquences restent à identifier (Truong et al., 2005). A
l’inverse, il a été montré que le glucagon était capable d’augmenter l’expression du CYP2E1
grâce à la voie de signalisation impliquant l’AMPc et la protéine kinase A (PKA) (Woodcroft
and Novak, 1999b). A notre connaissance, une seule étude a évalué sur des hépatocytes
humains l’effet de l’insuline sur l’expression du CYP2E1. Dans cette étude, Raucy et coll.
(2004) ont montré que l’insuline n’altère pas significativement l’expression des ARNm dans
des hépatocytes primaires humains en culture, bien que les valeurs montrent une tendance
à la diminution. Il est important de noter cependant que dans toutes ces investigations les
effets de l’insuline ont été évalués sur des temps relativement courts (en général moins de
48 h et 4 jours pour une étude) et surtout, que l’activité du CYP2E1 n’a jamais été mesurée
(Raucy et al., 2004).
• Maladies alcooliques du foie
L’impact de la consommation excessive d’alcool demeure élevé en France en termes
de morbidité et de mortalité. Outre la dépendance qu’engendre une consommation
excessive d’alcool, sa toxicité sur différents organes et tissus doit être prise en compte. Au
niveau hépatique, l’alcool entraine diverses lésions telles que la stéatose, la stéatohépatite
et la cirrhose, qui peut évoluer en carcinome hépatocellulaire (Fromenty and Pessayre, 1995;
Rocco et al., 2014).
De nombreuses investigations expérimentales et cliniques ont montré que
l’intoxication alcoolique est caractérisée par une augmentation de l’activité du CYP2E1
(Liangpunsakul et al., 2005; Lieber, 2004; Mishin et al., 1998; Seitz and Wang, 2013). Cet
effet est la conséquence d’une diminution de la dégradation du CYP2E1 par le protéasome,
alors que les taux d’ARNm ne sont pas modifiés (Eliasson et al., 1992; Roberts et al., 1995;
Song et al., 1989; Winters and Cederbaum, 1992; Zhukov and Ingelman-Sundberg, 1999).
43
L’éthanol fait donc partie des composés inducteurs du CYP2E1 tout en étant un substrat de
l’enzyme. Cette augmentation de l’activité du CYP2E1 chez les sujets alcooliques joue un rôle
majeur dans la physiopathologie des maladies alcooliques du foie, en particulier en
favorisant le stress oxydant et la nécro-inflammation (Cederbaum et al., 2009; French, 2013;
Oneta et al., 2002; Song, 1996; Zhukov and Ingelman-Sundberg, 1999). De façon
intéressante, des travaux récents suggèrent que le CYP2E1 pourrait également jouer un rôle
dans la stéatose hépatique induite par l’intoxication alcoolique (Chen et al., 2014; Wu et al.,
2010). Cette induction du CYP2E1 explique également pourquoi les sujets alcooliques
présentent un risque accru d’hépatotoxicité au paracétamol, même en absence de
surdosage (Emby and Fraser, 1977; Jaya et al., 1993; Manchanda et al., 2013). En effet, dans
ce contexte toxicologique, une plus grande quantité de NAPQI est générée par le CYP2E1
hépatique. Néanmoins, une étude de 2007 suggère que l’ingestion d’alcool de façon
concomitante à un surdosage en paracétamol est associée à un risque plus faible
d’hépatotoxicité induite par ce médicament (Waring et al., 2008). Cela pourrait s’expliquer
par la moindre production de NAPQI due à une compétition entre l’alcool et le paracétamol
pour le CYP2E1.
• Autres facteurs
Inflammation et cytokines
Différentes investigations expérimentales ont montré que des situations
d’inflammation aiguë entraînent une diminution de l’expression et de l’activité du CYP2E1
(Projean et al., 2005; Rockich and Blouin, 1999; Sewer et al., 1996). Cet effet, qui est en fait
retrouvé pour d’autres CYPs, semble la conséquence de la surproduction de cytokines pro-
inflammatoires comme l’IL-1α, l’IL-1β, l’IL-6 et le TNFα (Abdel-Razzak et al., 1993; Hakkola et
al., 2003; Peng and Coon, 2000). Des investigations sur des hépatocytes humains en culture
primaire ont montré que l’IL-4, une cytokine anti-inflammatoire, induit significativement
l’expression du CYP2E1 ainsi que celle des GSTs (Glutathion S Transférases), alors que cette
cytokine inhibe la plupart des CYPs (Abdel-Razzak et al., 1993). Wang et coll. (2010) se sont
intéressés à la régulation transcriptionnelle du CYP2E1 par l’IL-4 dans la lignée d’hépatome
humain B16A2 où ils ont mis en évidence deux voies de signalisation indépendantes en
44
réponse à l’IL-4. L’IL-4 induit en effet l’expression du CYP2E1 via deux facteurs de
transcription, STAT6 (voie JAK-STAT) et NAFATc1 (voie IRS1/2), qui se fixent au niveau de la
région promotrice du gène (Wang et al., 2010).
Médicaments
Certains médicaments comme le chlorméthiazole et le disulfiram sont connus pour
altérer l’expression et/ou de l’activité du CYP2E1. Le chlorméthiazole (CMZ) est un sédatif et
un hypnotique utilisé couramment dans le traitement et la prévention de l’état de manque
des alcooliques. C’est un inhibiteur du CYP2E1 au niveau transcriptionnel, mais également au
niveau post-traductionnel, probablement par la déstabilisation allostérique de l’enzyme
(Simi and Ingelman-Sundberg, 1999). Le CMZ apparait comme un inhibiteur relativement
spécifique et efficace in vivo (Hu et al., 1994). En effet, les patients exposés au CMZ
présentent un métabolisme de la chlorzoxazone fortement inhibé (Eap et al., 1998). De
nombreuses études in vitro ont également montré que le CMZ était un puissant inhibiteur
du CYP2E1 (Simi and Ingelman-Sundberg, 1999; Wu et al., 2012). Le disulfiram est un
inhibiteur de l’acétaldéhyde déshydrogénase (ALDH) utilisé dans le traitement de
l’alcoolisme chronique. C’est également un puissant inhibiteur de l’activité du CYP2E1 in
vitro et in vivo. En effet, Frye et coll. (1999) ont mesuré une inhibition de 95% du
métabolisme de la chlorzoxazone chez les sujets prenant du disulfiram (Frye et al., 1999). Le
diéthyldithiocarbamate (DDTC), un métabolite du disulfiram, est également un inhibiteur du
CYP2E1 (Ohashi et al., 2005; Pratt-Hyatt et al., 2010). Cependant, le DDTC n’est pas
spécifique du CYP2E1 puisqu’il est capable d’inhiber d’autres CYPs comme les CYP1A1, 1A2,
2A6 et 3A4 (Eagling et al., 1998; Ono et al., 1996).
45
C. Le CYP3A4
1. Généralités sur le CYP3A4
Le gène humain du CYP3A4 a été séquencé en 1993. Il est situé sur le chromosome 7
en position q22.1. Il est composé de 13 exons et code pour une protéine de 503 acides
aminés (Hashimoto et al., 1993; Inoue et al., 1992; Jounaïdi et al., 1994; Lamba et al., 2002).
Il est à noter que les CYPs correspondant au CYP3A4 humain sont chez la souris et le rat le
Cyp3a11 et le Cyp3a2, respectivement.
Le CYP3A4 est le principal CYP au niveau hépatique puisqu’il représente 60% des CYPs
totaux dans le foie (Guengerich, 1999). Il est également retrouvé dans la prostate, le sein, le
colon, le petit et le gros intestin et dans certaines régions du cerveau (Dutheil et al., 2009;
Huang et al., 1996; Kolars et al., 1994; Lown et al., 1997; Shimada et al., 1994).
Dans le foie, le CYP3A4 est exprimé majoritairement dans les hépatocytes entourant
les veines centrales (Hata et al., 2010). C’est une enzyme microsomale localisée dans le
réticulum endoplasmique (Paine et al., 1999). Cependant, Jeon et coll. (2008) ont mis en
évidence une activité catalytique de cette enzyme dans la fraction cytoplasmique suite à
l’ajout d’un partenaire redox (CPR et b5). D’après ces auteurs, il s’agirait d’une forme de
CYP3A4 délété en partie N-terminale (Jeon et al., 2008). Le CYP3A4 n’est pas exprimé dans le
foie fœtal (Betts et al., 2015; Lacroix et al., 1997). Chez l’adulte, une grande variabilité
interindividuelle a été décrite dans la population générale (Hata et al., 2010; Ozdemir et al.,
2000), et par exemple une étude a rapporté que l’expression hépatique de la protéine
CYP3A4 pouvait varier de 5 à 376 pmol/mg de protéine microsomale (Lin et al., 2002). Cette
variabilité contribue à des différences importantes concernant les effets thérapeutiques et
toxiques des xénobiotiques. Près de 90% de cette variabilité sont accordés à des facteurs
génétiques (Ozdemir et al., 2000). Il est à noter qu’un faible nombre d’allèles altère
l’expression du CYP3A4 (Horsmans et al., 1992; Lamba et al., 2002) et que son activité
enzymatique présente une variabilité inter-ethnique (Ahsan et al., 1991; Krishna and Shekar,
46
2005; Shimada et al., 1994). Par exemple, Ashan et coll. (1991) ont remarqué une activité
réduite chez des individus originaire d’Asie du Sud vivant en Grande Bretagne comparé à des
descendant britanniques, et ce indépendamment du régime alimentaire différent (Ahsan et
al., 1991).
Du fait de la variabilité de l’activité du CYP3A4 (qu’elle soit basale ou secondaire à
l’exposition à des médicaments ou à d’autres xénobiotiques) et du nombre important de
médicaments métabolisés par cette enzyme (en métabolites toxiques ou non), il existe de
nombreuses interactions médicamenteuses impliquant ce CYP. L’aspect des effets des
xénobiotiques sur l’expression et l’activité du CYP3A4 sera évoqué plus loin.
Les modifications transcriptionnelles du CYP3A4 (et des CYPs homologues chez les
rongeurs) sont relativement bien connues, notamment sa régulation par les facteurs de
transcription HNF-4α (Hepatocyte Nuclear Factor-4α) (Jover et al., 2001; Kamiyama et al.,
2007), PXR (Pregnane X Receptor), CAR (Constitutive Androstane Receptor) (Krishna and
Shekar, 2005; Luo et al., 2002; Martínez-Jiménez et al. , 2007), et PPARα (Peroxisome
Proliferator-Activated Receptor α) (Thomas et al., 2013). Le promoteur du gène du CYP3A4
contient de nombreux sites de fixation de facteurs de transcription tels que HNF-4α, Oct-1
(Octamer-Binding Protein 1), un élément de réponse aux glucocorticoïdes (GRE) ainsi que
des séquences d’éléments de réponse aux récepteurs des œstrogènes (Hashimoto et al.,
1993; Itoh et al., 1992). Il est à noter que HNF-4α peut interagir avec PGC-1α (Proliferator-
Activated Receptor γ Coactivator-1α) au niveau du promoteur du Cyp3a11 et que cette
interaction peut être diminuée par SREBP-2 (Sterol Regulatory Element Binding Protein-2),
un facteur de transcription qui est activé lorsque les niveaux cellulaires de cholestérol sont
faibles (Inoue et al., 2011). De façon intéressante, une étude a montré que l’expression du
CYP3A pouvait être aussi contrôlée par SREBP-1, un facteur de transcription activé au niveau
hépatique par l’insuline (Roth et al., 2008). En particulier, la surexpression de SREBP-1 inhibe
la transcription du CYP3A4 via son interaction directe avec CAR et PXR. Ainsi, l’expression
génique du CYP3A4 peut être régulée directement ou indirectement par de nombreux
facteurs comme des hormones, des dérivés endogènes et des xénobiotiques, ce qui peut
47
expliquer, en plus du polymorphisme génétique, la grande variabilité interindividuelle de
l’activité du CYP3A4.
Les régulations post-transcriptionnelles quant à elles sont peut élucidées, mis à part
l’inhibition de l’expression du CYP3A4 par certains microARNs (Koturbash et al., 2012; Wei et
al., 2014). Takagi et coll. (2008) rapportent par exemple que le CYP3A4 serait indirectement
régulé par miR-148a, qui contrôlerait la régulation du facteur de transcription PXR (Takagi et
al., 2008). Une étude récente de 2014 a également mis en évidence que le miR-223 était
capable de réduire l’activité du CYP3A4 dans des cellules HepG2 surexprimant ce microARN
sans affecter l’expression protéique du CYP3A4. Cette inhibition de l’activité se ferait via
l’inhibition de l’expression protéique du cytochrome b5 (Takahashi et al., 2014). Lamba et
coll. (2014) identifient de plus miR-34a comme étant un microARN régulant fortement
l’expression (ARNm) du CYP3A4 et de différents facteurs de transcription hépatiques comme
HNF4α. Ils suggèrent que miR-34a peut réguler directement ou indirectement l’expression
du CYP3A4. Dans cette étude, ces auteurs ont de plus observé que les hommes exprimaient
plus fortement le miR-34a hépatique, et avaient une activité du CYP3A4 moindre comparés
aux femmes (Lamba et al., 2014). Enfin, grâce à une modélisation mathématique et des
approches expérimentales complémentaires, Wei et coll. (2014) ont montré que le CYP3A4
pourrait être également régulé dans le foie de façon post-transcriptionnelle par hsa-miR-
577, hsa-miR-1, hsa miR-532-3p et hsa miR-627 (Wei et al., 2014).
2. Les substrats endogènes et exogènes du CYP3A4
Le CYP3A4 peut métaboliser un large spectre de dérivés exogènes, mais également
des molécules endogènes. Il joue un rôle fondamental dans le métabolisme des
xénobiotiques puisqu’on estime qu’il métabolise plus de 50% des médicaments
(antibiotiques, anesthésiques, antihistaminique, corticostéroïdes, statines,
immunosuppresseurs…) dont plus de 100 sont actuellement connus (Tab. 4) (Rendic, 2002).
Certains pesticides comme le parathion et le malathion peuvent être également métabolisés
par le CYP3A4 (Butler and Murray, 1997; Josse et al., 2014). Enfin, le CYP3A4 est également
48
capable de métaboliser des dérivés endogènes tels que les stéroïdes naturels comme la
testostérone et la progestérone (Guengerich, 1999; Pelkonen et al., 1998).
• Le paracétamol
Bien que le CYP2E1 soit majoritairement responsable du métabolisme du
paracétamol en NAPQI, des études indiquent que le CYP3A4 est également impliqué dans
cette biotransformation, que cela soit chez les rongeurs ou l’Homme (Patten et al., 1993). Le
métabolisme du paracétamol par le CYP3A4 sera développé dans la partie suivante.
• La testostérone
De nombreuses études sur microsomes de foies humains ont démontré que des
inhibiteurs sélectifs du CYP3A4 diminuaient l’hydroxylation de la testostérone en 6β-
hydroxytestostérone (Bourrié et al., 1996; Newton et al., 1995; Wrighton et al., 1989). Des
anticorps anti-CYP3A4 ont également été utilisés pour démontrer la relation entre l’activité
du CYP3A4 et cette hydroxylation de la testostérone. En effet, l’utilisation d’un anticorps
monoclonal anti-CYP3A4 diminue très fortement l’hydroxylation de la testostérone en 6β-
hydroxytestostérone (Mei et al., 1999; Shou et al., 2000). De nombreux travaux in vitro
utilisent ainsi la biotransformation de la testostérone en 6β-hydroxytestostérone comme
marqueur d’activité du CYP3A4 (Racha et al., 2003).
49
Tableau 4: Médicaments substrats du CYP3A4 (stéroïdes inclus) (d’après Guengerich, 1999).
50
3. Altération de l’expression et/ou de l’activité du CYP3A4 en conditions
physiopathologiques
• Obésité et NAFLD
Malgré l’importance et la prédominance du CYP3A4 au niveau hépatique, très peu
d’études se sont intéressées à cette enzyme dans le contexte physiopathologique de
l’obésité et des NAFLD, qui pourtant représente aujourd’hui un enjeu majeur de santé
publique. Néanmoins, quelques études expérimentales et cliniques suggèrent que
l’expression et l’activité enzymatique du CYP3A4 seraient réduites au niveau hépatique au
cours de ces maladies dysmétaboliques (Tab. 5).
Concernant les investigations cliniques, les auteurs ont constaté en général une
diminution de l’expression protéique et de l'activité du CYP3A4 (Brill et al., 2012; Donato et
al., 2007; Fisher et al., 2009; Kolwankar et al., 2007; Weltman et al., 1998). Certaines de ces
études rapportent des diminution d’activité du CYP3A4 dans des foies stéatosiques pouvant
atteindre 50% par rapport à des foies sains (Donato et al., 2007; Kolwankar et al., 2007). En
revanche, Niemelä et coll. (2000) ont observé par immunohistochimie une augmentation
protéique du CYP3A4 chez des patients obèses ou diabétiques par rapport à des sujets en
phase précoce de maladie alcoolique du foie. Cependant, il est à noter que ces résultats sont
difficiles à interpréter car les auteurs n’ont pas inclus dans l’étude des sujets sains (Niemelä
et al., 2000).
Concernant les investigations expérimentales chez l’animal, plusieurs études ont
également constaté une diminution hépatique du CYP3A4 suite à un régime riche en lipides,
que ce soit chez le cobaye (Patoine et al., 2013), chez la souris (Ghose et al., 2011; Yoshinari
et al., 2006), chez le rat ou encore chez le canard (Leclercq et al., 1998). Ainsi, Ghose et coll.
(2011) ont mis en évidence une diminution de l’expression (protéine et ARNm) et de
l’activité hépatique du Cyp3a11 (analogue murin du CYP3A4) chez des souris nourries avec
un régime riche en graisses. Cette inhibition est accompagnée d’une diminution des ARNm
de PXR et CAR et d’une augmentation de l’expression de cytokines telles que Il-1β, Il-6 et
51
TNFα (Ghose et al., 2011). Par contre, Li et coll. (2011) ont quant à eux observé une nette
augmentation des ARNm du Cyp3a2 hépatique chez des rats nourris par un régime riche en
graisses (Li et al., 2011). La discordance de cette étude avec les autres pourrait être due à
différents facteurs comme la composition du régime riche en graisse et la durée d’exposition
à ce régime.
Auteurs Conditions physiopathologiques investigations ARNm Protéines Activité
Weltman et al.,
1998
Foies au stade NASH (50% de sujets
obèses) versus foies sains (IMC des
patients non précisé)
Immunohistochimie - ↘ -
Donato et al.,
2006
Foies stéatosés versus foies sains (IMC des patients non précisé)
Microsomes - - ↘ ca 50%
Culture primaire - - ↘ ca 50%
Donato et al.,
2007
Foies stéatosés versus foies sains (IMC des patients non précisé)
Culture primaire - - ↘ ca 50%
Kolwankar et
al., 2007
Foies stéatosés (non-alcoolique) versus foies sains (IMC des patients non
précisé)
Homogénat total ↘ ca 40% - -
Microsomes - ↘ ca 30%
↘ ca 50% stéatose légère
↘ 70% stéatose modérée
Fisher et al.,
2009
Foies stéatosés ou au stade NASH versus foies sains (IMC des patients non
précisé)
Homogénat total → - -
Microsomes -
→ stéatose
↘ ns NASH
→ stéatose
↘ ns NASH
Bell et al.,
2010
Patients obèses ayant suivis une chirurgie bariatrique : comparaison
avant leur perte de poids Immunohistochimie - → -
Tableau 5: Altération de l’expression et/ou de l’activité du CYP3A4 lors de la stéatose et de
la NASH dans des foies humains.
52
D’autres études ont été effectuées avec des modèles expérimentaux d’obésité et de
stéatose plus particuliers. Par exemple, Su et coll. (1999) ont étudié des rats nourris avec un
régime standard ou un régime riche en sucrose, supplémenté ou non en l’acide orotique,
connu pour induire une stéatose microvésiculaire. Dans cette étude, seul le régime riche en
sucrose supplémenté en acide orotique induisait une accumulation intrahépatique de lipides
(phospholipides, triglycérides et cholestérol) qui était accompagnée d’une réduction de
l’activité hépatique du Cyp3a2 (Su et al., 1999). Vornoli et coll. (2014) ont quant à eux
travaillé sur un modèle de rats nourris avec un régime riche en graisses supplémenté en
streptozotocine, rendant ainsi ces rats obèses et diabétiques. Ces auteurs ont observé une
tendance à l’augmentation protéique et de l’activité du Cyp3a2 chez ces rats (Vornoli et al.,
2014).
Enfin, concernant les investigations in vitro, 4 études sur hépatocytes humains ont
évalué l’effet individuel de certains acides gras sur le CYP3A4 (Tab. 6). Madec et coll. (2011)
ainsi que Hu et coll. (2014) ont montré que l’acide linoléique augmentait l’expression des
ARNm ou l’activité du CYP3A4 (Hu et al., 2014; Madec et al., 2011).En revanche, alors que
l’acide oléique semble diminuer les ARNm du CYP3A4 dans l’étude d’Anthérieu et coll.
(2011), il augmente l’activité de l’enzyme dans l’étude de Hu et coll. (2014) (Anthérieu et al.,
2011; Hu et al., 2014). Ainsi, ces résultats semblent indiquer que le CYP3A4 pourrait être
régulé de façon différentielle en fonction du type d’acides gras, avec notamment certains
acides gras qui induiraient son expression tandis que d’autres pourraient la diminuer. Il est à
noter à ce sujet que l’augmentation de l’expression du CYP3A4 par certains acides gras (ou
certains lipides) pourrait être la conséquence d’une activation de PPARα (Thomas et al.,
2013). On ne peut pas exclure cependant que les différentes conditions de culture
(notamment des concentrations différentes d’insuline et de DMSO) aient pu également
influencer l’expression et/ou l’activité du CYP3A4 dans les différentes études citées ci-
dessus. Ainsi, d’autres études seraient nécessaires afin de mieux caractériser les effets des
acides gras et d’autres types de lipides sur l’expression et l’activité du CYP3A4.
53
Tableau 6: Régulation du CYP2E1 par les AG dans des hépatocytes humains in vitro. C16:0 acide palmitique ; C18 :0 acide stéarique ; C18:1 acide oléique ; C18:2 acide linoleïque ; ns :non significatif.
• Diabète de type 1 et de type 2
En ce qui concerne le diabète de type 2, il n’y a, à notre connaissance, qu’une seule
étude chez l’Homme ayant rapporté les effets de cette pathologie sur le CYP3A4 hépatique.
En effet, une étude publiée en 2011 et réalisée sur des foies humains a révélé que les ARNm,
l’expression protéique et l’activité du CYP3A4 étaient significativement diminuées dans les
foies de sujets diabétiques (Dostalek et al., 2011).
En revanche, plusieurs études ont été réalisées sur les rongeurs présentant un
diabète de type 2. Oh et coll. (2012) ont rapporté une augmentation de l’expression
protéique et de l’activité du Cyp3a2 chez des rats Goto-Kakizaki (rats GK) et Patoine et coll.
(2014) ont observé une augmentation significative de l’expression (ARNm et protéine) et de
Auteurs Models Acides gras temps Concentration ARNm Proteines Activité
Madec et al.
2011
HepaRG
sans DMSO 5µg/ml insuline
C18:2 24h
50µM → - -
100µM ↗ ns - -
200µM ↗ ca 50% - -
Donato et al.
2006
Hépatocytes primaires
humains
0,06µg/ml insuline (10-8M)
Mélange de C18:1/C16:0
(2:1) 14h
500µM total ↘ ns - ↘ ns
1mM total ↘ ca 30% - ↘ ca 40%
2mM total - - ↘ ca 50%
Anthérieu et
al.
2011
HepaRG
2%DMSO 5µg/ml insuline
C18:1
24h 250µM ↘ ns - -
500µM ↘ ca 38% - -
48h 500µM - → -
14 jours
250µM ↘ ns - -
500µM ↘ ns ↗ ca 30% -
Hu et al.
2014
HepG2
Sans insuline
C16:0
48h
50µM - - ↗ ca 20%
100µM - - ↗ ca 23%
200µM ↗ ca 110% ↗ ca 70% ↗ ca 24%
C18 :0 100µM - - ↗ ca 15%
200µM - - ↗ ca 57%
C18 :1
50µM - - →
100µM - - ↗ ca 35%
200µM ↗ ca 62% ↗ ca 57% ↗ ca 36%
C18:2 100µM - - ↗ ca 15%
200µM - - ↗ ca 44%
Fa2N-4
Sans insuline
C16:0
48h 200µM
- - ↗ ca 75%
C18:0 - - ↗ ca 60%
C18:1 - - ↗ ns
C18:2 - - ↗ ca 115%
54
l’activité du Cyp3a11 pour des souris db/db, accompagnée d’une augmentation de PXR et
CAR (Oh et al., 2012; Patoine et al., 2014). Par contre, une diminution de l’activité du
Cyp3a2est rapportée chez des rats Zucker par Zaluzny et coll. (1990) (Zaluzny et al., 1990).
Concernant le diabète de type 1, plusieurs études ont rapporté les effets du diabète
de type 1 sur le CYP3A chez des rongeurs traités par la streptozotocine. Ces études ont
montré globalement une augmentation de l’expression (ARNm ou protéine) et de l’activité
du Cyp3a11 chez des souris (Chatuphonprasert et al., 2012; Patoine et al., 2014) et du
Cyp3a2 chez le rat (Hu et al., 2011; Shimojo et al., 1993).
L’ensemble de ces études réalisées principalement chez les rongeurs suggère que le
glucose et/ou l’insuline pourraient modifier significativement l’expression du CYP3A.
Cependant, il existe peu de données concernant les effets de ces facteurs sur l’expression et
l’activité du CYP3A4, ou de ses homologues chez les rongeurs. Hu et coll. (2014) ont mis en
évidence que le glucose diminuait l’activité du CYP3A4 dans des hépatocytes humains alors
que l’insuline ne semblait pas modifier l’expression et/ou l’activité de cette enzyme (Hu et
al., 2014; Woodcroft and Novak, 1997). Néanmoins, Roth et coll. (2008) a montré que
l’insuline induit l’expression des ARNm du Cyp3a11 dans des hépatocytes primaires de souris
(Roth et al., 2008). Enfin, il est à noter que l’étude de Hu et al. (2014) a montré que
l’incubation d’hépatocytes humains avec du sérum de rats diabétiques entraine une
augmentation de l’activité du CYP3A4 (Hu et al., 2014). Clairement, d’autres études seraient
nécessaires afin de mieux connaitre les effets du glucose et de l’insuline sur l’expression et
l’activité du CYP3A et de déterminer s’il existe des différences entre les espèces.
• Autres situations physiopathologiques
L’expression hépatique du CYP3A4 semble être altérée lors des maladies alcooliques
du foie. Niemelä et coll. (2000) ont montré une induction protéique du CYP3A4 dans des
foies de patients alcooliques (Niemelä et al., 2000). Une étude sur hépatocytes primaires
humains montre également une induction des ARNm du CYP3A4 par l’éthanol (Kostrubsky et
55
al., 1995). Cependant, l’activité hépatique de l’enzyme ne semble pas altérée chez des
patients consommant de l’alcool modérément (Liangpunsakul et al., 2005).
Lors de l’inflammation et de l’infection, certaines cytokines sont responsables de
l’inhibition de l’expression et/ou l’activité du CYP3A4 (Aitken et al., 2006; Fardel and Le Vée,
2009). En effet, L’IL-6 et IL-1β diminue l’expression et l’activité catalytique du CYP3A4 in vitro
(Bachour-El Azzi et al., 2014; Rubin et al., 2015). L’inhibition du CYP3A4 par l’IL-6 semble
nécessiter le facteur de transcription PXR (Yang et al., 2010). Une étude chez des patients
après un stress chirurgical montre une corrélation négative entre l’induction d’IL-6 et
l’activité du CYP3A4 mesurée par une méthode non invasive (Haas et al., 2003). En revanche,
Il-18, IL-2 et IL-23 ne semble pas influencer l’expression et l’activité du CYP3A4 (Nguyen et
al., 2015; Rubin et al., 2015).
Certains xénobiotiques, en particulier des médicaments, peuvent augmenter
l’expression du CYP3A4 par activation des facteurs de transcription CAR et PXR. Pour les
médicaments, on peut citer par exemple la chlorpromazine, le phénobarbital, la rifampicine,
différentes statines (e.g. lovastatine et simvastatine), la troglitazone, l’irinotécan et le
tamoxifène (Ekins and Erickson, 2002; Faucette et al., 2007; Timsit and Negishi, 2007).
Différents inhibiteurs du CYP3A4 sont également connus, tels que le kétoconazole (Novotná
et al., 2014), le ritonavir et un de ses dérivés le cobicistat (Sevrioukova and Poulos, 2014),
ainsi que certains composés contenus dans le jus de pamplemousse (Uno and Yasui-
Furukori, 2006), ce qui peut induire des perturbations du métabolisme de nombreux
médicaments. Par exemple, l’absorption de jus de pamplemousse peut entraîner une
augmentation très importante des concentrations plasmatiques des statines par inhibition
du CYP3A4 au niveau intestinal et conduire ainsi à une toxicité accrue de ces hypolipémiants
(Dresser et al., 2000).
56
III/ Le paracétamol
A. Introduction
Le paracétamol (p-acétyl-aminophénol), aussi appelé « acetaminophen » par les
anglo-saxons, est une molécule synthétisée pour la première fois par le chimiste américain
Harmon Northrop Morse en 1878. Ses propriétés analgésiques et antipyrétiques furent
décrites en 1889 par le scientifique allemand Karl Morner, puis par le médecin allemand
Joseph Von Mering en 1893. Cependant, il fut mis de côté au profit d’autres médicaments
tels que l’acétanilide, la phénacétine et l’aspirine. Ce n’est que 50 ans plus tard, après
constatation des effets secondaires indésirables de l’acétanilide (méthémoglobinémie), de la
phénacétine (néphrotoxicité) et de l’aspirine (hémorragie, ulcère gastroduodénal, allergie),
que le paracétamol fut commercialisé.
1. Structure et propriétés chimiques
Le paracétamol est un dérivé de l’acétanilide (N-phényléthanamide). Un groupement
hydroxyle en position para le différencie de l’acétanilide. La phénacétine est également
synthétisé à partir de l’acétanilide, par ajout d’un groupement éthoxy.
Figure 9: structures chimiques de l’acétanilide, du paracétamol et de la phénacétine.
En conditions normales de température et de pression, le paracétamol est une
poudre blanche soluble dans l’alcool, l’acétone, le diméthylsulfoxyde (DMSO), mais peu
hydrosoluble et liposoluble (Prescott, 1980).
57
2. Pharmacologie
S’il est clair que le paracétamol agit au niveau du système nerveux central, son
mécanisme d’action complet n’est toutefois pas encore élucidé, et ce, plus d’un siècle après
sa découverte et de sa mise sur le marché. Il a été souvent associé à celui des anti-
inflammatoires non stéroïdiens (AINS), dont l’aspirine et l’ibuprofène de par ses propriétés
analgésiques et antipyrétiques, mais il s’en distingue par sa faible activité anti-inflammatoire
et antiplaquettaire.
Les activités thérapeutiques du paracétamol sont complexes et impliquent
probablement plusieurs voies ( Anderson, 2008). Comme les AINS, le paracétamol bloquerait
la production des prostaglandines en inhibant les cyclooxygénases synthases centrales
(Graham and Scott, 2005). D’autre part, un de ses métabolites actifs, la N-
arachidonoylphénolamine (ou AM404) agirait sur les récepteurs cannabinoïdes CB1 situées
dans le système nerveux central (Högestätt et al., 2005). Ces récepteurs sont impliqués dans
les voies de thermorégulation mais également celles de la douleur. Une autre hypothèse
serait que le paracétamol exerce un effet analgésique sur le système nerveux central par une
potentialisation des neurones sérotoninergiques descendants de la moelle épinière, ceci
ayant un effet sur les voies nociceptives (Björkman, 1995; Tjølsen et al., 1991).
3. Galénique et posologies
Le paracétamol existe sous plusieurs formes galéniques : comprimé sec ou
effervescent, poudre en gélules ou sachets, sirop, suppositoire, injectable pour voie
intraveineuse.
58
Tableau 7: Posologies du paracétamol recommandées en France, d’après le dictionnaire
VIDAL.
4. Données pharmacocinétiques
L’absorption du paracétamol par l’intestin grêle après ingestion orale est rapide et
presque totale, avec une biodisponibilité d’environ 80%. La paracétamolémie thérapeutique
se situe entre 8 et 30 mg/l et les concentrations plasmatiques maximales sont atteintes 30 à
60 minutes après ingestion. Cependant, selon les formulations et le mode d’administration,
la biodisponibilité ainsi que le temps nécessaire pour atteindre la concentration plasmatique
maximale peuvent légèrement varier. Le paracétamol se distribue rapidement dans tous les
tissus avec un volume de distribution proche de 1l/kg et les concentrations sont
comparables dans le sang, la salive et le plasma. Du fait de sa faible liposolubilité et de sa
faible liaison aux protéines plasmatiques, son imprégnation dans le tissu adipeux semble
être relativement faible. Le paracétamol est connu pour traverser la barrière hémato-
encéphalique et le placenta.
Après absorption gastro-intestinale, le paracétamol entre dans la circulation entéro-
hépatique afin d’être métabolisé principalement par le foie. Son élimination est
essentiellement urinaire. Environ 90% de la dose ingérée sont éliminés par le rein en 24
heures, majoritairement sous forme glucuronoconjuguée et sulfoconjuguée pour seulement
5% sous forme inchangée. La demi-vie d’élimination est comprise entre 1,5 à 3h mais celle-ci
peut augmenter en cas d’insuffisance hépatique sévère ou de surdosage (Marzuillo et al.,
2014; Prescott, 1980).
Dose thérapeutique
par 24 heures
Dose maximale recommandée
par 24 heures
Adultes et enfants de plus de 15
ans (≥ 50kg) 3 x 1g espacés de 4 heures
4g en 4 prises espacées de 6 heures
Entre 38-50kg 3 x 1g espacés de 6 heures 3g
Enfants et nourissons (≤38kg)
60 mg/kg/jour en 4 prises soit 15 mg/kg toutes les 6 heures ou 10 mg/kg toutes les 4 heures
80 mg/kg
59
Il est intéressant de noter que certaines études ont comparé la pharmacocinétique
du paracétamol entre des patients adultes obèses et non obèses (Abernethy et al., 1982;
Abernethy and Greenblatt, 1982). Dans ces travaux, le volume de distribution et la clairance
sont augmentés. Une autre étude, réalisée chez des enfants obèses pour qui une
stéatohépatopathie a été diagnostiquée, ne montre en revanche pas de différences
pharmacocinétiques avec des enfants sains, en particulier concernant la clairance (Barshop
et al., 2011).
60
B. Métabolisme
Le métabolisme du paracétamol a lieu essentiellement au niveau hépatique, par les
hépatocytes. Les deux voies métaboliques principales sont la glucuronoconjugaison (50-70%)
et la sulfoconjugaison (25-35%) (Fig. 10). En effet, 90% d’une dose normale ingérée sont pris
en charge par des enzymes de conjugaison, glucurotransférases et sulfotransférases, qui
greffent un groupement glucuronide ou sulfate à la molécule mère pour la rendre plus
hydrophile afin de faciliter l’élimination biliaire et urinaire du médicament. Une troisième
voie métabolique est également sollicitée. En effet, environ 5% du paracétamol sont
métabolisés par les cytochromes P450 (CYPs), majoritairement le CYP2E1 et le CYP3A4, en N-
acétyl-p-benzoquinone imine (NAPQI), un métabolite hautement réactif. A dose
thérapeutique, ce dernier est rapidement détoxifié par le glutathion (GSH) sous forme d’un
conjugué 3’-S-glutathionyl-paracétamol inactif, puis éliminé dans la bile et les urines à la
suite d’une réaction de conjugaison avec la cystéine et l’acide mercapturique (Fig. 10).
Finalement, une quatrième voie hépatique mineure de biotransformation aboutissant à la
formation de 3-hydroxy-paracétamol et de 3-méthoxy-paracétamol par les CYPs doit être
également considérée. Ces métabolites non toxiques sont rapidement éliminés par
glucurono et sulfoconjugaison (Marzuillo et al., 2014; McGill and Jaeschke, 2013; Zhao and
Pickering, 2011).
Enfin, un métabolite du paracétamol est connu pour ses propriétés
pharmacologiques, comme cela a été mentionné précédemment. En effet, le p-
aminophénol, provenant de la désacétylation hépatique du paracétamol, est conjugué au
niveau du cerveau à l’acide arachidonique par la Fatty Acid Amide Hydroxylase (FAAH) pour
former de la N-arachidonoylphénolamine (AM404) (Fig. 10) (Högestätt et al., 2005).
61
Figure 10: Les principales voies métaboliques du paracétamol après administration d’une
dose thérapeutique. Le paracétamol (APAP) est métabolisé dans le foie principalement par conjugaison à des groupements glucuronides (50 à 70% de la dose administrée) et sulfates (25 à 35%). Ces réactions sont catalysées respectivement par les UDP-glucuronosyltransférases (UGTs) et les sulfotransférases (SULTs). Une faible portion du paracétamol est prise en charge par les cytochromes P450 (CYPs), principalement le CYP2E1 et le CYP3A4, qui, par oxydation, forme le N-acétyl-p-benzoquinone imine (NAPQI). Ce métabolite très réactif est rapidement détoxifié par conjugaison au glutathion (GSH) par la glutathion-S-transférase (GST) pour former le 3’(S-glutathionyl)paracétamol qui est éliminé dans les urines. D’autres métabolites hépatiques peuvent être formés tels que le 3’-hydroxy ou 3’-méthoxy-paracétamol. L’excrétion biliaire des conjugués paracétamol-glucuronides (APAP-glucuronide) et sulfates (APAP-sulfate) est dépendante des transporteurs MRP2 (Multidrug resistance-associated protein 2) et BCRP (Breast cancer resistance protein) localisés au pôle apical des hépatocytes. L’excrétion biliaire du NAPQI-GSH requiert également MRP2. L’excrétion basolatérale vers les sinusoïdes sanguins dépend plutôt de MRP3 pour le paracétamol-glucuronide et de MRP2 / MRP4 pour le paracétamol-sulfate. Une autre voie métabolique, en partie responsable de l’activité analgésique, est la formation dans le cerveau du N-arachidonoylphénolamine (AM404). Après désacétylation hépatique du paracétamol en p-aminophénol, ce dernier est conjugué à un acide arachidonique par la fatty acid amide hydroxylase (FAAH) pour former l’AM404.
62
1. Les réactions de phase 1 et les cytochromes P450
Les réactions de phase 1 impliquent la biotransformation d’une molécule en un
métabolite polaire qui peut être éliminé directement, ou poursuivre les processus de
métabolisation par la phase 2. Il s’agit de réaction d’oxydation, de réduction, ou d’hydrolyse
impliquant majoritairement les CYPs, enzymes exprimées principalement dans le réticulum
endoplasmique mais également localisées au niveau mitochondrial (Bansal et al., 2013;
Matsuura et al., 1978; Robin et al., 2001). Les réactions catalysées par les CYPs consomment
du NADPH ainsi que de l’oxygène moléculaire.
RH + O2 +H+ + NADPH → ROH + H2O + NADP+
Au cours du métabolisme du paracétamol, les CYPs oxydent le médicament et forme
le NAPQI, qui est responsable de la toxicité hépatique (Dahlin et al., 1984; Gillette, 1981;
Potter and Hinson, 1987). Les principaux CYPs impliqués sont les CYP2E1 et le CYP3A4, mais
d’autres CYPs pourraient également être impliqués, tels que le CYP1A2 et 2D6 (Patten et al.,
1993; Raucy et al., 1989; Thummel et al., 1993; Wolf et al., 2007; Zaher et al., 1998).
2. Les réactions de conjugaison
Les réactions de conjugaison, ou réactions de phase 2, ont pour but de neutraliser les
groupements réactifs (thiol, amine, aldéhyde) d’une molécule ou de son métabolite, issus
d’une réaction de phase 1) et de rendre cette molécule plus hydrophile et donc facilement
éliminable par les liquides biologiques. Ces réactions sont catalysées par des enzymes de
phase 2 qui transfèrent un groupement polaire d’origine endogène sur un groupement
fonctionnel du xénobiotique, du substrat endogène ou de son métabolite. Les groupements
de conjugaison peuvent être des substrats hydrophiles (acide glucuronique, sulfurique ou
acétique), des acides aminés (glutamine, glycocolle), ou d’autres substrats tels que le
glutathion (GSH) ou la carnitine. Ces réactions sont catalysées par différentes transférases.
63
Le métabolisme du paracétamol fait intervenir trois types de conjugaison : la
glucuronoconjugaison, la sulfoconjugaison et la conjugaison au glutathion.
• La glucuronoconjugaison
La glucuronoconjugaison consiste en l’ajout d’un acide glucuronique, provenant de
l’acide uridine-5’-diphosphoglucuronique (UDPGA) à un groupement hydroxyle, carboxyle ou
amine d’une molécule cible. Ces réactions sont catalysées par des UDP-
glucuronosyltransférases (UGTs), protéines microsomales transmembranaires
principalement exprimées dans le foie, mais également dans les reins, la muqueuse
intestinale, la peau et les poumons (Buckley and Klaassen, 2007; Tukey and Strassburg,
2000). Les UGTs appartiennent à la superfamille des UDP-glycosyltransférases. Il existe une
vingtaines d’UGTs fonctionnelles chez l’Homme, subdivisées en quatre familles (UGT1, UGT2,
UGT3 et UGT8) (Mackenzie et al., 2005).
Dans le cas du paracétamol, la glucuronoconjugaison représente la voie majeure de
biotransformation chez l’adulte tandis que la sulfoconjugaison prédomine dans les
premières années de la vie (Van der Marel et al., 2003). Trois UGTs sont principalement
impliquées dans l’ajout d’une molécule de D-glucuronate sur le groupement hydroxyle du
paracétamol, pour former un ester-O-glucuronide : UGT1A6 qui a une forte affinité pour le
paracétamol (Km=2 mM) mais une faible capacité enzymatique, UGT1A9 qui, malgré sa
faible affinité pour la molécule (Km=50 mM), présente une forte capacité enzymatique, et
UGT1A1 qui possède une affinité (Km=9 mM) et une capacité enzymatique intermédiaires
(Court et al., 2001).
L’expression des UGTs peut être régulée selon différents facteurs : le sexe, le poids
et/le statut nutritionnel, l’exposition à des polluants environnementaux ou à des
médicaments. Certains de ces facteurs seront discutés plus en détail ci-dessous.
En ce qui concerne les xénobiotiques, l’expression de l’UGT1A6 est par exemple
augmentée via l’activation du récepteur AhR (Aryl hydrocarbon Receptor) chez les gros
64
fumeurs mais également via l’activation des facteurs de transcription CAR (Constitutive
Androstane Receptor) et PXR (Pregnane X Receptor) chez des patients traités par des
inducteurs enzymatiques de type phénobarbital, phénytoïne ou rifampicine (Bock and Bock-
Hennig, 2010).
Concernant le statut nutritionnel, il a été montré par exemple qu’un régime
hypercalorique, associé à une accumulation de triglycérides hépatiques et une augmentation
du poids corporel, induit l’expression des UGT1A1, 1A6 et 1A7 chez des rats mâles (Osabe et
al., 2008). Ce régime est également responsable d’une production accrue de conjugués
glucuronidés dans le plasma après un traitement au paracétamol chez ces mêmes rats
(Osabe et al., 2008). Des résultats similaires ont été mis en évidence sur des rongeurs
présentant une obésité d’origine génétique, comme par exemple les souris ob/ob (Aubert et
al., 2012; Xu et al., 2012) et les rats Zucker (Chaudhary et al., 1993). Chez l’Homme, la
glucuronoconjugaison du paracétamol semble également augmentée chez les patients
obèses et chez ceux présentant une stéatohépatopathie non alcoolique (Abernethy et al.,
1982; Barshop et al., 2011). Cependant, une étude plus récente menée chez des patients
présentant une stéatohépatopathie liée à l’obésité ne montre pas d’augmentation de la
glucuronidation du paracétamol, malgré une expression plus forte de certaines isoformes
d’UGTs au niveau hépatique (Hardwick et al., 2013).
• La sulfoconjugaison
Le transfert d’un groupement sulfate du « donneur » 3’-phosphoadénosine-
5’phosphosulfate (PAPS) à un «accepteur » par une sulfotransférase (SULT) représente la
réaction de sulfoconjugaison. Les SULTs sont retrouvées principalement au niveau du foie,
mais également dans les reins, les intestins et les poumons (Riches et al., 2009). Treize
isoformes cytosoliques des SULTs sont connues chez l’Homme, organisées en 4 familles
(Lindsay et al., 2008). Contrairement à la glucuronidation, cette voie est rapidement
saturable de par l’activité des SULTs ainsi que la disponibilité du PAPS, co-substrat de la
réaction (Boles and Klaassen, 2000).
65
Chez l’Homme, la sulfatation du paracétamol sur le groupement hydroxyle est
principalement due à SULT1A1, SULT1A3/4, SULT1E1 et SULT2A1 avec un Km de 2,4 mM, 1,5
mM, 1,9 mM et 3,7 mM, respectivement (Adjei et al., 2008).
Des polymorphismes génétiques du gène SULT1A1 chez l’Homme définissent 3
allèles (SULT1A1*1, SULT1A1*2 et SULT1A1*3). Leur fréquence diffère selon les
populations : le variant *1 est prédominant chez les orientaux (Chinois et Japonais), alors
que le variant *3 est majoritaire dans la population afro-américaine. Le variant *2, associé à
une plus faible activité enzymatique, est exprimé de manière équivalente au sein des
populations caucasiennes et afro-américaines (Coughtrie, 2002).
Actuellement, l’influence de l’obésité et des stéatohépatopathies associées sur la
sulfatation du paracétamol n’est pas clairement déterminée. En effet, les investigations chez
le rongeur et l’Homme ont données des résultats très contradictoires (Aubert et al., 2012;
Chaudhary et al., 1993; Corcoran et al., 1987; Hardwick et al., 2013).
• La conjugaison au glutathion
Le glutathion est un antioxydant endogène intervenant dans de nombreuses
réactions de détoxification et d’élimination d’espèces réactives de l’oxygène (ERO). Il joue un
rôle majeur dans le métabolisme du paracétamol car il permet la détoxification du NAPQI
(Mitchell et al., 1973). La réaction de conjugaison de ce métabolite réactif au groupement
thiol de la cystéine du glutathion, qui génère le 3-(glutathion-S-yl)paracétamol, est soit
spontanée soit catalysée par les glutathion-S-transférases (GSTs) (Coles et al., 1988; Dahlin
et al., 1984). Il est à noter que cette conjugaison du NAPQI au glutathion est très rapide,
mais également très limitée car les stocks cellulaires de glutathion sont vite saturables.
Différentes situations physiopathologiques peuvent réduire significativement les
concentrations basales de glutathion dans le foie telles que la malnutrition, le jeûne
prolongé et l’intoxication alcoolique chronique. En conséquence, ces situations favorisent
grandement l’hépatotoxicité du paracétamol (Bonkovsky et al. , 1994; Lauterburg and Velez,
1988; Wendel et al., 1979; Zhao et al., 2002).
66
Certaines études ont montré que les stéatohépatopathies liées à l’obésité peuvent
être également associées à une réduction des taux intra-hépatiques de glutathion, surtout
lorsque cette pathologie est au stade de la NASH (Begriche et al., 2013; Videla et al., 2004).
Cependant, au cours de la NASH, il semble que la déplétion en glutathion soit moins sévère
comparée aux autres situations physiopathologiques citées plus haut.
3. Le métabolisme de phase 3
Les conjugués du paracétamol résultant de la phase 1 et 2 du métabolisme sont
excrétés des hépatocytes via des transporteurs. L’excrétion biliaire des conjugués
paracétamol-glucuronide ainsi que des conjugués sulfates est dépendante des transporteurs
MRP2 (Multidrug Resistance-associated Protein 2) et BCRP (Breast Cancer Resistance
Protein) localisés au pôle apical des hépatocytes. L’excrétion biliaire du paracétamol-GSH
requiert également MRP2. L’excrétion basolatérale vers les sinusoïdes sanguins dépend
plutôt de MRP3 pour le paracétamol-glucuronide et de MRP2 / MRP4 pour le paracétamol-
sulfate.
Lors de la NASH, l’expression de ces transporteurs peut être modifiée (Cheng et al.,
2008; Halilbasic, Claudel and Trauner, 2013; Pizarro et al., 2004). Ainsi, l’élimination des
conjugués du paracétamol par la bile et les urines peut être altérée lors de la NASH. En effet,
Lickteig en 2007 a démontré qu’une NASH chez le rat était associée à une augmentation de
l’expression de MRP3, MRP4 et BCRP (ARNm et protéines) et à une diminution de l’excrétion
biliaire du paracétamol-glucuronide, du paracétamol-sulfate et du paracétamol-GSH
(Lickteig et al., 2007). Plus récemment chez l’Homme, Canet et coll. (2015) ont également
montré chez des patients souffrant de NASH sévère une induction hépatique de MRP3 et
une altération de la localisation intra-hépatocytaire de MRP2. De façon intéressante,
l’augmentation de l’expression de MRP3 pourrait expliquer, au moins en partie, pourquoi les
concentrations plasmatiques de paracétamol-glucuronide sont augmentées dans le contexte
d’une NAFLD (Barshop et al., 2011; Canet et al., 2015). Une autre explication pourrait être
également une augmentation de l’expression hépatique des UDP-glucuronosyltransférases,
comme indiqué précédemment (Osabe et al., 2008).
67
C. Toxicité hépatique du paracétamol
L’intoxication aiguë au paracétamol, qu’elle soit volontaire ou non, est actuellement
la première cause d’insuffisance hépatique aiguë aux Etats-Unis, au Royaume-Uni, en Suède
et dans de nombreux autres pays (Bernal et al., 2010; Larson et al., 2005; Megarbane et al.,
2007; Ostapowicz et al., 2002; Shi et al., 2011). Les premiers cas d’hépatotoxicité liés au
paracétamol ont été rapportés en 1966 (Davidson and Eastham, 1966; Thomson and
Prescott, 1966). Quelques années plus tard, le groupe de recherche dirigé par Bernard B.
Brodie s’est intéressé aux lésions induites par de fortes doses de paracétamol chez les
rongeurs ainsi qu’aux mécanismes de toxicité impliqués. Leurs travaux ont mis en évidence
différents évènements tels que la formation de plages de nécrose centrolobulaire, la
bioactivation du paracétamol par des enzymes microsomales, la formation d’un métabolite
réactif (le NAPQI) et la corrélation entre la quantité d’adduits NAPQI-protéines et le
développement d’une toxicité (Jollow et al., 1973; Mitchell et al., 1973; Potter et al., 1973).
Ces travaux ont également identifié le rôle critique du glutathion (GSH) dans la détoxification
de NAPQI (Mitchell et al.,1973).
La toxicité hépatique du paracétamol est caractérisée par une nécrose
centrolobulaire accompagnée d’une hypoxie liée à la congestion des vaisseaux hépatiques
(Walker et al, 1983) , et l’étendue de la nécrose est proportionnelle à la dose administrée
(Lee, 2003). Dans les cas extrêmes, lorsque la nécrose touche une trop grande quantité de
parenchyme hépatique, l’intoxication au paracétamol peut conduire à une hépatite
fulminante et engager le pronostic vital.
Le processus de toxicité du paracétamol conduisant à la nécrose hépatocytaire peut
être divisé en 3 phases : la phase d’initiation, la phase d’amplification et de propagation des
lésions, et la phase de réparation et de régénération tissulaire.
68
1. La phase d’initiation
L’évènement majeur à l’origine de la mort de l’hépatocyte est la bioactivation du
paracétamol en NAPQI par les CYPs, en particulier par le CYP2E1 et le CYP3A4 (Dahlin et al.,
1984; Gonzalez, 2007; Laine et al., 2009). Ainsi, tout composé capable d’induire ces 2 CYPs
favorise les lésions hépatiques dues au paracétamol, comme c’est le cas par exemple avec
l’éthanol qui induit le CYP2E1 (Wolf et al., 2007). A l’inverse, l’inhibition de ces enzymes, par
le diméthylsulfoxide (DMSO), le disulfiram ou le chlorméthiazole par exemple, protège de la
toxicité du paracétamol (Hazai et al., 2002; Lee et al., 1999; Park et al., 1988; Yoon et al.,
2006).
• Le NAPQI
La bioactivation hépatique du paracétamol par les CYPs conduit à la formation d’un
métabolite très réactif, le N-acétyl-p-benzoquinone-imine (NAPQI). Cet électrophile instable
est rapidement détoxifié par sa conjugaison au glutathion (GSH), comme précisé
précédemment (Mitchell et al., 1973; Rosen et al., 1984). Lors de la prise d’une forte dose de
paracétamol, ou au cours de situations physiopathologiques particulières, la production de
NAPQI peut excéder la capacité de conjugaison au glutathion. Ce dernier ne se restaurant
pas aussi rapidement qu’il est consommé, subit une déplétion rapide pouvant atteindre 90%.
De par son caractère électrophile et sa forte instabilité, le NAPQI se lie alors à d’autres
éléments nucléophiles de la cellule, tels que les bases puriques et pyrimidiques de l’ADN ou
les groupements thiols des protéines, formant ainsi différents adduits stables (Corcoran et
al., 1985; Jollow et al., 1973; Mitchell et al., 1973; Rogers et al., 1997; Streeter et al., 1984).
• Les adduits NAPQI-protéines
Les adduits NAPQI-protéines sont mesurables par des techniques telles que l’HPLC-
ECD (High-Performance Liquid Chromatography with Electrochemical Detection). Leur
concentration intra-hépatique est maximale environ 2 à 3 heures après l’intoxication au
paracétamol (Muldrew et al., 2002). De façon intéressante, il semblerait que ce ne soit pas la
déplétion en glutathion en elle-même qui soit responsable de la toxicité du paracétamol,
69
mais bien les liaisons covalentes du NAPQI aux protéines cellulaires. En effet, un traitement
au diéthymaléate (DEM) entraîne rapidement une déplétion du glutathion intra-hépatique
chez la souris semblable à celle obtenue avec le paracétamol, mais sans induire de nécrose
hépatocytaire (Mitchell et al., 1973). En revanche, l’administration de DEM 30 minutes avant
une forte dose de paracétamol (375 mg/kg) potentialise la formation d’adduits aux protéines
et la nécrose hépatocytaire. Enfin, la quantité d’adduits mesurées 2 heures après une
intoxication au paracétamol est corrélée chez la souris avec la sévérité de la nécrose
observée (Jollow et al., 1973).
Plusieurs protéines cibles du NAPQI ont été identifiées par des techniques
immunochimiques (Cohen et al., 1997), ou grâce au développement de la protéomique
(Hinson et al., 1996; Qiu et al. , 1998; Stamper bet al., 2011). Le NAPQI se fixe notamment
sur des protéines mitochondriales telles que la glutamate déshydrogénase (Halmes et al.,
1996), l’aldéhyde déshydrogénase, la carbamyl-phosphate synthétase-I et la sous-unité
alpha de l’ATP synthétase (Cohen et al., 1997; Myers et al., 1995; Nelson et al., 1991; Qiu et
al., 2001; Tirmenstein and Nelson, 1989). L’inactivation de certaines de ces enzymes par le
NAPQI est probablement à l’origine de l’inhibition de l’activité de la chaine respiratoire
mitochondriale (Burcham and Harman, 1991; Donnelly et al., 1994).
• La péroxidation lipidique
Malgré de nombreux arguments en faveur du rôle initiateur des adduits aux
protéines dans la cytotoxicité du paracétamol (Jaeschke et al., 2011a), cette hypothèse a été
contestée par certains chercheurs, en particulier du fait du manque de dose-réponse.
D’autres explications mécanistiques ont donc été recherchées (Jørgensen et al., 1988). Par
exemple, Wendel et ses collaborateurs ont observé chez des souris intoxiquées au
paracétamol une péroxydation lipidique massive, qui semble liée à la formation accrue
d’espèces réactives de l’oxygène (ERO) dans le foie des animaux traités (Wendel and
Feuerstein, 1981; Wendel et al., 1982; Wendel et al., 1979). Les auteurs émettent
l’hypothèse que cette péroxydation lipidique est à l’origine de la toxicité hépatique du
paracétamol. Cependant, il est à noter que ces auteurs ont nourri les animaux avec un
70
régime déficient en vitamine E et riche en acides gras polyinsaturés, ce qui les a
probablement rendus particulièrement susceptibles à la péroxydation lipidique. De plus, des
souris nourries avec un régime standard ne développent que très peu de péroxydation
lipidique après un traitement au paracétamol (Jaeschke at al., 2003), et la vitamine E ne
protège pas in vitro les cellules hépatiques vis-à-vis de sa cytotoxicité (Knight et al., 2003).
Ainsi, dans les conditions classiques d’investigations expérimentales, le rôle de la
péroxydation lipidique reste incertain dans la toxicité hépatique du paracétamol.
Figure 11: Phase d’initiation de la toxicité du paracétamol : la bioactivation. Lors d’une intoxication au paracétamol, les voies de glucuronidation et de sulfatation sont saturées. Les cytochromes P450 (CYP), en particulier le CYP2E1 et le CYP3A4, favorise l’oxydation du paracétamol (APAP) en N-acétyl-p-benzoquinone-imine (NAPQI). Ce métabolite très réactif est détoxifié par conjugaison au glutathion (GSH).Les stocks de GSH étant rapidement épuisés, le NAPQI réagit avec d’autres nucléophiles présents dans la cellule, tels que les groupements thiols des protéines. La formation des adduits NAPQI-protéine représente une étape clé dans l’initiation de la toxicité hépatique du paracétamol.
71
2. La phase d’amplification et de propagation des lésions
Comme mentionné précédemment, les protéines mitochondriales sont des cibles
privilégiées du NAPQI (Bulera et al., 1996; Cheng et al., 2008; Cohen et al., 1997; Jollow et
al., 1973; Pumford et al. , 1990; Qiu et al., 1998). La mitochondrie semble donc jouer un rôle
important dans le processus d’amplification et de propagation des lésions induites par le
paracétamol.
• Les lésions mitochondriales
Des examens au microscope électronique de foie de souris traitées au paracétamol
(600mg/kg) indiquent des altérations de la morphologie mitochondriale survenant
seulement quelques heures après administration (Placke et al., 1987).
La dysfonction mitochondriale observée au cours d’une intoxication au paracétamol
associe plusieurs évènements intervenant en 3 étapes :
Etape 1 : Initiation des lésions mitochondriales et augmentation de la production d’ERO
Cette première étape est la conséquence directe de la bioactivation du paracétamol
en NAPQI. Ce métabolite entraine une déplétion des stocks de glutathion dans le cytosol,
mais également au niveau mitochondrial (Cover et al., 2005; Knight et al. , 2001;
Ramachandran et al., 2011). A dose toxique, les adduits NAPQI-protéines ainsi que la
déplétion en glutathion mitochondrial entraînent une inhibition de la chaine respiratoire
mitochondriale (Burcham and Harman, 1991; Donnelly et al., 1994) et favorisent la
production d’ERO par la mitochondrie (Hanawa et al., 2008). En effet, comme le glutathion
est un cofacteur essentiel à la GSH-peroxydase qui détoxifie le peroxyde d’hydrogène (H2O2)
en eau dans la matrice mitochondriale (Han et al., 2003), sa déplétion favorise
l’accumulation mitochondriale d’ERO.
Les ERO ont une action directe sur la mitochondrie. Par exemple, l’anion superoxyde
(O2˙-) réagit rapidement avec l’oxyde d’azote (NO) pour former l’anion peroxynitrite
72
(ONOO˙-) (Cover et al., 2005; Hinson et al., 1998), qui est capable d’inhiber la chaîne
respiratoire (Schöpfer et al., 2000). Il est important de noter que l’inhibition de la chaîne
respiratoire, qu’elle soit directe via le NAPQI ou indirecte par les ERO, est capable
d’entrainer elle-même une production plus importante d’ERO par certains constituants de
cette chaîne, notamment par les complexes I et III (Begriche et al., 2011). L’anion
peroxynitrite peut également endommager d’autres composants mitochondriaux tels que
les membranes, des protéines anti-oxydantes comme la superoxyde dismutase à manganèse
(MnSOD) (Agarwal et al., 2011) et l’ADN mitochondrial (ADNmt) (Cover et al., 2005; J A
Hinson et al., 1998) (Fig. 12).
Il est important de savoir que l’ADNmt, codant pour 13 protéines de la chaîne
respiratoire mitochondriale, est plus fragile que l’ADN nucléaire. En effet, fixé à la
membrane interne, ce petit fragment d’ADN est très proche des sites de production d’ERO
(complexe I et III), et dépourvu d’histones protectrices. Cet ADN ne possède quasiment que
des séquences codantes et son système de réparation est moins efficace que celui de l’ADN
nucléaire (Begriche et al., 2006; Begriche et al., 2011). Cependant le rôle des altérations de
l’ADNmt dans la physiopathologie de l’hépatotoxicité du paracétamol reste encore incertain.
73
Figure 12: Lésions mitochondriales et stress oxydant induits par le NAPQI. La déplétion cytosolique et mitochondriale en glutathion (GSH) ainsi que l’inhibition de la chaine respiratoire par la formation d’adduits NAPQI-protéines entraine à l’accumulation d’ERO responsable d’un stress oxydant mitochondrial.
Etape 2 : Activation des voies cytosoliques de stress, en particulier la voie de la c-jun-N-
terminal kinase (JNK) par la génération d’ERO
Le stress oxydant généré dans la mitochondrie par la production d’ERO est capable
d’activer des voies de signalisation de stress cellulaire. C’est notamment le cas de la voie JNK
(c-Jun-N-terminal), avec un pic d’activation qui se situe environ deux heures après
l’intoxication au paracétamol (Gunawan et al., 2006; Hanawa et al., 2008; Xie et al., 2014a).
Cette activation de JNK pourrait se faire par l’intermédiaire de la kinase ASK-1 (Apoptosis
Signal-regulating Kinase 1). De plus, les ERO produites par les mitochondries semblent
activer plus précocement la GSK3β (Glycogen Synthase Kinase 3β), une kinase capable
d’initier également l’activation de JNK. Ainsi, les ERO mitochondriales pourraient activer JNK
via deux voies de signalisation : ASK-1 et GSK3β (Fig. 13) (Shinohara et al., 2010).
74
JNK est un membre de la superfamille des MAP kinases (Mitogen Activated Protein
kinase). La forme phosphorylée active de JNK peut participer à de nombreux évènements
cellulaires via la phosphorylation de facteurs de transcription tels que c-jun, p53 et ATF-2 et
celle de protéines de la famille Bcl-2 (Cheng et al., 2003; Hayakawa et al., 2004; Hibi et al.,
1993; Johnson and Nakamura, 2007; Latchoumycandane et al., 2007). JNK possède trois
isoformes : JNK1 et JNK2 exprimés de manière ubiquitaire, et JNK3 principalement exprimée
dans les neurones du système nerveux central (Sabapathy et al., 2004).
Certains travaux semblent indiquer que JNK1 et JNK2 jouent un rôle important dans
la toxicité du paracétamol. En effet, l’inhibition ou l’absence de ces deux kinases protège in
vivo de cette toxicité, sans interférer avec la bioactivation du médicament et la déplétion en
GSH (Gunawan et al., 2006; Hanawa et al., 2008; Henderson et al., 2007; Latchoumycandane
et al., 2007; Saito et al., 2010a). Cependant, l’inhibition sélective d’une seule de ces
enzymes, JNK1 ou JNK2, n’entraîne pas de protection (Bourdi et al., 2008; Saito et al.,
2010a). Au contraire, Bourdi et son équipe montrent que des souris déficientes pour JNK2
sont plus sensibles à la toxicité tardive du paracétamol (Bourdi et al., 2008). En effet, après
une dose de 300 mg/kg de paracétamol, 90% des souris KO pour le gène de JNK2 meurent
dans les 48 heures, contre 20% pour leurs homologues sauvages. Ces résultats suggèrent le
rôle bénéfique de JNK2 dans la réparation tissulaire après intoxication.
Malgré ces données, certaines investigations ne semblent pas être en faveur d’un
rôle majeur de l’activation de JNK dans certains modèles expérimentaux. Par exemple, une
étude récente chez des souris obèses ou wild-type montre que l’activation de JNK1/2 n’est
pas corrélée à la sévérité de la cytolyse hépatique (Aubert et al., 2012). En effet, 8 heures
après l’intoxication au paracétamol (500 mg/kg) l’expression de phospho-JNK1/2 était très
supérieure chez les souris ob/ob par rapport aux souris db/db et wild-type alors que la
cytolyse était significativement supérieure chez les souris db/db par rapport aux autres
groupes de souris (Aubert et al., 2012).
75
Etape 3 : Perméabilité mitochondriale et mort de l’hépatocyte
- Activation de BAX et relocalisation mitochondriale
Lorsque JNK est activé, il est capable de phosphoryler différentes protéines de la
famille Bcl-2, entraînant par exemple une inhibition des protéines anti-apoptotiques Bcl-2 et
Bcl-XL (B-cell Lymphoma-extra Large), ainsi que l’activation de la protéine pro-apoptotique
Bax (Bcl-2-Associated X protein) (Kharbanda et al., 2000; Saito et al., 2010a). Des études in
vivo chez des souris intoxiquées au paracétamol ont mis en évidence une relocalisation de
Bax du cytosol à la mitochondrie hépatique dès la première heure suivant l’administration
du médicament (Saito et al., 2010a). Bax, seul ou associé à Bad et à la forme tronquée de Bid
(tBid), est capable de former des pores dans la membrane externe de la mitochondrie (Chao
and Korsmeyer, 1998). La formation de ces pores facilite la libération précoce dans le cytosol
de protéines localisées dans l’espace inter-membranaire mitochondrial, telles que le
cytochrome c, SMAC (Second Mitochondrial Activator of Caspases), l’endonucléase G et AIF
(Apoptosis-Inducing Factor) (Adams et al., 2001; Bajt et al., 2008; El-Hassan et al., 2003;
Jaeschke and Bajt, 2006). La libération de ces protéines dans le cytosol joue un rôle dans la
survenue de la mort cellulaire. Par exemple, AIF et l’endonucléase G peuvent migrer au
noyau et participer à la fragmentation de l’ADN nucléaire (Fig.13) (Bajt et al., 2006; Bajt et
al., 2008; Jaeschke and Bajt, 2006; Kon et al., 2004; Ramachandran et al., 2011).
- Relocalisation mitochondriale de GSK3β et de phospho-JNK
Mise à part Bax, d’autres protéines peuvent subir un transfert du cytosol vers les
mitochondries, favorisant ainsi la mort cellulaire. Par exemple, la relocalisation
mitochondriale de GSK3β favoriserait le dégradation de Mcl-1 (induced Myeloid Leukemia
cell differentiation protein), une protéine anti-apoptotique de la membrane mitochondriale
(Shinohara et al., 2010). Phospho-JNK peut également se relocaliser dans la mitochondrie et
engendrer à son tour un stress oxydant par la formation d’ERO et de peroxynitrite (Hanawa
et al., 2008; Saito et al., 2010a). Le mécanisme impliqué est incertain mais il semblerait que
la liaison avec Sab, une protéine située dans la membrane externe des mitochondries, soit
nécessaire pour que phospho-JNK puisse induire la production d’ERO (Win et al., 2011).
76
Ainsi, l’intoxication au paracétamol entraîne dans la mitochondrie une dégradation ou
l’inactivation des facteurs anti-apoptotiques Mcl-2, Bcl-XL et Bcl-2, et une augmentation des
protéines pro-apoptotiques Bax (Fig. 13).
- Ouverture du pore de transition de perméabilité mitochondriale (PTPM)
L’augmentation de la production d’ERO et de peroxynitrite conduit à l’ouverture du
PTPM et à un découplage de la phosphorylation oxydative (Fig.13) (Jaeschke et al., 2012a).
En effet, les protons présents dans l’espace inter-membranaire peuvent entrer librement
dans la matrice mitochondriale sans transiter par le complexe de l’ATP synthase (ou
complexe V de la chaîne respiratoire). Ce découplage de la phosphorylation oxydative,
associé à la chute du potentiel de membrane, provoque l’arrêt de la synthèse d’ATP qui
concourt à la mort hépatocytaire par nécrose (Kon et al., 2004a; Masubuchi et al., 2005;
Ramachandran et al., 2011).
L’ouverture du PTPM provoque également un déséquilibre osmotique entre le
cytosol et la matrice mitochondriale, entraînant une entrée d’eau massive dans la
mitochondrie. Ceci a pour conséquence une augmentation du volume de la matrice
mitochondriale, un déploiement de la membrane interne et à la rupture de la membrane
externe de la mitochondrie. Cette rupture membranaire favorise non seulement la libération
de protéines pro-apoptotiques localisées dans l’espace inter-membranaire, telles que le
cytochrome c, mais également la sortie de calcium mitochondrial. Il s’ensuit alors une
augmentation de la concentration calcique cytosolique, provoquant l’activation de protéases
et d’endonucléases (Burcham and Harman, 1988; Donnelly et al., 1994; Nelson, 1990; Ray et
al., 1993; Salas and Corcoran, 1997; Tirmenstein and Nelson, 1989).
Des investigations in vivo chez la souris, et in vitro sur des mitochondries de foie de
rat, ont montré que le paracétamol induisait l’ouverture du PTPM et une libération de
calcium mitochondrial (Masubuchi et al., 2005; Moore et al., 1985; Weis et al., 1992). De
plus, des études ont montré que la toxicité du paracétamol pouvait être bloquée grâce à la
cyclosporine A, un inhibiteur de l’ouverture du PTPM. En effet, des souris prétraitées à la
77
cyclosporine A présentent une moindre augmentation des transaminases, malgré la
présence d’une déplétion en GSH, suggérant que cette molécule protectrice n’agit pas sur
l’activation métabolique du paracétamol (Beales and McLean, 1996; Haouzi et al., 2002;
Masubuchi et al., 2005). Ainsi, l’ouverture du PTPM semble être un évènement majeur
impliqué dans la physiopathologie de la toxicité hépatique induite par le paracétamol (Kon et
al., 2004a; Masubuchi et al., 2005; Reid et al., 2005). Cependant, il est important de noter
que certaines investigations in vitro montrant une ouverture du PTPM par le paracétamol
ont été réalisées en présence de calcium (Masubuchi et al., 2005), un activateur puissant du
PTPM. En revanche, en absence de calcium, ce médicament est incapable d’induire
l’ouverture du PTPM et la libération mitochondriale du cytochrome c (Porceddu et al., 2012).
Figure 13: Activation de la voie de la c-jun-N-terminal kinase (JNK) par les ERO suite à une
intoxication au paracétamol. Le stress oxydant mitochondrial favorise l’activation de JNK via ASK-1 et GSK3β, l’ouverture du pore de transition de perméabilité, la dégradation de l’ADN nucléaire et mitochondrial. Ces évènements conduisent à la mort de l’hépatocyte par nécrose.
78
• La nécrose et l’apoptose dan l’hépatotoxicité du paracétamol
Le type de mort cellulaire après intoxication au paracétamol a fait l’objet de
controverses. En effet, l’intoxication au paracétamol implique certaines caractéristiques de
l’apoptose, comme la translocation mitochondriale des protéines pro-apoptotiques Bax et
Bid (Adams et al., 2001; Bajt et al., 2008; El-Hassan et al., 2003; Jaeschke and Bajt, 2006), la
libération mitochondriale du cytochrome c (Adams et al., 2001; El-Hassan et al., 2003; Knight
and Jaeschke, 2002), l’activation de JNK (Gunawan et al., 2006; Henderson et al., 2007), la
fragmentation de l’ADN en « ladder » (Cover et al., 2005; Ray et al., 1990; Shen et al., 1991),
et la positivité des noyaux par la technique TUNEL (Terminal deoxynucleotidyl transferase-
mediated bio-dUTP Nick-End Labelling) (Gujral et al., 2002; Lawson et al., 1999). Pour ces
raisons, certains auteurs ont conclu que l’intoxication au paracétamol entraînait une mort
cellulaire par apoptose (El-Hassan et al., 2003; Hu and Colletti, 2010).
Cependant, les évènements cités ci-dessus (translocation de Bax, libération du
cytochrome c, positivité du TUNEL) ne sont pas spécifiques de l’apoptose. De plus, l’examen
anatomopathologique de foies de souris intoxiquées au paracétamol ne montre pas
d’altérations morphologiques des hépatocytes en faveur de l’apoptose : compaction de la
chromatine sous la membrane nucléaire, condensation du cytoplasme et fragmentation
cellulaire en corps apoptotiques (Fig. 14). Au contraire, les lésions cellulaires induites par le
paracétamol sont typiques de la nécrose : gonflement des cellules avec rupture de la
membrane plasmique, dégradation du noyau (caryorrhexie et caryolyse), réponse
inflammatoire (Gujral et al., 2002; Jaeschke and Lemasters, 2003) (Fig. 14). Enfin, plusieurs
études montrent qu’il n’y a pas d’activation significative des caspases, notamment la caspase
3, après intoxication au paracétamol, et que les inhibiteurs de caspases n’ont absolument
aucun effet protecteur vis-à-vis de sa toxicité (Gujral et al., 2002; Jaeschke and Bajt, 2006;
Jaeschke et al., 2011b; Lawson et al., 1999).
Il est à noter toutefois que d’autres études suggèrent le rôle significatif des caspases.
Par exemple, des investigations in vivo montrent un effet protecteur des inhibiteurs de
caspases, lorsqu’ils sont utilisés en préventif (El-Hassan et al., 2003; Hu and Colletti, 2010).
79
Cependant, ces molécules ont été dissoutes dans le DMSO, qui est lui-même un puissant
inhibiteur de l’activité enzymatique des CYPs ( Park et al., 1988), ainsi qu’un inhibiteur de la
libération de AIF dans le cytosol (Saito et al., 2010a). Même si les doses de DMSO utilisées
sont faibles, elles semblent suffisantes pour protéger entièrement de la toxicité du
paracétamol (Jaeschke et al., 2006; Jaeschke et al., 2011; Schulze-Osthoff and Bantel, 2011).
D’autres études montrent une activation de la caspase 3 après une forte dose de
paracétamol chez certaines souris non consanguines CD-1 ou Swiss Webster et non soumises
au jeûne (Antoine et al., 2009; Antoine et al., 2010; Williams et al., 2011). Malgré cette
activation, la proportion de cellules apoptotiques ne dépasse pas 0,5% des cellules
hépatiques totales alors que les auteurs observent environ 50% de cellules nécrotiques
(Williams et al., 2011). Ainsi, les cellules nécrotiques restent proportionnellement beaucoup
plus importantes suite à une intoxication au paracétamol.
Figure 14: Différences morphologiques entre la mort cellulaire par apoptose et par nécrose
observées après coloration à l’hématoxyline-éosine de coupes de foie de souris. Ces dernières ont été traitées soit par un mélange galactosamine-endotoxine (à gauche), connu pour entraîner une apoptose hépatocytaire, soit par 300 mg/kg de paracétamol pendant 6 heures (à droite). L’apoptose hépatocellulaire est caractérisée par la compaction de la chromatine sous la membrane nucléaire, la condensation du cytoplasme et la fragmentation de l’ADN. La nécrose est caractérisée par le gonflement des cellules avec rupture de la membrane plasmique et dégradation du noyau. Objectif X400 (Jaeschke et al., 2011a).
80
3. Régénération et réparation tissulaire
La réparation et les capacités de régénération du foie jouent un rôle capital dans le
pronostic vital à la suite d’une intoxication au paracétamol. En effet, le foie présente une
capacité de régénération remarquable, même lorsqu’une quantité importante de
parenchyme hépatique a été détruite ou réséquée. Néanmoins cette régénération est un
processus complexe faisant intervenir la prolifération des hépatocytes, la régénération de la
matrice extracellulaire et l’angiogenèse afin de restaurer l’ensemble de la structure et des
fonctions du foie (Mehendale, 2005).
• Prolifération cellulaire
La prolifération cellulaire à la suite d’une intoxication au paracétamol s’effectue dans
la zone de transition entre les cellules nécrosées (principalement dans la zone
centrolobulaire) et les cellules saines. Des hépatocytes quiescents entre en phase G1 du
cycle cellulaire (Bajt et al., 2003) sous l’action de différents médiateurs tels que l’IL-6
(Interleukine-6) et le TNFα, mais également de facteurs de croissance comme le VEGF
(Vascular Endothelial Growth Factor) (Chiu et al., 2003; Donahower et al., 2006; James et al.,
2003; Kato et al., 2011).
Des souris KO pour IL6, p55 (récepteur de type 1 du TNFα) ou VEGFR- (récepteur de
type 1 du VEGF) présentent une réponse régénérative altérée après un surdosage au
paracétamol (Chiu et al., 2003; James et al., 2003; T. Kato et al., 2011). Cependant, un
prétraitement des animaux à l’IL-6 ne protège pas vis-à-vis de la toxicité du paracétamol
(Bajt et al., 2003). En revanche, un traitement par une faible dose de thioacétamide, qui
force l’entrée des hépatocytes dans le cycle cellulaire, atténue les lésions induites par une
forte dose de paracétamol (Chanda et al., 1995). L’activation du cycle cellulaire et de la
régénération tissulaire sont donc des évènements importants après intoxication au
paracétamol.
81
• Rôle de l’immunité innée dans la régénération tissulaire
A la suite d’une intoxication au paracétamol, de nombreuses molécules et
composants cellulaires sont libérés des cellules nécrosées tels que les protéines HMGB1
(High-Mobility Group Box 1), des HSPs (Heat Chock Proteins) ou des fragments d’ADN
(Antoine et al., 2009; Jahr et al., 2001; Martin-Murphy et al., 2010). Ces différents
composants peuvent activer les TLRs (Toll-Like Receptors) situés à la surface des
macrophages ainsi que sur d’autres cellules non parenchymateuses. L’activation de ces
récepteurs conduits alors à la production de diverses cytokines et chimiokines (MIP-2, IL-6,
TNFα, MCP-1), en particulier grâce à l’activation du facteur de transcription NFκB (Dambach
et al., 2002; Imaeda et al., 2009), ce qui initie une réponse inflammatoire en l’absence de
pathogènes (on parle alors d’inflammation stérile) (Bianchi et al., 2007). En effet, ces
cytokines et chimiokines vont favoriser le recrutement de phagocytes (neutrophiles et
macrophages dérivés de monocytes) dans les tissus endommagés, en particulier au niveau
du foie, pour faciliter le nettoyage des cellules mortes et activer les voies de régénération
(Holt et al., 2008; Jaeschke et al., 2011a; Lawson et al., 2000).
Plusieurs équipes ont étudiés le rôle de l’activation des cellules de Kupffer
(macrophages hépatiques) dans l’intoxication au paracétamol. Certaines études ont suggéré
un rôle délétère de ces cellules car l’inhibition de leurs fonctions par un traitement au
chlorure de gadolinium diminue le stress oxydant et la production de médiateurs
cytotoxiques (Blazka et al., 1995; Laskin et al., 1995; Michael et al., 1999). Au contraire,
d’autres études sont en faveur d’un rôle bénéfique de ces cellules dans la réparation
tissulaire, en particulier par l’intermédiaire de la production de nombreux facteurs
protecteurs (IL-10, IL-6, prostaglandine E2) (Ju et al., 2002). Par exemple, l’IL-10 inhibe
l’expression de iNOS (Nitric Oxyde Synthase inductible), ce qui réduit la génération de
peroxynitrite, prévient les lésions hépatocytaires et favorise la réparation tissulaire (M
Bourdi, 2002). De plus, les prostaglandines induisent les HSPs telles que HSP70 et HSP32
(également appelée hème oxygénase 1, HO1), qui ont un rôle protecteur (Chiu et al., 2002;
Tolson et al., 2006). Ainsi, bien que des travaux supplémentaires soient encore nécessaires
82
pour évaluer le rôle exact des cellules de Kupffer dans l’hépatotoxicité du paracétamol, il est
possible que ce rôle soit différent en fonction de l’intensité des altérations hépatiques due à
la dose de paracétamol, et le contexte inflammatoire.
Figure 15: Réponse innée au cours de l’intoxication hépatique au paracétamol. La nécrose des hépatocytes suite à l’intoxication au paracétamol entraine la libération de différentes molécules capable d’activer les cellules de Kupffer. Cette activation est responsable d’une libération de cytokines et chémokines (MIP-2, IL-6, TNF-α, MCP1), générant une réponse inflammatoire stérile afin de nettoyer le foie des cellules mortes et d’activer la régénération tissulaire (Jaeschke et al., 2011a).
83
D. Prise en charge médicale de l’intoxication au paracétamol
Dans de nombreux pays, l’intoxication au paracétamol est un réel problème de santé
publique. Elle représente la principale cause d’insuffisance hépatique aiguë : 36% des cas en
Australie, 42% en Suède, 57% au Royaume-Uni, 39 à 46% aux Etats-Unis (Bernal et al., 2010;
Larson et al., 2005; Lee et al., 2008). Pour ces derniers, on dénombre plus de 100 000
intoxications par an, responsables en moyenne de 56 000 prises en charge médicales et de
500 décès (Lee, 2007; Nourjah et al., 2006). En France, le paracétamol est le médicament le
plus fréquemment impliqué dans les tentatives de suicide (Villa et al., 2008).
Bien que la majorité des intoxications au paracétamol soient volontaires, de récents
rapports rappellent qu’un quart des cas sont accidentels et associés à un fort taux de
mortalité. Ces intoxications involontaires peuvent être la conséquence de prises répétées de
doses supra-thérapeutiques de paracétamol et sont favorisées par la multitude de
spécialités pharmaceutiques existant sur le marché contenant cette molécule, seul
(doliprane®, efferalgan®, dafalgan® …) ou en association (actifed®, fervex® …) (Alhelail et al.,
2011; Clement et al., 2011). L’ANSM (Agence Nationale de Sécurité du Médicament et des
Produits de Santé), anciennement l’AFSSAPS (Agence Française de Sécurité Sanitaire des
Produits de Santé), a édité en 2008 une fiche de recommandations destinées aux
professionnels de santé pour limiter ces accidents.
1. Symptômes
La symptomatologie clinique d’une intoxication au paracétamol est variable selon la
dose ingérée. La dose toxique est estimée chez l’enfant à 135 mg/kg et entre 8 et 10 g chez
l’adulte. Le stade précoce de l’intoxication aiguë, de 0 à 24 heures suivant l’ingestion, peut
être marqué par des nausées, des vomissements, une anorexie, des sueurs et parfois une
somnolence. La cytolyse hépatique, marquée par une élévation des transaminases
plasmatiques (ALAT, ASAT), débute au plus tôt 8 à 10 heures après ingestion et atteint un
maximum aux environs du 3ème jour. Au stade tardif (3 à 4 jours), on note une douleur de
84
l’hypochondre droit signifiant l’atteinte hépatique. L’atteinte hépatique se caractérise par
une nécrose hépatocytaire massive dans la région centrolobulaire, accompagnée d’une
hypoxie liée à la congestion des vaisseaux hépatiques (Walker et al., 1983). Selon la dose,
l’atteinte peut être plus ou moins importante. L’hépatite dite « fulminante » est
particulièrement redoutée car elle est marquée par une acidose métabolique, une
coagulopathie et une encéphalopathie hépatique, ce qui nécessite de considérer en urgence
la transplantation hépatique.
2. Traitements
Dans la grande majorité des cas, l’administration par voie orale ou intraveineuse de
N-acétyl-cystéine (NAC) suffit à améliorer l’état du patient. La NAC représente le traitement
de référence et de première intention de l’intoxication au paracétamol depuis plus de 35 ans
(Polson and Lee, 2005; Prescott et al., 1977). Son utilisation s’appuie sur des travaux
expérimentaux réalisés par l’équipe de Bernard Brodie, qui a mis en évidence le rôle de la
déplétion du glutathion dans la toxicité du paracétamol (Mitchell et al., 1973). La NAC agit
comme un précurseur de la resynthèse de glutathion, en fournissant aux hépatocytes la
cystéine, acide aminé limitant de la synthèse. Ainsi la NAC prévient la liaison du NAPQI aux
protéines et à d’autres constituants cellulaires (Corcoran and Wong, 1986). Elle est donc
d’autant plus efficace qu’elle est administrée précocement (dans les 10 premières heures),
avant que les transaminases n’augmentent de manière significative.
Cependant, même débuté 24 heures après intoxication, le traitement à la NAC
améliore le pronostic et diminue la progression des lésions (Keays et al., 1991), suggérant la
mise en jeu d’autres mécanismes de protection. Récemment, Saito et coll. (2010) ont
proposé en effet deux mécanismes tardifs d’action de la NAC. Elle pourrait, en favorisant la
restauration du glutathion mitochondrial, améliorer l’élimination des ERO et des
peroxynitrites, mais aussi faciliter le maintien des concentrations hépatiques d’ATP grâce à
l’oxydation mitochondriale des acides aminés du glutathion régénéré (Saito et al., 2010b).
Malgré le bénéfice indéniable de la NAC chez les patients intoxiqués au paracétamol,
cette molécule peut entrainer des effets secondaires, tels que vomissements, nausées,
85
réactions anaphylactiques après administration par voie intraveineuse, ce qui nécessite
l’arrêt du traitement. L’administration d’un antihistaminique peut être indispensable dans ce
cas (Sandilands and Bateman, 2009). La NAC est également responsable de rares cas
d’hépatites aiguës cytolytiques (Biour et al., 2004).
Des alternatives thérapeutiques à la NAC ont été proposées expérimentalement mais
celles-ci ne sont pas encore utilisées en clinique. Ainsi, le léflunomide, indiqué dans le
traitement de la polyarthrite rhumatoïde, protège la souris de l’hépatotoxicité du
paracétamol en inhibant l’activation de JNK (Latchoumycandane et al., 2006). Beaucoup
d’autres molécules ont démontré des propriétés protectrices chez les rongeurs par
l’intermédiaire de différents mécanismes comme le curcumin via des effets antioxydants
(Somanawat et al., 2013), le 2-aminoethoxy-diphenyl-borate via des effets inhibiteurs des
« gap junctions » et des CYPs (S. J. Patel et al., 2012) ainsi que le NecroX-7 , un dérivé
synthétique de l’indole, via sa fixation au NAPQI (Park et al., 2013).
3. Diagnostic
Le diagnostic de l’intoxication au paracétamol repose sur trois critères. Dans un
premier temps, l’interrogatoire du patient, s’il est possible, doit permettre d’estimer la dose
ingérée et l’heure de la prise. Le deuxième critère, la paracétamolémie, dont l‘interprétation
s’appuie sur le nomogramme de Rumack et Matthew, permet de prédire le risque lésionnel
après un surdosage aigu, au plus tôt 4 heures et au plus tard 24 heures après la prise
(Rumack and Matthew, 1975). Deux dosages à quelques heures d’intervalle permettent
d’évaluer la demi-vie d’élimination du médicament. Toutefois, une paracétamolémie
négative n’écarte pas le risque d’une intoxication si l’hospitalisation du patient est tardive,
ou si l’intoxication est due à une prise répétée de doses supra-thérapeutiques (Alhelail et al.,
2011). De plus, le nomogramme de Rumack et Matthew, limité aux intoxications aiguës, ne
prend pas en compte certains facteurs individuels tels que des variations métaboliques, la
préexistence de lésions hépatiques ou encore la prise concomitante d’autres médicaments
(Cheung et al., 1994). Enfin, l’augmentation tardive du taux de transaminases sériques
représente le troisième critère.
86
Figure 16: Nomogramme de Rumack et Matthew, représentant la concentration
plasmatique (mg/l) du paracétamol en fonction du temps après ingestion. La N-acétyl-cystéine (NAC) doit être administrée au patient lorsque sa paracétamolémie est au-dessus de la ligne noire.
Ces critères sont parfois insuffisants pour le diagnostic. Le dosage des adduits (APAP-
cystéine) dans le sérum des patients a été récemment proposé. Ce dosage consiste à
mesurer les adduits formés dans les hépatocytes par la liaison du NAPQI aux protéines
cellulaires et libérés dans la circulation lors de la nécrose cellulaire (Pumford et al., 1989). Il
reflète donc la quantité de NAPQI produite par bioactivation du paracétamol par les CYPs.
Cette quantité est proportionnelle à l’intensité des lésions et selon une étude prospective, ce
dosage permet de diagnostiquer une intoxication au paracétamol pour 1/5 des hépatites
aiguës d’étiologie inconnue aux Etats-Unis. Cette technique apporte un avantage certain
dans le cas d’intoxication par ingestion répétée de dose supra-thérapeutiques, où le
nomogramme de Rumack et Matthew est inutile (Heard et al., 2011). En effet, les adduits
APAP-cystéines sont mesurables jusqu’à 12 jours après l’intoxication même lorsque le
paracétamol plasmatique est indétectable. Cependant, cette technique très spécifique n’est
87
pas encore utilisée en clinique car elle nécessite un appareillage coûteux (HPLC couplée à un
détecteur électrochimique) (Davern et al., 2006; Heard et al., 2011; Khandelwal et al., 2011;
Muldrew et al., 2002).
D’autres chercheurs ont proposé comme marqueurs des lésions hépatiques après
intoxication au paracétamol le dosage plasmatique de protéines telles que la cytokératine-
18 et l’HMGB1 (Antoine et al., 2012), la détection de microARN circulants tels que mir-122 et
mir-192 (Wang et al., 2009), ou le dosage urinaire de métabolites endogènes et/ou dérivés
du NAPQI (Clayton et al., 2006; Winnike et al., 2010). Même s’il est encore trop tôt pour dire
si ces biomarqueurs pourront être utilisés en routine, les recherches dans ce domaine
méritent d’être poursuivies. En effet, outre l’aide apporté au diagnostic, ces nouveaux
marqueurs pourraient également prédire le risque lésionnel lors d’une intoxication au
paracétamol, et ainsi identifier les sujets qui sont les plus à risque de développer une
hépatite grave, voire fulminante.
E. Facteurs de susceptibilité à la toxicité du paracétamol
La prise d’une forte dose de paracétamol (≥8-10 grammes) ou de plusieurs doses
supra-thérapeutiques de paracétamol peut entraîner des lésions hépatiques plus ou moins
sévères en fonction des doses administrées et de différents facteurs de susceptibilité.
Cependant, quelques études récentes mettent en évidence qu’un traitement au long cours
aux doses thérapeutiques maximales recommandées (4 grammes/jour) peut entraîner
également des anomalies hépatiques chez certains patients, telles que l’élévation des
transaminases plasmatiques, ou la présence de foyers de nécro-inflammation sur la biopsie
(Claridge et al., 2010; Harrill et al., 2009; Heard et al., 2007; Kurtovic and Riordan, 2003;
Schiødt et al., 1997; Watkins et al., 2006; Winnike et al., 2010). L’étude prospective menée
par Watkins chez des sujets sains montre que 31 à 44% d’entre eux présentent une
augmentation des transaminases plasmatiques 3 fois supérieure à la normale (fixée à 40
UI/L) après 14 jours de traitement au paracétamol à dose thérapeutique (Watkins et al.,
2006). Ces résultats suggèrent ainsi fortement l’existence de facteurs individuels de
88
sensibilité à la toxicité hépatique du paracétamol, que cela soit dans des conditions
d’intoxication par surdosage (Larson et al., 2005), ou de traitements aux doses
thérapeutiques (Winnike et al., 2010).
Les susceptibilités individuelles à la toxicité des médicaments sont déterminées selon
de multiples facteurs de risque génétiques et/ou environnementaux, tels que l’âge du
patient, les polymorphismes des gènes codant pour les enzymes du métabolisme du
paracétamol, l’exposition à des toxiques, le traitement par d’autres médicaments ou la
présence de pathologies hépatiques et extra-hépatiques (Larrey, 2002). Dans le cas du
paracétamol, sa toxicité est intimement liée à la formation du NAPQI et aux capacités du foie
à éliminer ce métabolite hautement réactif, comme cela a été mentionné précédemment.
Ainsi, tout facteur qui favorise la production du NAPQI ou freine sa détoxification est
susceptible d’augmenter la toxicité hépatique de ce médicament (Mitchell et al., 1973;
Tanaka et al., 2000). L’identification de ces facteurs de risque représente un « challenge »
pour les équipes médicales, car elle permet en aval d’affiner la prescription et la délivrance
de ce médicament dans les groupes à risque et ainsi de réduire les cas d’intoxication
médicamenteuse.
Il existe actuellement plusieurs facteurs de risque bien identifiés tels que
l’intoxication alcoolique chronique et d’autres facteurs qui sont moins clairement établis
pour différentes raisons (e.g. manque de données cliniques robustes publiées, fréquence
d’évènement trop faible pour que le risque soit bien identifié…). Bien que l’obésité et la
NAFLD rentrent plutôt dans la 2ème catégorie des facteurs de risque, nous le traiterons en
premier lieu puisque ma thèse porte sur ce sujet précis. Les autres facteurs de risque seront
ensuite abordés.
89
1. Obésité et pathologies hépatiques associées
Différentes investigations cliniques et expérimentales suggèrent que l’obésité et les
pathologies hépatiques associées (NAFLD) peuvent augmenter le risque et la sévérité de
l’hépatotoxicité au paracétamol après intoxication volontaire, ou non (Michaut et al., 2014).
Concernant l’hépatotoxicité de ce médicament lors d’une administration de doses
thérapeutiques chez des sujets obèses, le risque semble moins net, même si quelques cas
ont été décrits dans la littérature (Forget et al., 2009). Ainsi, le problème de l’hépatotoxicité
du paracétamol dans une situation d’obésité et de NAFLD sera principalement développé ci-
dessous en prenant en compte le contexte du surdosage, que cela soit chez l’Homme ou
expérimentalement chez le rongeur. Il est à noter enfin que l’augmentation du risque et de
la sévérité d’une hépatotoxicité dans un contexte d’obésité n’est pas spécifique à cet
antalgique. En effet, d’autres médicaments semblent être concernés tels que l’halothane, les
analogues antirétroviraux et le méthotrexate (Fromenty, 2013).
• Données cliniques
Une large étude rétrospective a rapporté un risque accru d'atteinte hépatique aiguë
induite par un surdosage de paracétamol chez les patients présentant une maladie
hépatique stéatosique non alcoolique (NAFLD). En effet, dans cette étude, les patients
atteints d’une NAFLD préexistante et hospitalisé pour surdosage au paracétamol avaient un
risque multiplié par 7 de survenue d’atteinte hépatique aiguë par rapport à ceux ne
présentant de NAFLD (Nguyen et al., 2008). Dans une étude ultérieure, Myers et Shaheen
(2009) ont analysé une nouvelle fois la même base de données mais en tenant compte des
différences possibles existant dans les circonstances de surdosage, ce qui aurait pu
constituer un facteur confondant important (Myers and Shaheen, 2009). Cette nouvelle
analyse a confirmé le risque plus élevé d'hépatotoxicité suite à un surdosage au paracétamol
chez les patients présentant une NAFLD (Nguyen et al., 2008), même si l'ampleur de ce
risque était atténué dans cette étude (3,91 vs 7,43). Cependant, il est important de souligner
que ces deux études ont montré que le risque d’hépatotoxicité après surdosage au
90
paracétamol était similaire chez les patients présentant une NAFLD et chez ceux atteints
d’une maladie alcoolique du foie (Myers and Shaheen, 2009; Nguyen et al., 2008).
En revanche, deux études ont montré que le risque de lésions hépatiques aiguës
après surdosage au paracétamol était similaire ou inférieure, chez les patients obèses par
rapport aux sujets non obèses, mais la présence d’une NAFLD n’a pas été déterminée dans
ces travaux (Radosevich et al., 2013; Rutherford et al., 2006). Cependant, dans l'une de ces
études, l’insuffisance hépatique aiguë avait une issue plus défavorable chez les patients
obèses (Rutherford et al., 2006).
L’ensemble de ces études cliniques suggère ainsi que la NAFLD, plutôt que l'obésité
en elle-même, pourrait augmenter le risque d'atteinte hépatique aiguë après un surdosage
au paracétamol. En fait, le risque et la sévérité de l’hépatotoxicité au paracétamol
pourraient être la résultante chez chaque patient de la présence de facteurs favorisant sa
toxicité (induction du CYP2E1, diminution préalable des stocks de glutathion) et l’existence
éventuelle de facteurs plutôt protecteurs (augmentation du volume de distribution et de la
glucuronidation, diminution de l’activité du CYP3A4) (Michaut et al., 2014).
• Données expérimentales chez les rongeurs
De 1987 à 2012, six études différentes ont rapporté l'effet de l'intoxication aiguë au
paracétamol dans plusieurs modèles animaux d'obésité et de NAFLD (Aubert et al., 2012;
Blouin et al., 1987; Corcoran et al., 1987; Ito et al., 2006; Kon et al., 2010; Kučera et al.,
2012). De plus, une étude a rapporté l’hépatotoxicité de fortes doses de paracétamol dans
un modèle murin de stéatohépatite induite par un régime déficient en méthionine et en
choline (régime « MCD ») (Donthamsetty et al., 2008). Cependant, il faut souligner que le
régime MCD entraîne une perte importante du poids corporel chez les animaux (Leclercq et
al., 2007; Rizki et al., 2006) et qu’il n'induit pas de résistance systémique à l'insuline (Leclercq
et al., 2007; Rinella and Green, 2004). Ainsi ce modèle de stéatohépatite n’est pas
totalement comparable aux modèles de NAFLD liés à la consommation excessive de calories.
91
Parmi ces différentes études, quatre d'entre elles ont montré que la présence d’une
NAFLD était associée à des lésions hépatiques plus sévères après une intoxication aiguë au
paracétamol (Aubert et al., 2012; Donthamsetty et al., 2008; Kon et al., 2010; Kučera et al.,
2012). Une autre étude a également montré une toxicité accrue du paracétamol chez les rats
nourris avec un régime riche en graisses (Corcoran et al., 1987), même si la présence
préalable de stéatose hépatique chez ces rats n’a pas été objectivée dans cette étude. En
revanche, les autres études ont montré des atteintes hépatiques moins graves (Ito et al.,
2006), ou similaires (Blouin et al., 1987) dans les modèles expérimentaux utilisés.
Il est difficile de donner des explications formelles concernant la divergence des
résultats obtenus dans les différents modèles de NAFLD chez les rongeurs, mais certaines
hypothèses peuvent cependant être avancées. Par exemple, les investigations réalisées chez
les souris ob/ob et db/db mâles et femelles suggèrent que les différences d’activité du
CYP2E1 hépatique pourraient jouer un rôle important (Aubert et al., 2012). En effet, une
hépatotoxicité accrue du paracétamol a été observée chez les souris db/db femelles, mais
pas chez les souris ob/ob femelles, et ceci était associé à une activité plus forte du CYP2E1
dans le premier groupe d'animaux. Il est intéressant de noter que l'activité du CYP2E1
hépatique est normale (Aubert et al., 2012), ou réduite (Enriquez et al., 1999), chez les souris
ob/ob mâles ce qui pourrait expliquer pourquoi Ito et coll. (2006) ont rapporté une
hépatotoxicité aiguë moins sévère du paracétamol dans ce modèle (Ito et al., 2006). Il est
également intéressant de souligner que les concentrations plasmatiques des métabolites
paracétamol-glucuronide et paracétamol-sulfate étaient assez similaires entre les souris
db/db femelles et les souris ob/ob femelles après un traitement de 500 mg/kg de
paracétamol (Aubert et al., 2012). Ainsi, la différence d'hépatotoxicité du paracétamol entre
ces modèles murins ne peut pas être attribuée à une différence significative de
glucuronidation ou de sulfatation de ce médicament.
Mis à part le rôle de l’induction du CYP2E1 et de la formation accrue du NAPQI,
d’autres hypothèses peuvent être avancées pour expliquer la plus grande sensibilité à
92
l’hépatotoxicité au paracétamol dans un contexte de NAFLD, comme par exemple
l'accumulation de lipides et un stress oxydant plus important.
En ce qui concerne l’accumulation lipidiques il est à noter que, dans le travail déjà
cité précédemment (Aubert et al., 2012), malgré une stéatose moins marquée chez les souris
db/db par rapport au souris ob/ob, une plus grande hépatotoxicité du paracétamol chez les
souris db/db est observée. De plus, les niveaux plasmatiques de base des transaminases
ALAT et ASAT (i.e. avant intoxication) étaient comparables entre les souris db/db et ob/ob
(Aubert et al., 2012). Ainsi, une sensibilité accrue à hépatotoxicité du paracétamol chez les
souris db/db femelles ne peut pas être attribuée à la préexistence d'une cytolyse hépatique
élevée. Cependant, cette étude ne permet pas d’exclure la possibilité que l'accumulation de
certaines espèces de lipides pourrait être impliquée. En effet, il est à noter que les
hépatocytes db/db présentent une stéatose plutôt microvésiculaire et moins
macrovacuolaire par rapport aux hépatocytes ob/ob (Aubert et al., 2012; Trak-Smayra et al.,
2011). Parce que la taille des gouttelettes est fortement influencée par la composition
lipidique (Guo et al., 2008; X. Shi et al., 2013), il est possible que l'accumulation de certaines
espèces de lipides spécifiques dans les hépatocytes des souris db/db femelles ait pu
contribuer à la plus grande susceptibilité à la toxicité du paracétamol.
La NAFLD est associée à un stress oxydant, susceptible d’altérer différents
composants cellulaires tels que des acides nucléiques et des acides gras insaturés (Begriche
et al., 2013; Bell et al., 2010; Seki et al., 2005). En outre, les réserves de GSH hépatique
peuvent être réduites au cours NAFLD (surtout au stade NASH), diminuant ainsi la capacité
antioxydantes des hépatocytes surchargés en graisse (Begriche et al., 2013; Videla et al.,
2004). Par conséquent, la sensibilité au paracétamol observée dans certains modèles de
rongeurs obèses pourrait être liée à un stress oxydant basal élevé et à des niveaux de GSH
plus bas. Cependant, les taux de base de GSH hépatique n’étaient pas significativement
réduits dans deux modèles de rongeurs d'obésité et de NAFLD pour lesquels une plus grande
vulnérabilité à la toxicité du paracétamol a été montrée (Aubert et al., 2012; Kučera et al.,
2012). Mais il est important de noter que seules les concentrations totales du GSH cellulaire
93
ont été mesurées dans ces études et ainsi il serait important de déterminer si les stocks de
GSH mitochondrial sont spécifiquement diminués dans ces modèles de NAFLD. En effet,
certaines études ont suggéré un rôle clé du pool mitochondrial de GSH dans les lésions
hépatiques induites par le paracétamol (Fernandez-Checa and Kaplowitz, 2005; Zhao et al.,
2002).
Comme mentionné précédemment, l'activation de JNK semble jouer un rôle
important dans l'hépatotoxicité induite par le paracétamol (Han et al., 2010; Hinson et al.,
2010; Jaeschke et al., 2012; Xie et al., 2014b). De façon intéressante, l'activation de JNK
pourrait également jouer un rôle important dans la pathogenèse de la NAFLD (Abdelmegeed
et al., 2012; Gadang et al., 2013; Singh et al., 2009). Seules deux études ont examiné
l’activation hépatique de JNK chez les animaux obèses intoxiqués par le paracétamol (Kon et
al., 2010; Aubert et al., 2012). Dans la première étude, l'activation de JNK (évaluée par
phospho-JNK) après intoxication était significativement plus forte chez les souris KK-Ay
obèses et diabétiques par rapport aux souris sauvages, et ceci était associé à une
hépatotoxicité plus importante du paracétamol chez les animaux obèses (Kon et al., 2010).
Dans la seconde étude, l'hépatotoxicité accrue observée chez les souris db/db femelles
n'était pas associée à une augmentation de la phosphorylation de JNK (Aubert et al., 2012).
De plus, et de façon inattendue, JNK était spécifiquement activée dans le foie des souris
ob/ob femelles intoxiquées, bien que ces animaux présentaient une cytolyse hépatique
moins importante par rapport aux souris db/db femelles (Aubert et al., 2012). Ainsi,
l'activation de JNK pourrait ne pas être un mécanisme clé de l’hépatotoxicité du paracétamol
dans certains modèles murins de NAFLD.
En plus des investigations réalisées sur des modèles de rongeurs obèses, une étude a
rapporté l'effet de l’intoxication aiguë au paracétamol dans un modèle murin de
stéatohépatite induite par un régime « MCD » (Donthamsetty et al., 2008). Dans cette étude,
une plus grande hépatotoxicité du paracétamol était observée malgré l'absence d’induction
préexistante du CYP2E1 et la présence de concentrations normales de base du GSH
hépatique (Donthamsetty et al., 2008), suggérant ainsi l'implication d'autres mécanismes. De
94
façon intéressante, les concentrations basales d’ATP hépatique étaient réduites de 45% chez
les souris nourries par le régime « MCD » (Donthamsetty et al., 2008), suggérant une
altération importante de la chaîne respiratoire mitochondriale et de la phosphorylation
oxydative dans ce modèle expérimental (Serviddio et al., 2008, 2010). Par conséquent, un
dysfonctionnement mitochondrial préexistant pourrait avoir joué un rôle significatif dans la
plus grande hépatotoxicité du paracétamol observée chez les souris nourries avec le régime
« MCD ». Même si ces résultats sont intéressants, il faut néanmoins garder à l’esprit que ce
modèle de NAFLD présente beaucoup de différences par rapport aux modèles de NAFLD
induite par des régimes hypercaloriques, comme cela a déjà été souligné plus haut.
• Synthèse des données cliniques et expérimentales
Bien que la présence d’une NAFLD chez les personnes obèses semble augmenter le
risque d'atteinte hépatique aiguë après intoxication au paracétamol (Nguyen et al., 2008;
Myers et al., 2009), ces études cliniques n'ont pas déterminé le mécanisme par lequel le
paracétamol pourrait être plus toxique dans cette situation pathologique. Néanmoins, il est
à noter qu’une augmentation de l'activité du CYP2E1 hépatique a été fréquemment
rapportée chez les patients présentant une NAFLD (Aubert et al., 2011; Chalasani et al.,
2003; Chtioui et al., 2007; Emery et al., 2003; Varela et al., 2008), même s'il est encore
difficile de savoir si l’induction du CYP2E1 est spécifiquement liée à cette maladie du foie, ou
à d'autres troubles métaboliques liés à l'obésité, tels que la résistance à l'insuline et le
diabète de type 2 (Aubert et al., 2011).
Dans les études expérimentales, la stéatose chez les rongeurs obèses était en général
associée à une hépatotoxicité plus élevée après un surdosage au paracétamol (Aubert et al.,
2012; Kon et al., 2010; Kučera et al., 2012). De plus, dans une de ces études, une cytolyse
hépatique aiguë plus sévère semblait corrélée avec une activité accrue préexistante du
CYP2E1 hépatique, mais pas avec le degré d'accumulation des lipides, c'est-à-dire avec la
sévérité de la stéatose hépatique (Aubert et al., 2012).
95
Contrastant avec ces études, l'obésité n’était pas associée à une plus grande
hépatotoxicité du paracétamol chez les patients chez lesquels la présence d’une NAFLD n'a
pas été recherché, comme précédemment indiqué (Rutherford et al., 2006; Radosevich et
al., 2013). De façon intéressante, une hépatotoxicité au paracétamol similaire ou inférieure a
été observée dans certains modèles de rongeurs obèses (Blouin et al., 1987; Ito et al., 2006;
Aubert et al., 2012). Différentes études cliniques et expérimentales ont montré que l'obésité
était associée à une plus grande glucuronidation hépatique du paracétamol et de sa
clairance (Abernethy et al., 1983; Aubert et al., 2012; Barshop et al., 2011; Brill et al., 2012;
Gicquel et al., 2013; Xu et al., 2012) . En revanche, l'influence de l'obésité et de la NAFLD sur
la sulfatation du paracétamol n’est pas clairement établie car les investigations chez les
rongeurs et les patients ont fourni des résultats divergents (Aubert et al., 2012; Chaudhary
et al., 1993; Corcoran et al., 1987; Hardwick et al., 2013). Il est à noter aussi que l'activité
hépatique du CYP3A4 est plus faible au cours de l'obésité et de la NAFLD chez l’Homme et
l’animal (Brill et al., 2012; Kolwankar et al., 2007; Patoine et al., 2013; Yoshinari et al., 2006),
ce qui peut réduire la production de NAPQI. Enfin, l'obésité semble être associée à une
moindre absorption gastro-intestinale du paracétamol et à un plus grand volume de
distribution, ce qui pourrait réduire les concentrations plasmatiques de cet antalgique
(Abernethy et al., 1982; Lee et al., 1981) .
Ainsi, il semble que l'apparition de lésions hépatiques aiguës chez une personne
obèse après un surdosage au paracétamol pourrait dépendre d'un équilibre délicat entre les
facteurs métaboliques qui peuvent avoir un effet protecteur (augmentation de la
glucuronidation et du volume de distribution, moindre absorption gastro-intestinale et
activité plus faible du CYP3A4) et d'autres susceptibles d’augmenter la production hépatique
de NAPQI (induction du CYP2E1) ou de réduire la détoxication de ce métabolite réactif
(baisse des stocks de GSH). L’implication possible de tous ces facteurs est présentée
schématiquement dans la Figure 17.
96
Figure 17: Facteurs pouvant moduler le risque et la sévérité de l’hépatotoxicité induite par
le paracétamol dans un contexte d’obésité et de NAFLD. Les facteurs pouvant protéger contre les lésions hépatiques liées au paracétamol incluent la diminution de l’absorption intestinale et de l’activité du CYP3A4, ainsi que l’augmentation du volume de distribution et de la glucuronidation hépatique. Ces facteurs peuvent réduire le taux plasmatique de paracétamol et diminuer la formation de NAPQI, un métabolite toxique du paracétamol. Les facteurs pouvant aggraver les lésions hépatiques dues au paracétamol comprennent une augmentation de l’activité du CYP2E1, qui mène à une production plus accrue de NAPQI, et un faible stock de glutathion hépatique, ce qui diminue les capacité de détoxification du NAPQI. D’autres investigations sont nécessaires pour déterminer si la présence d’une stéatohépatite (NASH) et/ou des dysfonctions mitochondriales peuvent favoriser l’hépatotoxicité du paracétamol chez les sujets obèses (Michaut et al., 2014).
97
• Questions en suspens
Bien qu'il existe des arguments expérimentaux indiquant que l’induction du CYP2E1
hépatique au cours de la NAFLD peut favoriser l'hépatotoxicité du paracétamol, il est
concevable que d'autres mécanismes puissent également jouer un rôle. Par exemple, il sera
important de déterminer si la gravité de la NAFLD peut être un facteur important.
Intuitivement, on peut s'attendre à ce que la présence d’une nécro-inflammation importante
(présence d’une NASH) puisse être associée à un risque plus élevé, par rapport à la stéatose
hépatique simple. La préexistence d'un dysfonctionnement mitochondrial liée à la NASH
(Begriche et al., 2013; Grattagliano et al., 2012) pourrait effectivement être impliqué
puisque ce dysfonctionnement joue un rôle clé dans l’apparition de la cytolyse induite par le
paracétamol (Han et al., 2010; Jaeschke et al., 2012; Knockaert et al., 2011). Il sera
également intéressant d’étudier la relation entre les concentrations intra-hépatiques de GSH
au cours de la NAFLD (et surtout de la NASH) et la sévérité des lésions hépatiques induites
par une intoxication au paracétamol.
Compte tenu du faible nombre d'études cliniques publiées sur l’hépatotoxicité du
paracétamol dans un contexte d’obésité et de NAFLD, d'autres investigations sont
clairement nécessaires pour obtenir plus d'informations sur cette question. En particulier, il
sera important de déterminer s’il existe un sous-groupe de sujets obèses présentant un
risque accru d'hépatotoxicité suite à une intoxication au paracétamol. Il est possible en effet
qu’un tel risque ne concerne pas tous les sujets obèses étant donné qu’il existe des facteurs
métaboliques liés à l’obésité qui peuvent constituer une protection vis-à-vis de
l’hépatotoxicité de cet antalgique, comme cela a été souligné précédemment. Ces
investigations cliniques devront porter non seulement sur les cas d’intoxication aiguë liés à
un surdosage, mais également sur les cas d’hépatotoxicité survenant dans le cadre d’une
administration chronique de paracétamol (Biour et al., 2004; Watelet et al., 2007). Des
investigations sont en cours dans l’équipe afin de déterminer si l’administration pendant
plusieurs semaines de doses thérapeutiques chez des souris nourries par un régime normal
ou riche en graisses est susceptible d’entraîner une cytolyse plus importante chez les souris
présentant une stéatose.
98
Des investigations seraient également nécessaires afin de déterminer si les troubles
métaboliques autres que la NAFLD pourraient favoriser l’hépatotoxicité du paracétamol, tels
que la résistance à l'insuline et le diabète de type 2. De façon intéressante, le diabète a été
associé à un risque plus élevé de lésions hépatiques graves induites par les médicaments
(Chalasani et al., 2008), bien que les cas d’hépatotoxicité au paracétamol n’aient pas été
inclus dans cette étude. Il sera également important de déterminer le(s) mécanisme(s) précis
de l’induction du CYP2E1 chez les patients obèses présentant une NAFLD. Les quelques
pistes existant actuellement ont été présentées dans le chapitre consacré à la
physiopathologie de la NAFLD.
2. Alcoolisme et maladies hépatiques liées à l’alcool
Un facteur de risque bien connu est l’intoxication alcoolique chronique et les
maladies alcooliques du foie qui lui sont associées (Larson et al., 2005 ; Nguyen et al., 2008).
En effet, de nombreux cas cliniques d’intoxication au paracétamol ont été mis en évidence
chez des malades alcooliques chroniques (Emby and Fraser, 1977; Licht et al., 1980; McClain
et al., 1980; Teschke et al., 1979; Zimmerman and Maddrey, 1995). Zimmerman et Maddrey
(1995) ont étudié 67 cas d’insuffisances hépatiques induites par le paracétamol: tous les
patients étaient consommateurs réguliers d’alcool, et 60% d’entre eux avaient consommé
moins de 6 grammes de paracétamol (Zimmerman and Maddrey, 1995). D’autres études
confirment que l’abus d’alcool, ou l’existence de pathologies hépatiques associées, sont des
facteurs de risque indépendants de mauvais pronostic à la suite d’une intoxication au
paracétamol, avec une augmentation du risque variant selon les études de 3,5 [IC95% 1,78-
6,97] à 6,46 [IC95% 4,53-9,21] (Nguyen et al., 2008; Schmidt et al., 2002).
La susceptibilité des sujets alcooliques chroniques semble s’expliquer par au moins
deux mécanismes:
1. Une forte augmentation de l’activité du CYP2E1, principalement liée à une
stabilisation accrue de la protéine par l’alcool (Gonzalez, 2007; Roberts et al., 1995). Il est à
noter que des travaux expérimentaux ont montré que l’augmentation de l’expression
99
protéique et de l’activité du CYP2E1 par l’éthanol concernent non seulement le CYP2E1
microsomal mais également le CYP2E1 localisé dans les mitochondries (Robin et al., 2005).
L’induction du CYP2E1 par l’alcool favorise ainsi fortement la transformation du paracétamol
en NAPQI et abaisse le seuil de toxicité (Zimmerman and Maddrey, 1995).
2. Une déplétion préexistante des stocks intra-hépatocytaires du glutathion(Sato et
al., 1981; Zimmerman and Maddrey, 1995). Il est à noter que cette déplétion préalable en
glutathion pourrait être liée au stress oxydant induit par l’intoxication alcoolique chronique
et/ou à la malnutrition fréquemment observée au cours de cette situation physio
pathologique (Gao and Bataller, 2011; Zimmerman and Maddrey, 1995).
Enfin, il est intéressant de noter que, contrairement à l’intoxication chronique, des
études expérimentales et cliniques ont montré que l’intoxication alcoolique aiguë semble au
contraire protéger vis-à-vis de l’hépatotoxicité du paracétamol (Sato and Lieber, 1981; Sato
et al., 1981; Schmidt et al., 2002; Waring et al., 2008). Bien que le mécanisme impliqué reste
encore incertain, cette protection est probablement la conséquence de la métabolisation de
l’éthanol par le CYP2E1, ce qui limite ainsi la biotransformation du paracétamol en NAPQI
(Sato et al., 1981). Cette compétition entre les deux substrats disparait dès lors que l’alcool
est éliminé de l’organisme.
3. Jeûne prolongé et dénutrition
Le jeûne et la dénutrition peuvent être fréquemment observés dans la pratique
clinique. Par exemple, les facteurs suivants peuvent entraîner une dénutrition: alcoolisation
chronique, anorexie mentale, vieillesse, conditions sociales défavorables, état dépressif et
situations post-opératoires, en particulier après une chirurgie dentaire (Clement et al., 2011;
Pickering et al., 2011).
Le jeûne prolongé et la dénutrition semblent augmenter significativement le risque
d’hépatotoxicité au paracétamol (Ferner et al., 2011), même si certains auteurs pensent que
ces facteurs jouent un rôle moins important que l’intoxication alcoolique chronique
100
(Rumack, 2004). Quoi qu’il en soit, différents cas cliniques d’insuffisance hépatique aiguë
après administration de doses thérapeutiques de paracétamol ont été rapportés chez des
sujets maigres et/ou dénutris (Claridge et al., 2010; Kurtovic and Riordan, 2003). De plus,
l’analyse multivariée menée par Nguyen confirme que la malnutrition est un facteur de
risque important de toxicité hépatique lors d’un surdosage au paracétamol, avec une
augmentation du risque (« odd-ratio ») de 3,84 [IC95% : 2,63-5,65] (Nguyen et al., 2008). Il
est également intéressant de noter que les investigations expérimentales in vivo concernant
l’hépatotoxicité du paracétamol chez les rongeurs s’effectuent classiquement chez des
animaux qui ont été placés préalablement à jeun afin de potentialiser cette toxicité.
Au moins quatre mécanismes différents pourraient expliquer l’hépatotoxicité accrue
du paracétamol dans un contexte de jeûne et de dénutrition. :
1. Une forte diminution des stocks intra-hépatiques de glutathion (Pessayre et al.,
1980; Price et al., 1987) . Un régime pauvre en protéines altère de la même manière les
stocks de glutathion. En effet, le glutathion est synthétisé à partir d’acides aminées
provenant des protéines fournies par l’alimentation. Une déplétion des stocks de glutathion
induit une moindre détoxication du NAPQI après un traitement au paracétamol.
2. Une diminution des stocks intra-hépatocytaires de glycogène et d’ATP,
sensibilisant ainsi les hépatocytes aux effets délétères du paracétamol sur les réserves
énergétiques de l’hépatocytes. De plus, le jeûne prolongé est associé à une diminution de la
glucuronoconjugaison, au profit de l’oxydation microsomale par les CYPs. Effectivement, la
glucuronoconjugaison dépend des réserves de glucose hépatique, qui peuvent être divisées
par 10 après une période de jeûne (Whitcomb and Block, 1994).
3. Une augmentation de l’expression du CYP2E1, qui pourrait être liée à la diminution
de l’insulinémie et/ou à l’augmentation du glucagon (Moncion et al., 2002; Woodcroft and
Novak, 1999a). Il est à noter que la régulation du CYP2E1 par l’insuline a été développée plus
longuement dans la 2ème partie de l’introduction. L’augmentation de l’expression du CYP2E1
101
pourrait également être liée à la plus grande production des corps cétoniques, et en
particulier de l’acétone (Forkert et al., 1994; Kraner et al., 1993).
4. Une diminution du volume de distribution associée à la réduction du poids
corporel. Ceci est associé à une augmentation des concentrations plasmatiques du
paracétamol et donc à une exposition plus forte du foie à son effet toxique. Claridge et ses
collaborateurs proposent de réduire de moitié la posologie quotidienne maximale
recommandée pour les adultes (2g/jour) dont le poids corporel est inférieur à 50 kg (Claridge
et al., 2010).
4. Autres facteurs de risques
• Hépatites virales
Les patients infectés par le virus de l’hépatite A ou le virus de l’hépatite C (VHC)
apparaissent plus à risque de développer des lésions hépatiques après la prise de
paracétamol, même pour des doses thérapeutiques (Myers and Shaheen, 2009; Nguyen et
al., 2008; Rezende et al., 2003; Stine and Lewis, 2011; Tarantino et al., 2007; Yaghi et al.,
2006). Selon l’analyse multivariée menée par Nguyen, portant sur plus de 42000 cas de
patients hospitalisés à la suite d’une intoxication au paracétamol, le risque de développer
des lésions hépatiques graves est multiplié par 1,80 si le patient est infecté par le VHC
(Nguyen et al., 2008). Cette susceptibilité accrue pourrait être la conséquence de la présence
d’un état inflammatoire lié au virus qui sensibiliserait le foie (Maddox et al., 2010). Le
principal médiateur pro-inflammatoire impliqué dans la sensibilisation des hépatocytes est le
TNFα (Tumor Necrosis Factor-alpha), probablement par l’intermédiaire d’un mécanisme
faisant intervenir JNK (Gandhi et al., 2010). Des dysfonctions mitochondriales induites par le
VHC pourraient également jouer un rôle important (Uehara et al., 2013).
• Interactions médicamenteuses
Lors d’un surdosage au paracétamol, la toxicité hépatique pourrait être en théorie
potentialisée par la prise concomitante d’inducteurs enzymatiques, tels que la phénytoïne,
102
ou le phénobarbital. Cependant, aucune étude clinique ne montre d’augmentation
significative du risque de lésons hépatiques chez les patients traités par ces médicaments. A
dose thérapeutique de paracétamol, ce risque semble néanmoins très faible (Rumack, 2004;
Toes et al., 2005).
• L’âge
Le métabolisme du paracétamol évolue avec l’âge. Principalement éliminé sous
forme sulfoconjugué au cours des premières années de vie, la forme glucuronidée devient
majoritaire pendant l’enfance, pour occuper 50 à 65% des métabolites excrétés chez
l’adulte. Le paracétamol est relativement bien toléré à tout âge, même chez les nourrissons.
On peut toutefois noter que l’intoxication volontaire au paracétamol touche principalement
des personnes entre 10 et 50 ans. Concernant les personnes âgées (plus de 70 ans), les
hospitalisations sont moins nombreuses, mais principalement liées à une intoxication
accidentelles (Myers et al., 2007). Les séniors seraient plus exposés à la malnutrition et
présenteraient plus de difficultés à restaurer les stocks de glutathion, en particulier en post-
opératoire (Pickering et al., 2011; Schmidt et al., 2002; Stio et al., 1994). De plus,
l’élimination du paracétamol semble aussi être affectée par l’âge, comme le montre
l’allongement de sa demi-vie, en particulier chez les hommes (Greenblatt et al., 1983).
• Le sexe
Un dimorphisme sexuel peut être à l’origine de variations du métabolisme du
paracétamol aussi bien chez les humains que chez les rongeurs, et par conséquent entrainer
des réponses toxiques plus ou moins fortes en fonction du sexe (Anderson, 2005; Kato,
1974; Waxman and Holloway, 2009). L’étude de Critchley et coll. (1986) sur des sujets
caucasiens met en évidence une moindre activité de glucuronidation ainsi qu’un plus fort
métabolisme microsomal chez les femmes comparés aux hommes (Critchley et al., 1986).
Ces résultats peuvent en partie expliquer pourquoi l’intoxication au paracétamol touche en
majorité les femmes (74% des cas) (Lee, 2008). Cependant, outre ces raisons métaboliques,
cette disproportion pourrait aussi s’expliquer par une préférence des femmes pour les
médicaments lors des tentatives de suicides (Saviuc et al., 1999).
103
Expérimentalement, plusieurs études mettent en évidence un dimorphisme sexuel
concernant la toxicité hépatique du paracétamol, observé aussi bien chez des souris
consanguines (C57Bl6J) que non consanguines (CD-1) (Botta et al., 2006; Dai et al., 2006;
Masubuchi et al., 2011; McConnachie et al., 2007). Dans toutes ces études, les souris
femelles ont montré moins de lésions hépatiques que leurs homologues mâles suite à une
intoxication au paracétamol. Selon les auteurs, cette moindre sensibilité serait liée à une
restauration plus rapide des quantités de GSH, en partie grâce à une plus forte activité de la
glutamate-cystéine synthase (GCS) chez les femelles (Botta et al., 2006; Masubuchi et al.,
2011; McConnachie et al., 2007).
• Polymorphismes génétiques
La susceptibilité à la toxicité du paracétamol pourrait également résulter de
variations d’expression de gènes codant pour des protéines impliquées dans le métabolisme
(SULTs, UGTs, CYPs), dans la réponse au stress cellulaire et/ou dans l’immunité innée (Adjei
et al., 2008; Court et al., 2001, 2014; Critchley et al., 1986; Miners et al., 1990; Patel, Tang, &
Kalow, 1992). Par exemple, la sulfotransférase SULT1A1 possède 3 allèles différents, dont la
fréquence d’expression varie selon les populations et qui sont associés à une activité
enzymatique plus ou moins forte (cf. chapitre métabolisme). En ce qui concerne les UGTs et
les CYPs, Critchley et coll. (1986) ont mis en évidence, après un traitement par une dose de
1,5 grammes de paracétamol, une excrétion urinaire accrue de conjugués glucuronides et
réduite de métabolites dérivés de l’oxydation par les CYPs chez les patients originaires
d’Afrique (Ghana et Kenya) comparés à des sujets caucasiens (Ecosse) (Critchley et al., 1986).
Ces résultats suggèrent une meilleure élimination du paracétamol non bioactivé dans les
populations africaines, qui pourraient être alors moins sensibles à la toxicité de cet
antalgique. Moyer et coll. (2011) se sont quant à eux intéressé aux SNP (Single Nucleotide
Polymorphism) des gènes impliqués dans la conjugaison au glutathion. Ils ont ainsi identifié
un groupe de SNP situé sur le chromosome 3 fortement associés à une toxicité plus accrue
du NAPQI, et ce indépendamment du sexe et du groupe ethnique (Moyer et al., 2011).
104
La susceptibilité au paracétamol pourrait être également influencée par l’expression
de gènes impliqués dans la réponse immunitaire. En effet, des investigations réalisées chez
des adultes sains traités par des doses maximales recommandées de paracétamol ont
montré qu’un polymorphisme sur le gène CD44 (qui code pour une molécule d’adhésion
cellulaire exprimée sur les lymphocytes) était associé à une augmentation des transaminases
sériques et donc à une plus grande sensibilité à cet antalgique (Harrill et al., 2009).
Cependant, une étude plus récente n’a pas montré de lien statistiquement significatif entre
la présence de ce polymorphisme et une hépatotoxicité au paracétamol secondaire à un
surdosage (Court et al., 2014).
Expérimentalement, la toxicité du paracétamol varie en fonction des souches de
souris utilisées (Harrill et al., 2009; Williams et al., 2011): certaines souches apparaissent
protégées (CAST/EiJ), alors que d’autres au contraire sont beaucoup plus sensibles (C57Bl/6J
ou B6C31/J). Cette susceptibilité pourrait être influencée par l’expression de gènes impliqués
dans la réponse immunitaire. Par exemple, les souches de souris exprimant moins de CD44
sont plus susceptibles à l’hépatotoxicité du paracétamol, comparées à des souris sauvages
(Harrill et al., 2009). Ainsi, des variations génétiques sur le gène CD44 semblent jouer un rôle
majeur dans la susceptibilité à l’hépatotoxicité au paracétamol, chez la souris et chez
l’Homme. Quoi qu’il en soit, et malgré les différents rôles déjà attribués à CD44 in vivo, tels
que les interactions cellules-matrices, la migration cellulaire ou encore la cicatrisation
(Rouschop et al., 2006), les mécanismes spécifiques impliqués dans la susceptibilité du
paracétamol nécessite d’être précisés.
Ainsi, certains polymorphismes génétiques pourraient expliquer des variations de
susceptibilité à la toxicité hépatique du paracétamol, non seulement au niveau des gènes
impliqués dans le métabolisme de cet antalgique, mais également de gènes impliqués dans
les processus de réparation, ou de régénération hépatique. Cependant, des investigations
cliniques supplémentaires seraient nécessaires afin d’identifier les principaux
polymorphismes impliqués dans cette susceptibilité accrue, car tous les polymorphismes
identifiés ne jouent pas nécessairement un rôle important.
105
F. Réglementation concernant la délivrance
Au sein de la population occidentale, le nombre de cas d’intoxication au paracétamol
varie grandement en fonction des pays. L’Espagne et la France sont deux des pays où l’on
note le plus faible pourcentage d’hépatites aiguës dues au paracétamol, respectivement 2,2
et 7% (Bernal et al., 2010; Escorsell et al., 2007; Ichai and Samuel, 2011; Polson and Lee,
2007). Cette moindre fréquence pourrait être la conséquence de réglementations plus
contraignantes quant à la délivrance de ce médicament. En effet, en France et en Espagne,
bien que le paracétamol soit en accès direct sans prescription médicale, il est vendu
uniquement en officine. De plus, son conditionnement est limité à 8 grammes par boîte
(Gunnell et al., 1997).
Au Royaume-Uni, pour diminuer le nombre d’intoxications volontaires, il a été adopté
une politique de restriction commerciale en 1998, en autorisant un maximum de 16
grammes de paracétamol par boîte vendue en pharmacie et 9 grammes hors officine
(Zarowitz, 2012). Cette politique semble avoir fait baisser les premières années le taux de
mortalité dû au paracétamol (Hawton et al., 2004; Inglis, 2004). Cependant, sur une période
plus longue, cette baisse est discutée (Bateman, 2009; Buckley and Gunnell, 2007; Hawkins
et al., 2007; Morgan et al., 2007).
Aux Etats-Unis, dans le but de diminuer le nombre de cas d’intoxications
accidentelles, la FDA (Food and Drug Administration) a demandé en juillet 2009 aux
industriels de clarifier l’étiquetage sur les conditionnements de toute formulation
pharmaceutique contenant du paracétamol. La composition doit être lisible et le mot
« acetaminophen » écrit en toute lettre. Les posologies recommandées, ainsi que les risques
de toxicité hépatique (en particulier lors d’une association avec l’alcool), doivent être
désormais clairement indiqués sur l’emballage. Une diminution des posologies maximales
recommandées (passage de 4 à 3,25gr/jour) a été proposée, mais celle-ci n’a pas encore été
adoptée (Graham et al., 2010).
106
Alors que la vente exclusive du paracétamol en pharmacie semble limiter les cas
d’intoxication, notamment en France (Polson and Lee, 2007), le rapport ATTALI en 2008 avait
troublé les professionnels de santé en proposant la levée du monopole officinal dans la
vente des médicaments ne nécessitant pas de prescription médicale. Ce débat a d’ailleurs
ressurgit récemment en France avec un rapport de l'Inspection Générale des Finances (IGF)
qui s'en prend, entre autre, au monopole des pharmaciens. De fait, vu le nombre de cas
d’intoxications médicamenteuses et les coûts de santé engendrés par les hospitalisations
dans les pays où la vente est moins restrictive, les autorités de santé devront bien réfléchir
quant aux conséquences sanitaires potentiellement délétères d'ouvrir à la concurrence la
vente de médicaments dont la prescription est facultative (ou de médicaments non
remboursables), en particulier pour ceux contenant du paracétamol.
107
ARTICLE 1
Michaut A, Moreau C, Robin MA, Fromenty B. Acetaminophen-induced liver injury in
obesity and nonalcoholic fatty liver disease. Liver International 2014; 34: e171-9.
Cette revue de la littérature fait le point sur l’hépatotoxicité du paracétamol dans un
contexte d’obésité et de NAFLD. Dans cet article, nous faisons d’abord un bref rappel sur les
principales caractéristiques du métabolisme du paracétamol ainsi que sur les mécanismes
généraux d’hépatotoxicité de ce médicament. Nous citons ensuite toutes les études
cliniques et expérimentales publiées se rapportant à l’hépatotoxicité du paracétamol chez
des patients ou des animaux obèses présentant une NAFLD. Concernant les études
expérimentales sur des rongeurs, nous en citons sept publiées depuis 1987. Parmi ces
études, cinq d'entre elles ont constaté que l’obésité et la NAFLD étaient associées à une plus
forte hépatotoxicité du paracétamol administré à fortes doses. Malheureusement, ces
études observationnelles ne permettent pas de proposer des mécanismes qui pourraient
expliquer cette toxicité hépatique accrue, bien que certaines investigations suggèrent que
l'induction préexistante du cytochrome P450 2E1 (CYP2E1) pourrait jouer un rôle important
en favorisant la génération de N-acétyl-p-benzoquinoneimine (NAPQI), le métabolite toxique
de paracétamol. De plus, certaines données suggèrent que d’autres facteurs pourraient
favoriser l’hépatotoxicité du paracétamol, telles que la déplétion en glutathion et la
dysfonction mitochondriale qui peuvent être associées à la NAFLD, en particulièrement au
stade de la NASH (Nonalcoholic Steatohepatitis). En revanche, d’autres investigations
semblent indiquer que certains facteurs pourraient protéger vis-à-vis de l’hépatotoxicité du
paracétamol chez les personnes obèses. C’est le cas par exemple de l’augmentation de la
glucuronidation du paracétamol et de la diminution de l'activité du CYP3A4 au niveau
hépatique, ainsi que de l'augmentation du volume de distribution de ce médicament. En
conséquence, le risque et la gravité de l’hépatotoxicité du paracétamol chez les personnes
obèses souffrant d’une NAFLD pourraient dépendre d'un équilibre précaire entre les facteurs
métaboliques qui protègent le foie et d’autres facteurs qui vont favoriser la génération
hépatique de grandes quantités de NAPQI ainsi que ses effets toxiques sur certaines cibles
cellulaires, et en particulier les mitochondries.
108
REVIEW ARTICLE
Acetaminophen-induced liver injury in obesity and nonalcoholic fattyliver disease
Ana€ıs Michaut1, Caroline Moreau1,2, Marie-Anne Robin1 and Bernard Fromenty1
1 INSERM, U991, Universit�e de Rennes 1, Rennes, France
2 Laboratoire de Biochimie et Toxicologie, CHU Pontchaillou, Rennes, France
Keywords
acetaminophen – hepatotoxicity – obesity –
fatty liver – steatosis – cytochrome P450 2E1
Correspondence
Dr Bernard Fromenty, INSERM UMR991,
Facult�e de Pharmacie. 2, avenue du
Professeur L�eon Bernard, 35043 Rennes
Cedex, France
Tel: +33 2 23 23 30 44
Fax: +33 2 23 23 53 85
e-mail: [email protected]
Received 9 January 2014
Revised 10 February 2014
Accepted 23 February 2014
DOI:10.1111/liv.12514
Liver Int. 2014: 34: e171–e179
AbstractAlthough acetaminophen (APAP) is usually considered as a safe drug, thispainkiller can lead to acute liver failure after overdoses. Moreover, there isevidence that the maximum recommended dosage can induce hepatic cytoly-sis in some individuals. Several predisposing factors appear to enhance therisk and severity of APAP-induced liver injury including chronic alcoholicliver disease and nonalcoholic fatty liver disease (NAFLD), which refers to alarge spectrum of hepatic lesions linked to obesity. In contrast, obesity byitself does not seem to be associated with a higher risk of APAP-induced liverinjury. Since 1987, seven studies dealt with APAP-induced hepatotoxicity inrodent models of NAFLD and five of them found that this liver disease wasassociated with higher APAP toxicity. Unfortunately, these studies did notunequivocally established the mechanism(s) whereby NAFLD could favourAPAP hepatotoxicity, although some investigations suggested that pre-exis-tent induction of hepatic cytochrome P450 2E1 (CYP2E1) could play a sig-nificant role by increasing the generation of N-acetyl-p-benzoquinone imine(NAPQI), the toxic metabolite of APAP. Moreover, pre-existent mitochon-drial dysfunction associated with NAFLD could also be involved. In contrast,some investigations suggested that factors that could reduce the risk andseverity of APAP hepatotoxicity in obesity and NAFLD include higher hepa-tic APAP glucuronidation, reduced CYP3A4 activity and increased volume ofbody distribution. Thus, the occurrence and the outcome of APAP-inducedliver injury in an obese individual with NAFLD might depend on a delicatebalance between metabolic factors that can be protective and others thatfavour large hepatic levels of NAPQI.
Acetaminophen (APAP), also known as paracetamol, isone of the most widely prescribed drugs for the manage-ment of pain and hyperthermia, even though its modeof action is still under investigation (1). The currentmaximum recommended dosage of APAP is 4 g/day inadults and 60–75 mg/kg/day in children. AlthoughAPAP is usually considered as a safe drug, APAP intoxi-cation after overdosage can lead to massive hepatocellu-lar necrosis and acute liver failure (2, 3). At themoment, N-acetylcysteine is the only approved drug totreat APAP-induced liver injury in patients after volun-tary, or unintentional, APAP overdose (4). Importantly,there is accumulating evidence that the maximum rec-ommended dose can induce mild-to-moderate hepaticcytolysis, even in healthy individuals (5, 6). It is alsonoteworthy that long-term APAP ingestion can inducechronic liver injury in some patients, such as granulom-atous hepatitis and cirrhosis (7, 8).
Different predisposing factors are known, or sus-pected, to significantly enhance the risk and severity of
APAP-induced hepatotoxicity. These factors includemalnutrition and fasting, chronic alcohol abuse andalcoholic liver disease, and hepatitis C virus infection(9–11). Another factor could be comedication withdrugs inducing cytochromes P450 (CYPs), such as iso-niazid, rifampicin and phenobarbital (12, 13), or withdrugs which may modulate liver injury and/or repair(14). The risk of APAP-induced liver injury could alsobe enhanced by some gene polymorphisms, in particularin genes encoding APAP metabolizing enzymes (15, 16).Lastly, a large retrospective study also reported thatobesity-related nonalcoholic fatty liver disease (NAFLD)could be a risk factor for APAP-induced acute liverinjury after APAP overdose (9).
Nonalcoholic fatty liver disease refers to the largespectrum of liver lesions in obese individuals rangingfrom fatty liver to nonalcoholic steatohepatitis (NASH)and cirrhosis. In some countries such as the UnitedStates, it is estimated that the prevalence of NAFLD inthe general population could be about 20% in adults
Liver International (2014)
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd e171
Liver International ISSN 1478-3223
and 10% in children and adolescents (17, 18). Actually,a majority of overweight and obese people develop fattyliver, which is characterized by the presence of large vac-uoles of lipids (mainly triacylglycerol) within the he-patocytes. During obesity, a major mechanism leadingto hepatic accretion of lipids is insulin resistance, whichfavours the redistribution of fat from adipose tissue tothe liver and higher de novo lipogenesis in hepatocytes(19, 20). Importantly, fatty liver can progress in the longterm to NASH in 10–20% of patients. NASH is charac-terized not only by steatosis but also by necroinflamma-tion (with ballooning degeneration of hepatocytes),some fibrosis and the presence of apoptotic hepatocytes.Key factors involved in the pathogenesis of NASHinclude oxidative stress, lipid peroxidation, mitochon-drial dysfunction and overproduction of proinflamma-tory and profibrotic cytokines (20, 21). Impairedactivity of the mitochondrial respiratory chain andinduction of CYP2E1 are two major factors leading toreactive oxygen species (ROS) overproduction duringNASH (20, 22).
As previously mentioned, clinical investigationsreported that NAFLD could favour APAP-induced acuteliver failure after an overdose. Moreover, studies wereperformed in different animal models of obesity andNAFLD to find out whether these metabolic diseasescould favour APAP-induced liver injury. To find out theclinical and experimental studies dealing with the topicof this review, we performed a PubMed search of litera-ture published in the English language using the combi-nation of at least two of the following queries:acetaminophen, obesity (or obese), liver, ‘fatty liver’,NASH, injury and ‘risk factors’. In the present article,the main findings of these clinical and experimentalinvestigations will be presented and subsequently dis-cussed. Prior to these sections, some major features ofAPAP metabolism and liver toxicity will be recalled.
Main features of APAP metabolism and hepatotoxicity
This section will only summarize the current knowledgeabout APAP metabolism and mechanisms of hepatotox-icity as several comprehensive reviews were recentlypublished on these topics (23–26). Briefly, APAP ismainly metabolized in the liver by phase II conjugatingenzymes into the nontoxic glucuronide and sulphateconjugates, which respectively represent about 55% and30–40% of the initial APAP dose (24, 27). In addition, asmall amount of APAP is oxidized to the highly reactivemetabolite N-acetyl-p-benzoquinone imine (NAPQI) byseveral CYPs, especially by CYP2E1 and CYP3A4 (28,29). There is strong evidence that CYP2E1 is the mainenzyme generating NAPQI in mice (29, 30), but severalinvestigations suggested that CYP3A4 could also be animportant enzyme catalysing NAPQI generation inhuman (31–33). Importantly, obesity and related meta-bolic disorders are associated with significant alterationsof APAP pharmacokinetics. In particular, increased
hepatic activity of CYP2E1 and higher APAP glucuroni-dation have consistently been reported in obesity andNAFLD (22, 34–36), although the exact mechanisms ofthese alterations are still poorly understood. In contrast,hepatic activity of CYP3A4 is reduced in obesity andNAFLD (36, 37).
After its formation, NAPQI is rapidly detoxified byhepatic reduced glutathione (GSH) when APAP is takenat the recommended dosage. However, after APAP over-dose, high levels of NAPQI can induce several detrimen-tal effects within the liver. Indeed, hepatocellular GSHstocks are quickly depleted and once GSH is no longeravailable for NAPQI detoxication, this reactive metabo-lite binds to different macromolecules, including cyto-solic and mitochondrial proteins (38, 39). These earlycellular events are then followed by c-jun N-terminalkinase (JNK) activation, profound mitochondrial dys-function and ATP depletion, overproduction of ROSand peroxynitrite and massive hepatocellular necrosis(23, 26, 40). Finally, this initial liver injury is followedby other key events such as inflammation, repair andregeneration that play a major role in the outcome ofAPAP-induced hepatotoxicity (23, 25, 41).
Data from clinical investigations
As already mentioned in the introduction, a large retro-spective study reported an increased risk of APAP-induced acute liver injury after APAP overdose inpatients with NAFLD (9). In this study, patients withpre-existent NAFLD and hospitalized for APAP over-dose had more than a seven-fold higher prevalence ofacute liver injury as compared to those without NAFLD(9). In a subsequent report, Myers and Shaheen reanaly-sed the same database by taking into account potentialdifferences in overdose circumstance, which could be asignificant confounding factor (42). This reanalysis sup-ported the previous findings of a higher risk of APAP-induced hepatotoxicity in patients with NAFLD (9),even though the magnitude of this risk was attenuated(i.e. 3.91 vs. 7.43). Importantly, both studies showedthat the risk of severe acute liver injury after APAP over-dose was increased about similarly with NAFLD andalcoholic liver disease (9, 42). In contrast, two studiesreported that the susceptibility to APAP-induced acuteliver injury was similar, or lower, in obese patients com-pared to nonobese individuals, but NAFLD was unfor-tunately not taken into consideration in theseinvestigations (43, 44). Interestingly, in one of thesestudies, obese patients had significantly poorer out-comes after acute liver failure (43). Altogether, theseclinical investigations suggest that NAFLD, rather thanobesity by itself, could increase the risk of APAP-induced acute liver injury after APAP overdose. Thisimportant point will be discussed later on. However, itis noteworthy that the discordant results between theaforementioned studies on the association between NA-FLD/obesity and APAP-induced acute liver injury could
Liver International (2014)
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltde172
Acetaminophen hepatotoxicity in obesity Michaut et al.
be caused by differences in the criteria adopted to definethese conditions in patients.
As previously mentioned, there is evidence that pre-scription of APAP at the recommended dosage caninduce mild-to-moderate hepatic cytolysis, even inhealthy individuals (5, 6). However, it is still unclearwhether NAFLD could enhance the risk, or the severity,of liver injury after therapeutic dose of APAP, althoughthis has been reported in some obese patients (45).
Data from experimental studies
Different rodent models of obesity and NAFLD can beused experimentally, in particular in investigations deal-ing with the hepatotoxic effects of chemicals such asAPAP (Table 1). Classically, obesity and related meta-bolic disorders can be induced by different types ofhigh-calorie diets (including high-fat and high-sucrose/fructose diets), by genetic defects altering different keyphysiological functions such as food intake and energyexpenditure, or by the combination of nutritional andgenetic approaches (46–50). Among the more com-monly used murine models of genetic obesity, the
C57BL/6J-ob/ob (ob/ob) are characterized by a muta-tion in the leptin gene. Indeed, lack of the adipokineleptin leads to increased food consumption and lowerenergy expenditure, thus resulting in massive obesity,insulin resistance, dyslipidaemia and severe fatty liver(51, 52). C57BL/KsJ-db/db mice and Zucker fa/fa ratspresent a mutation in the gene encoding leptin receptor,which disrupts leptin signalling and induces obesity,insulin resistance and fatty liver (46, 52). The KK-Ay
mice, which present a defect in the signalling of the mel-anocortin receptors, spontaneously develop obesity,fatty liver, type 2 diabetes, arterial hypertension and dia-betic nephropathy (46, 52, 53). These genetic rodentmodels of obesity are associated with metabolic disor-ders that are more severe compared to the nutritionalmodels, but usually with less variability between the ani-mals.
From 1987 to 2012, six different studies reported theeffect of acute APAP intoxication in several animalmodels of obesity and NAFLD (54–59). The main datafrom these investigations are presented in Table 1. Inaddition, one study reported APAP hepatotoxicity in amurine model of methionine and choline deficient
Table 1. Studies reporting APAP-induced acute liver injury in different animal models of NAFLD
References Animal models of NAFLD Presence of NAFLD Dose of APAP Response to APAP toxicity CYP2E1 activity
Corcoran and
Wong (54)
Male Sprague-Dawley
rats fed with a high-fat
diet for 24 weeks
Not reported in
this study*
710 mg/kg
(i.p.)
Higher toxicity after 48 h,
compared to rats fed a
standard diet
Not reported in this
study*
Blouin
et al. (55)
Obese male Zucker
fa/fa rats
Not reported in
this study†
1300 mg
(p.o.)
Similar toxicity after 48 h,
compared to lean rats
Not reported in this
study†
Ito et al. (56) Male C57Bl/6 mice
fed a ‘Western-style’
diet for 16 weeks
Male ob/ob mice
Yes
Not reported in
this study‡
300 mg/kg
(p.o.)
300 mg/kg
(p.o.)
Lower toxicity after 6 h,
compared to mice fed
a standard diet
Lower toxicity after 6 h,
compared to wild-type
mice
Not reported in this
study*
Not reported in this
study‡
Kon et al. (57) Male KK-Ay mice Yes 300 or
600 mg/kg
(p.o.)
Higher toxicity after 6 h,
compared to wild-type
mice
Not reported in this
study§
Kucera
et al. (58)
Male Sprague-Dawley
rats fed a high-fat
diet for 6 weeks
Yes 1 g/kg
(p.o)
Higher toxicity after
24 and 48 h, compared
to rats fed a standard diet
Not reported in this
study*
Aubert
et al. (59)
Female db/db mice
Female ob/ob mice
Yes
Yes
500 mg/kg
(p.o.)
500 mg/kg
(p.o.)
Higher toxicity after 8 h,
compared to wild-type
mice
Similar toxicity after 8 h,
compared to wild-type
mice
Increased
Unchanged
Donthamsetty
et al. (60)
Male Swiss Webster mice
fed a MCD diet for
1 month
Yes 360 mg/kg
(i.p.)
Higher toxicity from 6 to
48 h after overdose, compared
to mice fed a standard diet
Unchanged
*Different investigations in rats showed that long-term feeding with high-fat diets induce NAFLD (reviewed in 46 and 49) and increase the expression
and/or activity of CYP2E1 (reviewed in 22).
†Other studies showed that male obese and insulin resistant Zucker fa/fa rats present moderate fatty liver (106, 107), but reduced CYP2E1 activity
(106, 108).
‡Other studies showed that male obese and diabetic ob/ob mice present major fatty liver (50, 104, 109), with unchanged (59) or reduced (67)
CYP2E1 activity.
§One study showed that male KK-Ay mice present unchanged hepatic mRNA expression of CYP2E1 (110).
Liver International (2014)
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd e173
Michaut et al. Acetaminophen hepatotoxicity in obesity
(MCD) diet-induced steatohepatitis (Table 1) (60).However, it must be pointed out that the MCD dietconsistently leads to a dramatic loss of body weight (61–63) and does not induce systemic insulin resistance (63,64). It is also noteworthy that the doses of APAP greatlyvaried in these seven studies, with the highest doses usedin the rat models (Table 1). This is because rats aremuch more resistant to APAP-induced liver injury com-pared to mice (65, 66).
Among these different studies (Table 1), four of themshowed that NAFLD was associated with higher liverinjury after a single APAP overdose (57–60). Anotherstudy also showed higher APAP toxicity in rats fed ahigh-fat diet (54), although the presence of NAFLD canonly be suspected in this study (Table 1). In contrast,the remaining investigations showed similar (55) orlower liver injury (56). Unfortunately, there is no defi-nite explanation for these discrepancies, although somehypotheses can be put forward. For instance, investiga-tions in male and female ob/ob and db/db mice showedthat the hepatic CYP2E1 status could play a significantrole (59). Indeed, higher APAP hepatotoxicity wasobserved in female db/db mice but not in female ob/obmice and this was associated with a specific induction ofCYP2E1 activity in the first group of animals. Interest-ingly, hepatic CYP2E1 activity was unchanged (59) orreduced (67) in male ob/ob mice and this could explainwhy Ito and collaborators reported lower acute APAPhepatotoxicity in this model (56). It is also noteworthythat plasma levels of APAP-glucuronide and APAP-sul-phate were almost similar between female db/db miceand female ob/ob mice after 500 mg/kg of APAP (59).Hence, the observed difference of APAP-induced hepa-totoxicity between these murine models cannot beattributed to APAP glucuronidation and sulphation.
At the moment, it is still unclear why hepatic CYP2E1is specifically induced in female but not in male db/dbmice (59). Although there was an overall positive corre-lation between hepatic CYP2E1-mediated anilinehydroxylase activity and plasma glucose in all groups ofuntreated mice (i.e. wild-type, ob/ob and db/db of bothsexes), plasma glucose levels were not different betweenmale and female db/db mice (59). Thus, hepaticCYP2E1 induction in female db/db mice may not beexplained by the severity of insulin resistance and type 2diabetes in these animals, contrary to what has beensuggested by some investigations (22). In addition, therewas no difference in plasma b-hydroxybutyrate levelsbetween female and male db/db mice (59). This suggeststhat ketone bodies may not be responsible for CYP2E1induction in female db/db mice, although previousinvestigations found a significant correlation betweenplasma b-hydroxybutyrate levels and hepatic CYP2E1activity (34, 68). Thus, further investigations will beneeded to determine the exact mechanism of higherhepatic CYP2E1 activity in female db/db mice.
Besides differences in APAP biotransformation toNAPQI, higher susceptibility to APAP-induced liver
injury might be explained by lipid accumulation andoxidative stress associated with NAFLD. Regarding lipidaccretion, it is noteworthy that higher APAP hepatotox-icity in female db/db mice compared to female ob/obmice was observed despite lower lipid accumulation indb/db liver (59). Importantly, the basal plasma levels ofALT and AST (i.e. before APAP intoxication) were com-parable between female db/db and female ob/ob mice(59). Thus, increased susceptibility to APAP hepatotox-icity in female db/db mice cannot be attributed to thepre-existence of higher hepatic cytolysis. However, fur-ther studies will be required to find out whether theaccumulation of some lipid species could be involved.Indeed, it is noteworthy that db/db hepatocytes presentmore microvesicular steatosis and less macrovacuolarsteatosis compared to ob/ob hepatocytes (50, 59).Because the size of the droplets is greatly dependent ontheir lipid composition (69, 70), it is possible that theaccumulation of some specific lipid species in femaledb/db hepatocytes could have played a role in the highersusceptibility to APAP toxicity.
Nonalcoholic fatty liver disease is associated with oxi-dative stress, which can alter different cellular compo-nents such as nucleic acids and unsaturated fatty acids(20, 71, 72). Moreover, hepatic GSH reserves could belowered in NAFLD, thus reducing the antioxidantcapacity of the fatty hepatocytes (20, 73). Hence, thehigher susceptibility to APAP hepatotoxicity observedin some rodent models of obesity might be related tobasal oxidative stress and lower GSH levels. Yet, basalhepatic GSH levels were not significantly reduced in tworodent models of obesity showing higher vulnerabilityto APAP toxicity (58, 59). It is however noteworthy thattotal GSH levels were assessed in these studies and thusit will be important to determine whether mitochon-drial GSH was specifically depleted. Indeed, some inves-tigations suggested a key role of the mitochondrial poolof GSH in APAP-induced liver injury (74, 75).
As previously mentioned, JNK activation plays amajor role in APAP-induced hepatotoxicity (23, 26, 40).Interestingly, JNK activation could also play a signifi-cant role in NAFLD pathogenesis (76, 77). Only twostudies examined the hepatic JNK status in obese ani-mals intoxicated by APAP (57, 59). In the first study,JNK activation (as assessed by phospho-JNK) afterAPAP intoxication was significantly stronger in obeseand diabetic KK-Ay mice compared to wild-type mice,and this was associated to higher APAP hepatotoxicityin the obese animals (57). In the second study, increasedAPAP hepatotoxicity in db/db mice was not associatedto higher JNK phosphorylation (59). Unexpectedly,hepatic JNK was specifically activated in ob/ob micealthough these animals did not present higher APAPliver injury (59). Thus, JNK activation might not be akey mechanism of APAP hepatotoxicity in some murinemodels of NAFLD. Further investigations will be neededto assess phospho-JNK not only in whole liver but alsoin isolated mitochondria (78).
Liver International (2014)
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltde174
Acetaminophen hepatotoxicity in obesity Michaut et al.
In addition to the investigations performed in rodentmodels of obesity, one study reported the effect of acuteAPAP intoxication in a murine model of MCD diet-induced steatohepatitis (Table 1) (60). In this study,higher APAP hepatotoxicity was observed despite thelack of pre-existent CYP2E1 induction and the presenceof normal basal hepatic GSH levels (60), suggesting theinvolvement of other mechanism(s). Interestingly, thebasal hepatic ATP levels were already reduced by 45% inmice fed the MCD diet (60), which is consistent with asignificant impairment of the mitochondrial respiratorychain and oxidative phosphorylation in this experimen-tal model (79, 80). Hence, severe pre-existent mitochon-drial dysfunction might have played a role in the higherAPAP hepatotoxicity observed in mice fed the MCDdiet.
General discussion
Although the presence of NAFLD in obese individualsseems to increase the risk of APAP-induced acute liverinjury (9, 42), these clinical studies did not address themechanism whereby APAP could be more toxic in thismetabolic situation. Nevertheless, increased hepaticCYP2E1 activity has frequently been reported in patientswith NAFLD (22, 34, 81–83), as previously mentioned.However, it is still unclear whether CYP2E1 induction isspecifically linked to this liver disease, or to other meta-bolic disturbances linked to obesity, such as insulinresistance and type 2 diabetes (22). In the experimentalstudies, fatty liver in obese rodents was in general associ-ated with higher hepatotoxicity after APAP overdoses(Table 1)(57–59). In one of these studies, increasedacute liver injury seemed to correlate with pre-existenthepatic CYP2E1 induction, but not with the degree offat accretion (i.e. severity of fatty liver) (59). However, itis important to point out that greater hepatotoxicity inthese different experimental studies was observed afterthe administration of APAP doses that were adapted tobody weights. Hence, obese animals were treated withhigher absolute doses of APAP.
Contrasting with these studies, obesity was not asso-ciated with higher APAP hepatotoxicity in patients (forwhom the presence of NAFLD was not reported, as pre-viously pointed out) (43, 44). Experimentally, similar orlower APAP hepatotoxicity was observed in somerodent models of obesity (Table 1) (55, 56, 59). NAFLDwas objectified only in some of these investigations, butfor those where NAFLD was not determined it shouldbe mentioned that previous studies demonstrated thepresence of NAFLD in the same animal models(Table 1). Interestingly, obesity has been associated withhigher APAP glucuronidation and clearance in differentclinical and experimental investigations (35, 36, 59, 84–86), as previously mentioned. In contrast, the influenceof obesity and NAFLD on APAP sulphation is unclearsince investigations in rodents and patients provideddivergent results (59, 87–89). CYP3A activity is lower in
obesity and NAFLD (36, 37, 90, 91), and this mayreduce the generation of NAPQI. In addition, obesitycould lead to reduced APAP gastrointestinal absorptionrate and higher APAP volume of distribution, thusfavouring lower APAP plasma concentrations (92, 93).Thus, it appears that the occurrence of APAP-inducedliver injury in an obese individual will depend on a deli-cate balance between metabolic factors that can be pro-tective (higher APAP glucuronidation and volume ofdistribution, lower absorption rate and CYP3A4 activ-ity) and others that can augment the hepatic productionof NAPQI (CYP2E1 induction), or reduce the detoxica-tion of this highly reactive metabolite (lower GSHstores) (Fig. 1).
APAP-induced liver injury in obesity and NAFLD
Factors that could protect against liver injury
Gastrointestinal absorption Hepatic glucuronidation
Factors that could favour liver injury
Volume of distribution
Hepatic CYP2E1 activity Presence of NASH?
Generation of NAPQI
Hepatic GSH stores Mito dysfunction?
Mito dysfunction
Oxidative stress
Lower risk and severity of hepatic cytolysis
Hepatic CYP3A4 activity
Generation of NAPQI
NAPQI detoxication
APAP plasma levels
Stronger risk and severity of hepatic cytolysis
Fig. 1. Factors that could modulate the risk and severity of APAP-induced hepatotoxicity in obesity and NAFLD. (A) Factors that couldprotect against APAP-induced liver injury include reduced gastroin-testinal absorption and hepatic CYP3A4 activity, as well as highervolume of distribution and hepatic glucuronidation. Overall, thesefactors can reduce plasma levels of APAP and the hepatic genera-tion of NAPQI, a highly toxic APAP metabolite. (B) Factors thatcould favour APAP-induced liver injury include higher hepaticCYP2E1 activity, which leads to NAPQI overproduction and lowerGSH stores in liver, which reduce its ability to detoxify NAPQI. Fur-ther investigations will be required to determine whether the pres-ence of steatohepatitis (NASH) and/or the pre-existence ofmitochondrial dysfunction could favour APAP-induced hepatotoxic-ity in obese individuals.
Liver International (2014)
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd e175
Michaut et al. Acetaminophen hepatotoxicity in obesity
Remaining issues and future directions
Although there is some evidence that CYP2E1 inductioncould favour APAP-induced hepatotoxicity in the con-text of obesity and NAFLD, it is conceivable that otherhepatic disturbances could play a role. For instance, itwill be important to determine whether the severity ofNAFLD could be a significant factor. Intuitively, onemay expect that the presence of necroinflammation (i.e.NASH) could be associated with a higher risk, as com-pared to simple fatty liver. Likewise, the pre-existence ofmitochondrial dysfunction linked to NASH (20, 94)could be of importance since this cellular event plays akey role in APAP-induced liver injury (23, 26, 40, 95).The relationship between NAFLD, reduced levels ofhepatic GSH and APAP-induced liver injury will alsorequire further investigations.
Considering the low number of clinical studies pub-lished on APAP hepatotoxicity in obese patients, furtherinvestigations are clearly required to gain more informa-tion on this matter. More specifically, investigations willbe needed to determine which obese individuals will beat risk for APAP-induced hepatotoxicity and those whowill not. Indeed, at the current stage of knowledge, thehealth authorities cannot provide specific warnings forthe whole obese population. Novel findings are not onlyneeded on acute liver injury after APAP overdose butalso regarding APAP hepatotoxicity occurring duringchronic administration (7, 8). Thus, physicians could beencouraged to carry out a regular monitoring of liverfunction in obese patients treated with APAP, in partic-ular in patients with pre-existing NAFLD. Large pro-spective studies will also be required to establishwhether dysmetabolic disturbances other than NAFLDcould favour APAP hepatotoxicity, such as insulin resis-tance and type 2 diabetes. Interestingly, diabetes hasbeen associated with a higher risk of severe drug-induced liver injury (96), although APAP cases wereexcluded in this study. It will also be important to deter-mine the precise mechanism of CYP2E1 induction inobese patients with NAFLD. Previous clinical studiesshowed that hepatic CYP2E1 activity correlated withplasma ketone bodies and the degree of steatosis (34, 81,82), suggesting that some lipid derivatives could beCYP2E1 inducers in humans. In keeping with thisnotion, current investigations in our laboratory indicatethat CYP2E1 activity can significantly be induced inhuman hepatocytes by stearic acid, but not oleic acid.Moreover, our data show that stearate-induced CYP2E1induction is reduced by insulin in a concentration-dependent manner. Interestingly, CYP2E1 activity wasnot correlated with its mRNA and protein expressionsuggesting post-translational regulation, as previouslyreported in other pathophysiological situations (97, 98).Thus, it appears that CYP2E1 activity in human livercould be controlled by some lipid derivatives and thatlipid-induced CYP2E1 induction could be variabledepending on insulin signalling. Identification of the
potential CYP2E1 endogenous inducers might help notonly to decipher the pathophysiology of NAFLD (22)but also to understand why some obese individuals seemto present a higher risk of APAP-induced liver injury.
It must finally be pointed out that besides APAP,other drugs such as halothane, methotrexate and someantiretroviral drugs are suspected to be more hepato-toxic in patients suffering from obesity and relatedmetabolic disorders (99, 100). In contrast to APAP,virtually no experimental investigations have beenperformed with these drugs to understand why obesitycan favour their hepatotoxicity. In future, it will beimportant to carry out experimental studies with thesuspected drugs to determine the mechanism(s) ofhepatotoxicity in the context of obesity and fatty liver,although one may expect that some mechanisms ofhepatotoxicity could be common between certain drugs.In addition to in vitro studies using cellular models ofnutritional fatty liver (101), in vivo investigations inobese rodents will be also required. Indeed, recent stud-ies suggested that the effects of some xenobiotics onliver could be dependent on extra-hepatic tissues suchas intestine and white adipose tissue (102–105). Hence,the mechanisms of drug-induced liver injury in obesityand NAFLD might be more complex than expected.
Acknowledgements
Conflict of interest: The authors do not have any disclo-sures to report.
References
1. Toussaint K, Yang XC, Zielinski MA, et al. What do we(not) know about how paracetamol (acetaminophen)works? J Clin Pharm Ther 2010; 35: 617–38.
2. Craig DG, Bates CM, Davidson JS, et al. Overdosepattern and outcome in paracetamol-induced acutesevere hepatotoxicity. Br J Clin Pharmacol 2011; 71:273–82.
3. Antoine DJ, Dear JW, Lewis PS, et al. Mechanistic bio-markers provide early and sensitive detection of acetami-nophen-induced acute liver injury at first presentation tohospital. Hepatology 2013; 58: 777–87.
4. Ferner RE, Dear JW, Bateman DN. Management of par-acetamol poisoning. BMJ 2011; 342: d2218.
5. Watkins PB, Kaplowitz N, Slattery JT, et al. Aminotrans-ferase elevations in healthy adults receiving 4 grams ofacetaminophen daily: a randomized controlled trial.JAMA 2006; 296: 87–93.
6. Winnike JH, Li Z, Wright FA, et al. Use of pharmaco-metabonomics for early prediction of acetaminophen-induced hepatotoxicity in humans. Clin Pharmacol Ther2010; 88: 45–51.
7. Biour M, Ben Salem C, Chazouill�eres O, et al. Drug-induced liver injury; fourteenth updated edition of thebibliographic database of liver injuries and related drugs.Gastroenterol Clin Biol 2004; 28: 720–59.
8. Watelet J, Laurent V, Bressenot A, et al. Toxicity ofchronic paracetamol ingestion. Aliment Pharmacol Ther2007; 26: 1543–4.
Liver International (2014)
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltde176
Acetaminophen hepatotoxicity in obesity Michaut et al.
9. Nguyen GC, Sam J, Thuluvath PJ. Hepatitis C is a predic-tor of acute liver injury among hospitalizations for acet-aminophen overdose in the United States: a nationwideanalysis. Hepatology 2008; 48: 1336–41.
10. Myers RP, Shaheen AA, Li B, et al. Impact of liver dis-ease, alcohol abuse, and unintentional ingestions on theoutcomes of acetaminophen overdose. Clin GastroenterolHepatol 2008; 6: 918–25.
11. Claridge LC, Eksteen B, Smith A, et al. Acute liver failureafter administration of paracetamol at the maximum rec-ommended daily dose in adults. BMJ 2010; 341: c6764.
12. Nolan CM, Sandblom RE, Thummel KE, et al. Hepato-toxicity associated with acetaminophen usage in patientsreceiving multiple drug therapy for tuberculosis. Chest1994; 105: 408–11.
13. Lane JE, Belson MG, Brown DK, et al. Chronic acetami-nophen toxicity: a case report and review of the literature.J Emerg Med 2002; 23: 253–6.
14. Suzuki A, Yuen N, Walsh J, et al. Co-medications thatmodulate liver injury and repair influence clinical out-come of acetaminophen-associated liver injury. Clin Gas-troenterol Hepatol 2009; 7: 882–8.
15. Harrill AH, Watkins PB, Su S, et al. Mouse population-guided resequencing reveals that variants in CD44 con-tribute to acetaminophen-induced liver injury inhumans. Genome Res 2009; 19: 1507–15.
16. Court MH, Peter I, Hazarika S, et al. Candidate genepolymorphisms in patients with acetaminophen-inducedacute liver failure. Drug Metab Dispos 2014; 42: 28–32.
17. Lazo M, Hernaez R, Eberhardt MS, et al. Prevalence ofnonalcoholic fatty liver disease in the United States: theThird National Health and Nutrition Examination Sur-vey, 1988-1994. Am J Epidemiol 2013; 178: 38–45.
18. Berardis S, Sokal E. Pediatric non-alcoholic fatty liver dis-ease: an increasing public health issue. Eur J Pediatr 2014;173: 131–9.
19. Tamura S, Shimomura I. Contribution of adipose tissueand de novo lipogenesis to nonalcoholic fatty liver dis-ease. J Clin Invest 2005; 115: 1139–42.
20. Begriche K, Massart J, Robin MA, et al. Mitochondrialadaptations and dysfunctions in nonalcoholic fatty liverdisease. Hepatology 2013; 58: 1497–507.
21. Fabbrini E, Sullivan S, Klein S. Obesity and nonalcoholicfatty liver disease: biochemical, metabolic, and clinicalimplications. Hepatology 2010; 51: 679–89.
22. Aubert J, Begriche K, Knockaert L, et al. Increasedexpression of cytochrome P450 2E1 in nonalcoholic fattyliver disease: mechanisms and pathophysiological role.Clin Res Hepatol Gastroenterol 2011; 35: 630–7.
23. Hinson JA, Roberts DW, James LP. Mechanisms of acet-aminophen-induced liver necrosis. Handb Exp Pharmacol2010; 196: 369–405.
24. Zhao L, Pickering G. Paracetamol metabolism andrelated genetic differences. Drug Metab Rev 2011; 43:41–52.
25. Jaeschke H, Williams CD, Ramachandran A, et al. Acet-aminophen hepatotoxicity and repair: the role of sterileinflammation and innate immunity. Liver Int 2012; 32:8–20.
26. Jaeschke H, McGill MR, Ramachandran A. Oxidantstress, mitochondria, and cell death mechanisms in drug-induced liver injury: lessons learned from acetaminophenhepatotoxicity. Drug Metab Rev 2012; 44: 88–106.
27. Prescott LF. Kinetics and metabolism of paracetamol andphenacetin. Br J Clin Pharmacol 1980; 10(Suppl 2): 291S–8S.
28. Dahlin DC, Miwa GT, Lu AY, et al. N-acetyl-p-benzoqui-none imine: a cytochrome P450-mediated oxidationproduct of acetaminophen. Proc Natl Acad Sci USA 1984;81: 1327–31.
29. Gonzalez FJ. The 2006 Bernard B. Brodie Award Lecture.Cyp2E1. Drug Metab Dispos 2007; 35: 1–8.
30. Lee SS, Buters JT, Pineau T, et al. Role of CYP2E1 in thehepatotoxicity of acetaminophen. J Biol Chem 1996; 271:12063–7.
31. Thummel KE, Lee CA, Kunze KL, et al. Oxidation ofacetaminophen to N-acetyl-p-aminobenzoquinone imineby human CYP3A4. Biochem Pharmacol 1993; 45: 1563–9.
32. Yoshitomi S, Ikemoto K, Takahashi J, et al. Establish-ment of the transformants expressing human cytochromeP450 subtypes in HepG2, and their applications on drugmetabolism and toxicology. Toxicol In Vitro 2001; 15:245–56.
33. Laine JE, Auriola S, Pasanen M, et al. Acetaminophenbioactivation by human cytochrome P450 enzymes andanimal microsomes. Xenobiotica 2009; 39: 11–21.
34. Chalasani N, Gorski JC, Asghar MS, et al. Hepatic cyto-chrome P450 2E1 activity in nondiabetic patients withnonalcoholic steatohepatitis. Hepatology 2003; 37: 544–50.
35. Abernethy DR, Greenblatt DJ, Divoll M, et al. Enhancedglucuronide conjugation of drugs in obesity: studies oflorazepam, oxazepam, and acetaminophen. J Lab ClinMed 1983; 101: 873–80.
36. Brill MJ, Diepstraten J, van Rongen A, et al. Impact ofobesity on drug metabolism and elimination in adultsand children. Clin Pharmacokinet 2012; 51: 277–304.
37. Patoine D, Levac X, Pilote S, et al. Decreased CYP3Aexpression and activity in guinea pig models of diet-induced metabolic syndrome: is fatty liver infiltrationinvolved? Drug Metab Dispos 2013; 41: 952–7.
38. Qiu Y, Benet LZ, Burlingame AL. Identification of thehepatic protein targets of reactive metabolites of acetami-nophen in vivo in mice using two-dimensional gel elec-trophoresis and mass spectrometry. J Biol Chem 1998;273: 17940–53.
39. Muldrew KL, James LP, Coop L, et al. Determination ofacetaminophen-protein adducts in mouse liver andserum and human serum after hepatotoxic doses of acet-aminophen using high-performance liquid chromatogra-phy with electrochemical detection. Drug Metab Dispos2002; 30: 446–51.
40. Han D, Shinohara M, Ybanez MD, et al. Signal transduc-tion pathways involved in drug-induced liver injury.Handb Exp Pharmacol 2010; 196: 267–310.
41. Uzi D, Barda L, Scaiewicz V, et al. CHOP is a critical reg-ulator of acetaminophen-induced hepatotoxicity. J Hepa-tol 2013; 59: 495–503.
42. Myers RP, Shaheen AA. Hepatitis C alcohol abuse, andunintentional overdoses are risk factors for acetamino-phen-related hepatotoxicity. Hepatology 2009; 49: 1399–400.
43. Rutherford A, Davern T, Hay JE, et al. Influence of highbody mass index on outcome in acute liver failure. ClinGastroenterol Hepatol 2006; 4: 1544–9.
Liver International (2014)
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd e177
Michaut et al. Acetaminophen hepatotoxicity in obesity
44. Radosevich JJ, Patanwala AE, Erstad BL. Hepatotoxicityin obese versus nonobese patients with acetaminophenpoisoning who are treated with intravenous N-acetylcys-teine. Am J Ther 2013; doi: 10.1097/01.mjt.0000434043.62372.00 [Epub ahead of print].
45. Forget P, Wittebole X, Laterre PF. Therapeutic dose ofacetaminophen may induce fulminant hepatitis in thepresence of risk factors: a report of two cases. Br J Anaesth2009; 103: 899–900.
46. Koteish A, Diehl AM. Animal models of steatosis. SeminLiver Dis 2001; 21: 89–104.
47. Begriche K, Lett�eron P, Abbey-Toby A, et al. Partial lep-tin deficiency favors diet-induced obesity and relatedmetabolic disorders in mice. Am J Physiol EndocrinolMetab 2008; 294: E939–51.
48. Begriche K, Massart J, Abbey-Toby A, et al. b-Aminoiso-butyric acid prevents diet-induced obesity in mice withpartial leptin deficiency. Obesity 2008; 16: 2053–67.
49. Hebbard L, George J. Animal models of nonalcoholicfatty liver disease. Nat Rev Gastroenterol Hepatol 2011; 8:35–44.
50. Trak-Smayra V, Paradis V, Massart J, et al. Pathology ofthe liver in obese and diabetic ob/ob and db/db mice feda standard or high-calorie diet. Int J Exp Pathol 2011; 92:413–21.
51. Lindstr€om P. The physiology of obese-hyperglycemicmice [ob/ob mice]. ScientificWorldJournal 2007; 7: 666–85.
52. Fellmann L, Nascimento AR, Tibiric�a E, et al. Murinemodels for pharmacological studies of the metabolic syn-drome. Pharmacol Ther 2013; 137: 331–40.
53. Okazaki M, Saito Y, Udaka Y, et al. Diabetic nephropathyin KK and KK-Ay mice. Exp Anim 2002; 51: 191–6.
54. Corcoran GB, Wong BK. Obesity as a risk factor in drug-induced organ injury: increased liver and kidney damageby acetaminophen in the obese overfed rat. J PharmacolExp Ther 1987; 241: 921–7.
55. Blouin RA, Dickson P, McNamara PJ, et al. Phenobarbi-tal induction and acetaminophen hepatotoxicity: resis-tance in the obese Zucker rodent. J Pharmacol Exp Ther1987; 243: 565–70.
56. Ito Y, Abril ER, Bethea NW, et al. Dietary steatotic liverattenuates acetaminophen hepatotoxicity in mice. Micro-circulation 2006; 13: 19–27.
57. Kon K, Ikejima K, Okumura K, et al. Diabetic KK-A(y)mice are highly susceptible to oxidative hepatocellulardamage induced by acetaminophen. Am J Physiol Gastro-intest Liver Physiol 2010; 299: G329–37.
58. Kucera O, Rousar T, Stankova P, et al. Susceptibility ofrat non-alcoholic fatty liver to the acute toxic effect ofacetaminophen. J Gastroenterol Hepatol 2012; 27: 323–30.
59. Aubert J, Begriche K, Delannoy M, et al. Differences inearly acetaminophen hepatotoxicity between obese ob/oband db/db mice. J Pharmacol Exp Ther 2012; 342: 676–87.
60. Donthamsetty S, Bhave VS, Mitra MS, et al. Nonalco-holic steatohepatitic (NASH) mice are protected fromhigher hepatotoxicity of acetaminophen upon inductionof PPARalpha with clofibrate. Toxicol Appl Pharmacol2008; 230: 327–37.
61. Leclercq IA, Farrell GC, Field J, et al. CYP2E1 and CYP4Aas microsomal catalysts of lipid peroxides in murine non-alcoholic steatohepatitis. J Clin Invest 2000; 105: 1067–75.
62. Rizki G, Arnaboldi L, Gabrielli B, et al. Mice fed alipogenic methionine-choline-deficient diet develop
hypermetabolism coincident with hepatic suppression ofSCD-1. J Lipid Res 2006; 47: 2280–90.
63. Leclercq IA, Lebrun VA, St€arkel P, et al. Intrahepaticinsulin resistance in a murine model of steatohepatitis:effect of PPARgamma agonist pioglitazone. Lab Invest2007; 87: 56–65.
64. Rinella ME, Green RM. The methionine-choline deficientdietary model of steatohepatitis does not exhibit insulinresistance. J Hepatol 2004; 40: 47–51.
65. Tee LB, Davies DS, Seddon CE, et al. Species differencesin the hepatotoxicity of paracetamol are due to differ-ences in the rate of conversion to its cytotoxic metabolite.Biochem Pharmacol 1987; 36: 1041–52.
66. Jemnitz K, Veres Z, Monostory K, et al. Interspecies dif-ferences in acetaminophen sensitivity of human, rat, andmouse primary hepatocytes. Toxicol In Vitro 2008; 22:961–7.
67. Enriquez A, Leclercq I, Farrell GC, et al. Altered expres-sion of hepatic CYP2E1 and CYP4A in obese, diabetic ob/ob mice, and fa/fa Zucker rats. Biochem Biophys Res Com-mun 1999; 255: 300–6.
68. Bellward GD, Chang T, Rodrigues B, et al. Hepatic cyto-chrome P-450j induction in the spontaneously diabeticBB rat.Mol Pharmacol 1988; 33: 140–3.
69. Guo Y, Walther TC, Rao M, et al. Functional genomicscreen reveals genes involved in lipid-droplet formationand utilization. Nature 2008; 453: 657–61.
70. Shi X, Li J, Zou X, et al. Regulation of lipid droplet sizeand phospholipid composition by stearoyl-CoA desatur-ase. J Lipid Res 2013; 54: 2504–14.
71. Seki S, Kitada T, Sakaguchi H. Clinicopathological signif-icance of oxidative cellular damage in non-alcoholic fattyliver diseases. Hepatol Res 2005; 33: 132–4.
72. Bell LN, Temm CJ, Saxena R, et al. Bariatric surgery-induced weight loss reduces hepatic lipid peroxidationlevels and affects hepatic cytochrome P450 protein con-tent. Ann Surg 2010; 251: 1041–8.
73. Videla LA, Rodrigo R, Orellana M, et al. Oxidative stress-related parameters in the liver of non-alcoholic fatty liverdisease patients. Clin Sci 2004; 106: 261–8.
74. Zhao P, Kalhorn TF, Slattery JT. Selective mitochondrialglutathione depletion by ethanol enhances acetamino-phen toxicity in rat liver. Hepatology 2002; 36: 326–35.
75. Fernandez-Checa JC, Kaplowitz N. Hepatic mitochon-drial glutathione: transport and role in disease and toxic-ity. Toxicol Appl Pharmacol 2005; 204: 263–73.
76. Singh R, Wang Y, Xiang Y, et al. Differential effects ofJNK1 and JNK2 inhibition on murine steatohepatitis andinsulin resistance. Hepatology 2009; 49: 87–96.
77. Abdelmegeed MA, Banerjee A, Yoo SH, et al. Critical roleof cytochrome P450 2E1 (CYP2E1) in the developmentof high fat-induced non-alcoholic steatohepatitis. J Hepa-tol 2012; 57: 860–6.
78. Hanawa N, Shinohara M, Saberi B, et al. Role of JNKtranslocation to mitochondria leading to inhibition ofmitochondria bioenergetics in acetaminophen-inducedliver injury. J Biol Chem 2008; 283: 13565–77.
79. Serviddio G, Bellanti F, Tamborra R, et al. Alterations ofhepatic ATP homeostasis and respiratory chain duringdevelopment of non-alcoholic steatohepatitis in a rodentmodel. Eur J Clin Invest 2008; 38: 245–52.
80. Serviddio G, Bellanti F, Giudetti AM, et al. A silybin-phospholipid complex prevents mitochondrial dysfunc-
Liver International (2014)
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltde178
Acetaminophen hepatotoxicity in obesity Michaut et al.
tion in a rodent model of nonalcoholic steatohepatitis. JPharmacol Exp Ther 2010; 332: 922–32.
81. Emery MG, Fisher JM, Chien JY, et al. CYP2E1 activitybefore and after weight loss in morbidly obese subjectswith nonalcoholic fatty liver disease. Hepatology 2003; 38:428–35.
82. Chtioui H, Semela D, Ledermann M, et al. Expressionand activity of the cytochrome P450 2E1 in patients withnonalcoholic steatosis and steatohepatitis. Liver Int 2007;27: 764–71.
83. Varela NM, Qui~nones LA, Orellana M, et al. Study ofcytochrome P450 2E1 and its allele variants in liver injuryof nondiabetic, nonalcoholic steatohepatitis obesewomen. Biol Res 2008; 41: 81–92.
84. Barshop NJ, Capparelli EV, Sirlin CB, et al. Acetamino-phen pharmacokinetics in children with nonalcoholicfatty liver disease. J Pediatr Gastroenterol Nutr 2011; 52:198–202.
85. Xu J, Kulkarni SR, Li L, et al. UDP-glucuronosyltransfer-ase expression in mouse liver is increased in obesity andfasting-induced steatosis. Drug Metab Dispos 2012; 40:259–66.
86. Gicquel T, Aubert J, Lepage S, et al. Quantitative analysisof acetaminophen and its primary metabolites in smallplasma volumes by liquid chromatography-tandem massspectrometry. J Anal Toxicol 2013; 37: 110–6.
87. Corcoran GB, Wong BK, Shum L, et al. Acetaminophensulfation deficit in obese rats overfed an energy-dense caf-eteria diet. Endocr Res 1987; 13: 101–21.
88. Chaudhary IP, Tuntaterdtum S, McNamara PJ, et al.Effect of genetic obesity and phenobarbital treatment onthe hepatic conjugation pathways. J Pharmacol Exp Ther1993; 265: 1333–8.
89. Hardwick RN, Ferreira DW, More VR, et al. AlteredUDP-glucuronosyltransferase and sulfotransferaseexpression and function during progressive stages ofhuman nonalcoholic fatty liver disease. Drug Metab Dis-pos 2013; 41: 554–61.
90. Yoshinari K, Takagi S, Yoshimasa T, et al. HepaticCYP3A expression is attenuated in obese mice fed a high-fat diet. Pharm Res 2006; 23: 1188–200.
91. Kolwankar D, Vuppalanchi R, Ethell B, et al. Associationbetween nonalcoholic hepatic steatosis and hepatic cyto-chrome P-450 3A activity. Clin Gastroenterol Hepatol2007; 5: 388–93.
92. Lee WH, Kramer WG, Granville GE. The effect of obesityon acetaminophen pharmacokinetics in man. J Clin Phar-macol 1981; 21: 284–7.
93. Abernethy DR, Divoll M, Greenblatt DJ, et al. Obesity,sex, and acetaminophen disposition. Clin Pharmacol Ther1982; 31: 783–90.
94. Grattagliano I, de Bari O, Bernardo TC, et al. Role ofmitochondria in nonalcoholic fatty liver disease: fromorigin to propagation. Clin Biochem 2012; 45: 610–8.
95. Knockaert L, Descatoire V, Vadrot N, et al. Mitochon-drial CYP2E1 is sufficient to mediate oxidative stress and
cytotoxicity induced by ethanol and acetaminophen. Tox-icol In Vitro 2011; 25: 475–84.
96. Chalasani N, Fontana RJ, Bonkovsky HL, et al. Causes,clinical features, and outcomes from a prospective studyof drug-induced liver injury in the United States. Gastro-enterology 2008; 135: 1924–34.
97. Oesch-Bartlomowicz B, Padma PR, Becker R, et al. Dif-ferential modulation of CYP2E1 activity by cAMP-depen-dent protein kinase upon Ser129 replacement. Exp CellRes 1998; 242: 294–302.
98. Wauthier V, Schenten V, Verbeeck RK, et al. Ageing isassociated with increased expression but decreased activ-ity of CYP2E1 in male Wistar rats. Life Sci 2006; 79:1913–20.
99. Fromenty B. Drug-induced liver injury in obesity. J Hepa-tol 2013; 58: 824–6.
100. Pais R, Rusu E, Ratziu V. The impact of obesity and met-abolic syndrome on chronic hepatitis B and drug-induced liver disease. Clin Liver Dis 2014; 18: 165–78.
101. Anth�erieu S, Rogue A, Fromenty B, et al. Induction ofvesicular steatosis by amiodarone and tetracycline is asso-ciated with up-regulation of lipogenic genes in HepaRGcells. Hepatology 2011; 53: 1895–905.
102. Song Z, Zhou Z, Deaciuc I, et al. Inhibition of adipo-nectin production by homocysteine: a potential mech-anism for alcoholic liver disease. Hepatology 2008; 47:867–79.
103. Fromenty B, Vadrot N, Massart J, et al. Chronic ethanolconsumption lessens the gain of body weight, liver trigly-cerides, and diabetes in obese ob/ob mice. J PharmacolExp Ther 2009; 331: 23–34.
104. Massart J, Robin MA, Noury F, et al. Pentoxifyllineaggravates fatty liver in obese and diabetic ob/ob mice byincreasing intestinal glucose absorption and activatinghepatic lipogenesis. Br J Pharmacol 2012; 165: 1361–74.
105. Tan X, Sun X, Li Q, et al. Leptin deficiency contributesto the pathogenesis of alcoholic fatty liver disease in mice.Am J Pathol 2012; 181: 1279–86.
106. Carmiel-Haggai M, Cederbaum AI, Nieto N. Binge etha-nol exposure increases liver injury in obese rats. Gastro-enterology 2003; 125: 1818–33.
107. Cipriani S, Mencarelli A, Palladino G, et al. FXR activa-tion reverses insulin resistance and lipid abnormalitiesand protects against liver steatosis in Zucker (fa/fa) obeserats. J Lipid Res 2010; 51: 771–84.
108. Zaluzny L, Farrell GC, Murray M. Effect of genetic obes-ity and experimental diabetes on hepatic microsomalmixed function oxidase activities. J Gastroenterol Hepatol1990; 5: 256–63.
109. Robin MA, Demeilliers C, Sutton A, et al. Alcoholincreases tumor necrosis factor-a and decreases nuclearfactor-B to activate hepatic apoptosis in genetically obesemice. Hepatology 2005; 42: 1280–90.
110. Okumura K, Ikejima K, Kon K, et al. Exacerbation ofdietary steatohepatitis and fibrosis in obese, diabetic KK-A(y) mice. Hepatol Res 2006; 36: 217–28.
Liver International (2014)
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd e179
Michaut et al. Acetaminophen hepatotoxicity in obesity
118
119
ARTICLE 2
Michaut A, Le Guillou D, Moreau C, McGill MR, Bucher S, Martinais S, Gicquel T, Morel I,
Robin MA, Jaeschke H, Fromenty B. A cellular model to study drug-induced liver injury in
nonalcoholic fatty liver disease: application to acetaminophen.
Cet article sera soumis dans les semaines à venir.
Dans ce travail, nous avons dans un premier temps mis au point un modèle cellulaire
de NAFLD, en essayant de reproduire certaines caractéristiques importantes de ces
pathologies hépatiques associées à l’obésité. Nous nous sommes en particulier intéressés à
l’activité des cytochromes P450 2E1 (CYP2E1) et 3A4 (CYP3A4), ainsi qu’aux modifications de
l’expression de certains gènes liés au métabolisme glucido-lipidique. Pour cela, nous avons
incubé pendant une semaine des cellules HepaRG avec de l’acide stéarique (C18:0), ou de
l’acide oléique (C18:1), en présence de 3 concentrations différentes d’insuline (0, 0,01 et 5
µg/ml). Dans un deuxième temps nous avons traitées les cellules HepaRG stéatosiques ou
non avec différentes concentrations de paracétamol. Les principaux résultats obtenus au
cours de mon travail de thèse sont les suivants:
1) Les quantités de triglycérides cellulaires sont équivalentes entre les conditions
d’incubation des cellules HepaRG avec l’acide stéarique et l’acide oléique. De plus, ces deux
acides gras entraînent une l’augmentation similaire de l’expression des gènes connus pour
être régulés par les lipides, comme APOA4, PLIN1 et PLIN2.
2) L’incubation des cellules HepaRG avec l'acide stéarique est associée à une
augmentation de l'activité du CYP2E1 et à une diminution de l'activité du CYP3A4,
reproduisant ainsi différents données cliniques et expérimentales obtenues dans un
contexte d’obésité et de NAFLD. En revanche, l'acide oléique n'a pas d’effet sur l'activité de
ces CYPs. Les effets des deux acides gras sur ces CYPs sont donc différents alors que
l’intensité de la stéatose est comparable.
3) Les expériences effectuées avec différentes concentrations d'insuline montrent
que l'activité du CYP2E1 est régulée négativement par l'insuline de façon concentration-
120
dépendante. Malgré cela, l'insuline est responsable d’une augmentation de l’expression du
CYP2E1, un effet qui est également dépendant de la concentration de cette hormone. Des
expériences réalisées sur des cultures d’hépatocytes primaires humains montrent que
l'insuline réduit également l'activité de CYP2E1 avec une augmentation concomitante des
taux d'ARNm de ce CYP.
4) Comme attendu, l'insuline augmente l'expression de différents gènes impliqués
dans la synthèse des lipides tels que SREBF1, FASN et SCD1. L'insuline induit également une
augmentation de l'expression de PNPLA3. Ces effets de l’insuline sont observés sur les
cellules HepaRG et sur les hépatocytes primaires humains.
5) Les investigations réalisées avec une large gamme de concentrations de
paracétamol (2,5 à 20 mM) montrent que la perte d'ATP cellulaire est presque toujours plus
forte en présence d'acide stéarique. En revanche, la cytotoxicité de ce médicament était à
peu près semblable entre les cellules HepaRG non stéatosiques et celles incubées avec de
l'acide oléique.
6) Les expériences effectuées avec le chlorméthiazole (CMZ, un inhibiteur
prototypique du CYP2E1) indiquent que la plus forte cytotoxicité observée avec 2,5 et 20
mM de paracétamol en présence d'acide stéarique peut être attribué, au moins en partie, à
l'activité du CYP2E1. Toutefois, l'implication du CYP2E1 dans la cytotoxicité du paracétamol
observée en absence d’insuline ne semble significative qu’avec 20 mM de ce médicament.
De façon intéressante, nos expériences montrent également que dans les cellules HepaRG
non traitées avec le paracetamol, la perte (légère à modérée) de l'ATP cellulaire observée
dans certaines conditions est secondaire à l'activité basale du CYP2E1.
7) De façon surprenante, la protection exercée par le CMZ vis-à-vis de la cytotoxicité
du paracétamol (i.e. perte d’ATP) n’est pas associée à une augmentation des concentrations
cellulaires de GSH, ni à une diminution des quantités d’adduits paracétamol-protéines.
Ces résultats seront globalement repris et discutés dans la discussion générale de la
Thèse.
121
A cellular model to study drug-induced liver injury in nonalcoholic
fatty liver disease: application to acetaminophen
Anaïs Michaut1, Dounia Le Guillou1, Caroline Moreau1,2, Mitchell R. McGill3, Simon Bucher1,
Sophie Martinais1, Thomas Gicquel1,2, Isabelle Morel1,2, Marie-Anne Robin1, Hartmut
Jaeschke3, Bernard Fromenty1*
1INSERM, U991, Université de Rennes 1, Rennes, France ; 2Laboratoire de Biochimie et
Toxicologie, CHU Pontchaillou, Rennes, France ; 3Department of Pharmacology, Toxicology
and Therapeutics, University of Kansas Medical Center, Kansas City, KS, USA
*To whom correspondence should be addressed. Phone: 33-2-23-23-30-44; Fax: 33- 2-23-23-
53-85; E. mail : [email protected]
Running title: Cellular model of human NAFLD and APAP hepatotoxicity
Abbreviations: ACACA, acetyl-CoA carboxylase alpha; AICAR, 5-aminoimidazole-4-
carboxyamide ribonucleoside; APAP, acetaminophen; APOA4, apolipoprotein A-IV; CMZ,
chlormethiazole; CYP, cytochrome P450; FABP4, fatty acid binding protein 4; FASN, fatty acid
synthase; GSH, glutathione; NAFLD, nonalcoholic fatty liver disease; NAPQI, N-acetyl-p-
benzoquinone imine; PDK4, pyruvate dehydrogenase kinase 4; PHH, primary human
hepatocytes; PNPLA3, patatin-like phospholipase domain containing 3; PLIN, perilipin; SCD1,
stearoyl-Coenzyme A desaturase 1; SREBF1, sterol regulatory element binding transcription
factor 1
Key words: NAFLD, obesity, liver, hepatotoxicity, acetaminophen, CYP2E1
122
Abstract
Obesity and nonalcoholic fatty liver disease (NAFLD) have been reported to increase the
susceptibility of hepatotoxicity induced by some xenobiotics including drugs, but the involved
mechanisms are still poorly understood. For toxic compounds such as ethanol and
acetaminophen (APAP), a role of hepatic cytochrome P450 2E1 (CYP2E1) is suspected since the
activity of this enzyme is consistently enhanced during obesity and NAFLD. The first aim of our
study was to set up a cellular model of NAFLD characterized not only by triglyceride
accumulation but also by higher CYP2E1 activity. To this end, differentiated human HepaRG
cells were incubated during one week with stearic acid, or oleic acid, in the presence of
different concentrations of insulin. Cellular triglycerides and the expression of lipid-responsive
genes were similar with both fatty acids. However, CYP2E1 activity was significantly increased
only by stearate and this was associated with lower CYP3A4 activity, another metabolic feature
reported in NAFLD. CYP2E1 activity in HepaRG cells was reduced by insulin in a concentration-
dependent manner and this effect was reproduced in cultured primary human hepatocytes.
Hence, the highest CYP2E1 activity was observed in HepaRG cells with stearate and without
insulin. Next, the second aim of our study was to assess APAP cytotoxicity in HepaRG cells
presenting or not lipid accretion and CYP2E1 induction. Experiments with a large range of APAP
concentrations (1 to 20 mM) showed that the cellular loss of ATP and glutathione (GSH) was
almost always stronger in the presence of stearic acid. In cells pretreated with the CYP2E1
inhibitor chlormethiazole (CMZ), recovery of cellular ATP was significantly higher in the
presence of stearic acid with both low (2.5 mM) and high (20 mM) concentrations of APAP.
However, in the absence of insulin, CMZ-induced ATP recovery was significantly greater only for
20 mM of APAP. Surprisingly, there was no recovery of cellular GSH and no reduction of APAP-
protein adducts following CMZ pretreatment. Finally, levels of APAP-glucuronide were
significantly enhanced in the presence of insulin. Conclusions: When studied in specific
conditions of culture, the HepaRG cell line can be a valuable model of human NAFLD, especially
regarding CYP2E1 and CYP3A4 activity. Our data also suggest that higher CYP2E1 activity in
NAFLD could be secondary to the hepatic accumulation of some fatty acids and to the presence
of low insulin signaling. Hence, this cellular model can be used to unveil some important
metabolic and hormonal factors which can favor APAP hepatotoxicity in obese individuals.
123
Introduction
Liver injury can be induced by numerous drugs of our modern pharmacopoeia, herbals
and industrial toxicants (Biour et al., 2004; Seeff et al., 2015; Wahlang et al., 2013). In the most
severe cases, xenobiotic-induced liver injury can require a hospitalization and eventually lead to
the death of the patient (Björnsson, 2009). Among the different predisposing factors increasing
the risk of liver injury, there are growing evidence that nonalcoholic liver disease (NAFLD) could
play a significant role (Robin et al., 2005a; Fromenty, 2013; Tarantino et al., 2007). NAFLD is
often associated with obesity and type 2 diabetes and encompasses a large spectrum of liver
lesions such as fatty liver, nonalcoholic steatohepatitis (NASH) and cirrhosis (Michelotti et al.,
2013).
Greater hepatotoxicity in the context of obesity and NAFLD has been documented in
rodents and humans with some drugs including acetaminophen (APAP), halothane and
methotrexate as well as other xenobiotics such as ethanol and carbon tetrachloride (Robin et
al., 2005a; Donthamsetty et al., 2007; Tarantino et al., 2007; Michaut et al., 2014; Fromenty,
2013). However, the mechanisms involved in this higher susceptibility are poorly understood
although different hypotheses have been put forward (Fromenty, 2013). Furthermore, these
mechanisms could be complex and different from one compound to another (Robin et al.,
2005a; Fromenty, 2013; Carmiel-Haggai et al., 2003). Importantly, obesity and NAFLD in rodents
and humans are associated with different alterations in the expression and activity of hepatic
enzymes involved in drug metabolism including cytochromes P450 (CYPs) and UDP-
glucuronosyltransferases. More specifically, these dysmetabolic disorders are associated with
higher CYP2E1 activity, lower CYP3A4 activity and increased capacity of glucuronide conjugation
for different drugs such as APAP and lorazepam (Aubert et al., 2011; Brill et al., 2012; Chalasani
et al., 2003; Emery et al., 2003; Kolwankar et al., 2007; Michaut et al., 2014).
Deciphering the mechanisms whereby some drugs and environmental toxins are more
hepatotoxic in the context of obesity and NAFLD requires appropriate experimental models.
Although obese mice and rats can be useful (Robin et al., 2005a; Carmiel-Haggai et al., 2003;
Aubert et al., 2011; Massart et al., 2012), there are numerous differences between rodents and
humans regarding hepatic drug metabolism (Chu et al., 2013; Martignoni et al., 2006). In
124
addition, investigations in animals are cumbersome and ethically problematic. Thus, a relevant
human cellular model could be helpful in order to study hepatotoxicity in NAFLD.
In the past few years, the metabolically competent human hepatoma HepaRG cells have
been shown to be a valuable model to study the mechanism of hepatotoxicity induced by drugs
and toxicants (Anthérieu et al., 2011; McGill et al., 2011; Savary et al., 2014; Sharanek et al.,
2014; Tobwala et al., 2015). In addition, HepaRG cells have been successfully used to study the
effects of nutrients, hormones and drugs on the expression of various enzymes involved in
carbohydrate and lipid metabolism (Anthérieu et al., 2011; Madec et al., 2011; Nagasawa et al.,
2007; Samanez et al., 2012).
By using the human HepaRG cell line, the aim of the present study was two-fold. First,
we thought to set up a cellular model of NAFLD, in particular regarding the alterations of
CYP2E1 and CYP3A4 activity that are observed in this hepatic disease. To this end,
differentiated HepaRG cells were treated for one week with stearic acid (C18:0) or oleic acid
(C18:1) in the presence of different concentrations of insulin. Second, we used this cellular
model of NAFLD in order to determine the cytotoxic effects of the painkiller APAP. Indeed,
several studies in rodents and humans reported that NALFD is associated with more severe
APAP-induced hepatotoxicity, especially after an overdose (Aubert et al., 2012; Kon et al., 2010;
Michaut et al., 2014; Myers and Shaheen, 2008; NGuyen et al., 2008). Notably, some of the
studies performed in rodents suggested that higher APAP hepatotoxicity in NAFLD could be
attributed to greater CYP2E1 activity (Aubert et al., 2012; Michaut et al., 2014), the primary
enzyme responsible for the biotransformation of APAP to the highly reactive and toxic
metabolite N-acetyl-p-benzoquinone imine (NAPQI) (Hinson et al., 2010; McGill and Jaeschke,
2013). Overall, the results of the present study indicated that under selected culture conditions,
steatotic HepaRG cells can be used as a valuable model to study the impact of NAFLD on the
hepatotoxicity induced by APAP and other xenobiotics.
125
Materials and Methods
Chemicals. 5-Aminoimidazole-4-carboxyamide ribonucleoside (AICAR), APAP, APAP-β-D-
glucuronide, APAP-sulfate, testosterone, 6β-hydroxytestosterone, chlormethiazole (CMZ),
chlorzoxazone, metformin, dimethyl sulfoxide (DMSO), oleic acid, stearic acid, insulin and oil
Red O were purchased from Sigma Aldrich (Saint-Quentin-Fallavier, France). William’s E
medium was obtained from Eurobio laboratories (Les Ulis, France). Fetal Bovine Serum (FBS)
was supplied by Lonza (Levallois-Perret, France). Glutamine, penicillin and streptomycin
were obtained from Invitrogen (Cergy Pontoise, France). Hydrocortisone hemisuccinate was
purchased from Upjohn Pharmacia (Guancourt, France). Protease and phosphatase
inhibitors were purchased from Roche Diagnostics (Indianapolis, IN).
Cell cultures and treatments. Native HepaRG cells were cultured as previously described
(Aninat et al., 2006). Briefly, HepaRG cells were seeded at a density of 2.6 104 cells/cm2 and
were first incubated in a William’s medium supplemented with 10% FBS, 100 units/ml
penicillin, 100 µg/ml streptomycin, 2 mM glutamine, 5 µg/ml insulin and 50 µM
hydrocortisone hemisuccinate. After 2 weeks, cell differentiation was induced by the same
culture medium supplemented with 2% DMSO (differentiation medium) for 2 additional
weeks. Cells were subsequently treated for 7 days with different concentrations of insulin (0,
0.01 or 5µg/ml), stearic acid (0 or 100 µM), or oleic acid (0 or 100 µM). In some experiments,
lower or higher concentrations of fatty acids were used. For the APAP experiments, cells
were incubated with different concentrations of this drug (0 to 20 mM) during the last 6, 24
or 48h of the 7-day treatment. Stearic acid, oleic acid and APAP were dissolved in DMSO. For
the investigations performed with the prototypical CYP2E1 inhibitor CMZ, cells were
incubated 7 days with 150 µM of CMZ. Whatever the treatments, the culture medium was
renewed every 2 or 3 days during the 7-day experiments. For the experiments carried out
with the AMP-activated protein kinase (AMPK) activators AICAR and metformin, cells were
first preincubated for 6h with or without 500 µM of each activator. Cells were then treated
for 24h with 20 mM of APAP, with or without each AMPK activator (500 µM). HepaRG cells
were used at passages 11 to 15.
126
Primary human hepatocytes (PHH) from adult donors were prepared at Biopredic
International (Saint-Grégoire, France) by perfusion of liver fragments provided by the Centre
de Ressources Biologiques (CRB) Santé de Rennes. Hepatocytes were then immediately
seeded at a density of 11 104 cells/cm2 in a William’s E medium supplemented with 10% FBS,
100 units/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine, 5 µg/ml insulin and 5 µM
hydrocortisone hemisuccinate. The medium was discarded 12 h after seeding and cells were
then maintained in the same differentiation medium used for HepaRG cells, which was
renewed every other day. Two days after seeding, PHH were then treated or not with oleic
acid, stearic acid and insulin for one week.
Oil red O staining and triglycerides. For staining of neutral lipids, cells were washed with
phosphate-buffered saline, incubated for 45 min at room temperature with an oil red O-
saturated solution, washed in water, and observed under a phase-contrast microscope.
Triglyceride quantification was measured with a colorimetric kit purchased from Biovision
(Milpitas, CA), using the manufacturer’s recommendations.
Determination of CYP2E1 and CYP3A4 activities. In order to measure CYP2E1 and CYP3A4
activities, HepaRG cells or PHH were incubated for 6 and 2 hours in phenol red-free and
DMSO-free William’s E medium containing 300 µM chlorzoxazone or 200 µM testosterone,
respectively. At the end of the incubation, aliquots of culture media were collected and
stored at -80°C until analysis. 6-Hydroxychlorzoxazone was then quantified by high-
performance liquid chromatography (HPLC)-tandem mass spectrometry (Xenoblis, Rennes,
France), whereas 6β-hydroxytestosterone was measured by HPLC analysis, as previously
described (Aninat et al., 2006).
Cellular ATP and GSH. Cellular ATP was measured with the CellTiter-Glo® assay purchased
from Promega (Charbonnieres, France), using the manufacturer’s recommendations. Briefly,
HepaRG cells were incubated with the reagent 10 min at 37°C and the luminescent signal
was quantified using a POLARstar Omega microplate reader (BMG Labtech, Ortenberg,
Germany). Results were expressed in comparison to untreated cells. Total glutathione (GSH)
127
was quantified with the Glutathione assay kit purchased from Cayman Chemical (Ann Arbor,
USA), using the manufacturer’s recommendations.
Assessment of APAP metabolites and APAP-protein adducts. The quantification of APAP-β-
D-glucuronide and APAP-sulfate in the cell supernatants was performed on a Thermo
Scientific Q ExactiveTM mass spectrometer (San Jose, CA). An HESI-II ion source was used for
the electrospray ionization of the target compounds. Chromatographic separation of the
analytes was performed with an Accela pump (Thermo Scientific) equipped with a Thermo
Fisher Hypersil Gold C18 column (3.0 mm, 2.1, 100 mm) as previously described (Gicquel et
al. 2013). Data were acquired in Targeted SIM (Single Ion Monitoring) mode. For the
assessment of APAP-protein adducts in treated HepaRG cells, APAP-cysteine was measured
by using HPLC separation and electrochemical detection, as previously described (McGill et
al., 2011).
Isolation of RNA and real-time quantitative PCR analysis. Total RNA was extracted from ca.
106 HepaRG cells with the SV total RNA isolation system purchased from Promega
(Charbonnières-les-Bains, France) and from ca. 600.000 PHH with RNeasy Micro kit
purchased from Qiagen (Courtaboeuf, France). Each kit included a DNase treatment step.
RNAs were reverse-transcribed into cDNA using the High-Capacity cDNA Archive kit
purchased from Life technologies (Saint-Aubin, France). Real-time quantitative PCR (RT-
qPCR) was then performed using the SYBR Green PCR Master Mix on an Applied Biosystems
7900HT Fast Real-Time PCR System (Applied Biosystem, Woolston, UK). Expression of the
human TATA box binding protein (TBP) was used as reference, and the 2–ΔΔCt method was
used to express the relative expression of each selected gene. The sequences of the primers
used in this study are presented in the supplementary Table 1.
Western blot analysis. To assess the protein expression of CYP2E1 and CYP3A4 in HepaRG
cells, proteins underwent SDS-polyacrylamide electrophoresis. Briefly, cells were lysed in a
RIPA buffer (25 mM Tris-HCL pH 7.6, 150 mM NaCl, 1% NP40, 1% sodium deoxycholate and
0.1% sodium dodecyl sulfate) supplemented with protease and phosphatase inhibitors.
128
Fifteen µg of protein were then separated by electrophoresis on 4-12% gradient Bis-Tris gels
(Invitrogen, Cergy-Pontoise, France), transferred to 0.2 µM nitrocellulose membranes (Bio-
Rad, Hercules, CA), which were saturated in 2% BSA/TBS-T (0.2% tween in TBS) for 2 h at
room temperature. Proteins were then immunoblotted with antibodies against CYP2E1
(Oxford Biomedical Research, Rochester Hills, MI), CYP3A4 (Oxford Biomedical Research), or
heat-shock cognate 70 (HSC70) (Tebu-bio, Le Perray-en-Yvelines, France). Finally, blots were
incubated with appropriate secondary antibodies, and protein bands were revealed by
enhanced chemiluminescence in a Chemi-smart imager (Fisher Scientific, Illkirch, France).
HSC70 was used to normalize protein loadings, and quantification was performed with the
BIO-1D software.
Statistical analysis. All results are expressed as mean ± SEM (standard error of mean).
Comparison between multiple groups were performed with two-way analysis of variance
(ANOVA). When ANOVA provided significant differences, individual means were compared
with the post-hoc Bonferroni test. The Mann and Whitney test were used for the
experiments carried out in cultured PHH.
129
Results
Effects of stearic acid, oleic acid and insulin on lipid content, CYP2E1 and CYP3A4 activity
and gene expression in HepaRG cells. HepaRG cells were incubated without or with stearic
acid, oleic acid and insulin for 7 days, as described in the Methods section. Because insulin
was studied at three different concentrations (0, 0.01 and 5 µg/ml), nine different
experimental conditions were initially studied. As expected, incubation of these cells with
each fatty acid (100 µM) was associated with significantly higher cellular triglycerides (Fig.
1A) and total neutral lipids (Fig. 1B). In addition, insulin significantly decreased triglycerides
in cells overloaded with each fatty acid (Fig. 1A). The latter result is in keeping with previous
data in rat and human indicating that chronic insulin favours hepatic triglycerides secretion
(Bartlett and Gibbons, 1988; Reaven et al., 1967; Zammit et al., 2001).
Next, the activity and expression of CYP2E1 and CYP3A4 were studied in all the
experimental conditions. Regarding CYP2E1, its activity was increased by stearic acid but not
by oleic acid (Fig. 1C). Moreover, insulin reduced CYP2E1 activity in a concentration-
dependent manner in HepaRG cells overloaded with stearic acid (Fig. 1C). Surprisingly,
insulin increased the mRNA expression of CYP2E1 in a concentration-dependent manner
(Fig. 1D). Similarly, insulin augmented the protein expression of CYP2E1 (Supplementary Fig.
1). In contrast, CYP3A4 activity was significantly reduced by stearic acid, but not oleic acid,
without significant effect of insulin (Fig. 1C). The mRNA expression of CYP3A4 was decreased
by stearic acid, especially in the absence of insulin (Fig. 1D). The protein expression of
CYP3A4 was also reduced by stearic acid (data not shown). Importantly, the activity of both
CYP2E1 and CYP3A4 was not significantly changed after 7 days of incubation with 50 µM of
each fatty acid, or after 48 h of incubation with 100 µM of these fatty acids (Supplementary
Fig. 2).
Finally, we measured the mRNA expression of different genes known to be regulated
by lipids, insulin or both factors. As expected, the expression of sterol regulatory element
binding transcription factor 1 (SREBF1, also known as SREBP-1c), acetyl-CoA carboxylase
alpha (ACACA), fatty acid synthase (FASN), stearoyl-Coenzyme A desaturase 1 (SCD1) and
patatin-like phospholipase domain containing 3 (PNPLA3) was positively regulated by insulin
130
in a concentration-dependent manner, whereas each fatty acid had no effect (Fig. 2). In
addition, the expression of pyruvate dehydrogenase kinase 4 (PDK4), fatty acid binding
protein 4 (FABP4) and apolipoprotein A-IV (APOA4) was regulated by the fatty acids and
insulin, while that of perilipin 1 (PLIN1) and 2 (PLIN2, also known as ADFP) was regulated
only by the fatty acids (Fig. 2).
Effects of stearic acid, oleic acid and insulin on CYP2E1 and CYP3A4 activity and gene
expression in cultured PHH. In another series of experiments, the effects of stearic acid,
oleic acid and insulin were studied in PHH cultured for 7 days. In the absence of fatty acids,
insulin (5 µg/ml) significantly decreased CYP2E1 activity with a concomitant increase in
CYP2E1 mRNA levels (Fig. 3). Insulin also enhanced the protein expression of CYP2E1 in a
concentration-dependent manner in cultured PHH of 3 different donors (data not shown). In
contrast, insulin did not change CYP3A4 mRNA expression and activity (Fig. 3). Importantly,
insulin increased the mRNA expression of SREBF1, ACACA, FASN, SCD1 and PNPLA3 and
reduced that of PDK4 (Fig. 3). Thus, when incubated without fatty acid, the effects induced
by insulin were similar between cultured PHH and HepaRG cells. However, treatment with
100 µM of stearic acid did not increase CYP2E1 activity (data not shown). Notably, our PHH
often presented steatosis to a variable degree (from 10 to 40%) (Supplemental Fig. 3), and
thus CYP2E1 activity might have already been augmented in these hepatocytes. Although we
did not have the anthropomorphic data for all the different liver donors, it was noteworthy
that several of them presented overweight or obesity, sometimes associated with type 2
diabetes. Moreover, most of the donors were over age 60. This could also have contributed
to the presence of steatosis since NAFLD is common in the elderly (Bertolotti et al., 2014;
Gan et al., 2011).
APAP-induced cytotoxicity and GSH depletion in normal and steatotic HepaRG cells. In
order to determine APAP cytotoxicity in normal and steatotic HepaRG cells, a large range of
APAP concentrations was selected and cellular ATP was measured after 6, 24 and 48 h of
treatment. Whereas no significant cytotoxicity was observed for 1 mM APAP, reduced ATP
levels was already observed with 2.5 mM although the effects greatly depended of the
131
culture conditions (Supplementary Fig. 4). Indeed, APAP-induced loss of cellular ATP was
consistently more important in the presence of stearic acid (Fig. 4). Moreover, incubation
without insulin was associated with a significantly stronger ATP depletion after 6 and 12 h
for 2.5 mM APAP and after 6 h for 5 mM of this drug (Fig. 4). It was noteworthy that cellular
ATP levels in the basal state (i.e. without APAP treatment) were significantly lower with
stearic acid (Fig. 4). However, when the basal ATP levels were equally set for the three
different conditions of fatty acid incubation, APAP cytotoxicity remained most of the time
stronger in the presence of stearic acid, excepted in the presence of 5 µg/ml of insulin after
6 h of APAP treatment (Supplementary Fig. 4). Thus, these results indicated that the higher
ATP depletion induced by APAP in the presence of stearic acid was not a mere consequence
of the basal cytotoxicity induced by this fatty acid.
In the next series of investigations, cellular GSH levels were measured after a
treatment with low (2.5 mM) and high (20 mM) APAP concentrations. These investigations
were carried out with the three conditions of fatty acid incubation but with only two
concentrations of insulin (i.e. 0 and 5 µg/ml). After APAP treatment, GSH depletion was
generally stronger in the presence of stearic acid (Fig. 5). A significant effect of insulin was
also observed in some conditions. Indeed, GSH depletion after 12 h of 2.5 mM APAP was
stronger in the presence of insulin, whereas GSH depletion after 24 h of 20 mM APAP was
stronger in the absence of insulin (Fig. 5). Importantly, basal GSH levels were not significantly
different between the 6 different conditions, although there was a trend towards lower GSH
in the presence of stearic acid (P=0.11) (Fig. 5).
APAP-induced expression of oxidative stress genes in normal and steatotic HepaRG cells.
Oxidative stress, including induced by APAP, can secondarily increase the expression of
different genes such as heme oxygenase 1, γ-glutamylcysteine synthase, different
glutathione S-transferases, heat shock protein 70 and tribbles pseudokinase 3 (Aubert et al.,
2012; Chan et al., 2001). Importantly, nuclear factor, erythroid 2-like 2 (NRF2, or NFE2L2) is a
transcription factor playing a major role in the regulation of most of these genes (Chan et al.,
2001; Ma and He, 2012). Hence, the mRNA expression of some of these genes was assessed
in HepaRG cells treated with 2.5 or 20 mM APAP (Fig. 6). Notably, the expression of NRF2,
132
HMOX1, TRIB3 and HSP70 was increased by APAP, sometimes in a dose-dependent manner.
However, it was noteworthy that the expression of some oxidative stress genes was already
induced in the basal state (i.e. in cells not treated with APAP), in particular when HepaRG
cells were incubated with stearic acid. This was observed for instance with HMOX1, TRIB3
and HSP70. Moreover, we also found that in the basal state insulin significantly increased the
expression of GSTA1/2 and GSTA3. Previous studies in primary cultured rat hepatocytes also
showed that insulin enhanced the expression of GSTA1/2 and GSTA3//5 (Kim et al., 2006).
Finally, the expression of these genes was significantly decreased after APAP treatment in
cells incubated with stearic acid.
APAP-induced cytotoxicity, GSH depletion and APAP-protein adducts in normal and
steatotic HepaRG cells treated or not with the CYP2E1 inhibitor CMZ. Another series of
experiments was subsequently designed in order to determine the exact role of CYP2E1 in
APAP-induced toxicity in HepaRG cells. For this purpose, HepaRG cells were incubated with
150 µM of CMZ for 7 days before APAP treatment. This protocol of CMZ treatment was
selected because preliminary experiments showed a maximal inhibitory effect of CYP2E1
activity without significant cytotoxicity (data not shown).
Because our experiments were carried out simultaneously with and without CMZ, the
recovery of ATP in the presence of CMZ could be calculated for these experiments. ATP
recovery was almost always observed in the different tested conditions (Fig. 7). With 2.5 mM
of APAP, ATP recovery with CMZ was significantly higher in the presence of stearic acid after
6 and 24 h of APAP treatment, but no significant effect was observed regarding insulin (Fig.
7). With 20 mM of APAP, ATP recovery was also higher in the presence of stearic acid but
only after 6 h of APAP treatment (Fig. 7). A significant effect of insulin was also observed at
this time point. Indeed, ATP recovery was significantly lower in the presence of insulin,
especially in cells incubated with oleic acid (Fig. 7). Notably, ATP recovery in the basal state
was significantly changed in the presence of fatty acids. In particular, ATP recovery was
higher with stearic acid and lower with oleic acid (Fig. 7). Taken together, these results
indicated that in HepaRG cells CYP2E1 was involved in the loss of ATP levels after APAP
133
treatment, but also in the basal state at a lesser degree. Moreover, ATP loss related to
CYP2E1 activity was usually higher in the presence of stearic acid.
The effect of CMZ pretreatment on total GSH levels and APAP-protein adducts was
also assessed in different conditions of fatty acids, insulin and APAP treatment (2.5 and 20
mM). Surprisingly, CMZ did not prevent the loss of total GSH after 24 h (Supplementary Fig.
5), thus indicating that CYP2E1 was not primarily involved in GSH depletion after APAP
treatment in HepaRG cells. Moreover, CMZ did not prevent the generation of APAP-protein
adducts 6 h after 2.5 or 20 mM of APAP (data not shown).
APAP-glucuronide and APAP-sulfate in normal and steatotic HepaRG cells. APAP-
glucuronide and APAP-sulfate were measured in the culture media of normal or steatotic
HepaRG cells treated for 1 or 6 h with 2.5 and 20 mM of APAP. Whereas APAP-sulfate levels
were unchanged in the different conditions of culture, APAP-glucuronide levels were
consistently higher in the presence of insulin (Fig. 8). In contrast, there was no effect of
stearic acid or oleic acid on APAP-glucuronide levels (Fig. 8).
Prevention of APAP-induced cytotoxicity in HepaRG cells by the AMPK activators AICAR
and metformin. Recent investigations in primary mouse hepatocytes showed that APAP-
induced necrosis was prevented by the AMPK activator III (DHPO), thus suggesting a role of
AMPK impairment in APAP cytotoxicity (Saberi et al., 2014). Thus, in a last series of
investigations, we determined the effect of AICAR and metformin on APAP-induced
cytotoxicity in non-steatotic and steatotic HepaRG cells. Preliminary experiments allowed us
to show that the expression of both phospho-AMPK and phospho-acetyl-CoA carboxylase
(phospho-ACC) was efficiently enhanced with 500 µM of each prototypical AMPK activator
(data not shown). Using this concentration, both AMPK activators prevented the ATP
depletion measured 24 h after 20 mM of APAP (Supplementary Fig. 6), although the ATP
recovery was lower compared to CMZ in the same conditions of APAP treatment (Fig. 7).
Nevertheless, ATP recovery with AICAR and metformin tended to be higher in HepaRG cells
incubated with stearic acid (Supplementary Fig. 6). Finally, there was almost no GSH
134
recovery with both AMPK activators, excepted in HepaRG cells incubated without fatty acid
and without insulin (Supplementary Fig. 6).
135
Discussion
There are growing evidence that NAFLD can increase the risk and the severity of
hepatotoxicity induced by some drugs and toxins (Robin et al., 2005a; Fromenty, 2013;
Tarantino et al., 2007). However, little is known regarding the involved mechanisms,
although some hypotheses have been proposed (Fromenty, 2013). Thus, relevant
experimental models are needed to determine which compounds can pose a specific risk in
NAFLD and to understand why they are more hepatotoxic in this dysmetabolic context. Since
the HepaRG cell line has been shown to be a valuable model to study hepatotoxicity induced
by drugs and toxins (Anthérieu et al., 2011; McGill et al., 2011; Savary et al., 2014; Sharanek
et al., 2014; Tobwala et al., 2015), a first goal of our study was to determine whether this cell
line could also be used as a pertinent model of human NALFD. To this end, HepaRG cells
incubated for one week in different conditions of incubation with stearic acid, oleic acid and
insulin.
Several investigations in rodents and humans reported that NALFD is associated with
more severe APAP-induced hepatotoxicity, especially after an overdose (Aubert et al., 2012;
Kon et al., 2010; Michaut et al., 2014; Myers and Shaheen, 2008; NGuyen et al., 2008).
Although the mechanism is still poorly understood, there is evidence for a significant role of
CYP2E1 whose activity is consistently increased in NAFLD (Aubert et al., 2011; Aubert et al.,
2012; Michaut et al., 2014). Thus, the second objective of our study was to assess APAP-
induced toxicity in non-steatotic and steatotic HepaRG cells.
The most relevant data from this study can be summarized as followed:
1) The incubation of HepaRG cells for one week with stearic acid was associated to higher
CYP2E1 activity and lower CYP3A4 activity, thus reproducing data collected in patients with
obesity and NAFLD (Aubert et al., 2011; Brill et al., 2012; Chalasani et al., 2003; Emery et al.,
2003; Kolwankar et al., 2007). In contrast, oleic acid had no effect on CYP2E1 and CYP3A4
activity.
136
2) Our data with different concentrations of insulin showed that CYP2E1 activity in HepaRG
cells was negatively regulated by insulin in a concentration-dependent manner. Surprisingly,
insulin was responsible for an increased CYP2E1 expression in a concentration-dependent way.
Notably, experiments in cultured PHH indicated that insulin also reduced CYP2E1 activity with a
concomitant increase in CYP2E1 mRNA levels.
3) Steatosis in HepaRG cells induced by stearic or oleic acid was associated with higher
expression of different genes known to be regulated by lipids such as APOA4 and PLIN1.
Moreover, insulin enhanced the expression of different genes involved in lipid synthesis such as
SREBF1, FASN and SCD1 (Begriche et al., 2013; Postic and Girard, 2008). Insulin also increased
the expression of PNPLA3, in keeping with recent studies (Dubuquoy et al., 2011; Huang et al.,
2010).
4) Experiments with a large range of APAP concentrations (2.5 to 20 mM) showed that APAP-
induced loss of cellular ATP was almost always stronger in the presence of stearic acid. In
contrast, APAP cytotoxicity was about similar between non-steatotic cells and HepaRG cells
incubated with oleic acid.
5) Investigations with the prototypical CYP2E1 inhibitor CMZ indicated that the stronger
cytotoxicity observed with 2.5 and 20 mM APAP in the presence of stearic acid could be
attributed, at least in part, to higher CYP2E1 activity. However, the involvement of CYP2E1 in
the higher APAP cytotoxicity observed without insulin was significant only with 20 mM APAP.
Our experiments also provided evidence that in HepaRG cells not treated with APAP, the
slight to moderate loss of cellular ATP observed in some conditions was secondary to basal
CYP2E1 activity.
Our results regarding the effects of stearic acid, oleic acid and insulin on the activity
of CYP2E1 and CYP3A4 in HepaRG cells deserves further discussion.
Although different investigations consistently reported higher hepatic CYP2E1 activity
in human NAFLD (Aubert et al., 2011; Brill et al., 2012; Chalasani et al., 2003; Emery et al.,
2003), the exact mechanism of this induction is still unknown. It has been reported that
CYP2E1 induction in obese individuals was associated with several dysmetabolic parameters
137
such as the degree of steatosis, hyperketonemia (especially high β-hydroxybutyrate),
hyperlipidemia, insulin resistance, type 2 diabetes and even nocturnal hypoxemia (Chalasani
et al., 2003; Chtioui et al., 2007; Emery et al., 2003; Lucas et al., 1998; Wang et al., 2003).
Importantly, our study showed that despite the similar amount of cellular triglycerides,
CYP2E1 activity was selectively enhanced when steatosis was induced by stearic acid, but not
by oleic acid. Altogether, these data suggest that higher CYP2E1 activity in human NAFLD
could depend not only on the degree of steatosis but also by the composition of the
deposited lipids. Moreover, our data suggested a post-translational regulation of CYP2E1 by
stearic acid in HepaRG cells since this saturated fatty acid increased CYP2E1 activity but not
its mRNA and protein expression. Notably, previous investigations in rats showed that
CYP2E1 could be post-translationally regulated via phosphorylation (Oesch-Bartlomovicz and
Oesch, 2005; Oesch-Bartlomovicz et al., 1998). Moreover, an inverse relationship between
hepatic CYP2E1 protein expression and activity was reported during ageing in rat (Wauthier
et al., 2006).
An important observation in this study was that insulin significantly reduced CYP2E1
activity in HepaRG cells and PHH in a concentration-dependent manner. Hence, low insulin
was associated with higher CYP2E1 activity. This could be in keeping with some data in
human NAFLD reporting an association between higher CYP2E1 activity and insulin
resistance, as already mentioned (Chalasani et al., 2003). Moreover, insulin deficiency in
rodents treated with streptozotocin was associated to higher hepatic CYP2E1 activity and
this induction was corrected by insulin therapy (Ioannides et al., 1998; Raza et al., 2004). In
addition to the accumulation of some lipid species, higher CYP2E1 activity in human NAFLD
could thus be linked to insulin resistance, which is frequently associated to this liver disease
(Begriche et al., 2013; Tilg and Moschen 2014).
In HepaRG cells and PHH, insulin reduced CYP2E1 activity but increased the mRNA
and protein expression of this CYP. This suggest that CYP2E1 activity could be regulated post-
translationally by this hormone in human hepatocytes. It is also noteworthy that the positive
effect of insulin on CYP2E1 mRNA expression in human hepatocytes is in sharp contrast with
previous investigations carried out in rat hepatocytes (Moncion et al., 2002; Woodcroft and
138
Novak, 1999). However, CYP2E1 activity was not reported in these studies. Thus, CYP2E1
expression could be differentially regulated by insulin between rat and human. Further
investigations will be needed in order to determine the transcriptional, translational and
post-translational regulation of CYP2E1 in human hepatocytes. HepaRG cells could be helpful
for this purpose.
In contrast to CYP2E1, CYP3A4 activity in HepaRG cells was reduced by stearic acid
but not by oleic acid. Moreover, reduced CYP3A4 activity was associated with lower mRNA
levels. Interestingly, a previous study performed in PHH showed that a mixture of palmitic
acid (C16:0) and oleic acid reduced CYP3A4 activity (Donato et al., 2006). Thus, CYP3A4
activity could be specifically reduced by long-chain saturated fatty acids. It will be interesting
to determine whether oxidative stress is involved in this effect, as suggested by previous
studies (Anthérieu et al., 2013; Gallagher et al., 1995).
In our experiments performed with APAP, pretreatment of HepaRG cells with CMZ
was associated with significant cellular ATP recovery although this CYP2E1 inhibitor did not
afford a significant protection regarding total GSH and APAP-protein adducts. Notably,
APAP-induced cytotoxicity could be the consequence of the covalent binding of NAPQI to
specific cellular proteins, in particular within the mitochondrial compartment (McGill and
Jaeschke, 2013; Tirmenstein and Nelson, 1989). In addition, several studies reported the
presence of significant amount of CYP2E1 in liver mitochondria, in particular in humans
(Bansal et al., 2013; Knockaert et al., 2011). Thus, it is conceivable that inhibition of CYP2E1
by CMZ could have prevented APAP-induced ATP depletion by inhibiting the covalent
binding of this drug to a small number of key mitochondrial proteins and without modifying
the total GSH levels since the mitochondrial pool of this antioxidant is rather low. Indeed,
mitochondrial GSH represents 10 to 15% of the whole cellular GSH reserve (Fernandez-
Checa and Kaplowitz, 2005; Robin et al., 2005b). Finally, CMZ pretreatment of HepaRG cells
could have not be able to prevent the generation of most APAP-protein adducts and the
depletion of total GSH because NAPQI is also generated by CYP3A4, a microsomal enzyme
that has not been reported to be also located in the mitochondrial compartment.
139
In conclusion, we set up a cellular model of human NAFLD which can be a valuable
tool to gain insight regarding the mechanisms whereby this frequent hepatic disease appears
to favour APAP-induced acute liver failure, in particular after an overdose (Michaut et al.,
2014; Myers and Shaheen, 2009; NGuyen et al., 2008). This model can also be used to test
the effect of other drugs or toxins that are suspected to be more hepatotoxic in the context
of obesity and NAFLD, in particular as a consequence of CYP2E1 induction (Fromenty, 2013).
Because AMPK can be activated in HepaRG cells, it will be also interesting to determine
whether AMPK activators such as metformin and AICAR could afford also a protection
against the cytotoxicity of these drugs.
Acknowledgement
This work was supported by INSERM (Institut National de la Recherche et de la Santé
Médicale). Anaïs Michaut was a recipient of a 6-month fellowship from the Fondation pour
la Recherche Médicale (FRM, fellowship n°FDT20140931112). We are grateful to the Conseil
Régional de Bretagne for its financial support via a project call from ID2Santé (formerly
known as CRITT Santé Bretagne). We are also grateful to Mireille Desille-Dugast and Dr
Bruno Turlin from the Centre de Ressources Biologiques (CRB) Santé de Rennes for their
involvement in the preparation of the primary human hepatocytes.
140
References
Aninat C, Piton A, Glaise D, Le Charpentier T, Langouët S, Morel F, Guguen-Guillouzo C, Guillouzo A. Expression of cytochromes P450, conjugating enzymes and nuclear receptors in human hepatoma HepaRG cells. Drug Metab Dispos 2006; 34: 75-83.
Anthérieu S, Rogue A, Fromenty B, Guillouzo A, Robin MA. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology 2011; 53: 1895-905.
Anthérieu S, Bachour-El Azzi P, Dumont J, Abdel-Razzak Z, Guguen-Guillouzo C, Fromenty B, Robin MA, Guillouzo A. Oxidative stress plays a major role in chlorpromazine-induced cholestasis in human HepaRG cells. Hepatology 2013; 57: 1518-29.
Aubert J, Begriche K, Knockaert L, Robin MA, Fromenty B. Increased expression of cytochrome P450 2E1 in nonalcoholic fatty liver disease: mechanisms and pathophysiological role. Clin Res Hepatol Gastroenterol 2011; 35: 630-637.
Aubert J, Begriche K, Delannoy M, Morel I, Pajaud J, Ribault C, Lepage S, McGill MR, Lucas-Clerc C, Turlin B, Robin MA, Jaeschke H, Fromenty B. Differences in early acetaminophen hepatotoxicity between obese ob/ob and db/db mice. J Pharmacol Exp Ther 2012; 342: 676-87.
Bansal S, Anandatheerthavarada HK, Prabu GK, Milne GL, Martin MV, Guengerich FP, Avadhani NG. Human cytochrome P450 2E1 mutations that alter mitochondrial targeting efficiency and susceptibility to ethanol-induced toxicity in cellular models. J Biol Chem 2013; 288: 12627-44.
Bartlett SM, Gibbons GF. Short- and longer-term regulation of very-low-density lipoprotein secretion by insulin, dexamethasone and lipogenic substrates in cultured hepatocytes. A biphasic effect of insulin. Biochem J 1988; 249: 37-43.
Begriche K, Massart J, Robin MA, Bonnet F, Fromenty B. Mitochondrial adaptations and dysfunctions in nonalcoholic fatty liver disease. Hepatology 2013; 58: 1497-507.
Bertolotti M, Lonardo A, Mussi C, Baldelli E, Pellegrini E, Ballestri S, Romagnoli D, Loria P. Nonalcoholic fatty liver disease and aging: epidemiology to management. World J Gastroenterol 2014; 20: 14185-204.
Biour M, Ben Salem C, Chazouillères O, Grangé JD, Serfaty L, Poupon R. Drug-induced liver injury; fourteenth updated edition of the bibliographic database of liver injuries and related drugs. Gastroenterol Clin Biol 2004; 28: 720-759.
Björnsson E. The natural history of drug-induced liver injury. Semin Liver Dis. 2009; 29: 357-63.
Brill MJ, Diepstraten J, van Rongen A, van Kralingen S, van den Anker JN, Knibbe CA. Impact of obesity on drug metabolism and elimination in adults and children. Clin Pharmacokinet 2012; 51: 277-304.
Carmiel-Haggai M, Cederbaum AI, Nieto N. Binge ethanol exposure increases liver injury in obese rats. Gastroenterology 2003; 125: 1818-33.
141
Chalasani N, Gorski JC, Asghar MS, Asghar A, Foresman B, Hall SD, Crabb DW. Hepatic cytochrome P450 2E1 activity in nondiabetic patients with nonalcoholic steatohepatitis. Hepatology 2003; 37: 544-50.
Chan K, Han XD, Kan YW. An important function of Nrf2 in combating oxidative stress: detoxification of acetaminophen. Proc Natl Acad Sci USA 2001; 98: 4611-6.
Chtioui H, Semela D, Ledermann M, Zimmermann A, Dufour JF. Expression and activity of the cytochrome P450 2E1 in patients with nonalcoholic steatosis and steatohepatitis. Liver Int 2007; 27: 764-71.
Chu X, Bleasby K, Evers R. Species differences in drug transporters and implications for translating preclinical findings to humans. Expert Opin Drug Metab Toxicol 2013; 9: 237-52.
Donato MT, Lahoz A, Jimenez N, Pérez G, Serralta A, Mir J, Castell JV, Gómez-Lechon MJ. Potential impact of steatosis on cytochrome P450 enzymes of human hepatocytes isolated from fatty liver grafts. Drug Metab Dispos 2006; 34: 1556-62.
Donthamsetty S, Bhave VS, Mitra MS, Latendresse JR, Mehendale HM. Nonalcoholic fatty liver sensitizes rats to carbon tetrachloride hepatotoxicity. Hepatology 2007; 45: 391-403.
Dubuquoy C, Robichon C, Lasnier F, Langlois C, Dugail I, Foufelle F, Girard J, Burnol AF, Postic C, Moldes M. Distinct regulation of adiponutrin/PNPLA3 gene expression by the transcription factors ChREBP and SREBP1c in mouse and human hepatocytes. J Hepatol 2011; 55: 145-53.
Emery MG, Fisher JM, Chien JY, Kharasch ED, Dellinger EP, Kowdley KV, Thummel KE. CYP2E1 activity before and after weight loss in morbidly obese subjects with nonalcoholic fatty liver disease. Hepatology 2003; 38: 428-35.
Fernandez-Checa JC, Kaplowitz N. Hepatic mitochondrial glutathione: transport and role in disease and toxicity. Toxicol Appl Pharmacol 2005; 204: 263-73.
Fromenty B. Drug-induced liver injury in obesity. J Hepatol 2013; 58: 824-6.
Gallagher EP, Buetler TM, Stapleton PL, Wang C, Stahl DL, Eaton DL. The effects of diquat and ciprofibrate on mRNA expression and catalytic activities of hepatic xenobiotic metabolizing and antioxidant enzymes in rat liver. Toxicol Appl Pharmacol 1995; 134: 81-91.
Gan L, Chitturi S, Farrell GC. Mechanisms and implications of age-related changes in the liver: nonalcoholic fatty liver disease in the elderly. Curr Gerontol Geriatr Res 2011; 2011: 831536.
Gicquel T, Aubert J, Lepage S, Fromenty B, Morel I. Quantitative analysis of acetaminophen and its primary metabolites in small plasma volumes by liquid chromatography-tandem mass spectrometry. J Anal Toxicol 2013; 37: 110-6.
Hinson JA, Roberts DW, James LP. Mechanisms of acetaminophen-induced liver necrosis. Handb Exp Pharmacol 2010: 196: 369-405.
Huang Y, He S, Li JZ, Seo YK, Osborne TF, Cohen JC, Hobbs HH. A feed-forward loop amplifies nutritional regulation of PNPLA3. Proc Natl Acad Sci USA 2010; 107: 7892-7.
142
Ioannides C, Bass SL, Ayrton AD, Trinick J, Walker R, Flatt PR. Streptozotocin-induced diabetes modulates the metabolic activation of chemical carcinogens. Chem Biol Interact 1988; 68: 189-202.
Kim SK, Abdelmegeed MA, Novak RF. Identification of the insulin signaling cascade in the regulation of alpha-class glutathione S-transferase expression in primary cultured rat hepatocytes. J Pharmacol Exp Ther 2006; 316: 1255-61.
Knockaert L, Fromenty B, Robin MA. Mechanisms of mitochondrial targeting of cytochrome P450 2E1: physiopathological role in liver injury and obesity. FEBS J 2011; 278: 4252-60.
Kolwankar D, Vuppalanchi R, Ethell B, Jones DR, Wrighton SA, Hall SD, Chalasani N. Association between nonalcoholic hepatic steatosis and hepatic cytochrome P-450 3A activity. Clin Gastroenterol Hepatol 2007; 5: 388-93.
Kon K, Ikejima K, Okumura K, Arai K, Aoyama T, Watanabe S. Diabetic KK-A(y) mice are highly susceptible to oxidative hepatocellular damage induced by acetaminophen. Am J Physiol Gastrointest Liver Physiol 2010; 299: G329-37.
Lucas D, Farez C, Bardou LG, Vaisse J, Attali JR, Valensi P. Cytochrome P450 2E1 activity in diabetic and obese patients as assessed by chlorzoxazone hydroxylation. Fundam Clin Pharmacol. 1998; 12: 553-8.
Ma Q, He X. Molecular basis of electrophilic and oxidative defense: promises and perils of Nrf2. Pharmacol Rev 2012; 64: 1055-81.
Madec S, Cerec V, Plée-Gautier E, Antoun J, Glaise D, Salaun JP, Guguen-Guillouzo C, Corlu A. CYP4F3B expression is associated with differentiation of HepaRG human hepatocytes and unaffected by fatty acid overload. Drug Metab Dispos 2011; 39: 1987-96.
Martignoni M, Groothuis GM, de Kanter R. Species differences between mouse, rat, dog, monkey and human CYP-mediated drug metabolism, inhibition and induction. Expert Opin Drug Metab Toxicol 2006; 2: 875-94.
Massart J, Robin MA, Noury F, Fautrel A, Lettéron P, Bado A, Eliat PA, Fromenty B. Pentoxifylline aggravates fatty liver in obese and diabetic ob/ob mice by increasing intestinal glucose absorption and activating hepatic lipogenesis. Br J Pharmacol. 2012; 165: 1361-74.
McGill MR, Jaeschke H. Metabolism and disposition of acetaminophen: recent advances in relation to hepatotoxicity and diagnosis. Pharm Res 2013; 30: 2174-87.
McGill MR, Yan HM, Ramachandran A, Murray GJ, Rollins DE, Jaeschke H. HepaRG cells: a human model to study mechanisms of acetaminophen hepatotoxicity. Hepatology 2011; 53: 974-82.
Michaut A, Moreau C, Robin MA, Fromenty B. Acetaminophen-induced liver injury in obesity and nonalcoholic fatty liver disease. Liver Int 2014; 34: e171-9.
Michelotti GA, Machado MV, Diehl AM. NAFLD, NASH and liver cancer. Nat Rev Gastroenterol Hepatol 2013; 10: 656-65.
Moncion A, Truong NT, Garrone A, Beaune P, Barouki R, De Waziers I. Identification of a 16-nucleotide sequence that mediates post-transcriptional regulation of rat CYP2E1 by insulin. J Biol Chem 2002; 277: 45904-10.
143
Myers RP, Shaheen AA. Hepatitis C, alcohol abuse, and unintentional overdoses are risk factors for acetaminophen-related hepatotoxicity. Hepatology 2009; 49: 1399-400.
Nagasawa M, Akasaka Y, Ide T, Hara T, Kobayashi N, Utsumi M, Murakami K. Highly sensitive
upregulation of apolipoprotein A-IV by peroxisome proliferator-activated receptor alpha (PPARα) agonist in human hepatoma cells. Biochem Pharmacol 2007; 74: 1738-46.
Nguyen GC, Sam J, Thuluvath PJ. Hepatitis C is a predictor of acute liver injury among hospitalizations for acetaminophen overdose in the United States: a nationwide analysis. Hepatology 2008; 48: 1336-41.
Oesch-Bartlomowicz B, Oesch F. Phosphorylation of cytochromes P450: first discovery of a posttranslational modification of a drug-metabolizing enzyme. Biochem Biophys Res Commun 2005; 338: 446-9.
Oesch-Bartlomowicz B, Padma PR, Becker R, Richter B, Hengstler JG, Freeman JE, Wolf CR, Oesch F. Differential modulation of CYP2E1 activity by cAMP-dependent protein kinase upon Ser129 replacement. Exp Cell Res 1998; 242: 294-302.
Postic C, Girard J. Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: lessons from genetically engineered mice. J Clin Invest 2008; 118: 829-38.
Raza H, Prabu SK, Robin MA, Avadhani NG. Elevated mitochondrial cytochrome P450 2E1 and glutathione S-transferase A4-4 in streptozotocin-induced diabetic rats: tissue-specific variations and roles in oxidative stress. Diabetes 2004; 53: 185-94.
Reaven GM, Lerner RL, Stern MP, Farquhar JW. Role of insulin in endogenous hypertriglyceridemia. J Clin Invest 1967; 46: 1756-67.
Robin MA, Demeilliers C, Sutton A, Paradis V, Maisonneuve C, Dubois S, Poirel O, Lettéron P, Pessayre
D, Fromenty B. Alcohol increases tumor necrosis factor alpha and decreases nuclear factor-κB to activate hepatic apoptosis in genetically obese mice. Hepatology 2005a; 42: 1280-90.
Robin MA, Sauvage I, Grandperret T, Descatoire V, Pessayre D, Fromenty B. Ethanol increases mitochondrial cytochrome P450 2E1 in mouse liver and rat hepatocytes. FEBS Lett 2005b; 579: 6895-902.
Saberi B, Ybanez MD, Johnson HS, Gaarde WA, Han D, Kaplowitz N. Protein kinase C (PKC) participates in acetaminophen hepatotoxicity through c-jun-N-terminal kinase (JNK)-dependent and -independent signaling pathways. Hepatology 2014; 59: 1543-54.
Samanez CH, Caron S, Briand O, Dehondt H, Duplan I, Kuipers F, Hennuyer N, Clavey V, Staels B. The human hepatocyte cell lines IHH and HepaRG: models to study glucose, lipid and lipoprotein metabolism. Arch Physiol Biochem 2012; 118: 102-11.
Savary CC, Jossé R, Bruyère A, Guillet F, Robin MA, Guillouzo A. Interactions of endosulfan and methoxychlor involving CYP3A4 and CYP2B6 in human HepaRG cells. Drug Metab Dispos 2014; 42: 1235-40.
Seeff LB, Bonkovsky HL, Navarro VJ, Wang G. Herbals and the Liver - A Review of Adverse Effects and Mechanisms. Gastroenterology 2015; 148: 517-532.
144
Sharanek A, Azzi PB, Al-Attrache H, Savary CC, Humbert L, Rainteau D, Guguen-Guillouzo C, Guillouzo A. Different dose-dependent mechanisms are involved in early cyclosporine a-induced cholestatic effects in HepaRG cells. Toxicol Sci 2014; 141: 244-53.
Tarantino G, Conca P, Basile V, Gentile A, Capone D, Polichetti G, Leo E. A prospective study of acute drug-induced liver injury in patients suffering from non-alcoholic fatty liver disease. Hepatol Res 2007; 37: 410-5.
Tilg H, Moschen AR. Evolving therapies for non-alcoholic steatohepatitis. Expert Opin Drug Discov 2014; 9: 687-96.
Tirmenstein MA, Nelson SD. Subcellular binding and effects on calcium homeostasis produced by acetaminophen and a nonhepatotoxic regioisomer, 3'-hydroxyacetanilide, in mouse liver. J Biol Chem 1989; 264: 9814-9.
Tobwala S, Khayyat A, Fan W, Ercal N. Comparative evaluation of N-acetylcysteine and N-acetylcysteineamide in acetaminophen-induced hepatotoxicity in human hepatoma HepaRG cells. Exp Biol Med 2015; 240: 261-72.
Wahlang B, Beier JI, Clair HB, Bellis-Jones HJ, Falkner KC, McClain CJ, Cave MC. Toxicant-associated steatohepatitis. Toxicol Pathol 2013; 41: 343-60.
Wang Z, Hall SD, Maya JF, Li L, Asghar A, Gorski JC. Diabetes mellitus increases the in vivo activity of cytochrome P450 2E1 in humans. Br J Clin Pharmacol 2003; 55: 77-85.
Wauthier V, Schenten V, Verbeeck RK, Calderon PB. Ageing is associated with increased expression but decreased activity of CYP2E1 in male Wistar rats. Life Sci 2006; 79: 1913-20.
Woodcroft KJ, Novak RF. The role of phosphatidylinositol 3-kinase, Src kinase, and protein kinase A signaling pathways in insulin and glucagon regulation of CYP2E1 expression. Biochem Biophys Res Commun 1999; 266: 304-7.
Zammit VA, Waterman IJ, Topping D, McKay G. Insulin stimulation of hepatic triacylglycerol secretion and the etiology of insulin resistance. J Nutr 2001; 131: 2074-7.
145
Legends to the figures
Figure 1. Effects of 1 week of treatment with stearic acid (C18:0), oleic acid (C18:1) and
insulin on cellular triglycerides, neutral lipid deposition and mRNA expression and activity of
CYP2E1 and CYP3A4 in HepaRG cells. (A) Cellular triglycerides. Results are means ± SEM for 5
independent cultures, with data in duplicates for each culture. (B) Cellular lipids stained with
oil red O. The pictures 1 to 6 are representative of the following conditions: 1) HepaRG cells
incubated without insulin and fatty acids; 2) HepaRG cells incubated without insulin and
with stearic acid; 3) HepaRG cells incubated without insulin and with oleic acid; 4) HepaRG
cells incubated with insulin and without fatty acids; 5) HepaRG cells incubated with insulin
and with stearic acid; 6) HepaRG cells incubated with insulin and with oleic acid . (C) CYP2E1
and CYP3A4 activity. Results are means ± SEM for 5 independent cultures, with data in
duplicates for each culture. (D) mRNA levels of CYP2E1 and CYP3A4. Results are means ± SEM
for 5 independent cultures, with data in duplicates for each culture. In panels showing bar
graphs, letters F and I indicate a significant effect (P<0.05) of fatty acids and insulin,
respectively. *Significantly different from HepaRG cells incubated without fatty acids and
with the same condition of insulin treatment (P<0.05). #Significantly different from HepaRG
cells incubated without insulin and with the same condition of fatty acid treatment (P<0.05).
Figure 2. Effects of 1 week of treatment with stearic acid (C18:0), oleic acid (C18:1) and
insulin on the expression of genes responsive to lipids and insulin in HepaRG cells. Results are
means ± SEM for 5 independent cultures, with data in duplicates for each culture. Letters F
and I indicate a significant effect (P<0.05) of fatty acids and insulin, respectively. FxI indicates
a significant interaction between the effects of fatty acids and insulin. *Significantly different
from HepaRG cells incubated without fatty acids and with the same condition of insulin
treatment (P<0.05). #Significantly different from HepaRG cells incubated without insulin and
with the same condition of fatty acid treatment (P<0.05).
146
Figure 3. Effects of 1 week of treatment with insulin in cultured PHH. (A) CYP2E1 and CYP3A4
activity. Results are means ± SEM for 5 and 4 independent cultures, respectively for the
activity of CYP2E1 and CYP3A4. #Significantly different from HepaRG cells incubated without
insulin (P<0.05). (B) mRNA levels of CYP2E1 and CYP3A4. Results are means ± SEM for 4
independent cultures. #Significantly different from HepaRG cells incubated without insulin
(P<0.05). (C) mRNA expression of genes responsive to insulin. Results are means ± SEM for 4
independent cultures. #Significantly different from HepaRG cells incubated without insulin
(P<0.05).
Figure 4. Levels of ATP in HepaRG cells treated or not with APAP. HepaRG cells were
incubated for 1 week with different conditions of incubation with stearic acid (C18:0), oleic
acid (C18:1) and insulin and subsequently treated or not with 2.5, 5, 10 or 20 mM of APAP.
ATP levels were measured 6, 12 or 24 hours after APAP treatment. Cellular ATP levels were
set at 100% in HepaRG cells incubated for 1 week without fatty acids and with 5 µg/ml of
insulin and not treated with APAP. Results are means ± SEM for 3 to 6 independent cultures,
with data in duplicates for each culture. Letters F and I indicate a significant effect (P<0.05)
of fatty acids and insulin, respectively. *Significantly different from HepaRG cells incubated
without fatty acids and with the same condition of insulin treatment (P<0.05). #Significantly
different from HepaRG cells incubated without insulin and with the same condition of fatty
acid treatment (P<0.05).
Figure 5. Levels of total GSH in HepaRG cells treated or not with APAP. HepaRG cells were
incubated for 1 week with different conditions of incubation with stearic acid (C18:0), oleic
acid (C18:1) and insulin and subsequently treated or not with 2.5 or 20 mM of APAP. Total
GSH levels were measured 6, 12 or 24 hours after APAP treatment. Results are means ± SEM
for 5 independent cultures. Letters F and I indicate a significant effect (P<0.05) of fatty acids
and insulin, respectively and ns, not significant with a two-way ANOVA analysis. *Significantly
different from HepaRG cells incubated without fatty acids and with the same condition of
insulin treatment (P<0.05).
147
Figure 6. Expression of different genes involved in oxidative stress in HepaRG cells treated or
not with APAP. HepaRG cells were incubated for 1 week with different conditions of
incubation with stearic acid (C18:0), oleic acid (C18:1) and insulin and subsequently treated
with 2.5 and 20 mM of APAP. Gene expression was measured 6 hours after APAP treatment.
Results are means ± SEM for 3-4 independent cultures, with data in duplicates for each
culture. Letters F and I indicate a significant effect (P<0.05) of fatty acids and insulin,
respectively and ns, not significant with a two-way ANOVA analysis. *Significantly different
from HepaRG cells incubated without fatty acids and with the same condition of insulin
treatment (P<0.05).
Figure 7. Recovery of ATP in HepaRG cells pretreated with the CYP2E1 inhibitor CMZ and
subsequently treated with APAP. HepaRG cells were incubated for 1 week with different
conditions of incubation with stearic acid (C18:0), oleic acid (C18:1), insulin and CMZ and
subsequently treated or not with 2.5 or 20 mM of APAP. ATP levels were measured 6, 24 or
48 hours after APAP treatment. ATP recovery was determined by calculating the difference
of ATP levels measured with and without CMZ. Results are means ± SEM for 3 independent
cultures, with data in triplicates for each culture. Letters F and I indicate a significant effect
(P<0.05) of fatty acids and insulin, respectively and ns, not significant with a two-way ANOVA
analysis. *Significantly different from HepaRG cells incubated without fatty acids and with
the same condition of insulin treatment (P<0.05). #Significantly different from HepaRG cells
incubated without insulin and with the same condition of fatty acid treatment (P<0.05).
Figure 8. Concentrations of APAP-glucuronide and APAP-sulfate in the culture media of
HepaRG cells treated with 2.5 or 20 mM of APAP. HepaRG cells were incubated for 1 week
with different conditions of incubation with stearic acid (C18:0), oleic acid (C18:1) and insulin
and subsequently treated with 2.5 and 20 mM of APAP. APAP-glucuronide and APAP-sulfate
were measured 1 and 6 hours after APAP treatment. Results are means ± SEM for 4
independent cultures. The letter I indicates a significant effect (P<0.05) of insulin, and ns, not
significant with a two-way ANOVA analysis. #Significantly different from HepaRG cells
incubated without insulin and with the same condition of fatty acid treatment (P<0.05).
00.
01 5 00.
01 5 00.
01 5
0
20
40
60
80
100
F, I*
no FA C18:0 C18:1
Insulin(µg/ml)
*
#T
rig
lyce
rid
es(n
mol /
mg o
f pro
tein
s)
A
B
D CYP2E1 mRNA CYP3A4 mRNA
CCYP2E1 activity CYP3A4 activity
Cellular triglycerides
00.
01 5 00.
01 5 00.
01 50
50
100
150
200
no FA C18:0 C18:1
Insulin(µg/ml)
*
#
F, I
*
CY
P2E
1 ac
tivi
ty(p
mol O
H-C
ZX
/ h
/ m
g o
f pro
tein
s)
00.
01 5 00.
01 5 00.
01 50
2
4
6
8
I
#
#
no FA C18:0 C18:1
Insulin(µg/ml)
CY
P2E
1 m
RN
Are
lativ
e e
xpre
ssio
n
00.
01 5 00.
01 5 00.
01 50.0
0.2
0.4
0.6
0.8
1.0
1.2
F
*
no FA C18:0 C18:1
Insulin(µg/ml)
CY
P3A
4 m
RN
Are
lativ
e e
xpre
ssio
n
00.
01 5 00.
01 5 00.
01 50
10
20
30
40
no FA C18:0 C18:1
Insulin(µg/ml)
F
*
CY
P3A
4 ac
tivi
ty(n
mol 6
OH
-testo
ste
rone / h
/ m
g o
f pro
tein
s)
1 2 3
4 5 6
Figure 1
00.
01 5 00.
01 5 00.
01 50
1
2
3
no FA C18:0 C18:1
Insulin(µg/ml)
I # #
#
SR
EB
PF1
mR
NA
rela
tive e
xpre
ssio
n
SREBF1
00.
01 5 00.
01 5 00.
01 50.0
0.5
1.0
1.5
2.0
no FA C18:0 C18:1
Insulin(µg/ml)
I#
#
AC
AC
A m
RN
Are
lativ
e e
xpre
ssio
n
ACACA
00.
01 5 00.01 5 0
0.01 5
0.0
0.5
1.0
1.5
2.0
no FA C18:0 C18:1
Insulin(µg/ml)
F, I*
#
#
#
#
PD
K4
mR
NA
rela
tive e
xpre
ssio
n
PDK4
00.
01 5 00.
01 5 00.
01 50
1
2
3
4
I # ##
#
no FA C18:0 C18:1
Insulin(µg/ml)
SC
D1
mR
NA
rela
tive e
xpre
ssio
n
SCD1
00.
01 5 00.
01 5 00.
01 50.0
0.5
1.0
1.5
2.0
2.5
no FA C18:0 C18:1
Insulin(µg/ml)
F, I
#
FAB
P4
mR
NA
rela
tive e
xpre
ssio
n
FABP4
00.
01 5 00.
01 5 00.
01 50
2
4
6
8
no FA C18:0 C18:1
Insulin(µg/ml)
F, I, FXI
#
* *
AP
O A
4 m
RN
Are
lativ
e e
xpre
ssio
n
APOA4
00.
01 5 00.
01 5 00.
01 50.0
0.5
1.0
1.5
2.0
no FA C18:0 C18:1
Insulin(µg/ml)
I# #
#
PN
PL
A3
mR
NA
rela
tive e
xpre
ssio
n
PNPLA3
00.
01 5 00.
01 5 00.
01 50
1
2
3
F *
no FA C18:0 C18:1
Insulin(µg/ml)
*
PLI
N1
mR
NA
rela
tive e
xpre
ssio
n
PLIN1
00.01 5 0
0.01 5 0
0.01 5
0
1
2
F
no FA C18:0 C18:1
Insulin(µg/ml)
PLI
N2
mR
NA
rela
tive e
xpre
ssio
n
PLIN2
00.01 5 0
0.01 5 0
0.01 5
0.0
0.5
1.0
1.5
2.0
I#
#
no FA C18:0 C18:1
Insulin(µg/ml)
FAS
N m
RN
Are
lativ
e e
xpre
ssio
n
FASN
Figure 2
0 0.01 50
50
100
150
#
Insulin (µg/ml)
CY
P2E
1 ac
tivi
ty(p
mol O
H-C
ZX
/ h
/ m
g o
f pro
tein
s)
CYP2E1 activity
0 0.01 5
0
20
40
60
80
100
120
Insulin (µg/ml)
CY
P3A
4 ac
tivi
ty(n
mol 6
OH
-te
sto
ste
rone / h
/ m
g o
f pro
tein
s)
CYP3A4 activity
0 0.01 50
1
2
3
4
#
#
Insulin (µg/ml)
CY
P2E
1 m
RN
Are
lativ
e e
xpre
ssio
n
CYP2E1 mRNA
0 0.01 50.0
0.2
0.4
0.6
0.8
1.0
1.2
Insulin (µg/ml)
CY
P3A
4 m
RN
Are
lativ
e e
xpre
ssio
n
CYP3A4 mRNA
A
B
0 0.01 5
0
1
2
3
4
5
#
Insulin (µg/ml)
SR
EB
F1 m
RN
Are
lativ
e e
xpre
ssio
n
SREBF1 mRNA
0 0.01 50
5
10
15
20
Insulin (µg/ml)
SC
D1
mR
NA
rela
tive
ex
pre
ssio
n
SCD1 mRNA
0 0.01 50.0
0.2
0.4
0.6
0.8
1.0
1.2
#
Insulin (µg/ml)
PD
K4
mR
NA
rela
tive
ex
pre
ssio
n
PDK4 mRNA
0 0.01 50
1
2
3
4
5
#
#
Insulin (µg/ml)
PN
PL
A3
mR
NA
rela
tive e
xpre
ssio
n
PNPLA3 mRNA
0 0.01 5
0
1
2
3
Insulin (µg/ml)
AC
AC
A m
RN
Are
lativ
e e
xpre
ssio
n
ACACA mRNA
0 0.01 5
0
2
4
6
8
10
Insulin (µg/ml)
FAS
N m
RN
Are
lativ
e e
xpre
ssio
n
FASN mRNAC
Figure 3
0
20
40
60
80
100
120
no FA C18:0 C18:1
6h
no FA C18:0 C18:1
12h
no FA C18:0 C18:1
24h
F, I
*
F, I
*
F
*
Cel
lula
r A
TP
(%
)2.5 mM APAP
0
20
40
60
80
100
120
*#
#
#
#
0µg/ml insulin
0.01µg/ml insulin
5µg/ml insulin
no FA C18:0 C18:1
F, I
Cel
lula
r A
TP
(%
)
0
20
40
60
80
100
120
no FA C18:0 C18:1
6h
no FA C18:0 C18:1
12h
no FA C18:0 C18:1
24h
F, I F F
*
Cel
lula
r A
TP
(%
)
0
20
40
60
80
100
120 F F F
no FA C18:0 C18:1
6h
no FA C18:0 C18:1
12h
no FA C18:0 C18:1
24h
Cel
lula
r A
TP
(%
)
0
20
40
60
80
100
120 F F F
no FA C18:0 C18:1
6h
no FA C18:0 C18:1
12h
no FA C18:0 C18:1
24h
Cel
lula
r A
TP
(%
)
5 mM APAP
10 mM APAP
20 mM APAP
0 mM APAPFigure 4
0
10
20
30
40
50
without insulin
with 5µg/ml insulin
no FA C18:0 C18:1
ns[G
SH
] n
mo
l / m
g p
rote
in
0
10
20
30
40
no FA C18:0 C18:1
6h
no FA C18:0 C18:1
12h
no FA C18:0 C18:1
24h
F, I F
**
F
[GS
H]
nmo
l /
mg
pro
tein
0
10
20
30
40
no FA C18:0 C18:1
6h
no FA C18:0 C18:1
12h
no FA C18:0 C18:1
24h
ns F F, I
[GS
H]
nmo
l /
mg
pro
tein
2.5 mM APAP
0 mM APAP
20 mM APAP
Figure 5
0
1
2
3
4
F
*
C18:0 C18:1no FA0
1
2
3
4
C18:0 C18:1no FA
ns
0
1
2
3
4
C18:0 C18:1no FA
ns
NR
F2
rela
tive
exp
ressio
n
NRF2
0 mM APAP 2,5 mM APAP 20 mM APAP
0
1
2
3
C18:0 C18:1no FA
ns
0
1
2
3
C18:0 C18:1no FA
ns
GC
LC
mR
NA
rela
tive
exp
ressio
n
0
1
2
3
C18:0 C18:1no FA
ns
GCLC
0 mM APAP 2,5 mM APAP 20 mM APAP
0
1
2
3
4
5
C18:0 C18:1no FA
F
HM
OX
1 m
RN
Are
lative
exp
ressio
n
0
1
2
3
4
5
C18:0 C18:1no FA
ns
0
1
2
3
4
5
C18:0 C18:1no FA
ns
HMOX1
0 mM APAP 2,5 mM APAP 20 mM APAP
0
2
4
6
C18:0 C18:1no FA
F
*
0
2
4
6
I
C18:0 C18:1no FA
GS
TA
1/2
rela
tive
exp
ressio
n
0
2
4
6
C18:0 C18:1no FA
F
GSTA1/2
0 mM APAP 2,5 mM APAP 20 mM APAP
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
C18:0 C18:1no FA
*
I
GS
TA
3re
lative
exp
ressio
n
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
C18:0 C18:1no FA
F
*
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
C18:0 C18:1no FA
**
F
GSTA3
0 mM APAP 2,5 mM APAP 20 mM APAP
0
2
4
6
8
10
12
C18:0 C18:1no FA
F
*
*
TR
IB3
mR
NA
rela
tive
exp
ressio
n
0
2
4
6
8
10
12
C18:0 C18:1no FA
F *
0
2
4
6
8
10
12
C18:0 C18:1no FA
F
* *
TRIB3
0 mM APAP 2,5 mM APAP 20 mM APAP
0
1
2
3
4ns
C18:0 C18:1no FA
GS
TM
1re
lative
exp
ressio
n
0
1
2
3
4
C18:0 C18:1no FA
ns
0
1
2
3
4
C18:0 C18:1no FA
ns
GSTM1
0 mM APAP 2,5 mM APAP 20 mM APAP
0
5
10
15
20
C18:0 C18:1no FA
F
*
HS
P70
mR
NA
rela
tive
exp
ressio
n
0
5
10
15
20
C18:0 C18:1no FA
F
*
0
5
10
15
20
C18:0 C18:1no FA
F
HSP70
0 mM APAP 2,5 mM APAP 20 mM APAP
Figure 6
0
10
20
30
40
50
60
no FA C18:0 C18:1
6h
no FA C18:0 C18:1
24h
no FA C18:0 C18:1
48h
F, I ns ns
*
#
ATP
rec
ove
ry w
ith
CM
Z (%
)
0
5
10
15
20
25
no FA C18:0 C18:1
*with 5µg/ml insulin
without insulin
FA
TP r
eco
very
wit
h C
MZ
(%)
0
10
20
30
40
50
60
no FA C18:0 C18:1
6h
no FA C18:0 C18:1
24h
no FA C18:0 C18:1
48h
F nsF
*
*
*
ATP
rec
over
y w
ith
CM
Z (%
)
2.5 mM APAP
0 mM APAP
20 mM APAP
Figure 7
0
50
100
150
200
250
no FA C18:0 C18:1
2.5 mM APAP
no FA C18:0 C18:1
20 mM APAP
#
ns I
AP
AP
-glu
curo
nid
e (µ
M)
0
5
10
15
20
25
no FA C18:0 C18:1
2.5 mM APAP
no FA C18:0 C18:1
20 mM APAP
I I
without insulin
with 5 µg/ml insulin
AP
AP
-glu
curo
nid
e (µ
M)
0
2
4
6
no FA C18:0 C18:1
2.5 mM APAP
no FA C18:0 C18:1
20 mM APAP
ns ns
AP
AP
-sul
fate
(µM
)
APAP-Glucuronide after 1h APAP-Glucuronide after 6h
APAP-Sulfate after 1h APAP-Sulfate after 6h
0
10
20
30
40
50
no FA C18:0 C18:1
2.5 mM APAP
no FA C18:0 C18:1
20 mM APAP
ns ns
AP
AP
-sul
fate
(µM
)
Figure 8
156
Supplementary materials
Supplementary Table 1. Sequences of the primers used in the study.
Gene Forward primer Reverse primer
ACACA ACAGTGGAGCAAGAATCGG AATGGACAGAGTTGAGAGCAC
APO A4 CAGTGTGGCAAGAAACTCCT GTAGTCCCACATCACCGTG
CYP2E1 TTGAAGCCTCTCGTTGACCC CGTGGTGGGATACAGCAA
CYP3A4 CTTCATCCAATGGACTGCATAAAT TCCCAAGTATAACACTCTACACAGACAA
FABP4 GGAAAATCAACCACCATAAAGAGAA GGAAGTGACGCCTTTCATGAC
FASN GTACACACCCAAGGCCAAGTA GACGTGGACGGATACTTTCC
GCLC GGCGATGAGGTGGAATAC AGGATGGTTTGGGTTTGTC
GSTA1/2 TGCAACAATAAGTGCTTTACCTAAGTG TTAACTAAGTGGGTGAATAGGAGTTGTATT
GSTA3 AAGTCGCTATTTCCCTGCC GAAGTTGGAGATAAGGCTGGAG
GSTM1 CTCCACCGTATATTTGAGCCC AGCCATCTTTGAGAACACAGG
HMOX1 ACTTTCAGAAGGGCCAGGT TTGTTGCGCTCAATCTCCT
HSP70 AGC TGCTGCAGGACTTCTTC AAGATCTGCGTCTGCTTGGT
NRF2 TCAGCATGCTACGTGATGAAG TTTGCTGCAGGGAGTATTCA
PDK4 CTCGCGCTAGAGCCCG GCATTTTCTGAACCAAAGTCCAG
PLIN1 TGGTCCTCATGATCCTCCTC GTTGTCGATGTCCCGGAATT
PLIN2 CCATTCTACTGTTCACCTGATTGA ACCCATGAGAGGTAGAGCTTAT
PNPLA3 TTCTGGTGTCTGACTTTCGG ATGAAGGGTACGTTGTCACTC
SCD1 ACTATTTTGTCAGTGCCCTGG ACGAGCCCATTCATAGACATC
SREBF1 CAACACAGCAACCACAAACTC CTCCACCTCAGTCTTCACG
TBP GAGAGTTCTGGGATTGTACCG ATCCTCATGATTACCGCAGC
TRIB3 CCCTGCTCACAGAGATGACA GCAGCTGGTTTGTTTGTGAA
157
Legends to the supplementary figures
Supplementary Figure 1. Effects of 1 week of treatment with stearic acid (C18:0), oleic acid
(C18:1) and insulin on CYP2E1 protein expression in HepaRG cells. (A) Representative
western blot. (B) CYP2E1 levels were assessed in 5 independent cultures, and values were
normalized with HSC70. The letter I indicate a significant effect (P<0.05) of insulin with a two-
way ANOVA analysis.
Supplementary Figure 2. Activity of CYP2E1 and CYP3A4 in HepaRG cells in different
conditions of treatment. (A) CYP2E1 and CYP3A4 activity in HepaRG cells incubated during
one week with different concentrations of insulin and with or without 50 µM of stearic acid
(C18:0), or oleic acid (C18:1). Results are means ± SEM for 4 independent cultures. (B)
CYP2E1 and CYP3A4 activity in HepaRG cells incubated during 48 h with different
concentrations of insulin and with or without 100 µM of stearic acid (C18:0), or oleic acid
(C18:1). Results are means ± SEM for 3 independent cultures.
Supplementary Figure 3. PHH from 4 different donors 2 days after seeding and before the
one-week treatment with different concentrations of insulin and with or without 100 µM of
stearic acid, or oleic acid. Note the presence of numerous cytoplasmic fat droplets in the
PHH of these donors.
Supplementary Figure 4. Levels of ATP in HepaRG cells treated or not with various
concentrations of APAP. HepaRG cells were incubated for 1 week with different conditions of
incubation with stearic acid (C18:0), oleic acid (C18:1) and insulin and subsequently treated
with concentrations of APAP ranging from 1 to 20 mM. ATP levels were measured 6, 24 or 48
hours after APAP treatment. Results are means ± SEM for 3 to 6 independent cultures, with
data in duplicates for each culture. †Significantly different from HepaRG cells incubated
without APAP (P<0.05).
158
Supplementary Figure 5. Total GSH levels in HepaRG cells pretreated or not with the CYP2E1
inhibitor CMZ and subsequently treated with APAP. HepaRG cells were incubated for 1 week
with different conditions of incubation with stearic acid (C18:0), oleic acid (C18:1), insulin
and CMZ and subsequently treated or not with 2.5 and 20 mM APAP. GSH levels were
measured 24 hours after APAP treatment. Results are means ± SEM for 5 independent
cultures. Letters F and I indicate a significant effect (P<0.05) of fatty acids and insulin,
respectively and ns, not significant with a two-way ANOVA analysis.
Supplementary Figure 6. Effects of AMPK activation on APAP-induced toxicity in HepaRG
cells. Effects of metformin and AICAR on the recovery of ATP and total GSH levels in HepaRG
cells treated with 20 mM of APAP. Cells were incubated with different conditions of
incubation with stearic acid (C18:0), oleic acid (C18:1) and insulin. After 1 week, cells were
first preincubated for 6h with or without 500 µM of each activator and then treated for 24h
with 20 mM of APAP, with or without each AMPK activator. (A) ATP recovery with metformin
and AICAR. ATP recovery was determined by calculating the difference of ATP levels
measured with and without each AMPK activator. Results are means ± SEM for 4
independent cultures. The letters ns indicate that there was no significant effect of fatty
acids or insulin with a two-way ANOVA analysis. (B) Levels of total GSH in cells treated or not
with metformin and AICAR. Results are means ± SEM for 4 independent cultures. The letters
ns indicate that there was no significant effect of fatty acids or insulin with a two-way
ANOVA analysis.
Supplementary figure 1
00.0
1 5 00.0
1 5 00.0
1 5
0.0
0.5
1.0
1.5
2.0
2.5
3.0
I
no FA C18:0 C18:1
Insulin(µg/ml)
CY
P2E
1 p
rote
inre
lativ
e e
xpre
ssio
n
0 0.01 5
no FA
0 0.01 5
C18:0
0 0.01 5
C18:1
CYP2E1
HSC70
Insulin(µg/ml)
A
B
00.
01 5 00.
01 5 00.
01 50
10
20
30
40
no FA C18:0 C18:1
Insulin(µg/ml)
ns
CY
P3A
4 ac
tivi
ty(n
mol 6
OH
-testo
ste
rone / h
/ m
g o
f pro
tein
s)
00.
01 5 00.
01 5 00.
01 50
20
40
60
no FA C18:0 C18:1
Insulin(µg/ml)
ns
CY
P2E
1 ac
tivi
ty(p
mol O
H-C
ZX
/ h
/ m
g o
f pro
tein
s)
CYP2E1 activity after 7 days with 50µM FA
00.
01 5 00.
01 5 00.
01 5
0
20
40
60
80
no FA C18:0 C18:1
Insulin(µg/ml)
ns
CY
P2E
1 ac
tivi
ty(p
mol O
H-C
ZX
/ h
/ m
g o
f pro
tein
s)
00.
01 5 00.
01 5 00.
01 5
0
5
10
15
20
25
no FA C18:0 C18:1
Insulin(µg/ml)
ns
CY
P3A
4 ac
tivity
(nm
ol 6
OH
-testo
ste
rone / h
/ m
g o
f pro
tein
s)
CYP3A4 activity after 7 days with 50µM FA
CYP2E1 activity after 48h with 100µM FA CYP3A4 activity after 48h with 100µM FA
A
B
Supplementary figure 2
Donor 1 Donor 2
Donor 4Donor 3
Supplementary figure 3
Supplementary figure 4
0 1 2.5 5 10 200
20
40
60
80
100
120
A, F
†
†
APAP concentration (mM)
Cel
lula
r A
TP
(%
)
0 1 2.5 5 10 200
20
40
60
80
100
120 A, F
†
†
†
†
†
†
APAP concentration (mM)
Cel
lula
r A
TP (
%)
0 1 2.5 5 10 200
20
40
60
80
100
120
A, F
††
†
†
APAP concentration (mM)
Cel
lula
r A
TP
(%
)
without insulin 0.01 µg/ml insulin 5 µg/ml insulin
6h
AP
AP
0 1 2.5 5 10 200
20
40
60
80
100
120
A, F
††
†
†
†
††
†
APAP concentration (mM)
Cel
lula
r A
TP
(%
)
0 1 2.5 5 10 200
20
40
60
80
100
120
A, F
†
†
††
†
†
†
APAP concentration (mM)
Cel
lula
r A
TP
(%
)
0 1 2.5 5 10 200
20
40
60
80
100
120
A
†
†
†
†
†
†
†
APAP concentration (mM)
Cel
lula
r A
TP
(%
)
24
h A
PA
P
without insulin 0.01 µg/ml insulin 5 µg/ml insulin
0 1 2.5 5 10 200
20
40
60
80
100
120
A
† †
†
†
†
†
†
†
APAP concentration (mM)
Cel
lula
r A
TP
(%
)
0 1 2.5 5 10 200
20
40
60
80
100
120
A, F
†
†
†
†
†
†
†
†
APAP concentration (mM)
Cel
lula
r A
TP
(%
)
0 1 2.5 5 10 200
20
40
60
80
100
120
A, F
†
†
†
†
†
†
†
†
APAP concentration (mM)
Cel
l via
bili
ty (
%)
48
h A
PA
P
without insulin 0.01 µg/ml insulin 5 µg/ml insulin
0
10
20
30
40
50
without insulin
with 5µg/ml insulin
no FA C18:0 C18:1
without CMZ
no FA C18:0 C18:1
with CMZ
ns ns[G
SH
] n
mo
l / m
g p
rote
in
0
10
20
30
40
no FA C18:0 C18:1
without CMZ
no FA C18:0 C18:1
with CMZ
ns ns
[GS
H]
nmo
l /
mg
pro
tein
0
10
20
30
40
no FA C18:0 C18:1
without CMZ
no FA C18:0 C18:1
with CMZ
F, I ns
[GS
H]
nm
ol
/ mg
pro
tein
2.5 mM APAP
20 mM APAP
0 mM APAP
Supplementary figure 5
0
10
20
30
40
50
without insulin
with 5 µg/ml insulin
no FA C18:0 C18:1
ns
reco
very
of
AT
P (
%)
A. ATP recovery with AMPK activators
0
10
20
30
40
50
no FA C18:0 C18:1
ns
reco
very
of
AT
P (
%)
0 mM APAP
0
20
40
60
no FA C18:0 C18:1
ns
without AMPK activators
no FA C18:0 C18:1
ns
with Metformin
no FA C18:0 C18:1
ns
with AICAR
[GS
H]
nm
ol /
mg
pro
tein
20 mM APAP
0
10
20
30
no FA C18:0 C18:1
ns
without AMPK activators
no FA C18:0 C18:1
ns
with Metformin
no FA C18:0 C18:1
ns
with AICAR
[GS
H]
nm
ol /
mg
pro
tein
Metformin AICAR
B. GSH Level
Supplementary figure 6
165
DISCUSSION, CLONCLUSION ET PERSPECTIVES
• NAFLD et hépatotoxicité des xénobiotiques
De nombreux médicaments, des plantes médicinales et des toxiques industriels
peuvent induire une hépatotoxicité (Biour et al., 2004; Seeff et al., 2015; Wahlang et al.,
2013). Dans les cas les plus graves, cette hépatotoxicité peut nécessiter une hospitalisation,
et éventuellement conduire à la mort du patient (Björnsson, 2009). De nombreux facteurs
peuvent favoriser la survenue d’une hépatotoxicité tels que la présence de certains
polymorphismes génétiques, la consommation excessive d’alcool, ou l’infection par des virus
hépatotropes comme le VHC (Begriche et al., 2011; Chalasani and Björnsson, 2010). De plus,
un nombre croissant d’études indique que la NAFLD est une pathologie hépatique pouvant
augmenter le risque et la sévérité des lésions hépatiques induites par certains médicaments
(e.g. paracétamol, halothane, méthotrexate) ou certains toxiques (e.g. alcool éthylique et
tétrachlorure de carbone) (Donthamsetty et al., 2007; Fromenty, 2013; Michaut et al., 2014;
Tarantino et al., 2007). Etant donné que la NAFLD est fréquemment associée à l'obésité et au
diabète de type 2, l’hépatotoxicité dans ces situations pathologiques est une problématique
importante pour la santé publique (Fromenty, 2013).
Cette problématique soulève cependant pour les toxicologues deux
questions importantes:
1) quels sont les principaux xénobiotiques capables d’induire une hépatotoxicité
accrue dans un contexte d’obésité et de NAFLD?
2) Quels sont les principaux mécanismes impliqués?
Malheureusement, il existe actuellement peu de réponses à ces deux questions.
Concernant les xénobiotiques pouvant présenter un risque particulier, différentes études
cliniques et expérimentales ont pu en identifier quelques-uns (Begriche et al., 2011;
Fromenty, 2013; Tarantino et al., 2007). Cependant, étant donné le grand nombre de
166
médicaments et de toxiques auxquels l’Homme est exposé, il y a encore de nombreuses
investigations à réaliser pour déterminer les molécules les plus problématiques.
Il existe aussi de nombreuses interrogations quant aux mécanismes impliqués dans la
plus grande sensibilité d’un foie stéatosique à l’hépatotoxicité de certains xénobiotiques,
même si quelques hypothèses ont été avancées. On suspecte par exemple les
dysfonctionnements mitochondriaux et le stress oxydant associés à la stéatose qui
pourraient sensibiliser les hépatocytes à une agression externe (Fromenty, 2013). De plus,
ces mécanismes pourraient être complexes et différents en fonction des molécules (Carmiel-
Haggai et al., 2003; Fromenty, 2013; Robin et al., 2005).
• Les modèles expérimentaux de NAFLD
L’identification des molécules particulièrement hépatotoxiques dans un contexte
d’obésité et de NAFLD et les mécanismes impliqués dans cette hépatotoxicité accrue
nécessite d’utiliser des modèles expérimentaux de NAFLD appropriés. Il peut être
intéressant par exemple de travailler sur différents modèles de rongeurs dont l’obésité est
d’origine génétique (souris ob/ob et db/db ou rats fa/fa), ou induite par un régime enrichi en
lipides (Aubert et al., 2011; Carmiel-Haggai et al., 2003; Massart et al., 2012; Xu et al., 2011).
Cependant, il existe de nombreuses différences entre les rongeurs et les humains
concernant le métabolisme hépatique des xénobiotiques (Martignoni et al., 2006), et les
expérimentations animales sont lourdes et éthiquement problématiques.
Concernant les modèles in vitro, de nombreux travaux ont proposé des modèles de
stéatose hépatique en utilisant différents types de cellules, qu’elles soient d’origine humaine
ou animale, incubées avec des acides gras ou plus rarement des émulsions de triglycérides
(Anthérieu et al., 2011; Damelin et al., 2007; De Gottardi et al., 2007; Donato et al., 2007;
Garcia et al., 2011; Janorkar et al., 2009; Liu et al., 2010; Luo et al., 2012; Nativ et al., 2013;
Tirosh et al., 2009). Cependant, ces travaux présentent dans leur ensemble des limitations
importantes qu’il faut souligner :
167
1) Les acides gras (en général, acide palmitique, acide oléique ou des mélanges de ces
deux acides gras) sont parfois utilisés à des concentrations de l’ordre du millimolaire (Donato
et al., 2007; Garcia et al., 2011; Liu et al., 2010), qui sont très supérieures aux concentrations
retrouvées dans la circulation sanguine. En effet, les concentrations plasmatiques des
principaux acides gras saturés (palmitate et stéarate) et monoinsaturés (palmitoléate et
oléate) sont en général inférieures à 200 µM (Fraser et al., 1999; Hagenfeldt et al., 1972;
Kangani et al., 2008; Kotani et al., 2000; Mitropoulos et al., 1994).
2) Plusieurs de ces études utilisent la lignée cellulaire HepG2 (Damelin et al., 2007;
Liu et al., 2010; Luo et al., 2012)qui possède des capacités de métabolisation des
xénobiotiques très limitées, en particulier en ce qui concerne les CYPs (Aninat et al., 2006;
Gerets et al., 2012).
3) Le temps d’exposition des cellules aux acides gras est en général relativement
court, au maximum 48 heures (Damelin et al., 2007; Donato et al., 2007; Garcia et al., 2011;
Liu et al., 2010; Luo et al., 2012; Tirosh et al., 2009). Ainsi, ces modèles cellulaires ne peuvent
pas être utilisés pour étudier les effets cytotoxiques à long-terme de certains xénobiotiques.
4) Dans la plupart des cas, ces travaux n’ont pas évalué l’impact de l’accumulation
lipidique sur les activités du CYP2E1 et du CYP3A4, qui sont significativement modifiées au
cours de l’obésité et des NAFLD. En effet, plusieurs travaux expérimentaux et cliniques ont
montré que l’activité du CYP2E1 est augmentée au cours de ces pathologies, tandis que celle
du CYP3A4 est réduite (Aubert et al, 2011; Brill et al, 2012; Chalasani et al, 2003; Emery et
al., 2003; Kolwankar et al, 2007; Michaut et al, 2014). Une étude réalisée sur des
hépatocytes humains en culture primaire a étudié les effets d’un mélange oléate/palmitate
sur ces activités après 14 heures d’incubation. Cette étude montre cependant une
diminution significative des deux activités (Donato et al., 2007).
168
• NAFLD et hépatotoxicité du paracétamol
Comme il a été mentionné précédemment, des études expérimentales et cliniques
ont montré que l’obésité et la NAFLD pouvaient favoriser l’hépatotoxicité de certains
xénobiotiques, et notamment des médicaments. C’est le cas par exemple du paracétamol,
en particulier chez l’Homme dans le cadre de surdosages (qu’ils soient intentionnels ou non),
ou chez le rongeur après administration de fortes doses (Aubert et al., 2012 ; Corcoran and
Wong, 1987 ; Kon et al., 2010 ; Myers and Shaheen, 2009 ; Nguyen et al., 2008). Il est
important de noter que cette hépatotoxicité accrue dans le contexte de l’obésité ne
semblerait pas restreinte aux intoxications au paracétamol puisqu’elle a été décrite
également pour des doses thérapeutiques (Forget et al., 2009).
Le cas du paracétamol est très intéressant, en particulier pour les raisons suivantes :
1) C’est un antalgique qui est consommé par des millions de personnes, sans
nécessité de prescription médicale.
2) L’hépatotoxicité induite par un surdosage au paracétamol est une des premières
causes d’hépatite fulminante, une atteinte hépatique sévère pouvant entraîner le décès des
patients si les traitements symptomatiques ne sont pas efficaces (Larson et al., 2005;
Megarbane et al., 2007; Shi et al., 2011).
3) Une hépatotoxicité au paracétamol, parfois sévère, peut également s’observer
chez des patients prenant des doses thérapeutiques de cet antalgique, notamment sur des
périodes prolongées, allant plusieurs jours à quelques semaines de traitement) (Claridge et
al., 2010; Forget et al., 2009; Kurtovic and Riordan, 2003; Mitchell et al., 2011; Savino et al.,
2011; Zimmerman and Maddrey, 1995). Dans certaines de ces études, des facteurs
favorisant ont pu être suspectés ou identifiés, tels que le jeûne prolongé, une dénutrition, la
consommation excessive d’alcool ou plus rarement l’obésité et la stéatose associée. Ce point
est discuté plus longuement ci-dessous.
4) Le métabolisme et les mécanismes d’hépatotoxicité du paracétamol sont
globalement bien connus, surtout en ce qui concerne la génération du métabolite toxique
169
NAPQI via les CYP2E1 et CYP3A4 (Hinson et al., 2010; McGill and Jaeschke, 2013; Rumack,
2002). Or, comme cela a été déjà mentionné, l’activité de ces deux enzymes est
significativement modifiée au cours de l’obésité et de la NAFLD. Il est important de
mentionner également qu’une étude effectuée au laboratoire sur des souris wild-type et
génétiquement obèses db/db et ob/ob a apporté des arguments expérimentaux en faveur
du rôle de l’induction du CYP2E1 hépatique dans l’hépatotoxicité accrue du paracétamol
chez certaines des souris obèses (Aubert et al, 2012). Il est à noter enfin que différentes
études expérimentales et cliniques ont montré que l’obésité et la NAFLD étaient également
associées à une augmentation des capacités de glucurono-conjugaison pour le paracétamol
(Abernethy et al., 1983; Aubert et al., 2012; Barshop et al., 2011; Brill et al, 2012; Chaudary,
1993; Michaut et al, 2014).
Dans un article de synthèse récent, nous avons répertorié les différents facteurs qui,
dans un contexte d’obésité et de NAFLD, pourraient favoriser l’hépatotoxicité du
paracétamol, ou à l’inverse protéger les individus vis-à-vis de cette toxicité (Michaut et al.,
2014). Les facteurs qui favoriseraient l’hépatotoxicité au paracétamol sont l’augmentation
de l’activité du CYP2E1 hépatique, la diminution des stocks hépatocellulaires de GSH et la
présence d’une dysfonction mitochondriale significative, s’il existe des lésions de NASH. Les
facteurs qui protégeraient sont l’augmentation du volume de distribution du paracétamol et
des capacités hépatiques de glucuronidation plus importante, ainsi qu’une réduction de
l’activité du CYP3A4.
Ainsi, nous proposons que l’hépatotoxicité accrue de cet antalgique chez les sujets
présentant une NAFLD, rapportée principalement dans un contexte d’intoxication (Myers et
Shaheen, 2008; Nguyen et al, 2008), dépend de la balance entre ces différents facteurs
(Michaut et al., 2014). Ceci pourrait expliquer notamment pourquoi tous les sujets obèses ne
semblent pas susceptibles à l’hépatotoxicité du paracétamol et aussi pourquoi cette
hépatotoxicité accrue s’observerait principalement dans un contexte d’intoxication. Cette
situation contraste avec les sujets alcooliques chez lesquels l’hépatotoxicité du paracétamol
est fréquemment observée, que ce soit après une intoxication ou dans un contexte de prise
170
de doses thérapeutiques (Larson et al., 2005; Lesser et al., 1986; Manchanda et al., 2013;
McClain et al., 1980; Zimmerman and Maddrey, 1995). En effet, dans le cadre de
l’intoxication alcoolique, les facteurs qui pourraient protéger de la toxicité du paracétamol
sont peu nombreux, voire inexistants.
• Les deux grands objectifs des travaux de thèse
Dans ce contexte, mon travail de thèse a eu un double objectif :
1) Grâce à la lignée d'hépatome humain HepaRG, nous avons voulu mettre au point
un modèle cellulaire reproduisant un certain nombre de caractéristiques métaboliques de la
NAFLD, notamment en ce qui concerne les activités des CYP2E1 et CYP3A4, et l’expression
de gènes du métabolisme glucido-lipidique. Pour celà, des cellules HepaRG différenciées ont
été traitées pendant une semaine avec de l'acide stéarique (C18:0) ou de l'acide oléique
(C18:1), en présence de différentes concentrations d'insuline (0, 0.01 or 5µg/ml). Nous avons
étudié les effets de l’insuline car cette hormone joue un rôle central dans l’accumulation des
lipides au niveau hépatocytaire (Ferré and Foufelle, 2010; Xu et al., 2013). De plus,
différentes investigations réalisées sur des cellules hépatiques de rat ont montré que
l’insuline pouvait moduler l’expression du CYP2E1 (Moncion et al., 2002; Shukla et al., 2013;
Woodcroft and Novak, 1999a; Woodcroft et al., 2002).
2) Dans un deuxième temps, nous avons testé la validité de ce modèle cellulaire en
utilisant le paracétamol comme exemple de médicament dont l’hépatotoxicité est accrue
dans un contexte de NAFLD.
Avant de présenter les principaux résultats obtenus, il est important de rappeler
quelques points importants concernant la lignée HepaRG, une lignée cellulaire qui a été
découverte à Rennes par l’équipe de Christiane Guguen-Guillouzo et décrite initialement
pour ces capacités à être infectée par le virus de l’hépatite B (Gripon et al., 2002). Depuis ces
travaux pionniers, de nombreuses études ont montré que cette lignée était
métaboliquement compétente en ce qui concerne les enzymes du métabolisme des
xénobiotiques, avec en particulier des activités des principaux CYPs assez proches des
171
hépatocytes primaires humains (Aninat et al., 2006; Anthérieu et al., 2012; Gerets et al.,
2012; Guillouzo et al., 2007). De plus, il a été montré que la lignée HepaRG était un modèle
intéressant pour étudier les mécanismes d'hépatotoxicité aiguë, ou chronique, induite par
des médicaments (e.g. paracétamol, amiodarone, tétracycline) et différents dérivés toxiques
(e.g. endosulfan, aflatoxin B1, malathion) (Anthérieu et al., 2011; Josse et al., 2008, 2014;
McGill et al., 2011; Savary et al., 2014; Tobwala et al., 2015). Les cellules HepaRG ont été
également utilisées avec succès pour étudier les effets de nutriments, d’hormones ou de
médicaments sur l'expression de diverses enzymes impliquées dans le métabolisme des
glucides et des lipides (Anthérieu et al., 2011; Madec et al., 2011; Nagasawa et al., 2007;
Samanez et al., 2012).
• Principaux résultats obtenus
Les principaux résultats obtenus au cours de mon travail de thèse peuvent être
résumés de la façon suivante :
1) Le traitement des cellules HepaRG pendant une semaine avec de l'acide stéarique
est associé à une augmentation de l'activité du CYP2E1 et à une diminution de l'activité du
CYP3A4, reproduisant ainsi différents données cliniques et expérimentales obtenues dans un
contexte d’obésité et de NAFLD (Aubert et al, 2011; Brill et al, 2012; Chalasani et al., 2003;
Emery et al, 2003; Kolwankar et al, 2007). En revanche, l'acide oléique n'a aucun effet sur
l'activité du CYP2E1 et du CYP3A4.
2) Les expériences effectuées avec différentes concentrations d'insuline ont montré
que l'activité du CYP2E1 dans les cellules HepaRG est régulée négativement par l'insuline de
façon concentration-dépendante. Malgré cela, l'insuline est responsable d’une
augmentation de l’expression du CYP2E1, un effet qui est également dépendant de la
concentration de cette hormone. De plus, des expériences réalisées sur des cultures
primaires d’hépatocytes humains montrent que l'insuline réduit également l'activité de
CYP2E1 avec une augmentation concomitante des taux d'ARNm de ce CYP.
172
3) La stéatose induite dans les cellules HepaRG par l'acide stéarique ou oléique est
associée à une plus forte expression de différents gènes connus pour être régulés par les
lipides, comme APOA4, PLIN1 et PLIN2. En outre, comme attendu, l'insuline augmente
l'expression de différents gènes impliqués dans la synthèse des lipides tels que SREBF1, FASN
et SCD1 (Begriche et al, 2013; Postic and Girard, 2008). L'insuline induit également une
augmentation de l'expression de PNPLA3, en accord avec des études récentes (Dubuquoy et
al., 2011; Huang et al., 2010).
4) Nos investigations réalisées avec une large gamme de concentrations de
paracétamol (1 à 20 mM) montrent que la perte d'ATP cellulaire est presque toujours plus
forte en présence d'acide stéarique. En revanche, la cytotoxicité de ce médicament était à
peu près semblable entre les cellules HepaRG non stéatosiques et celles incubées avec de
l'acide oléique.
5) Les expériences avec le chlorméthiazole (CMZ, un inhibiteur du CYP2E1) indiquent
que la plus forte cytotoxicité observée avec 2,5 et 20 mM de paracétamol en présence
d'acide stéarique peut être attribué, au moins en partie, à l'activité du CYP2E1. Toutefois,
l'implication du CYP2E1 dans la cytotoxicité du paracétamol observée en absence d’insuline
ne semble significative qu’avec 20 mM de ce médicament. De façon intéressante, nos
expériences montrent également que dans les cellules HepaRG non traitées avec le
paracetamol, la perte (légère à modérée) de l'ATP cellulaire observée dans certaines
conditions est secondaire à l'activité basale du CYP2E1.
6) Alors que le CMZ protège les cellules HepaRG vis-à-vis de la perte d’ATP, cet
inhibiteur du CYP2E1 n’offre pas de protection concernant la diminution du GSH et la
génération des adduits du paracétamol avec les protéines cellulaires (adduits «APAP-
protéines»).
Dans la suite de la discussion, certains des résultats mentionnés ci-dessus seront plus
particulièrement développés.
173
• Effets des acides gras sur l’activité du CYP2E1 et du CYP3A4 dans les cellules
HepaRG
Dans notre travail, nous avons obtenu des résultats significatifs avec l’acide stéarique
sur les activités du CYP2E1 et CYP3A4 tandis que l’acide oléique n’avait aucun effet, alors
que le degré de stéatose hépatocytaire était similaire pour les deux acides gras. Ceci suggère
que la nature des acides gras accumulés est très importante, plutôt que la simple quantité
de lipides. Ce résultat important est en accord avec une étude réalisée récemment au
laboratoire sur des souris femelles wild-type, ob/ob et db/db (Aubert et al., 2012). En effet,
cette étude a montré que l’activité du CYP2E1 hépatique était significativement augmentée
chez les souris db/db par rapport au souris non obèses mais pas chez les souris ob/ob, alors
que la quantité de lipides et de triglycérides intra-hépatiques était bien moindre chez les
souris db/db par rapport au souris ob/ob (Aubert et al., 2012). Malheureusement, l’activité
du CYP3A4 n’a pas été évaluée dans cette étude. Il est à noter enfin que deux études
cliniques ont rapporté une corrélation positive et significative entre l’activité du CYP2E1 et le
degré de stéatose mais ces études n’ont pas évalué la nature des lipides intra-hépatiques
(Chtioui et al., 2007 ; Emery et al., 2003). Il serait intéressant à l’avenir de déterminer sur les
cellules HepaRG les effets d’autres acides gras sur les activités du CYP2E1 et CYP3A4 afin de
savoir notamment si les effets de l’acide stéarique peuvent être reproduits avec d’autres
acides gras saturés à longue chaîne. En outre, des investigations seraient nécessaires afin de
déterminer les mécanismes par lesquels l’acide stéarique augmente l’activité du CYP2E1 et
réduit celle du CYP3A4.
Concernant le CYP2E1, il semble que l’acide stéarique agisse à un niveau post-
traductionnel puisque l’augmentation de l’activité de ce CYP n’est pas associée à une
augmentation de son expression. Cependant la régulation post-traductionnelle du CYP2E1
est relativement peu documentée. Des investigations sur des hépatocytes de rat ont montré
que la phosphorylation du CYP2E1 via la protéine kinase A (PKA) diminue l’activité de
l’enzyme sans modifier l’expression protéique (Oesch-Bartlomovicz et al., 1998). Il serait
donc intéressant d’étudier les effets de l’acide stéarique sur l’état de phosphorylation du
CYP2E1, en particulier au niveau de la Ser129 qui semble importante pour la modulation de
174
l’activité enzymatique (Oesch-Bartlomovicz et al., 1998). Il serait intéressant également de
déterminer si l’acide stéarique est capable de réduire l’activité de la PKA au niveau
hépatocytaire, ce qui pourrait expliquer l’augmentation de l’activité du CYP2E1. Après
recherche bibliographique, nous n’avons pas retrouvé de données rapportant un effet de
l’acide stéarique sur l’activation de la PKA dans les hépatocytes. De façon surprenante,
plusieurs études réalisées sur des cellules non-hépatocytaires ont montré que d’autres
acides gras tels que des acides gras polyinsaturés à chaîne longue (acide eicosapentaenoïque
et acide arachidonique), l’acide 2-hydroxyoléique et l’acide butyrique pouvaient activer la
voie cAMP/PKA (Alemany et al., 2006; DeCastro et al., 2005; McClain et al., 1980; Petersen et
al., 2003; Szentandrássy et al., 2007). Ainsi, l’activation de la PKA par les acides gras pourrait
être dépendante de leur structure, et peut-être aussi du type cellulaire.
Contrairement au CYP2E1, l'activité du CYP3A4 dans les cellules HepaRG est réduite
par l'acide stéarique, mais pas par l'acide oléique. La diminution de l’activité du CYP3A4 est
associée à une expression plus faible de cette enzyme. De façon intéressante, une étude
réalisée sur des hépatocytes humains a montré qu'un mélange d'acide palmitique (C16:0) et
d'acide oléique réduisait l'activité du CYP3A4 (Donato et al, 2006). Cependant, ces effets
apparaissent assez rapidement (14 h) après l’ajout d’acides gras, et l’étude n’a pas
déterminé les taux d’ARNm (Donato et al, 2006). Ainsi, l'activité du CYP3A4 et peut-être son
expression pourrait être plus spécifiquement réduite par les acides gras saturés à longue
chaîne, mais des investigations avec différents acides gras seraient nécessaires afin de
répondre à cette question.
Les mécanismes par lesquels l’acide stéarique réduirait l’expression et l’activité du
CYP3A4 ne sont pas connus. Une première hypothèse pourrait être la présence d’un stress
du réticulum endoplasmique qui induirait secondairement l’activation de SREBP-1c (Ferré
and Foufelle, 2010). Des investigations réalisées sur des hépatocytes humains a montré que
ce facteur de transcription peut réduire significativement l’expression du CYP3A4 (Roth et
al., 2008). Une deuxième hypothèse possible serait le rôle du stress oxydatif comme
certaines études pourraient le suggérer (Anthérieu et al., 2013; Gallagher et al., 1995). Il est
175
intéressant de noter qu’une étude réalisée sur des hépatocytes humains a montré que
l’activation de la PKA était responsable d’une diminution de l’expression (mRNA) du CYP3A4
(Lichti-Kaiser et al., 2009). Cependant, bien que la piste de la PKA puisse être intéressante, il
serait difficile d’expliquer pourquoi l’augmentation de l’activité du CYP2E1 par l’acide
stéarique serait liée à une réduction de l’activité de PKA et la diminution de l’expression du
CYP3A4 à une activation de cette kinase.
• Effets de l’insuline sur l’activité du CYP2E1 dans les cellules HepaRG
Mis à part la nature des lipides accumulés dans le foie, d’autres facteurs pourraient
participer à l’augmentation de l’activité du CYP2E1 observée au cours de l’obésité et de la
NAFLD. En particulier, certaines investigations cliniques ont rapporté que cette induction du
CYP2E1 était associée à l'insulinorésistance et au diabète de type 2 (Chalasani et al., 2003;
Emery et al., 2003; Wang et al, 2003). Ainsi, des facteurs comme l’insuline et le glucose
pourraient jouer un rôle significatif. Dans notre travail, nous avons étudié les effets de
l’insuline pour des raisons déjà évoquées ci-dessus mais pas les effets du glucose car nous
avions déjà beaucoup de conditions de culture cellulaire à tester.
Une observation importante dans notre étude est que l'insuline réduit de façon
concentration-dépendante l'activité de CYP2E1 dans les cellules HepaRG et les hépatocytes
humains en culture primaire. Ainsi, plus les quantités d’insuline sont faibles, plus l’activité du
CYP2E1 est élevée dans les hépatocytes. Etant donné que l’obésité et la NAFLD sont souvent
associées à une insulinorésistance, en particulier au niveau hépatique (Asrih and Jornayvaz,
2015; Begriche et al., 2013), nos résultats suggèrent qu’une moindre signalisation insulinique
dans les hépatocytes pourrait, au moins en partie, expliquer l’induction du CYP2E1
hépatique au cours de ces pathologies dysmétaboliques. Il est à noter aussi que nos résultats
sont en accord avec certaines études réalisées chez l’animal. Des études ont montré que
l’insulinopénie induite chez les rongeurs traités par la streptozotocine était associée à une
augmentation du CYP2E1 hépatique, et que cette induction était corrigée par un traitement
à l'insuline (Ioannides et al., 1988; Raza et al., 2004).
176
De façon surprenante, alors que l'insuline réduit l'activité du CYP2E1 dans les HepaRG
et les hépatocytes humains en culture primaire, cette hormone est responsable d’une
augmentation des taux d’ARNm du CYP2E1. De plus, l'insuline augmente l'expression
protéique du CYP2E1 dans les 2 types cellulaires. Ceci suggère que l'activité du CYP2E1
pourrait être régulée de façon post-traductionnelle par l'insuline dans les hépatocytes
humains. Il est également intéressant de relever que les effet positifs de l'insuline sur les
taux d’ARNm du CYP2E1 observés contrastent avec les résultats d’études menées sur des
hépatocytes de rats dans lesquelles des effets inverses étaient observés (Moncion et al.,
2002; Woodcroft and Novak, 1999). Cependant, l'activité du CYP2E1 n'a malheureusement
pas été rapportée dans ces études. Ainsi, l'expression du CYP2E1 pourrait être régulée
différemment par l'insuline chez le rat et l'Homme. D'autres travaux de recherche seront
nécessaires pour déterminer les effets de l’insuline sur la transcription, la traduction et la
régulation post-traductionnelle du CYP2E1 dans les hépatocytes humains. Pour cela, les
cellules HepaRG pourraient être utiles comme modèle expérimental.
• Toxicité du paracétamol sur les cellules HepaRG stéatosiques ou non
Chez l’Homme, les concentrations sériques de paracétamol retrouvées dans
différentes situations cliniques correspondantes à des doses thérapeutiques, toxiques et
létales sont respectivement 10-25 mg/L (0,07-0,17 mM), 100-150 mg/L (0,66-1,0 mM) et
200-300 mg/L (1,32-2,0 mM) (Schulz and Schmoldt, 2003). Il y a donc un facteur
respectivement 10 ou 20 entre les concentrations « thérapeutiques » et les concentrations
retrouvées dans des situations de toxicité « classique » ou létale.
Dans notre travail, nous avons étudié une large gamme de concentrations de
paracétamol, allant de 1 à 20 mM, même si la plus faible de ces concentrations n’était pas
cytotoxique dans la plupart des conditions expérimentales testées. Ainsi, nous avons utilisé
une gamme de concentrations qui reproduit le facteur 20 retrouvé dans différentes
situations cliniques. Il est également important de souligner que les concentrations de
paracétamol que nous avons utilisées sont équivalentes à celles classiquement étudiées sur
des hépatocytes humains ou de rongeurs (Jemnitz et al., 2008; Saberi et al., 2014; Xie et al.,
177
2014a). Le travail de Jemnitz et coll. (2008) montre d’ailleurs que les hépatocytes humains
sont beaucoup moins sensibles à la toxicité du paracétamol comparés aux hépatocytes de
rongeurs. En effet, si l’on compare la cytotoxicité de ce médicament sur des hépatocytes de
souris, de rat et d’Homme, les EC50 sont respectivement de 3,8 mM, 7,6 mM et de 28,2 mM
(Jemnitz et al., 2008). Malheureusement dans cette étude, les auteurs n’ont pas retrouvé de
corrélation entre la sensibilité des hépatocytes au paracétamol et l’activité du CYP2E1 pour
les trois espèces étudiées.
Dans nos expériences réalisées sur les cellules HepaRG traitées avec le paracétamol,
l’inhibition du CYP2E1 par le prétraitement au CMZ est associée à une protection
significative vis-à-vis de la chute de l'ATP cellulaire. Celà confirme que le CYP2E1 est
important dans le mécanisme de cytotoxicité de ce médicament. Il est important de noter
que cette « récupération » (recovery) d’ATP à des temps précoces après le traitement au
paracétamol (6 heures) était significativement plus importante en présence d’acide
stéarique comparée aux autres conditions, que cela soit avec de faibles (2,5 mM) ou de
fortes (20 mM) concentrations de paracétamol. Ce résultat est intéressant car il suggère que
la NAFLD pourrait favoriser la cytotoxicité du paracétamol dans un contexte
«thérapeutique» en plus du contexte de surdosage. En absence d’insuline, la
« récupération » d’ATP induite par le CMZ n’est significative que pour les fortes
concentrations de paracétamol (20 mM), ce qui suggère que les sujets ayant le plus grand
risque d’hépatotoxicité sévère après une intoxication au paracétamol seraient ceux qui
présenteraient une signalisation insulinique altérée au niveau hépatique.
De façon surprenante, alors que le CMZ protége les cellules HepaRG de la chute
d’ATP induite par le paracétamol, cet inhibiteur du CYP2E1 n’offre pas de protection vis-à-vis
de la déplétion du GSH ou de l’apparition des adduits « APAP-protéines ». Nous n’avons pas
à l’heure actuelle d’explication définitive à ces résultats apparemment contradictoires.
Cependant, une hypothèse possible serait que l’inhibition du CYP2E1 dans les cellules
HepaRG diminue la formation de NAPQI dans le compartiment mitochondrial sans
178
retentissement significatif sur les concentrations cellulaires totales de GSH et les quantités
d’adduits « APAP-protéines ».
Certains travaux suggèrent en effet que la toxicité du paracétamol pourrait être la
conséquence de la fixation covalente du NAPQI sur certaines protéines mitochondriales
(McGill and Jaeschke, 2013; Tirmenstein and Nelson, 1989), et plusieurs études ont rapporté
la présence d'une quantité importante de CYP2E1 dans les mitochondries du foie, en
particulier chez l'Homme (Bansal et al, 2013;. Knockaert et al., 2011). Ainsi, il est concevable
que l'inhibition de CYP2E1 par le CMZ ait pu empêcher la liaison du NAPQI à des protéines
mitochondriales critiques, et ainsi diminuer la chute secondaire d’ATP, sans modifier
significativement les quantités totales de GSH cellulaire. Il est à noter que le pool de GSH
mitochondrial ne représente effectivement qu’une petite partie (ca. 10 à 15%) des stocks
cellulaires totaux (Fernandez-Checa and Kaplowitz, 2005; Robin et al., 2005).
Finalement, comme le NAPQI est également formé par le CYP3A4, enzyme ayant une
localisation uniquement microsomale, le CMZ ne peut empêcher la génération d’une grande
partie des adduits « APAP-protéines » dans les cellules HepaRG.
179
BIBLIOGRAPHIE
Abdelmegeed, M. A., Banerjee, A., Yoo, S.-H., Jang, S., Gonzalez, F. J., & Song, B.-J. (2012). Critical role of cytochrome P450 2E1 (CYP2E1) in the development of high fat-induced non-alcoholic steatohepatitis. Journal of Hepatology, 57(4), 860–6.
Abdel-Razzak, Z., Loyer, P., Fautrel, A., Gautier, J. C., Corcos, L., Turlin, B., … Guillouzo, A. (1993). Cytokines down-regulate expression of major cytochrome P-450 enzymes in adult human hepatocytes in primary culture. Molecular Pharmacology, 44(4), 707–15.
Abernethy, D. R., Divoll, M., Greenblatt, D. J., & Ameer, B. (1982). Obesity, sex, and acetaminophen disposition. Clinical Pharmacology and Therapeutics, 31(6), 783–90.
Abernethy, D. R., & Greenblatt, D. J. (1982). Pharmacokinetics of drugs in obesity. Clinical
Pharmacokinetics, 7(2), 108–24.
Abernethy, D. R., Greenblatt, D. J., Divoll, M., & Shader, R. I. (1983). Enhanced glucuronide conjugation of drugs in obesity: studies of lorazepam, oxazepam, and acetaminophen. The
Journal of Laboratory and Clinical Medicine, 101(6), 873–80.
Adams, L. A., Waters, O. R., Knuiman, M. W., Elliott, R. R., & Olynyk, J. K. (2009). NAFLD as a Risk Factor for the Development of Diabetes and the Metabolic Syndrome: An Eleven-Year Follow-up Study. The American Journal of Gastroenterology, 104(4), 861–867.
Adams, M. L., Pierce, R. H., Vail, M. E., White, C. C., Tonge, R. P., Kavanagh, T. J., … Bruschi, S. A. (2001). Enhanced acetaminophen hepatotoxicity in transgenic mice overexpressing BCL-2. Molecular Pharmacology, 60(5), 907–15.
Adjei, A. A., Gaedigk, A., Simon, S. D., Weinshilboum, R. M., & Leeder, J. S. (2008). Interindividual variability in acetaminophen sulfation by human fetal liver: implications for pharmacogenetic investigations of drug-induced birth defects. Birth Defects Research. Part A, Clinical and
Molecular Teratology, 82(3), 155–65.
Agarwal, R., MacMillan-Crow, L. A., Rafferty, T. M., Saba, H., Roberts, D. W., Fifer, E. K., … Hinson, J. A. (2011). Acetaminophen-induced hepatotoxicity in mice occurs with inhibition of activity and nitration of mitochondrial manganese superoxide dismutase. The Journal of Pharmacology and
Experimental Therapeutics, 337(1), 110–6.
Aguiar, M., Masse, R., & Gibbs, B. F. (2005). Regulation of cytochrome P450 by posttranslational modification. Drug Metabolism Reviews, 37(2), 379–404. doi:10.1081/DMR-46136
Ahsan, C. H., Renwick, A. G., Macklin, B., Challenor, V. F., Waller, D. G., & George, C. F. (1991). Ethnic differences in the pharmacokinetics of oral nifedipine. British Journal of Clinical Pharmacology, 31(4), 399–403.
Aitken, A. E., Richardson, T. A., & Morgan, E. T. (2006). Regulation of drug-metabolizing enzymes and transporters in inflammation. Annual Review of Pharmacology and Toxicology, 46, 123–49.
180
Akiyama, T. E., & Gonzalez, F. J. (2003). Regulation of P450 genes by liver-enriched transcription factors and nuclear receptors. Biochimica et Biophysica Acta, 1619(3), 223–34.
Alemany, R., Vögler, O., Terés, S., Egea, C., Baamonde, C., Barceló, F., … Escribá, P. V. (2006). Antihypertensive action of 2-hydroxyoleic acid in SHRs via modulation of the protein kinase A pathway and Rho kinase. Journal of Lipid Research, 47(8), 1762–70.
Alhelail, M. A., Hoppe, J. A., Rhyee, S. H., & Heard, K. J. (2011). Clinical course of repeated supratherapeutic ingestion of acetaminophen. Clinical Toxicology (Philadelphia, Pa.), 49(2), 108–12.
Alpert, M. A., & Hashimi, M. W. (1993). Obesity and the heart. The American Journal of the Medical
Sciences, 306(2), 117–23.
Amundsen, M. O., Engdahl, B., Berg, C., & Nordeng, H. (2010). Use of psychotropic drugs and analgesics among users of antiobesity drugs--a population based study. Pharmacoepidemiology
and Drug Safety, 19(3), 273–9.
Anderson, B. J. (2008). Paracetamol (Acetaminophen): mechanisms of action. Paediatric Anaesthesia, 18(10), 915–21.
Anderson, G. D. (2005). Sex and racial differences in pharmacological response: where is the evidence? Pharmacogenetics, pharmacokinetics, and pharmacodynamics. Journal of Women’s
Health (2002), 14(1), 19–29.
Aninat, C., Piton, A., Glaise, D., Le Charpentier, T., Langouët, S., Morel, F., … Guillouzo, A. (2006). Expression of cytochromes P450, conjugating enzymes and nuclear receptors in human hepatoma HepaRG cells. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 34(1), 75–83.
Anstee, Q. M., & Day, C. P. (2013). The genetics of NAFLD. Nature Reviews. Gastroenterology &
Hepatology, 10(11), 645–55.
Anstey, K. J., Kingston, A., Kiely, K. M., Luszcz, M. A., Mitchell, P., & Jagger, C. (2014). The influence of smoking, sedentary lifestyle and obesity on cognitive impairment-free life expectancy. International Journal of Epidemiology, 43(6), 1874–83.
Anthérieu, S., Bachour-El Azzi, P., Dumont, J., Abdel-Razzak, Z., Guguen-Guillouzo, C., Fromenty, B., … Guillouzo, A. (2013). Oxidative stress plays a major role in chlorpromazine-induced cholestasis in human HepaRG cells. Hepatology (Baltimore, Md.), 57(4), 1518–29.
Anthérieu, S., Chesné, C., Li, R., Guguen-Guillouzo, C., & Guillouzo, A. (2012). Optimization of the HepaRG cell model for drug metabolism and toxicity studies. Toxicology in Vitro : An
International Journal Published in Association with BIBRA, 26(8), 1278–85.
Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., & Robin, M.-A. (2011). Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology (Baltimore, Md.), 53(6), 1895–905.
181
Antoine, D. J., Jenkins, R. E., Dear, J. W., Williams, D. P., McGill, M. R., Sharpe, M. R., … Park, B. K. (2012). Molecular forms of HMGB1 and keratin-18 as mechanistic biomarkers for mode of cell death and prognosis during clinical acetaminophen hepatotoxicity. Journal of Hepatology, 56(5), 1070–9.
Antoine, D. J., Williams, D. P., Kipar, A., Jenkins, R. E., Regan, S. L., Sathish, J. G., … Park, B. K. (2009). High-mobility group box-1 protein and keratin-18, circulating serum proteins informative of acetaminophen-induced necrosis and apoptosis in vivo. Toxicological Sciences : An Official
Journal of the Society of Toxicology, 112(2), 521–31.
Antoine, D. J., Williams, D. P., Kipar, A., Laverty, H., & Park, B. K. (2010). Diet restriction inhibits apoptosis and HMGB1 oxidation and promotes inflammatory cell recruitment during acetaminophen hepatotoxicity. Molecular Medicine (Cambridge, Mass.), 16(11-12), 479–90.
Asrih, M., & Jornayvaz, F. R. (2015). Metabolic syndrome and nonalcoholic fatty liver disease: Is
insulin resistance the link? Molecular and Cellular Endocrinology, S0303-7207(15)00094-5.
Aubert, J., Begriche, K., Delannoy, M., Morel, I., Pajaud, J., Ribault, C., … Fromenty, B. (2012). Differences in early acetaminophen hepatotoxicity between obese ob/ob and db/db mice. The
Journal of Pharmacology and Experimental Therapeutics, 342(3), 676–87.
Aubert, J., Begriche, K., Knockaert, L., Robin, M. A., & Fromenty, B. (2011). Increased expression of cytochrome P450 2E1 in nonalcoholic fatty liver disease: Mechanisms and pathophysiological role. Clinics and Research in Hepatology and Gastroenterology, 35(10), 630–637.
Bachmann, K., & Sarver, J. G. (1996). Chlorzoxazone as a single sample probe of hepatic CYP2E1 activity in humans. Pharmacology, 52(3), 169–77.
Bachour-El Azzi, P., Sharanek, A., Abdel-Razzak, Z., Antherieu, S., Al-Attrache, H., Savary, C. C., … Guillouzo, A. (2014). Impact of inflammation on chlorpromazine-induced cytotoxicity and cholestatic features in HepaRG cells. Drug Metabolism and Disposition: The Biological Fate of
Chemicals, 42(9), 1556–66.
Bajt, M. L., Cover, C., Lemasters, J. J., & Jaeschke, H. (2006). Nuclear translocation of endonuclease G and apoptosis-inducing factor during acetaminophen-induced liver cell injury. Toxicological
Sciences : An Official Journal of the Society of Toxicology, 94(1), 217–25.
Bajt, M. L., Farhood, A., Lemasters, J. J., & Jaeschke, H. (2008). Mitochondrial bax translocation accelerates DNA fragmentation and cell necrosis in a murine model of acetaminophen hepatotoxicity. The Journal of Pharmacology and Experimental Therapeutics, 324(1), 8–14. doi:10.1124/jpet.107.129445
Bajt, M. L., Knight, T. R., Farhood, A., & Jaeschke, H. (2003). Scavenging peroxynitrite with glutathione promotes regeneration and enhances survival during acetaminophen-induced liver injury in mice. The Journal of Pharmacology and Experimental Therapeutics, 307(1), 67–73.
Baker, S. S., Baker, R. D., Liu, W., Nowak, N. J., & Zhu, L. (2010). Role of alcohol metabolism in non-alcoholic steatohepatitis. PloS One, 5(3), e9570.
182
Bansal, S., Anandatheerthavarada, H. K., Prabu, G. K., Milne, G. L., Martin, M. V, Guengerich, F. P., & Avadhani, N. G. (2013). Human cytochrome P450 2E1 mutations that alter mitochondrial targeting efficiency and susceptibility to ethanol-induced toxicity in cellular models. The Journal
of Biological Chemistry, 288(18), 12627–44.
Barshop, N. J., Capparelli, E. V, Sirlin, C. B., Schwimmer, J. B., & Lavine, J. E. (2011). Acetaminophen pharmacokinetics in children with nonalcoholic fatty liver disease. Journal of Pediatric
Gastroenterology and Nutrition, 52(2), 198–202.
Bateman, D. N. (2009). Limiting paracetamol pack size: has it worked in the UK? Clinical Toxicology
(Philadelphia, Pa.), 47(6), 536–41.
Beales, D., & McLean, A. E. (1996). Protection in the late stages of paracetamol-induced liver cell injury with fructose, cyslosporin A and trifluoperazine. Toxicology, 107(3), 201–8.
Begriche, K., Igoudjil, A., Pessayre, D., & Fromenty, B. (2006). Mitochondrial dysfunction in NASH: causes, consequences and possible means to prevent it. Mitochondrion, 6(1), 1–28.
Begriche, K., Massart, J., Robin, M.-A., Bonnet, F., & Fromenty, B. (2013). Mitochondrial adaptations and dysfunctions in nonalcoholic fatty liver disease. Hepatology (Baltimore, Md.), 58(4), 1497–507.
Begriche, K., Massart, J., Robin, M.-A., Borgne-Sanchez, A., & Fromenty, B. (2011). Drug-induced toxicity on mitochondria and lipid metabolism: mechanistic diversity and deleterious consequences for the liver. Journal of Hepatology, 54(4), 773–94.
Bell, L. N., Temm, C. J., Saxena, R., Vuppalanchi, R., Schauer, P., Rabinovitz, M., … Mattar, S. G. (2010). Bariatric surgery-induced weight loss reduces hepatic lipid peroxidation levels and affects hepatic cytochrome P-450 protein content. Annals of Surgery, 251(6), 1041–8.
Berardis, S., & Sokal, E. (2014). Pediatric non-alcoholic fatty liver disease: an increasing public health issue. European Journal of Pediatrics, 173(2), 131–9.
Berghöfer, A., Pischon, T., Reinhold, T., Apovian, C. M., Sharma, A. M., & Willich, S. N. (2008). Obesity prevalence from a European perspective: a systematic review. BMC Public Health, 8, 200.
Bernal, W., Auzinger, G., Dhawan, A., & Wendon, J. (2010). Acute liver failure. Lancet, 376(9736), 190–201.
Betts, S., Björkhem-Bergman, L., Rane, A., & Ekström, L. (2015). Expression of CYP3A4 and CYP3A7 in Human Foetal Tissues and its Correlation with Nuclear Receptors. Basic & Clinical Pharmacology
& Toxicology.
Bianchi, M., Martucci, C., Ferrario, P., Franchi, S., & Sacerdote, P. (2007). Increased tumor necrosis factor-alpha and prostaglandin E2 concentrations in the cerebrospinal fluid of rats with inflammatory hyperalgesia: the effects of analgesic drugs. Anesthesia and Analgesia, 104(4), 949–54.
183
Biour, M., Ben Salem, C., Chazouillères, O., Grangé, J.-D., Serfaty, L., & Poupon, R. (2004). Drug-induced liver injury; fourteenth updated edition of the bibliographic database of liver injuries and related drugs. Gastroentérologie Clinique et Biologique, 28(8-9), 720–59.
Björkman, R. (1995). Central antinociceptive effects of non-steroidal anti-inflammatory drugs and paracetamol. Experimental studies in the rat. Acta Anaesthesiologica Scandinavica.
Supplementum, 103, 1–44.
Björnsson, E. (2009). The natural history of drug-induced liver injury. Seminars in Liver Disease, 29(4), 357–63.
Blazka, M. E., Wilmer, J. L., Holladay, S. D., Wilson, R. E., & Luster, M. I. (1995). Role of Proinflammatory Cytokines in Acetaminophen Hepatotoxicity. Toxicology and Applied
Pharmacology, 133(1), 43–52.
Blouin, R. A., Dickson, P., McNamara, P. J., Cibull, M., & McClain, C. (1987). Phenobarbital induction and acetaminophen hepatotoxicity: resistance in the obese Zucker rodent. The Journal of
Pharmacology and Experimental Therapeutics, 243(2), 565–70.
Bock, K. W., & Bock-Hennig, B. S. (2010). UDP-glucuronosyltransferases (UGTs): from purification of Ah-receptor-inducible UGT1A6 to coordinate regulation of subsets of CYPs, UGTs, and ABC transporters by nuclear receptors. Drug Metabolism Reviews, 42(1), 6–13.
Bodegard, J., Sundström, J., Svennblad, B., Östgren, C. J., Nilsson, P. M., & Johansson, G. (2013). Changes in body mass index following newly diagnosed type 2 diabetes and risk of cardiovascular mortality: a cohort study of 8486 primary-care patients. Diabetes & Metabolism, 39(4), 306–13.
Boles, J. W., & Klaassen, C. D. (2000). Effects of molybdate and pentachlorophenol on the sulfation of acetaminophen. Toxicology, 146(1), 23–35.
Bonkovsky, H. L., Kane, R. E., Jones, D. P., Galinsky, R. E., & Banner, B. (1994). Acute hepatic and renal toxicity from low doses of acetaminophen in the absence of alcohol abuse or malnutrition: Evidence for increased susceptibility to drug toxicity due to cardiopulmonary and renal insufficiency. Hepatology, 19(5), 1141–1148.
Booth, A., Magnuson, A., & Foster, M. (2014). Detrimental and protective fat: body fat distribution and its relation to metabolic disease. Hormone Molecular Biology and Clinical Investigation, 17(1), 13–27.
Botta, D., Shi, S., White, C. C., Dabrowski, M. J., Keener, C. L., Srinouanprachanh, S. L., … Kavanagh, T. J. (2006). Acetaminophen-induced liver injury is attenuated in male glutamate-cysteine ligase transgenic mice. The Journal of Biological Chemistry, 281(39), 28865–75.
Bourdi, M. (2002). Protection against acetaminophen-induced liver injury and lethality by interleukin 10: Role of inducible nitric oxide synthase. Hepatology, 35(2), 289–298.
184
Bourdi, M., Korrapati, M. C., Chakraborty, M., Yee, S. B., & Pohl, L. R. (2008). Protective role of c-Jun N-terminal kinase 2 in acetaminophen-induced liver injury. Biochemical and Biophysical
Research Communications, 374(1), 6–10.
Bourrié, M., Meunier, V., Berger, Y., & Fabre, G. (1996). Cytochrome P450 isoform inhibitors as a tool for the investigation of metabolic reactions catalyzed by human liver microsomes. The Journal
of Pharmacology and Experimental Therapeutics, 277(1), 321–32.
Brill, M. J. E., Diepstraten, J., van Rongen, A., van Kralingen, S., van den Anker, J. N., & Knibbe, C. A. J. (2012). Impact of obesity on drug metabolism and elimination in adults and children. Clinical
Pharmacokinetics, 51(5), 277–304.
Browning, J. D., Szczepaniak, L. S., Dobbins, R., Nuremberg, P., Horton, J. D., Cohen, J. C., … Hobbs, H. H. (2004). Prevalence of hepatic steatosis in an urban population in the United States: impact of ethnicity. Hepatology (Baltimore, Md.), 40(6), 1387–95.
Brunt, E. M., Kleiner, D. E., Wilson, L. A., Belt, P., & Neuschwander-Tetri, B. A. (2011). Nonalcoholic fatty liver disease (NAFLD) activity score and the histopathologic diagnosis in NAFLD: distinct clinicopathologic meanings. Hepatology (Baltimore, Md.), 53(3), 810–20.
Brunt, E. M., & Tiniakos, D. G. (2010). Histopathology of nonalcoholic fatty liver disease. World
Journal of Gastroenterology : WJG, 16(42), 5286–96.
Buckley, D. B., & Klaassen, C. D. (2007). Tissue- and gender-specific mRNA expression of UDP-glucuronosyltransferases (UGTs) in mice. Drug Metabolism and Disposition: The Biological Fate
of Chemicals, 35(1), 121–7.
Buckley, N. A., & Gunnell, D. (2007). Does restricting pack size of paracetamol (acetaminophen) reduce suicides? PLoS Medicine, 4(4), e152.
Bugianesi, E., McCullough, A. J., & Marchesini, G. (2005). Insulin resistance: a metabolic pathway to chronic liver disease. Hepatology (Baltimore, Md.), 42(5), 987–1000.
Bulera, S. J., Cohen, S. D., & Khairallah, E. A. (1996). Acetaminophen-arylated proteins are detected in hepatic subcellular fractions and numerous extra-hepatic tissues in CD-1 and C57B1/6J mice. Toxicology, 109(2-3), 85–99.
Burcham, P. C., & Harman, A. W. (1988). Effect of acetaminophen hepatotoxicity on hepatic mitochondrial and microsomal calcium contents in mice. Toxicology Letters, 44(1-2), 91–9.
Burcham, P. C., & Harman, A. W. (1991). Acetaminophen toxicity results in site-specific mitochondrial damage in isolated mouse hepatocytes. The Journal of Biological Chemistry, 266(8), 5049–54.
Butler, A. M., & Murray, M. (1997). Biotransformation of parathion in human liver: participation of CYP3A4 and its inactivation during microsomal parathion oxidation. The Journal of
Pharmacology and Experimental Therapeutics, 280(2), 966–73.
185
Butura, A., Nilsson, K., Morgan, K., Morgan, T. R., French, S. W., Johansson, I., … Ingelman-Sundberg, M. (2009). The impact of CYP2E1 on the development of alcoholic liver disease as studied in a transgenic mouse model. Journal of Hepatology, 50(3), 572–83.
Byrne, C. D., & Targher, G. (2014). Ectopic fat, insulin resistance, and nonalcoholic fatty liver disease: implications for cardiovascular disease. Arteriosclerosis, Thrombosis, and Vascular Biology, 34(6), 1155–61.
Cahill, A., Cunningham, C. C., Adachi, M., Ishii, H., Bailey, S. M., Fromenty, B., & Davies, A. (2002). Effects of alcohol and oxidative stress on liver pathology: the role of the mitochondrion. Alcoholism, Clinical and Experimental Research, 26(6), 907–15.
Canet, M. J., Merrell, M. D., Hardwick, R. N., Betaille, A. M., Campion, S. N., Ferreira, D. W., … Cherrington, N. J. (2015). Altered Regulation of Hepatic Efflux Transporters Disrupts Acetaminophen Disposition in Pediatric Nonalcoholic Steatohepatitis. Drug Metabolism and
Disposition: The Biological Fate of Chemicals, dmd.114.062703–.
Carmiel-Haggai, M., Cederbaum, A. I., & Nieto, N. (2003). Binge ethanol exposure increases liver injury in obese rats. Gastroenterology, 125(6), 1818–33.
Caro, A. A., & Cederbaum, A. I. (2001). Synergistic toxicity of iron and arachidonic acid in HepG2 cells overexpressing CYP2E1. Molecular Pharmacology, 60(4), 742–52.
Carrière, V., Berthou, F., Baird, S., Belloc, C., Beaune, P., & de Waziers, I. (1996). Human cytochrome P450 2E1 (CYP2E1): from genotype to phenotype. Pharmacogenetics, 6(3), 203–11.
Cederbaum, A. I. (2014). Methodology to assay CYP2E1 mixed function oxidase catalytic activity and its induction. Redox Biology, 2, 1048–1054.
Cederbaum, A. I., Lu, Y., & Wu, D. (2009). Role of oxidative stress in alcohol-induced liver injury. Archives of Toxicology, 83(6), 519–48.
Chalasani, N., & Björnsson, E. (2010). Risk factors for idiosyncratic drug-induced liver injury. Gastroenterology, 138(7), 2246–59.
Chalasani, N., Gorski, J. C., Asghar, M. S., Asghar, A., Foresman, B., Hall, S. D., & Crabb, D. W. (2003). Hepatic cytochrome P450 2E1 activity in nondiabetic patients with nonalcoholic steatohepatitis. Hepatology (Baltimore, Md.), 37(3), 544–50.
Chanda, S., Mangipudy, R. S., Warbritton, A., Bucci, T. J., & Mehendale, H. M. (1995). Stimulated hepatic tissue repair underlies heteroprotection by thioacetamide against acetaminophen-induced lethality. Hepatology (Baltimore, Md.), 21(2), 477–86.
Chao, D. T., & Korsmeyer, S. J. (1998). BCL-2 family: regulators of cell death. Annual Review of
Immunology, 16, 395–419.
Chatuphonprasert, W., Nemoto, N., Sakuma, T., & Jarukamjorn, K. (2012). Modulations of cytochrome P450 expression in diabetic mice by berberine. Chemico-Biological Interactions, 196(1-2), 23–9.
186
Chaudhary, I. P., Tuntaterdtum, S., McNamara, P. J., Robertson, L. W., & Blouin, R. A. (1993). Effect of genetic obesity and phenobarbital treatment on the hepatic conjugation pathways. The Journal
of Pharmacology and Experimental Therapeutics, 265(3), 1333–8.
Chen, Y.-Y., Zhang, C.-L., Zhao, X.-L., Xie, K.-Q., & Zeng, T. (2014). Inhibition of cytochrome P4502E1 by chlormethiazole attenuated acute ethanol-induced fatty liver. Chemico-Biological
Interactions, 222C, 18–26.
Cheng, Q., Aleksunes, L. M., Manautou, J. E., Cherrington, N. J., Scheffer, G. L., Yamasaki, H., & Slitt, A. L. (2008). Drug-metabolizing enzyme and transporter expression in a mouse model of diabetes and obesity. Molecular Pharmaceutics, 5(1), 77–91.
Cheng, W.-H., Zheng, X., Quimby, F. R., Roneker, C. A., & Lei, X. G. (2003). Low levels of glutathione peroxidase 1 activity in selenium-deficient mouse liver affect c-Jun N-terminal kinase activation and p53 phosphorylation on Ser-15 in pro-oxidant-induced aponecrosis. The Biochemical
Journal, 370(Pt 3), 927–34.
Cheung, C., Akiyama, T. E., Kudo, G., & Gonzalez, F. J. (2003). Hepatic expression of cytochrome P450s in hepatocyte nuclear factor 1-alpha (HNF1alpha)-deficient mice. Biochemical
Pharmacology, 66(10), 2011–20.
Cheung, L., Potts, R. G., & Meyer, K. C. (1994). Acetaminophen treatment nomogram. The New
England Journal of Medicine, 330(26), 1907–8.
Chilakapati, J., Korrapati, M. C., Shankar, K., Hill, R. A., Warbritton, A., Latendresse, J. R., & Mehendale, H. M. (2007). Role of CYP2E1 and saturation kinetics in the bioactivation of thioacetamide: Effects of diet restriction and phenobarbital. Toxicology and Applied
Pharmacology, 219(1), 72–84.
Chiu, H., Brittingham, J. A., & Laskin, D. L. (2002). Differential induction of heme oxygenase-1 in macrophages and hepatocytes during acetaminophen-induced hepatotoxicity in the rat: effects of hemin and biliverdin. Toxicology and Applied Pharmacology, 181(2), 106–15.
Chiu, H., Gardner, C. R., Dambach, D. M., Durham, S. K., Brittingham, J. A., Laskin, J. D., & Laskin, D. L. (2003). Role of tumor necrosis factor receptor 1 (p55) in hepatocyte proliferation during acetaminophen-induced toxicity in mice. Toxicology and Applied Pharmacology, 193(2), 218–27.
Chtioui, H., Semela, D., Ledermann, M., Zimmermann, A., & Dufour, J.-F. (2007). Expression and activity of the cytochrome P450 2E1 in patients with nonalcoholic steatosis and steatohepatitis. Liver International : Official Journal of the International Association for the Study of the Liver, 27(6), 764–71.
Claridge, L. C., Eksteen, B., Smith, A., Shah, T., & Holt, A. P. (2010). Acute liver failure after administration of paracetamol at the maximum recommended daily dose in adults. BMJ
(Clinical Research Ed.), 341, c6764.
Clark, J. M. (2006). The epidemiology of nonalcoholic fatty liver disease in adults. Journal of Clinical
Gastroenterology, 40 Suppl 1, S5–10.
187
Clayton, T. A., Lindon, J. C., Cloarec, O., Antti, H., Charuel, C., Hanton, G., … Nicholson, J. K. (2006). Pharmaco-metabonomic phenotyping and personalized drug treatment. Nature, 440(7087), 1073–7.
Clement, C., Scala-Bertola, J., Javot, L., Royer-Morrot, M. J., Gillet, P., Trechot, P., … Gambier, N. (2011). Misuse of acetaminophen in the management of dental pain. Pharmacoepidemiology
and Drug Safety, 20(9), 996–1000.
Cohen, S. D., Pumford, N. R., Khairallah, E. A., Boekelheide, K., Pohl, L. R., Amouzadeh, H. R., & Hinson, J. A. (1997). Selective protein covalent binding and target organ toxicity. Toxicology and
Applied Pharmacology, 143(1), 1–12.
Cohen, S. S., Gammon, M. D., North, K. E., Millikan, R. C., Lange, E. M., Williams, S. M., … Matthews, C. E. (2011). ADIPOQ, ADIPOR1, and ADIPOR2 polymorphisms in relation to serum adiponectin levels and BMI in black and white women. Obesity (Silver Spring, Md.), 19(10), 2053–62.
Colditz, G. A., Willett, W. C., Rotnitzky, A., & Manson, J. E. (1995). Weight gain as a risk factor for clinical diabetes mellitus in women. Annals of Internal Medicine, 122(7), 481–6.
Coles, B., Wilson, I., Wardman, P., Hinson, J. A., Nelson, S. D., & Ketterer, B. (1988). The spontaneous and enzymatic reaction of N-acetyl-p-benzoquinonimine with glutathione: a stopped-flow kinetic study. Archives of Biochemistry and Biophysics, 264(1), 253–60.
Corcoran, G. B., Racz, W. J., Smith, C. V, & Mitchell, J. R. (1985). Effects of N-acetylcysteine on acetaminophen covalent binding and hepatic necrosis in mice. The Journal of Pharmacology and
Experimental Therapeutics, 232(3), 864–72.
Corcoran, G. B., & Wong, B. K. (1986). Role of glutathione in prevention of acetaminophen-induced hepatotoxicity by N-acetyl-L-cysteine in vivo: studies with N-acetyl-D-cysteine in mice. The
Journal of Pharmacology and Experimental Therapeutics, 238(1), 54–61.
Corcoran, G. B., Wong, B. K., Shum, L., & Galinsky, R. E. (1987). Acetaminophen sulfation deficit in obese rats overfed an energy-dense cafeteria diet. Endocrine Research, 13(2), 101–21.
Coughtrie, M. W. H. (2002). Sulfation through the looking glass--recent advances in sulfotransferase research for the curious. The Pharmacogenomics Journal, 2(5), 297–308.
Court, M. H., Duan, S. X., von Moltke, L. L., Greenblatt, D. J., Patten, C. J., Miners, J. O., & Mackenzie, P. I. (2001). Interindividual variability in acetaminophen glucuronidation by human liver microsomes: identification of relevant acetaminophen UDP-glucuronosyltransferase isoforms. The Journal of Pharmacology and Experimental Therapeutics, 299(3), 998–1006.
Court, M. H., Peter, I., Hazarika, S., Vasiadi, M., Greenblatt, D. J., & Lee, W. M. (2014). Candidate gene polymorphisms in patients with acetaminophen-induced acute liver failure. Drug Metabolism
and Disposition: The Biological Fate of Chemicals, 42(1), 28–32.
Cover, C., Mansouri, A., Knight, T. R., Bajt, M. L., Lemasters, J. J., Pessayre, D., & Jaeschke, H. (2005). Peroxynitrite-induced mitochondrial and endonuclease-mediated nuclear DNA damage in
188
acetaminophen hepatotoxicity. The Journal of Pharmacology and Experimental Therapeutics, 315(2), 879–87.
Critchley, J. A., Nimmo, G. R., Gregson, C. A., Woolhouse, N. M., & Prescott, L. F. (1986). Inter-subject and ethnic differences in paracetamol metabolism. British Journal of Clinical Pharmacology, 22(6), 649–57.
Dahlin, D. C., Miwa, G. T., Lu, A. Y., & Nelson, S. D. (1984). N-acetyl-p-benzoquinone imine: a cytochrome P-450-mediated oxidation product of acetaminophen. Proceedings of the National
Academy of Sciences of the United States of America, 81(5), 1327–31.
Dai, G., He, L., Chou, N., & Wan, Y.-J. Y. (2006). Acetaminophen metabolism does not contribute to gender difference in its hepatotoxicity in mouse. Toxicological Sciences : An Official Journal of
the Society of Toxicology, 92(1), 33–41.
Dambach, D. M., Watson, L. M., Gray, K. R., Durham, S. K., & Laskin, D. L. (2002). Role of CCR2 in macrophage migration into the liver during acetaminophen-induced hepatotoxicity in the mouse. Hepatology (Baltimore, Md.), 35(5), 1093–103.
Damelin, L. H., Coward, S., Kirwan, M., Collins, P., Selden, C., & Hodgson, H. J. F. (2007). Fat-loaded HepG2 spheroids exhibit enhanced protection from Pro-oxidant and cytokine induced damage. Journal of Cellular Biochemistry, 101(3), 723–34.
Das, S. K., & Vasudevan, D. M. (2007). Alcohol-induced oxidative stress. Life Sciences, 81(3), 177–87.
Davern, T. J., James, L. P., Hinson, J. A., Polson, J., Larson, A. M., Fontana, R. J., … Lee, W. M. (2006). Measurement of serum acetaminophen-protein adducts in patients with acute liver failure. Gastroenterology, 130(3), 687–94.
Davidson, D. G., & Eastham, W. N. (1966). Acute liver necrosis following overdose of paracetamol. British Medical Journal, 2(5512), 497–9.
De Gottardi, A., Vinciguerra, M., Sgroi, A., Moukil, M., Ravier-Dall’Antonia, F., Pazienza, V., … Hadengue, A. (2007). Microarray analyses and molecular profiling of steatosis induction in immortalized human hepatocytes. Laboratory Investigation; a Journal of Technical Methods and
Pathology, 87(8), 792–806.
De Waziers, I., Garlatti, M., Bouguet, J., Beaune, P. H., & Barouki, R. (1995). Insulin down-regulates cytochrome P450 2B and 2E expression at the post-transcriptional level in the rat hepatoma cell line. Molecular Pharmacology, 47(3), 474–9.
DeCastro, M., Nankova, B. B., Shah, P., Patel, P., Mally, P. V, Mishra, R., & La Gamma, E. F. (2005). Short chain fatty acids regulate tyrosine hydroxylase gene expression through a cAMP-dependent signaling pathway. Brain Research. Molecular Brain Research, 142(1), 28–38.
Demeilliers, C., Maisonneuve, C., Grodet, A., Mansouri, A., Nguyen, R., Tinel, M., … Fromenty, B. (2002). Impaired adaptive resynthesis and prolonged depletion of hepatic mitochondrial DNA after repeated alcohol binges in mice. Gastroenterology, 123(4), 1278–90.
189
Denechaud, P.-D., Dentin, R., Girard, J., & Postic, C. (2008). Role of ChREBP in hepatic steatosis and insulin resistance. FEBS Letters, 582(1), 68–73.
Dey, A., & Kumar, S. M. (2011). Cytochrome P450 2E1 and hyperglycemia-induced liver injury. Cell
Biology and Toxicology, 27(4), 285–310.
Doi, H., & Horie, T. (2010). Salicylic acid-induced hepatotoxicity triggered by oxidative stress. Chemico-Biological Interactions, 183(3), 363–8.
Donahower, B., McCullough, S. S., Kurten, R., Lamps, L. W., Simpson, P., Hinson, J. A., & James, L. P. (2006). Vascular endothelial growth factor and hepatocyte regeneration in acetaminophen toxicity. American Journal of Physiology. Gastrointestinal and Liver Physiology, 291(1), G102–9.
Donato, M. T., Jiménez, N., Serralta, A., Mir, J., Castell, J. V, & Gómez-Lechón, M. J. (2007). Effects of steatosis on drug-metabolizing capability of primary human hepatocytes. Toxicology in Vitro :
An International Journal Published in Association with BIBRA, 21(2), 271–6.
Donato, M. T., Lahoz, A., Jiménez, N., Pérez, G., Serralta, A., Mir, J., … Gómez-Lechón, M. J. (2006). Potential impact of steatosis on cytochrome P450 enzymes of human hepatocytes isolated from fatty liver grafts. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 34(9), 1556–62.
Dong, Z. G., Hong, J. Y., Ma, Q. A., Li, D. C., Bullock, J., Gonzalez, F. J., … Yang, C. S. (1988). Mechanism of induction of cytochrome P-450ac (P-450j) in chemically induced and spontaneously diabetic rats. Archives of Biochemistry and Biophysics, 263(1), 29–35.
Donnelly, P. J., Walker, R. M., & Racz, W. J. (1994). Inhibition of mitochondrial respiration in vivo is an early event in acetaminophen-induced hepatotoxicity. Archives of Toxicology, 68(2), 110–8.
Donthamsetty, S., Bhave, V. S., Mitra, M. S., Latendresse, J. R., & Mehendale, H. M. (2007). Nonalcoholic fatty liver sensitizes rats to carbon tetrachloride hepatotoxicity. Hepatology
(Baltimore, Md.), 45(2), 391–403.
Donthamsetty, S., Bhave, V. S., Mitra, M. S., Latendresse, J. R., & Mehendale, H. M. (2008). Nonalcoholic steatohepatitic (NASH) mice are protected from higher hepatotoxicity of acetaminophen upon induction of PPARalpha with clofibrate. Toxicology and Applied
Pharmacology, 230(3), 327–37.
Dostalek, M., Court, M. H., Yan, B., & Akhlaghi, F. (2011). Significantly reduced cytochrome P450 3A4 expression and activity in liver from humans with diabetes mellitus. British Journal of
Pharmacology, 163(5), 937–47.
Dresser, G. K., Spence, J. D., & Bailey, D. G. (2000). Pharmacokinetic-pharmacodynamic consequences and clinical relevance of cytochrome P450 3A4 inhibition. Clinical Pharmacokinetics, 38(1), 41–57.
Dubuquoy, C., Robichon, C., Lasnier, F., Langlois, C., Dugail, I., Foufelle, F., … Moldes, M. (2011). Distinct regulation of adiponutrin/PNPLA3 gene expression by the transcription factors ChREBP and SREBP1c in mouse and human hepatocytes. Journal of Hepatology, 55(1), 145–53.
190
Dupont, I., Berthou, F., Bodenez, P., Bardou, L., Guirriec, C., Stephan, N., … Lucas, D. (1999). Involvement of cytochromes P-450 2E1 and 3A4 in the 5-hydroxylation of salicylate in humans. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 27(3), 322–6.
Dutheil, F., Dauchy, S., Diry, M., Sazdovitch, V., Cloarec, O., Mellottée, L., … Loriot, M.-A. (2009). Xenobiotic-metabolizing enzymes and transporters in the normal human brain: regional and cellular mapping as a basis for putative roles in cerebral function. Drug Metabolism and
Disposition: The Biological Fate of Chemicals, 37(7), 1528–38.
Eagling, V. A., Tjia, J. F., & Back, D. J. (1998). Differential selectivity of cytochrome P450 inhibitors against probe substrates in human and rat liver microsomes. British Journal of Clinical
Pharmacology, 45(2), 107–14.
Eap, C. B., Schnyder, C., Besson, J., Savary, L., & Buclin, T. (1998). Inhibition of CYP2E1 by chlormethiazole as measured by chlorzoxazone pharmacokinetics in patients with alcoholism and in healthy volunteers. Clinical Pharmacology and Therapeutics, 64(1), 52–7.
Ekins, S., & Erickson, J. A. (2002). A pharmacophore for human pregnane X receptor ligands. Drug
Metabolism and Disposition: The Biological Fate of Chemicals, 30(1), 96–9.
El-Hassan, H., Anwar, K., Macanas-Pirard, P., Crabtree, M., Chow, S. C., Johnson, V. L., … Kass, G. E. N. (2003). Involvement of mitochondria in acetaminophen-induced apoptosis and hepatic injury: roles of cytochrome c, Bax, Bid, and caspases. Toxicology and Applied Pharmacology, 191(2), 118–29.
Eliasson, E., Johansson, I., & Ingelman-Sundberg, M. (1990). Substrate-, hormone-, and cAMP-regulated cytochrome P450 degradation. Proceedings of the National Academy of Sciences of
the United States of America, 87(8), 3225–9.
Eliasson, E., & Kenna, J. G. (1996). Cytochrome P450 2E1 is a cell surface autoantigen in halothane hepatitis. Molecular Pharmacology, 50(3), 573–82.
Eliasson, E., Mkrtchian, S., & Ingelman-Sundberg, M. (1992). Hormone- and substrate-regulated intracellular degradation of cytochrome P450 (2E1) involving MgATP-activated rapid proteolysis in the endoplasmic reticulum membranes. The Journal of Biological Chemistry, 267(22), 15765–9.
Ellero, S., Chakhtoura, G., Barreau, C., Langouët, S., Benelli, C., Penicaud, L., … de Waziers, I. (2010). Xenobiotic-metabolizing cytochromes p450 in human white adipose tissue: expression and induction. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 38(4), 679–86.
Emby, D. J., & Fraser, B. N. (1977). Hepatotoxicity of paracetamol enhanced by ingestion of alcohol: report of two cases. South African Medical Journal = Suid-Afrikaanse Tydskrif Vir Geneeskunde, 51(7), 208–9.
Emery, M. G., Fisher, J. M., Chien, J. Y., Kharasch, E. D., Dellinger, E. P., Kowdley, K. V, & Thummel, K. E. (2003). CYP2E1 activity before and after weight loss in morbidly obese subjects with nonalcoholic fatty liver disease. Hepatology (Baltimore, Md.), 38(2), 428–35.
191
Enriquez, A., Leclercq, I., Farrell, G. C., & Robertson, G. (1999). Altered expression of hepatic CYP2E1 and CYP4A in obese, diabetic ob/ob mice, and fa/fa Zucker rats. Biochemical and Biophysical
Research Communications, 255(2), 300–6.
Escorsell, A., Mas, A., & de la Mata, M. (2007). Acute liver failure in Spain: analysis of 267 cases. Liver
Transplantation : Official Publication of the American Association for the Study of Liver Diseases
and the International Liver Transplantation Society, 13(10), 1389–95.
Evans, W. E., & Relling, M. V. (1999). Pharmacogenomics: translating functional genomics into rational therapeutics. Science (New York, N.Y.), 286(5439), 487–91.
Fabbrini, E., deHaseth, D., Deivanayagam, S., Mohammed, B. S., Vitola, B. E., & Klein, S. (2009). Alterations in fatty acid kinetics in obese adolescents with increased intrahepatic triglyceride content. Obesity (Silver Spring, Md.), 17(1), 25–9.
Fabbrini, E., Sullivan, S., & Klein, S. (2010). Obesity and nonalcoholic fatty liver disease: biochemical, metabolic, and clinical implications. Hepatology (Baltimore, Md.), 51(2), 679–89.
Fardel, O., & Le Vée, M. (2009). Regulation of human hepatic drug transporter expression by pro-inflammatory cytokines. Expert Opinion on Drug Metabolism & Toxicology, 5(12), 1469–81.
Farrell, G. C., & Larter, C. Z. (2006). Nonalcoholic fatty liver disease: from steatosis to cirrhosis. Hepatology (Baltimore, Md.), 43(2 Suppl 1), S99–S112.
Faucette, S. R., Zhang, T.-C., Moore, R., Sueyoshi, T., Omiecinski, C. J., LeCluyse, E. L., … Wang, H. (2007). Relative activation of human pregnane X receptor versus constitutive androstane receptor defines distinct classes of CYP2B6 and CYP3A4 inducers. The Journal of Pharmacology
and Experimental Therapeutics, 320(1), 72–80.
Fernandez-Checa, J. C., & Kaplowitz, N. (2005). Hepatic mitochondrial glutathione: transport and role in disease and toxicity. Toxicology and Applied Pharmacology, 204(3), 263–73.
Ferner, R. E., Dear, J. W., & Bateman, D. N. (2011). Management of paracetamol poisoning. BMJ
(Clinical Research Ed.), 342, d2218.
Ferré, P., & Foufelle, F. (2010). Hepatic steatosis: a role for de novo lipogenesis and the transcription factor SREBP-1c. Diabetes, Obesity & Metabolism, 12 Suppl 2, 83–92.
Finkelstein, E. A., Trogdon, J. G., Cohen, J. W., & Dietz, W. (2009). Annual medical spending attributable to obesity: payer-and service-specific estimates. Health Affairs (Project Hope), 28(5), w822–31.
Fisher, C. D., Lickteig, A. J., Augustine, L. M., Ranger-Moore, J., Jackson, J. P., Ferguson, S. S., & Cherrington, N. J. (2009). Hepatic cytochrome P450 enzyme alterations in humans with progressive stages of nonalcoholic fatty liver disease. Drug Metabolism and Disposition: The
Biological Fate of Chemicals, 37(10), 2087–94.
192
Flegal, K. M., Shepherd, J. A., Looker, A. C., Graubard, B. I., Borrud, L. G., Ogden, C. L., … Schenker, N. (2009). Comparisons of percentage body fat, body mass index, waist circumference, and waist-stature ratio in adults. The American Journal of Clinical Nutrition, 89(2), 500–8.
Forget, P., Wittebole, X., & Laterre, P.-F. (2009). Therapeutic dose of acetaminophen may induce fulminant hepatitis in the presence of risk factors: a report of two cases. British Journal of
Anaesthesia, 103(6), 899–900.
Forkert, P. G., Redza, Z. M., Mangos, S., Park, S. S., & Tam, S. P. (1994). Induction and regulation of CYP2E1 in murine liver after acute and chronic acetone administration. Drug Metabolism and
Disposition: The Biological Fate of Chemicals, 22(2), 248–53.
Fraser, D. A., Thoen, J., Rustan, A. C., Førre, O., & Kjeldsen-Kragh, J. (1999). Changes in plasma free fatty acid concentrations in rheumatoid arthritis patients during fasting and their effects upon T-lymphocyte proliferation. Rheumatology (Oxford, England), 38(10), 948–52.
French, S. W. (2013). The importance of CYP2E1 in the pathogenesis of alcoholic liver disease and drug toxicity and the role of the proteasome. Sub-Cellular Biochemistry, 67, 145–64.
Fromenty, B. (2013). Drug-induced liver injury in obesity. Journal of Hepatology, 58(4), 824–6.
Fromenty, B., & Pessayre, D. (1995). Inhibition of mitochondrial beta-oxidation as a mechanism of hepatotoxicity. Pharmacology & Therapeutics, 67(1), 101–54.
Frye, R. F., Tammara, B., Cowart, T. D., & Bramer, S. L. (1999). Effect of disulfiram-mediated CYP2E1 inhibition on the disposition of vesnarinone. Journal of Clinical Pharmacology, 39(11), 1177–83.
Fujii, H., Ikura, Y., Arimoto, J., Sugioka, K., Iezzoni, J. C., Park, S. H., … Ueda, M. (2009). Expression of perilipin and adipophilin in nonalcoholic fatty liver disease; relevance to oxidative injury and hepatocyte ballooning. Journal of Atherosclerosis and Thrombosis, 16(6), 893–901.
Gadang, V., Kohli, R., Myronovych, A., Hui, D. Y., Perez-Tilve, D., & Jaeschke, A. (2013). MLK3 promotes metabolic dysfunction induced by saturated fatty acid-enriched diet. American
Journal of Physiology. Endocrinology and Metabolism, 305(4), E549–56.
Galinier, M., Pathak, A., Roncalli, J., & Massabuau, P. (2005). [Obesity and cardiac failure]. Archives
Des Maladies Du Coeur et Des Vaisseaux, 98(1), 39–45.
Gallagher, E. P., Buetler, T. M., Stapleton, P. L., Wang, C., Stahl, D. L., & Eaton, D. L. (1995). The effects of diquat and ciprofibrate on mRNA expression and catalytic activities of hepatic xenobiotic metabolizing and antioxidant enzymes in rat liver. Toxicology and Applied
Pharmacology, 134(1), 81–91.
Gandhi, A., Guo, T., & Ghose, R. (2010). Role of c-Jun N-terminal kinase (JNK) in regulating tumor necrosis factor-alpha (TNF-alpha) mediated increase of acetaminophen (APAP) and chlorpromazine (CPZ) toxicity in murine hepatocytes. The Journal of Toxicological Sciences, 35(2), 163–73.
193
Gao, B., & Bataller, R. (2011). Alcoholic liver disease: pathogenesis and new therapeutic targets. Gastroenterology, 141(5), 1572–85.
Garcia, M. C., Amankwa-Sakyi, M., & Flynn, T. J. (2011). Cellular glutathione in fatty liver in vitro models. Toxicology in Vitro : An International Journal Published in Association with BIBRA, 25(7), 1501–6.
Gerbal-Chaloin, S., Dumé, A.-S., Briolotti, P., Klieber, S., Raulet, E., Duret, C., … Daujat-Chavanieu, M. (2014). The WNT/β-catenin pathway is a transcriptional regulator of CYP2E1, CYP1A2, and aryl hydrocarbon receptor gene expression in primary human hepatocytes. Molecular
Pharmacology, 86(6), 624–34.
Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., & Atienzar, F. A. (2012). Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology, 28(2), 69–87.
Ghose, R., Omoluabi, O., Gandhi, A., Shah, P., Strohacker, K., Carpenter, K. C., … Guo, T. (2011). Role of high-fat diet in regulation of gene expression of drug metabolizing enzymes and transporters. Life Sciences, 89(1-2), 57–64.
Gicquel, T., Aubert, J., Lepage, S., Fromenty, B., & Morel, I. (2013). Quantitative analysis of acetaminophen and its primary metabolites in small plasma volumes by liquid chromatography-tandem mass spectrometry. Journal of Analytical Toxicology, 37(2), 110–6.
Gillette, J. R. (1981). An integrated approach to the study of chemically reactive metabolites of acetaminophen. Archives of Internal Medicine, 141(3 Spec No), 375–9.
Gonzalez, F. J. (2005). Role of cytochromes P450 in chemical toxicity and oxidative stress: studies with CYP2E1. Mutation Research, 569(1-2), 101–10.
Gonzalez, F. J. (2007). The 2006 Bernard B. Brodie Award Lecture. Cyp2e1. Drug Metabolism and
Disposition: The Biological Fate of Chemicals, 35(1), 1–8.
Graham, G. G., Day, R. O., Graudins, A., & Mohamudally, A. (2010). FDA proposals to limit the hepatotoxicity of paracetamol (acetaminophen): are they reasonable? Inflammopharmacology, 18(2), 47–55.
Graham, G. G., & Scott, K. F. (2005). Mechanism of action of paracetamol. American Journal of
Therapeutics, 12(1), 46–55.
Grattagliano, I., de Bari, O., Bernardo, T. C., Oliveira, P. J., Wang, D. Q.-H., & Portincasa, P. (2012). Role of mitochondria in nonalcoholic fatty liver disease--from origin to propagation. Clinical
Biochemistry, 45(9), 610–8.
Greenblatt, D. J., Abernethy, D. R., Divoll, M., Ochs, H. R., & Shader, R. I. (1983). Antipyretic analgesic drugs as models for studies of drug disposition in old age. The American Journal of Medicine, 75(5A), 127–32.
194
Gripon, P., Rumin, S., Urban, S., Le Seyec, J., Glaise, D., Cannie, I., … Guguen-Guillouzo, C. (2002). Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National
Academy of Sciences of the United States of America, 99(24), 15655–60.
Guengerich, F. P. (1999). Cytochrome P-450 3A4: regulation and role in drug metabolism. Annual
Review of Pharmacology and Toxicology, 39, 1–17.
Guengerich, F. P. (2006). Cytochrome P450s and other enzymes in drug metabolism and toxicity. The
AAPS Journal, 8(1), E101–11.
Guengerich, F. P., & Cheng, Q. (2011). Orphans in the human cytochrome P450 superfamily: approaches to discovering functions and relevance in pharmacology. Pharmacological Reviews, 63(3), 684–99.
Guengerich, F. P., & Munro, A. W. (2013). Unusual cytochrome p450 enzymes and reactions. The
Journal of Biological Chemistry, 288(24), 17065–73.
Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., & Guguen-Guillouzo, C. (2007). The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions, 168(1), 66–73.
Gujral, J. S., Knight, T. R., Farhood, A., Bajt, M. L., & Jaeschke, H. (2002). Mode of cell death after acetaminophen overdose in mice: apoptosis or oncotic necrosis? Toxicological Sciences : An
Official Journal of the Society of Toxicology, 67(2), 322–8.
Gunawan, B. K., Liu, Z.-X., Han, D., Hanawa, N., Gaarde, W. A., & Kaplowitz, N. (2006). c-Jun N-terminal kinase plays a major role in murine acetaminophen hepatotoxicity. Gastroenterology, 131(1), 165–78.
Gunnell, D., Hawton, K., Murray, V., Garnier, R., Bismuth, C., Fagg, J., & Simkin, S. (1997). Use of paracetamol for suicide and non-fatal poisoning in the UK and France: are restrictions on availability justified? Journal of Epidemiology and Community Health, 51(2), 175–9.
Guo, Y., Walther, T. C., Rao, M., Stuurman, N., Goshima, G., Terayama, K., … Farese, R. V. (2008). Functional genomic screen reveals genes involved in lipid-droplet formation and utilization. Nature, 453(7195), 657–61.
Gupta, N., Goel, K., Shah, P., & Misra, A. (2012). Childhood obesity in developing countries: epidemiology, determinants, and prevention. Endocrine Reviews, 33(1), 48–70.
Haas, C. E., Kaufman, D. C., Jones, C. E., Burstein, A. H., & Reiss, W. (2003). Cytochrome P450 3A4 activity after surgical stress. Critical Care Medicine, 31(5), 1338–46.
Hagenfeldt, L., Wahren, J., Pernow, B., & Räf, L. (1972). Uptake of individual free fatty acids by skeletal muscle and liver in man. The Journal of Clinical Investigation, 51(9), 2324–30.
Hakkola, J., Hu, Y., & Ingelman-Sundberg, M. (2003). Mechanisms of down-regulation of CYP2E1 expression by inflammatory cytokines in rat hepatoma cells. The Journal of Pharmacology and
Experimental Therapeutics, 304(3), 1048–54.
195
Halilbasic, E., Claudel, T., & Trauner, M. (2013). Bile acid transporters and regulatory nuclear receptors in the liver and beyond. Journal of Hepatology, 58(1), 155–68.
Halmes, N. C., Hinson, J. A., Martin, B. M., & Pumford, N. R. (1996). Glutamate dehydrogenase covalently binds to a reactive metabolite of acetaminophen. Chemical Research in Toxicology, 9(2), 541–6.
Han, D., Canali, R., Rettori, D., & Kaplowitz, N. (2003). Effect of glutathione depletion on sites and topology of superoxide and hydrogen peroxide production in mitochondria. Molecular
Pharmacology, 64(5), 1136–44.
Han, D., Shinohara, M., Ybanez, M. D., Saberi, B., & Kaplowitz, N. (2010). Signal transduction pathways involved in drug-induced liver injury. Handbook of Experimental Pharmacology, (196), 267–310.
Hanawa, N., Shinohara, M., Saberi, B., Gaarde, W. A., Han, D., & Kaplowitz, N. (2008). Role of JNK translocation to mitochondria leading to inhibition of mitochondria bioenergetics in acetaminophen-induced liver injury. The Journal of Biological Chemistry, 283(20), 13565–77.
Hannemann, F., Bichet, A., Ewen, K. M., & Bernhardt, R. (2007). Cytochrome P450 systems--biological variations of electron transport chains. Biochimica et Biophysica Acta, 1770(3), 330–44.
Haouzi, D., Cohen, I., Vieira, H. L. A., Poncet, D., Boya, P., Castedo, M., … Kroemer, G. (2002). Mitochondrial permeability transition as a novel principle of hepatorenal toxicity in vivo. Apoptosis : An International Journal on Programmed Cell Death, 7(5), 395–405.
Hardwick, R. N., Ferreira, D. W., More, V. R., Lake, A. D., Lu, Z., Manautou, J. E., … Cherrington, N. J. (2013). Altered UDP-glucuronosyltransferase and sulfotransferase expression and function during progressive stages of human nonalcoholic fatty liver disease. Drug Metabolism and
Disposition: The Biological Fate of Chemicals, 41(3), 554–61.
Harrill, A. H., Watkins, P. B., Su, S., Ross, P. K., Harbourt, D. E., Stylianou, I. M., … Threadgill, D. W. (2009). Mouse population-guided resequencing reveals that variants in CD44 contribute to acetaminophen-induced liver injury in humans. Genome Research, 19(9), 1507–15.
Hashimoto, H., Toide, K., Kitamura, R., Fujita, M., Tagawa, S., Itoh, S., & Kamataki, T. (1993). Gene structure of CYP3A4, an adult-specific form of cytochrome P450 in human livers, and its transcriptional control. European Journal of Biochemistry / FEBS, 218(2), 585–95.
Hata, S., Miki, Y., Fujishima, F., Sato, R., Okaue, A., Abe, K., … Sasano, H. (2010). Cytochrome 3A and 2E1 in human liver tissue: Individual variations among normal Japanese subjects. Life Sciences, 86(11-12), 393–401.
Hawkins, L. C., Edwards, J. N., & Dargan, P. I. (2007). Impact of restricting paracetamol pack sizes on paracetamol poisoning in the United Kingdom: a review of the literature. Drug Safety, 30(6), 465–79.
196
Hawton, K., Simkin, S., Deeks, J., Cooper, J., Johnston, A., Waters, K., … Simpson, K. (2004). UK legislation on analgesic packs: before and after study of long term effect on poisonings. BMJ
(Clinical Research Ed.), 329(7474), 1076.
Hayakawa, J., Mittal, S., Wang, Y., Korkmaz, K. S., Adamson, E., English, C., … Mercola, D. (2004). Identification of promoters bound by c-Jun/ATF2 during rapid large-scale gene activation following genotoxic stress. Molecular Cell, 16(4), 521–35.
Hayashi, S., Watanabe, J., & Kawajiri, K. (1991). Genetic polymorphisms in the 5’-flanking region change transcriptional regulation of the human cytochrome P450IIE1 gene. Journal of
Biochemistry, 110(4), 559–65.
Hazai, E., Vereczkey, L., & Monostory, K. (2002). Reduction of toxic metabolite formation of acetaminophen. Biochemical and Biophysical Research Communications, 291(4), 1089–94.
Heard, K., Green, J. L., Bailey, J. E., Bogdan, G. M., & Dart, R. C. (2007). A randomized trial to determine the change in alanine aminotransferase during 10 days of paracetamol (acetaminophen) administration in subjects who consume moderate amounts of alcohol. Alimentary Pharmacology & Therapeutics, 26(2), 283–90.
Heard, K. J., Green, J. L., James, L. P., Judge, B. S., Zolot, L., Rhyee, S., & Dart, R. C. (2011). Acetaminophen-cysteine adducts during therapeutic dosing and following overdose. BMC
Gastroenterology, 11, 20.
Henderson, N. C., Pollock, K. J., Frew, J., Mackinnon, A. C., Flavell, R. A., Davis, R. J., … Simpson, K. J. (2007). Critical role of c-jun (NH2) terminal kinase in paracetamol- induced acute liver failure. Gut, 56(7), 982–90.
Hibi, M., Lin, A., Smeal, T., Minden, A., & Karin, M. (1993). Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes &
Development, 7(11), 2135–48.
Hinson, J. A., Pike, S. L., Pumford, N. R., & Mayeux, P. R. (1998). Nitrotyrosine-protein adducts in hepatic centrilobular areas following toxic doses of acetaminophen in mice. Chemical Research
in Toxicology, 11(6), 604–7.
Hinson, J. A., Roberts, D. W., Halmes, N. C., Gibson, J. D., & Pumford, N. R. (1996). Immunochemical detection of drug-protein adducts in acetaminophen hepatotoxicity. Advances in Experimental
Medicine and Biology, 387, 47–55.
Hinson, J. A., Roberts, D. W., & James, L. P. (2010). Mechanisms of acetaminophen-induced liver necrosis. Handbook of Experimental Pharmacology, (196), 369–405.
Högestätt, E. D., Jönsson, B. A. G., Ermund, A., Andersson, D. A., Björk, H., Alexander, J. P., … Zygmunt, P. M. (2005). Conversion of acetaminophen to the bioactive N-acylphenolamine AM404 via fatty acid amide hydrolase-dependent arachidonic acid conjugation in the nervous system. The Journal of Biological Chemistry, 280(36), 31405–12.
197
Holt, M. P., Cheng, L., & Ju, C. (2008). Identification and characterization of infiltrating macrophages in acetaminophen-induced liver injury. Journal of Leukocyte Biology, 84(6), 1410–21.
Horsmans, Y., Desager, J. P., & Harvengt, C. (1992). Absence of CYP3 A Genetic Polymorphism Assessed by Urinary Excretion of 6 β-Hydroxycortisol in 102 Healthy Subjects on Rifampicin. Pharmacology & Toxicology, 71(4), 258–261.
Hsiao, P.-J., Chen, Z.-C., Hung, W.-W., Yang, Y.-H. C., Lee, M.-Y., Huang, J.-F., & Kuo, K.-K. (2013). Risk interaction of obesity, insulin resistance and hormone-sensitive lipase promoter polymorphisms (LIPE-60 C > G) in the development of fatty liver. BMC Medical Genetics, 14, 54.
Hu, B., & Colletti, L. M. (2010). CXC receptor-2 knockout genotype increases X-linked inhibitor of apoptosis protein and protects mice from acetaminophen hepatotoxicity. Hepatology
(Baltimore, Md.), 52(2), 691–702.
Hu, N., Hu, M., Duan, R., Liu, C., Guo, H., Zhang, M., … Liu, X. (2014). Increased levels of fatty acids contributed to induction of hepatic CYP3A4 activity induced by diabetes - in vitro evidence from HepG2 cell and Fa2N-4 cell lines. Journal of Pharmacological Sciences, 124(4), 433–44.
Hu, N., Xie, S., Liu, L., Wang, X., Pan, X., Chen, G., … Wang, G. (2011). Opposite effect of diabetes mellitus induced by streptozotocin on oral and intravenous pharmacokinetics of verapamil in rats. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 39(3), 419–25.
Hu, Y., Mishin, V., Johansson, I., von Bahr, C., Cross, A., Ronis, M. J., … Ingelman-Sundberg, M. (1994). Chlormethiazole as an efficient inhibitor of cytochrome P450 2E1 expression in rat liver. The
Journal of Pharmacology and Experimental Therapeutics, 269(3), 1286–91.
Huang, Y., He, S., Li, J. Z., Seo, Y.-K., Osborne, T. F., Cohen, J. C., & Hobbs, H. H. (2010). A feed-forward loop amplifies nutritional regulation of PNPLA3. Proceedings of the National Academy of
Sciences of the United States of America, 107(17), 7892–7.
Huang, Z., Fasco, M. J., Figge, H. L., Keyomarsi, K., & Kaminsky, L. S. (1996). Expression of cytochromes P450 in human breast tissue and tumors. Drug Metabolism and Disposition: The
Biological Fate of Chemicals, 24(8), 899–905.
Hukkanen, J., Pelkonen, O., Hakkola, J., & Raunio, H. (2002). Expression and Regulation of Xenobiotic-Metabolizing Cytochrome P450 (CYP) Enzymes in Human Lung. Critical Reviews in Toxicology, 32(5), 391–411.
Ichai, P., & Samuel, D. (2011). Epidemiology of liver failure. Clinics and Research in Hepatology and
Gastroenterology, 35(10), 610–7.
Imaeda, A. B., Watanabe, A., Sohail, M. A., Mahmood, S., Mohamadnejad, M., Sutterwala, F. S., … Mehal, W. Z. (2009). Acetaminophen-induced hepatotoxicity in mice is dependent on Tlr9 and the Nalp3 inflammasome. The Journal of Clinical Investigation, 119(2), 305–14.
Ingelman-Sundberg, M., Ronis, M. J., Lindros, K. O., Eliasson, E., & Zhukov, A. (1994). Ethanol-inducible cytochrome P4502E1: regulation, enzymology and molecular biology. Alcohol and
Alcoholism (Oxford, Oxfordshire). Supplement, 2, 131–9.
198
Inglis, J. H. C. (2004). Restricting sales of paracetamol tablets: effect on deaths and emergency admissions for poisoning in Scotland 1991 - 2002. Scottish Medical Journal, 49(4), 142–3.
Inoue, K., Inazawa, J., Nakagawa, H., Shimada, T., Yamazaki, H., Guengerich, F. P., & Abe, T. (1992). Assignment of the human cytochrome P-450 nifedipine oxidase gene (CYP3A4) to chromosome 7 at band q22.1 by fluorescence in situ hybridization. The Japanese Journal of Human Genetics, 37(2), 133–8.
Inoue, S., Yoshinari, K., Sugawara, M., & Yamazoe, Y. (2011). Activated sterol regulatory element-binding protein-2 suppresses hepatocyte nuclear factor-4-mediated Cyp3a11 expression in mouse liver. Molecular Pharmacology, 79(1), 148–56.
Ioannides, C., Bass, S. L., Ayrton, A. D., Trinick, J., Walker, R., & Flatt, P. R. (1988). Streptozotocin-induced diabetes modulates the metabolic activation of chemical carcinogens. Chemico-
Biological Interactions, 68(3-4), 189–202. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/2975197
Ito, Y., Abril, E. R., Bethea, N. W., McCuskey, M. K., & McCuskey, R. S. (2006). Dietary steatotic liver attenuates acetaminophen hepatotoxicity in mice. Microcirculation (New York, N.Y. : 1994), 13(1), 19–27.
Itoh, S., Yanagimoto, T., Tagawa, S., Hashimoto, H., Kitamura, R., Nakajima, Y., … Kamataki, T. (1992). Genomic organization of human fetal specific P-450IIIA7 (cytochrome P-450HFLa)-related gene(s) and interaction of transcriptional regulatory factor with its DNA element in the 5’ flanking region. Biochimica et Biophysica Acta, 1130(2), 133–8.
Jaeschke, H., & Bajt, M. L. (2006). Intracellular signaling mechanisms of acetaminophen-induced liver cell death. Toxicological Sciences : An Official Journal of the Society of Toxicology, 89(1), 31–41.
Jaeschke, H., Cover, C, Bajt, ML. (2006).Role of caspases in acetaminophen-induced liver injury. LifeSci. 2006 Mar 6;78(15):1670-6.
Jaeschke, H., Knight, T. R., & Bajt, M. L. (2003). The role of oxidant stress and reactive nitrogen species in acetaminophen hepatotoxicity. Toxicology Letters, 144(3), 279–88.
Jaeschke, H., & Lemasters, J. J. (2003). Apoptosis versus oncotic necrosis in hepatic ischemia/reperfusion injury. Gastroenterology, 125(4), 1246–57.
Jaeschke, H., McGill, M. R., & Ramachandran, A. (2012). Oxidant stress, mitochondria, and cell death mechanisms in drug-induced liver injury: lessons learned from acetaminophen hepatotoxicity. Drug Metabolism Reviews, 44(1), 88–106.
Jaeschke, H., McGill, M. R., Williams, C. D., & Ramachandran, A. (2011a). Current issues with acetaminophen hepatotoxicity--a clinically relevant model to test the efficacy of natural products. Life Sciences, 88(17-18), 737–45.
Jaeschke, H., Williams, C. D., & Farhood, A. (2011b). No evidence for caspase-dependent apoptosis in acetaminophen hepatotoxicity. Hepatology (Baltimore, Md.), 53(2), 718–9.
199
Jaeschke, H., Williams, C. D., Ramachandran, A., & Bajt, M. L. (2012). Acetaminophen hepatotoxicity and repair: the role of sterile inflammation and innate immunity. Liver International : Official
Journal of the International Association for the Study of the Liver, 32(1), 8–20.
Jahr, S., Hentze, H., Englisch, S., Hardt, D., Fackelmayer, F. O., Hesch, R. D., & Knippers, R. (2001). DNA fragments in the blood plasma of cancer patients: quantitations and evidence for their origin from apoptotic and necrotic cells. Cancer Research, 61(4), 1659–65.
James, L. P., Lamps, L. W., McCullough, S., & Hinson, J. A. (2003). Interleukin 6 and hepatocyte regeneration in acetaminophen toxicity in the mouse. Biochemical and Biophysical Research
Communications, 309(4), 857–63.
Janorkar, A. V, King, K. R., Megeed, Z., & Yarmush, M. L. (2009). Development of an in vitro cell culture model of hepatic steatosis using hepatocyte-derived reporter cells. Biotechnology and
Bioengineering, 102(5), 1466–74.
Jaya, D. S., Augstine, J., & Menon, V. P. (1993). Role of lipid peroxides, glutathione and antiperoxidative enzymes in alcohol and drug toxicity. Indian Journal of Experimental Biology, 31(5), 453–9.
Jemnitz, K., Veres, Z., Monostory, K., Kóbori, L., & Vereczkey, L. (2008). Interspecies differences in acetaminophen sensitivity of human, rat, and mouse primary hepatocytes. Toxicology in Vitro :
An International Journal Published in Association with BIBRA, 22(4), 961–7.
Jeon, S., Kim, K. H., Yun, C. H., Hong, B.-W., Chang, Y.-S., Han, H.-S., … Lee, A.-Y. (2008). An NH2-terminal truncated cytochrome P450 CYP3A4 showing catalytic activity is present in the cytoplasm of human liver cells. Experimental & Molecular Medicine, 40(2), 254–60.
Jiang, C.-M., Pu, C.-W., Hou, Y.-H., Chen, Z., Alanazy, M., & Hebbard, L. (2014). Non alcoholic steatohepatitis a precursor for hepatocellular carcinoma development. World Journal of
Gastroenterology : WJG, 20(44), 16464–16473.
Jocken, J. W. E., Langin, D., Smit, E., Saris, W. H. M., Valle, C., Hul, G. B., … Blaak, E. E. (2007). Adipose triglyceride lipase and hormone-sensitive lipase protein expression is decreased in the obese insulin-resistant state. The Journal of Clinical Endocrinology and Metabolism, 92(6), 2292–9.
Johnson, G. L., & Nakamura, K. (2007). The c-jun kinase/stress-activated pathway: regulation, function and role in human disease. Biochimica et Biophysica Acta, 1773(8), 1341–8. doi:10.1016/j.bbamcr.2006.12.009
Jollow, D. J., Mitchell, J. R., Potter, W. Z., Davis, D. C., Gillette, J. R., & Brodie, B. B. (1973). Acetaminophen-induced hepatic necrosis. II. Role of covalent binding in vivo. The Journal of
Pharmacology and Experimental Therapeutics, 187(1), 195–202.
Jørgensen, L., Thomsen, P., & Poulsen, H. E. (1988). Disulfiram prevents acetaminophen hepatotoxicity in rats. Pharmacology & Toxicology, 62(5), 267–71.
200
Jossé, R., Aninat, C., Glaise, D., Dumont, J., Fessard, V., Morel, F., … Guillouzo, A. (2008). Long-term functional stability of human HepaRG hepatocytes and use for chronic toxicity and genotoxicity studies. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 36(6), 1111–8.
Josse, R., Sharanek, A., Savary, C. C., & Guillouzo, A. (2014). Impact of isomalathion on malathion cytotoxicity and genotoxicity in human HepaRG cells. Chemico-Biological Interactions, 209, 68–76.
Jounaïdi, Y., Guzelian, P. S., Maurel, P., & Vilarem, M. J. (1994). Sequence of the 5’-flanking region of CYP3A5: comparative analysis with CYP3A4 and CYP3A7. Biochemical and Biophysical Research
Communications, 205(3), 1741–7.
Jover, R., Bort, R., Gómez-Lechón, M. J., & Castell, J. V. (2001). Cytochrome P450 regulation by hepatocyte nuclear factor 4 in human hepatocytes: a study using adenovirus-mediated antisense targeting. Hepatology (Baltimore, Md.), 33(3), 668–75. doi:10.1053/jhep.2001.22176
Ju, C., Reilly, T. P., Bourdi, M., Radonovich, M. F., Brady, J. N., George, J. W., & Pohl, L. R. (2002). Protective role of Kupffer cells in acetaminophen-induced hepatic injury in mice. Chemical
Research in Toxicology, 15(12), 1504–13.
Kamada, Y., Matsumoto, H., Tamura, S., Fukushima, J., Kiso, S., Fukui, K., … Hayashi, N. (2007). Hypoadiponectinemia accelerates hepatic tumor formation in a nonalcoholic steatohepatitis mouse model. Journal of Hepatology, 47(4), 556–64.
Kamiyama, Y., Matsubara, T., Yoshinari, K., Nagata, K., Kamimura, H., & Yamazoe, Y. (2007). Role of human hepatocyte nuclear factor 4alpha in the expression of drug-metabolizing enzymes and transporters in human hepatocytes assessed by use of small interfering RNA. Drug Metabolism
and Pharmacokinetics, 22(4), 287–98.
Kangani, C. O., Kelley, D. E., & Delany, J. P. (2008). New method for GC/FID and GC-C-IRMS analysis of plasma free fatty acid concentration and isotopic enrichment. Journal of Chromatography. B,
Analytical Technologies in the Biomedical and Life Sciences, 873(1), 95–101.
Kataoka, S., Yasui, H., Hiromura, M., & Sakurai, H. (2005). Effect of insulin-mimetic vanadyl sulfate on cytochrome P450 2E1-dependent p-nitrophenol hydroxylation in the liver microsomes of streptozotocin-induced type 1 diabetic rats. Life Sciences, 77(22), 2814–29.
Kathirvel, E., Chen, P., Morgan, K., French, S. W., & Morgan, T. R. (2010). Oxidative stress and regulation of anti-oxidant enzymes in cytochrome P4502E1 transgenic mouse model of non-alcoholic fatty liver. Journal of Gastroenterology and Hepatology, 25(6), 1136–43.
Kathirvel E1, Morgan K, French SW, M. T. (2009). Overexpression of liver-specific cytochrome P4502E1 impairs hepatic insulin signaling in a transgenic mouse model of nonalcoholic fatty liver disease. European Journal of Gastroenterology & Hepatology, 21(9), 973–983.
Kato, R. (1974). Sex-related differences in drug metabolism. Drug Metabolism Reviews, 3(1), 1–32.
Kato, T., Ito, Y., Hosono, K., Suzuki, T., Tamaki, H., Minamino, T., … Majima, M. (2011). Vascular endothelial growth factor receptor-1 signaling promotes liver repair through restoration of liver
201
microvasculature after acetaminophen hepatotoxicity. Toxicological Sciences : An Official
Journal of the Society of Toxicology, 120(1), 218–29.
Keays, R., Harrison, P. M., Wendon, J. A., Forbes, A., Gove, C., Alexander, G. J., & Williams, R. (1991). Intravenous acetylcysteine in paracetamol induced fulminant hepatic failure: a prospective controlled trial. BMJ (Clinical Research Ed.), 303(6809), 1026–9.
Khandelwal, N., James, L. P., Sanders, C., Larson, A. M., & Lee, W. M. (2011). Unrecognized acetaminophen toxicity as a cause of indeterminate acute liver failure. Hepatology (Baltimore,
Md.), 53(2), 567–76.
Kharbanda, S., Saxena, S., Yoshida, K., Pandey, P., Kaneki, M., Wang, Q., … Kufe, D. (2000). Translocation of SAPK/JNK to mitochondria and interaction with Bcl-x(L) in response to DNA damage. The Journal of Biological Chemistry, 275(1), 322–7.
Khemawoot, P., Yokogawa, K., Shimada, T., & Miyamoto, K.-I. (2007). Obesity-induced increase of CYP2E1 activity and its effect on disposition kinetics of chlorzoxazone in Zucker rats. Biochemical Pharmacology, 73(1), 155–62.
Kim, R. B., Yamazaki, H., Chiba, K., O’Shea, D., Mimura, M., Guengerich, F. P., … Wilkinson, G. R. (1996). In vivo and in vitro characterization of CYP2E1 activity in Japanese and Caucasians. The
Journal of Pharmacology and Experimental Therapeutics, 279(1), 4–11.
Kit, B. K., Ogden, C. L., & Flegal, K. M. (2012). Prescription medication use among normal weight, overweight, and obese adults, United States, 2005-2008. Annals of Epidemiology, 22(2), 112–9.
Kitahara, C. M., Flint, A. J., Berrington de Gonzalez, A., Bernstein, L., Brotzman, M., MacInnis, R. J., … Hartge, P. (2014). Association between class III obesity (BMI of 40-59 kg/m2) and mortality: a pooled analysis of 20 prospective studies. PLoS Medicine, 11(7), e1001673.
Knight, T. R., Fariss, M. W., Farhood, A., & Jaeschke, H. (2003). Role of lipid peroxidation as a mechanism of liver injury after acetaminophen overdose in mice. Toxicological Sciences : An
Official Journal of the Society of Toxicology, 76(1), 229–36.
Knight, T. R., & Jaeschke, H. (2002). Acetaminophen-induced inhibition of Fas receptor-mediated liver cell apoptosis: mitochondrial dysfunction versus glutathione depletion. Toxicology and Applied
Pharmacology, 181(2), 133–41.
Knight, T. R., Kurtz, A., Bajt, M. L., Hinson, J. A., & Jaeschke, H. (2001). Vascular and hepatocellular peroxynitrite formation during acetaminophen toxicity: role of mitochondrial oxidant stress. Toxicological Sciences : An Official Journal of the Society of Toxicology, 62(2), 212–20.
Knockaert, L., Descatoire, V., Vadrot, N., Fromenty, B., & Robin, M.-A. (2011). Mitochondrial CYP2E1 is sufficient to mediate oxidative stress and cytotoxicity induced by ethanol and acetaminophen. Toxicology in Vitro : An International Journal Published in Association with
BIBRA, 25(2), 475–84.
202
Kohjima, M., Enjoji, M., Higuchi, N., Kato, M., Kotoh, K., Yoshimoto, T., … Nakamuta, M. (2007). Re-evaluation of fatty acid metabolism-related gene expression in nonalcoholic fatty liver disease. International Journal of Molecular Medicine, 20(3), 351–8.
Kolars, J. C., Lown, K. S., Schmiedlin-Ren, P., Ghosh, M., Fang, C., Wrighton, S. A., … Watkins, P. B. (1994). CYP3A gene expression in human gut epithelium. Pharmacogenetics, 4(5), 247–59.
Kolwankar, D., Vuppalanchi, R., Ethell, B., Jones, D. R., Wrighton, S. A., Hall, S. D., & Chalasani, N. (2007). Association Between Nonalcoholic Hepatic Steatosis and Hepatic Cytochrome P-450 3A Activity. Clinical Gastroenterology and Hepatology, 5(3), 388–393.
Kon, K., Ikejima, K., Okumura, K., Arai, K., Aoyama, T., & Watanabe, S. (2010). Diabetic KK-A(y) mice are highly susceptible to oxidative hepatocellular damage induced by acetaminophen. American
Journal of Physiology. Gastrointestinal and Liver Physiology, 299(2), G329–37.
Kon, K., Kim, J.-S., Jaeschke, H., & Lemasters, J. J. (2004). Mitochondrial permeability transition in acetaminophen-induced necrosis and apoptosis of cultured mouse hepatocytes. Hepatology
(Baltimore, Md.), 40(5), 1170–9.
Koop, D. R. (1992). Oxidative and reductive metabolism by cytochrome P450 2E1. FASEB Journal :
Official Publication of the Federation of American Societies for Experimental Biology, 6(2), 724–30.
Korenblat, K. M., Fabbrini, E., Mohammed, B. S., & Klein, S. (2008). Liver, muscle, and adipose tissue insulin action is directly related to intrahepatic triglyceride content in obese subjects. Gastroenterology, 134(5), 1369–75.
Kostrubsky, V. E., Strom, S. C., Wood, S. G., Wrighton, S. A., Sinclair, P. R., & Sinclair, J. F. (1995). Ethanol and isopentanol increase CYP3A and CYP2E in primary cultures of human hepatocytes. Archives of Biochemistry and Biophysics, 322(2), 516–20.
Kotani, A., Fuse, T., & Kusu, F. (2000). Determination of plasma free fatty acids by high-performance liquid chromatography with electrochemical detection. Analytical Biochemistry, 284(1), 65–9.
Koturbash, I., Beland, F. A., & Pogribny, I. P. (2012). Role of microRNAs in the regulation of drug metabolizing and transporting genes and the response to environmental toxicants. Expert
Opinion on Drug Metabolism & Toxicology, 8(5), 597–606.
Kraner, J. C., Lasker, J. M., Corcoran, G. B., Ray, S. D., & Raucy, J. L. (1993). Induction of P4502E1 by acetone in isolated rabbit hepatocytes. Role of increased protein and mRNA synthesis. Biochemical Pharmacology, 45(7), 1483–92.
Krishna, D. R., & Shekar, M. S. (2005). Cytochrome P450 3A: genetic polymorphisms and inter-ethnic differences. Methods and Findings in Experimental and Clinical Pharmacology, 27(8), 559–67.
Kučera, O., Roušar, T., Staňková, P., Haňáčková, L., Lotková, H., Podhola, M., & Cervinková, Z. (2012). Susceptibility of rat non-alcoholic fatty liver to the acute toxic effect of acetaminophen. Journal
of Gastroenterology and Hepatology, 27(2), 323–30.
203
Kurtovic, J., & Riordan, S. M. (2003). Paracetamol-induced hepatotoxicity at recommended dosage. Journal of Internal Medicine, 253(2), 240–3.
Lacroix, D., Sonnier, M., Moncion, A., Cheron, G., & Cresteil, T. (1997). Expression of CYP3A in the Human Liver - Evidence that the Shift between CYP3A7 and CYP3A4 Occurs Immediately After Birth. European Journal of Biochemistry, 247(2), 625–634.
Laethem, R. M., Balazy, M., Falck, J. R., Laethem, C. L., & Koop, D. R. (1993). Formation of 19(S)-, 19(R)-, and 18(R)-hydroxyeicosatetraenoic acids by alcohol-inducible cytochrome P450 2E1. The
Journal of Biological Chemistry, 268(17), 12912–8.
Laine, J. E., Auriola, S., Pasanen, M., & Juvonen, R. O. (2009). Acetaminophen bioactivation by human cytochrome P450 enzymes and animal microsomes. Xenobiotica; the Fate of Foreign
Compounds in Biological Systems, 39(1), 11–21.
Lamb, D. C., & Waterman, M. R. (2013). Unusual properties of the cytochrome P450 superfamily. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 368(1612), 20120434.
Lamba, J. K., Lin, Y. S., Schuetz, E. G., & Thummel, K. E. (2002). Genetic contribution to variable human CYP3A-mediated metabolism. Advanced Drug Delivery Reviews, 54(10), 1271–94.
Lamba, V., Ghodke, Y., Guan, W., & Tracy, T. S. (2014). microRNA-34a is associated with expression of key hepatic transcription factors and cytochromes P450. Biochemical and Biophysical Research
Communications, 445(2), 404–11.
Larrey, D. (2002). Epidemiology and individual susceptibility to adverse drug reactions affecting the liver. Seminars in Liver Disease, 22(2), 145–55.
Larson, A. M., Polson, J., Fontana, R. J., Davern, T. J., Lalani, E., Hynan, L. S., … Lee, W. M. (2005). Acetaminophen-induced acute liver failure: results of a United States multicenter, prospective study. Hepatology (Baltimore, Md.), 42(6), 1364–72.
Larter, C. Z., Chitturi, S., Heydet, D., & Farrell, G. C. (2010). A fresh look at NASH pathogenesis. Part 1: the metabolic movers. Journal of Gastroenterology and Hepatology, 25(4), 672–90.
Laskin, D. L., Gardner, C. R., Price, V. F., & Jollow, D. J. (1995). Modulation of macrophage functioning abrogates the acute hepatotoxicity of acetaminophen. Hepatology (Baltimore, Md.), 21(4), 1045–50.
Latchoumycandane, C., Goh, C. W., Ong, M. M. K., & Boelsterli, U. A. (2007). Mitochondrial protection by the JNK inhibitor leflunomide rescues mice from acetaminophen-induced liver injury. Hepatology (Baltimore, Md.), 45(2), 412–21.
Latchoumycandane, C., Seah, Q. M., Tan, R. C. H., Sattabongkot, J., Beerheide, W., & Boelsterli, U. A. (2006). Leflunomide or A77 1726 protect from acetaminophen-induced cell injury through inhibition of JNK-mediated mitochondrial permeability transition in immortalized human hepatocytes. Toxicology and Applied Pharmacology, 217(1), 125–33.
204
Lauterburg, B. H., & Velez, M. E. (1988). Glutathione deficiency in alcoholics: risk factor for paracetamol hepatotoxicity. Gut, 29(9), 1153–1157.
Lawson, J. A., Farhood, A., Hopper, R. D., Bajt, M. L., & Jaeschke, H. (2000). The hepatic inflammatory response after acetaminophen overdose: role of neutrophils. Toxicological Sciences : An Official
Journal of the Society of Toxicology, 54(2), 509–16.
Lawson, J. A., Fisher, M. A., Simmons, C. A., Farhood, A., & Jaeschke, H. (1999). Inhibition of Fas receptor (CD95)-induced hepatic caspase activation and apoptosis by acetaminophen in mice. Toxicology and Applied Pharmacology, 156(3), 179–86.
Lazo, M., Hernaez, R., Eberhardt, M. S., Bonekamp, S., Kamel, I., Guallar, E., … Clark, J. M. (2013). Prevalence of nonalcoholic fatty liver disease in the United States: the Third National Health and Nutrition Examination Survey, 1988-1994. American Journal of Epidemiology, 178(1), 38–45. doi:10.1093/aje/kws448
Leclercq, I. A., Farrell, G. C., Field, J., Bell, D. R., Gonzalez, F. J., & Robertson, G. R. (2000). CYP2E1 and CYP4A as microsomal catalysts of lipid peroxides in murine nonalcoholic steatohepatitis. The
Journal of Clinical Investigation, 105(8), 1067–75. doi:10.1172/JCI8814
Leclercq, I. A., Lebrun, V. A., Stärkel, P., & Horsmans, Y. J. (2007). Intrahepatic insulin resistance in a murine model of steatohepatitis: effect of PPARgamma agonist pioglitazone. Laboratory
Investigation; a Journal of Technical Methods and Pathology, 87(1), 56–65.
Leclercq, I., Horsmans, Y., Desager, J. P., Delzenne, N., & Geubel, A. P. (1998). Reduction in hepatic cytochrome P-450 is correlated to the degree of liver fat content in animal models of steatosis in the absence of inflammation. Journal of Hepatology, 28(3), 410–6.
Lee, H. C., Jung, S. A., Jung, H. K., Yi, S. Y., Kim, D. Y., Moon, I. H., & Park, S. S. (1999). Protective effect of chlormethiazole, a sedative, against acetaminophen-induced liver injury in mice. The Korean
Journal of Internal Medicine, 14(2), 27–33.
Lee, W. H., Kramer, W. G., & Granville, G. E. (1981). The effect of obesity on acetaminophen pharmacokinetics in man. Journal of Clinical Pharmacology, 21(7), 284–7.
Lee, W. M. (2003). Acute liver failure in the United States. Seminars in Liver Disease, 23(3), 217–26.
Lee, W. M. (2007). Acetaminophen toxicity: changing perceptions on a social/medical issue. Hepatology (Baltimore, Md.), 46(4), 966–70.
Lee, W. M. (2008). Acetaminophen-related acute liver failure in the United States. Hepatology
Research : The Official Journal of the Japan Society of Hepatology, 38 Suppl 1, S3–8.
Lee, W. M., Squires, R. H., Nyberg, S. L., Doo, E., & Hoofnagle, J. H. (2008). Acute liver failure: Summary of a workshop. Hepatology (Baltimore, Md.), 47(4), 1401–15.
Lesser, P. B., Vietti, M. M., & Clark, W. D. (1986). Lethal enhancement of therapeutic doses of acetaminophen by alcohol. Digestive Diseases and Sciences, 31(1), 103–5.
205
Leung, T.-M., & Nieto, N. (2013). CYP2E1 and oxidant stress in alcoholic and non-alcoholic fatty liver disease. Journal of Hepatology, 58(2), 395–8.
Lewis, D. F. V. (2003). P450 structures and oxidative metabolism of xenobiotics. Pharmacogenomics, 4(4), 387–95.
Li, P., Robertson, T. A., Thorling, C. A., Zhang, Q., Fletcher, L. M., Crawford, D. H. G., & Roberts, M. S. (2011). Hepatic Pharmacokinetics of Cationic Drugs in a High-Fat Emulsion-Induced Rat Model of Nonalcoholic Steatohepatitis. Drug Metabolism and Disposition, 39(4), 571–579.
Liangpunsakul, S., Kolwankar, D., Pinto, A., Gorski, J. C., Hall, S. D., & Chalasani, N. (2005). Activity of CYP2E1 and CYP3A enzymes in adults with moderate alcohol consumption: a comparison with nonalcoholics. Hepatology (Baltimore, Md.), 41(5), 1144–50.
Licht, H., Seeff, L. B., & Zimmerman, H. J. (1980). Apparent potentiation of acetaminophen hepatotoxicity by alcohol. Annals of Internal Medicine, 92(4), 511.
Lichti-Kaiser, K., Xu, C., & Staudinger, J. L. (2009). Cyclic AMP-dependent protein kinase signaling modulates pregnane x receptor activity in a species-specific manner. The Journal of Biological
Chemistry, 284(11), 6639–49.
Lickteig, A. J., Fisher, C. D., Augustine, L. M., Aleksunes, L. M., Besselsen, D. G., Slitt, A. L., … Cherrington, N. J. (2007). Efflux Transporter Expression and Acetaminophen Metabolite Excretion Are Altered in Rodent Models of Nonalcoholic Fatty Liver Disease. Drug Metabolism
and Disposition, 35(10), 1970–1978.
Lieber, C. S. (2004). The discovery of the microsomal ethanol oxidizing system and its physiologic and pathologic role. Drug Metabolism Reviews, 36(3-4), 511–29.
Lin, Y. S., Dowling, A. L. S., Quigley, S. D., Farin, F. M., Zhang, J., Lamba, J., … Thummel, K. E. (2002). Co-regulation of CYP3A4 and CYP3A5 and contribution to hepatic and intestinal midazolam metabolism. Molecular Pharmacology, 62(1), 162–72.
Lindsay, J., Wang, L.-L., Li, Y., & Zhou, S.-F. (2008). Structure, function and polymorphism of human cytosolic sulfotransferases. Current Drug Metabolism, 9(2), 99–105.
Liu, J., Jin, X., Yu, C.-H., Chen, S.-H., Li, W.-P., & Li, Y.-M. (2010). Endoplasmic reticulum stress involved in the course of lipogenesis in fatty acids-induced hepatic steatosis. Journal of Gastroenterology
and Hepatology, 25(3), 613–8.
Liu, S. Y., & Gonzalez, F. J. (1995). Role of the liver-enriched transcription factor HNF-1 alpha in expression of the CYP2E1 gene. DNA and Cell Biology, 14(4), 285–93.
Loeper, J., Descatoire, V., Maurice, M., Beaune, P., Belghiti, J., Houssin, D., … Pessayre, D. (1993). Cytochromes P-450 in human hepatocyte plasma membrane: recognition by several autoantibodies. Gastroenterology, 104(1), 203–16.
Loguercio, C., De Simone, T., D’Auria, M. V, de Sio, I., Federico, A., Tuccillo, C., … Del Vecchio Blanco, C. (2004). Non-alcoholic fatty liver disease: a multicentre clinical study by the Italian Association
206
for the Study of the Liver. Digestive and Liver Disease : Official Journal of the Italian Society of
Gastroenterology and the Italian Association for the Study of the Liver, 36(6), 398–405.
Lown, K. S., Bailey, D. G., Fontana, R. J., Janardan, S. K., Adair, C. H., Fortlage, L. A., … Watkins, P. B. (1997). Grapefruit juice increases felodipine oral availability in humans by decreasing intestinal CYP3A protein expression. The Journal of Clinical Investigation, 99(10), 2545–53.
Lu, Y., & Cederbaum, A. I. (2008). CYP2E1 and oxidative liver injury by alcohol. Free Radical Biology
and Medicine, 44(5), 723–738.
Lucas, D., Farez, C., Bardou, L. G., Vaisse, J., Attali, J. R., & Valensi, P. (1998). Cytochrome P450 2E1 activity in diabetic and obese patients as assessed by chlorzoxazone hydroxylation. Fundamental & Clinical Pharmacology, 12(5), 553–8.
Ludwig, J., Viggiano, T. R., McGill, D. B., & Oh, B. J. (1980). Nonalcoholic steatohepatitis: Mayo Clinic experiences with a hitherto unnamed disease. Mayo Clinic Proceedings, 55(7), 434–8.
Luo, G., Cunningham, M., Kim, S., Burn, T., Lin, J., Sinz, M., … Gan, L.-S. (2002). CYP3A4 induction by drugs: correlation between a pregnane X receptor reporter gene assay and CYP3A4 expression in human hepatocytes. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 30(7), 795–804.
Luo, Y., Rana, P., & Will, Y. (2012). Palmitate increases the susceptibility of cells to drug-induced toxicity: an in vitro method to identify drugs with potential contraindications in patients with metabolic disease. Toxicological Sciences : An Official Journal of the Society of Toxicology, 129(2), 346–62.
Mackenzie, P. I., Bock, K. W., Burchell, B., Guillemette, C., Ikushiro, S., Iyanagi, T., … Nebert, D. W. (2005). Nomenclature update for the mammalian UDP glycosyltransferase (UGT) gene superfamily. Pharmacogenetics and Genomics, 15(10), 677–85.
Maddox, J. F., Amuzie, C. J., Li, M., Newport, S. W., Sparkenbaugh, E., Cuff, C. F., … Ganey, P. E. (2010). Bacterial- and viral-induced inflammation increases sensitivity to acetaminophen hepatotoxicity. Journal of Toxicology and Environmental Health. Part A, 73(1), 58–73.
Madec, S., Cerec, V., Plée-Gautier, E., Antoun, J., Glaise, D., Salaun, J.-P., … Corlu, A. (2011). CYP4F3B expression is associated with differentiation of HepaRG human hepatocytes and unaffected by fatty acid overload. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 39(10), 1987–96.
Magkos, F., Su, X., Bradley, D., Fabbrini, E., Conte, C., Eagon, J. C., … Klein, S. (2012). Intrahepatic Diacylglycerol Content Is Associated With Hepatic Insulin Resistance in Obese Subjects. Gastroenterology, 142(7), 1444–1446.e2.
Maksymchuk, O. V. (2014). [Influence of omega-3 polyunsaturated fatty acids on oxidative stress and cytochrome P450 2E1 expression in rat liver]. Ukrainskiĭ Biokhimicheskiĭ Zhurnal, 86(4), 132–7.
Manchanda, A., Cameron, C., & Robinson, G. (2013). Beware of paracetamol use in alcohol abusers: a potential cause of acute liver injury. The New Zealand Medical Journal, 126(1383), 80–4.
207
Martignoni, M., Groothuis, G. M. M., & de Kanter, R. (2006). Species differences between mouse, rat, dog, monkey and human CYP-mediated drug metabolism, inhibition and induction. Expert
Opinion on Drug Metabolism & Toxicology, 2(6), 875–94. doi:10.1517/17425255.2.6.875
Martínez-Jiménez, C. P., Jover, R., Donato, M. T., Castell, J. V, & Gómez-Lechón, M. J. (2007). Transcriptional regulation and expression of CYP3A4 in hepatocytes. Current Drug Metabolism, 8(2), 185–94.
Martin-Murphy, B. V, Holt, M. P., & Ju, C. (2010). The role of damage associated molecular pattern molecules in acetaminophen-induced liver injury in mice. Toxicology Letters, 192(3), 387–94.
Marzuillo, P., Guarino, S., & Barbi, E. (2014). Paracetamol: a focus for the general pediatrician. European Journal of Pediatrics, 173(4), 415–25.
Massart, J., Robin, M. A., Noury, F., Fautrel, A., Lettéron, P., Bado, A., … Fromenty, B. (2012). Pentoxifylline aggravates fatty liver in obese and diabetic ob/ob mice by increasing intestinal glucose absorption and activating hepatic lipogenesis. British Journal of Pharmacology, 165(5), 1361–74.
Masubuchi, Y., Nakayama, J., & Watanabe, Y. (2011). Sex difference in susceptibility to acetaminophen hepatotoxicity is reversed by buthionine sulfoximine. Toxicology, 287(1-3), 54–60.
Masubuchi, Y., Suda, C., & Horie, T. (2005). Involvement of mitochondrial permeability transition in acetaminophen-induced liver injury in mice. Journal of Hepatology, 42(1), 110–6.
Matsunaga, N., Ikeda, M., Takiguchi, T., Koyanagi, S., & Ohdo, S. (2008). The molecular mechanism regulating 24-hour rhythm of CYP2E1 expression in the mouse liver. Hepatology (Baltimore,
Md.), 48(1), 240–51.
Matsuura, S., Fujii-Kuriyama, Y., & Tashiro, Y. (1978). Immunoelectron microscope localization of cytochrome P-450 on microsomes and other membrane structures of rat hepatocytes. The
Journal of Cell Biology, 78(2), 503–19.
McCarver, D. G., Byun, R., Hines, R. N., Hichme, M., & Wegenek, W. (1998). A genetic polymorphism in the regulatory sequences of human CYP2E1: association with increased chlorzoxazone hydroxylation in the presence of obesity and ethanol intake. Toxicology and Applied
Pharmacology, 152(1), 276–81.
McClain, C. J., Kromhout, J. P., Peterson, F. J., & Holtzman, J. L. (1980). Potentiation of acetaminophen hepatotoxicity by alcohol. JAMA, 244(3), 251–3.
McConnachie, L. A., Mohar, I., Hudson, F. N., Ware, C. B., Ladiges, W. C., Fernandez, C., … Kavanagh, T. J. (2007). Glutamate cysteine ligase modifier subunit deficiency and gender as determinants of acetaminophen-induced hepatotoxicity in mice. Toxicological Sciences : An Official Journal of
the Society of Toxicology, 99(2), 628–36.
McGill, M. R., & Jaeschke, H. (2013). Metabolism and disposition of acetaminophen: recent advances in relation to hepatotoxicity and diagnosis. Pharmaceutical Research, 30(9), 2174–87.
208
McGill, M. R., Yan, H.-M., Ramachandran, A., Murray, G. J., Rollins, D. E., & Jaeschke, H. (2011). HepaRG cells: a human model to study mechanisms of acetaminophen hepatotoxicity. Hepatology (Baltimore, Md.), 53(3), 974–82.
McLean, K. J., Hans, M., & Munro, A. W. (2012). Cholesterol, an essential molecule: diverse roles involving cytochrome P450 enzymes. Biochemical Society Transactions, 40(3), 587–93.
McPherson, S., Hardy, T., Henderson, E., Burt, A. D., Day, C. P., & Anstee, Q. M. (2014). Evidence of NAFLD progression from steatosis to fibrosing-steatohepatitis using paired biopsies: Implications for prognosis and clinical management. Journal of Hepatology.
Megarbane, B., Deye, N., & Baud, F. (2007). Foie toxique : mécanismes lésionnels et thérapeutiques pharmacologiques spécifiques. Réanimation, 16(7-8), 632–642.
Mehendale, H. M. (2005). Tissue repair: an important determinant of final outcome of toxicant-induced injury. Toxicologic Pathology, 33(1), 41–51.
Mei, Q., Tang, C., Assang, C., Lin, Y., Slaughter, D., Rodrigues, A. D., … Shou, M. (1999). Role of a potent inhibitory monoclonal antibody to cytochrome P-450 3A4 in assessment of human drug metabolism. The Journal of Pharmacology and Experimental Therapeutics, 291(2), 749–59.
Meisinger, C., Döring, A., Thorand, B., Heier, M., & Löwel, H. (2006). Body fat distribution and risk of type 2 diabetes in the general population: are there differences between men and women? The MONICA/KORA Augsburg cohort study. The American Journal of Clinical Nutrition, 84(3), 483–9.
Michael, S. L., Pumford, N. R., Mayeux, P. R., Niesman, M. R., & Hinson, J. A. (1999). Pretreatment of mice with macrophage inactivators decreases acetaminophen hepatotoxicity and the formation of reactive oxygen and nitrogen species. Hepatology (Baltimore, Md.), 30(1), 186–95.
Michaut, A., Moreau, C., Robin, M.-A., & Fromenty, B. (2014). Acetaminophen-induced liver injury in obesity and nonalcoholic fatty liver disease. Liver International : Official Journal of the
International Association for the Study of the Liver, 34(7), e171–9.
Min, H.-K., Sookoian, S., Pirola, C. J., Cheng, J., Mirshahi, F., & Sanyal, A. J. (2014). Metabolic profiling reveals that PNPLA3 induces widespread effects on metabolism beyond triacylglycerol remodeling in Huh-7 hepatoma cells. American Journal of Physiology. Gastrointestinal and Liver
Physiology, 307(1), G66–76.
Miners, J. O., Lillywhite, K. J., Yoovathaworn, K., Pongmarutai, M., & Birkett, D. J. (1990). Characterization of paracetamol UDP-glucuronosyltransferase activity in human liver microsomes. Biochemical Pharmacology, 40(3), 595–600.
Minervini, M. I., Ruppert, K., Fontes, P., Volpes, R., Vizzini, G., de Vera, M. E., … Demetris, A. J. (2009). Liver biopsy findings from healthy potential living liver donors: reasons for disqualification, silent diseases and correlation with liver injury tests. Journal of Hepatology, 50(3), 501–10.
Mishin, V. M., Rosman, A. S., Basu, P., Kessova, I., Oneta, C. M., & Lieber, C. S. (1998). Chlorzoxazone pharmacokinetics as a marker of hepatic cytochrome P4502E1 in humans. The American Journal
of Gastroenterology, 93(11), 2154–61.
209
Mitchell, J. R., Jollow, D. J., Potter, W. Z., Gillette, J. R., & Brodie, B. B. (1973). Acetaminophen-induced hepatic necrosis. IV. Protective role of glutathione. The Journal of Pharmacology and
Experimental Therapeutics, 187(1), 211–7.
Mitchell, S. J., Hilmer, S. N., Murnion, B. P., & Matthews, S. (2011). Hepatotoxicity of therapeutic short-course paracetamol in hospital inpatients: impact of ageing and frailty. Journal of Clinical
Pharmacy and Therapeutics, 36(3), 327–35.
Mitropoulos, K. A., Miller, G. J., Martin, J. C., Reeves, B. E., & Cooper, J. (1994). Dietary fat induces changes in factor VII coagulant activity through effects on plasma free stearic acid concentration. Arteriosclerosis and Thrombosis : A Journal of Vascular Biology / American Heart
Association, 14(2), 214–22.
Mitsuyoshi, H., Yasui, K., Harano, Y., Endo, M., Tsuji, K., Minami, M., … Yoshikawa, T. (2009). Analysis of hepatic genes involved in the metabolism of fatty acids and iron in nonalcoholic fatty liver disease. Hepatology Research : The Official Journal of the Japan Society of Hepatology, 39(4), 366–73.
Mohri, T., Nakajima, M., Fukami, T., Takamiya, M., Aoki, Y., & Yokoi, T. (2010). Human CYP2E1 is regulated by miR-378. Biochemical Pharmacology, 79(7), 1045–1052.
Moncion, A., Truong, N. T., Garrone, A., Beaune, P., Barouki, R., & De Waziers, I. (2002). Identification of a 16-nucleotide sequence that mediates post-transcriptional regulation of rat CYP2E1 by insulin. The Journal of Biological Chemistry, 277(48), 45904–10.
Moore, M., Thor, H., Moore, G., Nelson, S., Moldéus, P., & Orrenius, S. (1985). The toxicity of acetaminophen and N-acetyl-p-benzoquinone imine in isolated hepatocytes is associated with thiol depletion and increased cytosolic Ca2+. The Journal of Biological Chemistry, 260(24), 13035–40.
Morgan, O., Hawkins, L., Edwards, N., & Dargan, P. (2007). Paracetamol (acetaminophen) pack size restrictions and poisoning severity: time trends in enquiries to a UK poisons centre. Journal of
Clinical Pharmacy and Therapeutics, 32(5), 449–55. doi:10.1111/j.1365-2710.2007.00842.x
Moyer, A. M., Fridley, B. L., Jenkins, G. D., Batzler, A. J., Pelleymounter, L. L., Kalari, K. R., … Weinshilboum, R. M. (2011). Acetaminophen-NAPQI hepatotoxicity: a cell line model system genome-wide association study. Toxicological Sciences : An Official Journal of the Society of
Toxicology, 120(1), 33–41.
Muldrew, K. L., James, L. P., Coop, L., McCullough, S. S., Hendrickson, H. P., Hinson, J. A., & Mayeux, P. R. (2002). Determination of acetaminophen-protein adducts in mouse liver and serum and human serum after hepatotoxic doses of acetaminophen using high-performance liquid chromatography with electrochemical detection. Drug Metabolism and Disposition: The
Biological Fate of Chemicals, 30(4), 446–51.
Muzumdar, H., & Rao, M. (2006). Pulmonary dysfunction and sleep apnea in morbid obesity. Pediatric Endocrinology Reviews : PER, 3 Suppl 4, 579–83.
210
Myers, R. P., Li, B., Fong, A., Shaheen, A. A. M., & Quan, H. (2007). Hospitalizations for acetaminophen overdose: a Canadian population-based study from 1995 to 2004. BMC Public
Health, 7, 143.
Myers, R. P., & Shaheen, A. A. M. (2009). Hepatitis C, alcohol abuse, and unintentional overdoses are risk factors for acetaminophen-related hepatotoxicity. Hepatology (Baltimore, Md.), 49(4), 1399–400.
Myers, T. G., Dietz, E. C., Anderson, N. L., Khairallah, E. A., Cohen, S. D., & Nelson, S. D. (1995). A comparative study of mouse liver proteins arylated by reactive metabolites of acetaminophen and its nonhepatotoxic regioisomer, 3’-hydroxyacetanilide. Chemical Research in Toxicology, 8(3), 403–13.
Nagasawa, M., Akasaka, Y., Ide, T., Hara, T., Kobayashi, N., Utsumi, M., & Murakami, K. (2007). Highly sensitive upregulation of apolipoprotein A-IV by peroxisome proliferator-activated receptor alpha (PPARalpha) agonist in human hepatoma cells. Biochemical Pharmacology, 74(12), 1738–46.
Narbro, K., Agren, G., Jonsson, E., Näslund, I., Sjöström, L., & Peltonen, M. (2002). Pharmaceutical costs in obese individuals: comparison with a randomly selected population sample and long-term changes after conventional and surgical treatment: the SOS intervention study. Archives of
Internal Medicine, 162(18), 2061–9.
Nativ, N. I., Yarmush, G., Chen, A., Dong, D., Henry, S. D., Guarrera, J. V, … Yarmush, M. L. (2013). Rat hepatocyte culture model of macrosteatosis: effect of macrosteatosis induction and reversal on viability and liver-specific function. Journal of Hepatology, 59(6), 1307–14.
Nebert, D. W., Adesnik, M., Coon, M. J., Estabrook, R. W., Gonzalez, F. J., Guengerich, F. P., … Levin, W. (1987). The P450 gene superfamily: recommended nomenclature. DNA (Mary Ann Liebert,
Inc.), 6(1), 1–11.
Nebert, D. W., Wikvall, K., & Miller, W. L. (2013). Human cytochromes P450 in health and disease. Philosophical Transactions of the Royal Society B: Biological Sciences, 368(1612), 20120431–20120431.
Nelson, D. R., Koymans, L., Kamataki, T., Stegeman, J. J., Feyereisen, R., Waxman, D. J., … Nebert, D. W. (1996). P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics, 6(1), 1–42.
Nelson, S. D. (1990). Molecular mechanisms of the hepatotoxicity caused by acetaminophen. Seminars in Liver Disease, 10(4), 267–78.
Nelson, S. D., Tirmenstein, M. A., Rashed, M. S., & Myers, T. G. (1991). Acetaminophen and protein thiol modification. Advances in Experimental Medicine and Biology, 283, 579–88.
Neve, E. P., Eliasson, E., Pronzato, M. A., Albano, E., Marinari, U., & Ingelman-Sundberg, M. (1996). Enzyme-specific transport of rat liver cytochrome P450 to the Golgi apparatus. Archives of
Biochemistry and Biophysics, 333(2), 459–65.
211
Newton, D. J., Wang, R. W., & Lu, A. Y. (1995). Cytochrome P450 inhibitors. Evaluation of specificities in the in vitrometabolism of therapeutic agents by human liver microsomes. Drug Metabolism
and Disposition: The Biological Fate of Chemicals, 23(1), 154–8.
Nguyen, G. C., Sam, J., & Thuluvath, P. J. (2008). Hepatitis C is a predictor of acute liver injury among hospitalizations for acetaminophen overdose in the United States: a nationwide analysis. Hepatology (Baltimore, Md.), 48(4), 1336–41.
Nguyen, T. V, Ukairo, O., Khetani, S. R., McVay, M., Kanchagar, C., Seghezzi, W., … Evers, R. (2015). Establishment of a hepatocyte-kupffer cell coculture model for assessment of proinflammatory cytokine effects on metabolizing enzymes and drug transporters. Drug Metabolism and
Disposition: The Biological Fate of Chemicals, 43(5), 774–85.
Niemelä, O., Parkkila, S., Juvonen, R. O., Viitala, K., Gelboin, H. V, & Pasanen, M. (2000). Cytochromes P450 2A6, 2E1, and 3A and production of protein-aldehyde adducts in the liver of patients with alcoholic and non-alcoholic liver diseases. Journal of Hepatology, 33(6), 893–901.
Nourjah, P., Ahmad, S. R., Karwoski, C., & Willy, M. (2006). Estimates of acetaminophen (Paracetomal)-associated overdoses in the United States. Pharmacoepidemiology and Drug
Safety, 15(6), 398–405.
Novak, R. F., & Woodcroft, K. J. (2000). The alcohol-inducible form of cytochrome P450 (CYP 2E1): role in toxicology and regulation of expression. Archives of Pharmacal Research, 23(4), 267–82.
Novotná, A., Krasulová, K., Bartoňková, I., Korhoňová, M., Bachleda, P., Anzenbacher, P., & Dvořák, Z. (2014). Dual effects of ketoconazole cis-enantiomers on CYP3A4 in human hepatocytes and HepG2 Cells. PloS One, 9(10), e111286.
O’Shea, D., Davis, S. N., Kim, R. B., & Wilkinson, G. R. (1994). Effect of fasting and obesity in humans on the 6-hydroxylation of chlorzoxazone: a putative probe of CYP2E1 activity. Clinical
Pharmacology and Therapeutics, 56(4), 359–67.
Oesch-Bartlomowicz, B., & Oesch, F. (2005). Phosphorylation of cytochromes P450: First discovery of a posttranslational modification of a drug-metabolizing enzyme. Biochemical and Biophysical
Research Communications, 338(1), 446–449.
Oesch-Bartlomowicz, B., Padma, P. R., Becker, R., Richter, B., Hengstler, J. G., Freeman, J. E., … Oesch, F. (1998). Differential modulation of CYP2E1 activity by cAMP-dependent protein kinase upon Ser129 replacement. Experimental Cell Research, 242(1), 294–302.
Ogden, C. L., Carroll, M. D., Kit, B. K., & Flegal, K. M. (2014). Prevalence of childhood and adult obesity in the United States, 2011-2012. JAMA : The Journal of the American Medical
Association, 311(8), 806–14.
Oh, S. J., Choi, J. M., Yun, K. U., Oh, J. M., Kwak, H. C., Oh, J.-G., … Kim, S. K. (2012). Hepatic expression of cytochrome P450 in type 2 diabetic Goto-Kakizaki rats. Chemico-Biological
Interactions, 195(3), 173–9.
212
Ohashi, Y., Yamada, K., Takemoto, I., Mizutani, T., & Saeki, K. (2005). Inhibition of human cytochrome P450 2E1 by halogenated anilines, phenols, and thiophenols. Biological & Pharmaceutical
Bulletin, 28(7), 1221–3.
Omura, T., & Sato, R. (1962). A new cytochrome in liver microsomes. The Journal of Biological
Chemistry, 237, 1375–6.
Oneta, C. M., Lieber, C. S., Li, J., Rüttimann, S., Schmid, B., Lattmann, J., … Seitz, H. K. (2002). Dynamics of cytochrome P4502E1 activity in man: induction by ethanol and disappearance during withdrawal phase. Journal of Hepatology, 36(1), 47–52.
Ong, J. P., Elariny, H., Collantes, R., Younoszai, A., Chandhoke, V., Reines, H. D., … Younossi, Z. M. (2005). Predictors of nonalcoholic steatohepatitis and advanced fibrosis in morbidly obese patients. Obesity Surgery, 15(3), 310–5.
Ono, S., Hatanaka, T., Hotta, H., Satoh, T., Gonzalez, F. J., & Tsutsui, M. (1996). Specificity of substrate and inhibitor probes for cytochrome P450s: evaluation of in vitro metabolism using cDNA-expressed human P450s and human liver microsomes. Xenobiotica; the Fate of Foreign
Compounds in Biological Systems, 26(7), 681–93.
Opel, N., Redlich, R., Grotegerd, D., Dohm, K., Heindel, W., Kugel, H., … Dannlowski, U. (2014). Obesity and major depression: Body-mass index (BMI) is associated with a severe course of disease and specific neurostructural alterations. Psychoneuroendocrinology, 51C, 219–226.
Osabe, M., Sugatani, J., Fukuyama, T., Ikushiro, S., Ikari, A., & Miwa, M. (2008). Expression of hepatic UDP-glucuronosyltransferase 1A1 and 1A6 correlated with increased expression of the nuclear constitutive androstane receptor and peroxisome proliferator-activated receptor alpha in male rats fed a high-fat and high-sucrose diet. Drug Metabolism and Disposition: The Biological Fate
of Chemicals, 36(2), 294–302.
Ostapowicz, G., Fontana, R. J., Schiødt, F. V, Larson, A., Davern, T. J., Han, S. H. B., … Lee, W. M. (2002). Results of a prospective study of acute liver failure at 17 tertiary care centers in the United States. Annals of Internal Medicine, 137(12), 947–54.
Ozdemir, V., Kalow, W., Tang, B. K., Paterson, A. D., Walker, S. E., Endrenyi, L., & Kashuba, A. D. (2000). Evaluation of the genetic component of variability in CYP3A4 activity: a repeated drug administration method. Pharmacogenetics, 10(5), 373–88.
Pahan, K., Smith, B. T., Singh, A. K., & Singh, I. (1997). Cytochrome P-450 2E1 in rat liver peroxisomes: downregulation by ischemia/reperfusion-induced oxidative stress. Free Radical Biology &
Medicine, 23(7), 963–71.
Paine, M. F., Schmiedlin-Ren, P., & Watkins, P. B. (1999). Cytochrome P-450 1A1 expression in human small bowel: interindividual variation and inhibition by ketoconazole. Drug Metabolism and
Disposition: The Biological Fate of Chemicals, 27(3), 360–4.
Park, J.-H., Seo, K.-S., Tadi, S., Ahn, B.-H., Lee, J.-U., Heo, J.-Y., … Kweon, G. (2013). An indole derivative protects against acetaminophen-induced liver injury by directly binding to N-acetyl-p-benzoquinone imine in mice. Antioxidants & Redox Signaling, 18(14), 1713–22.
213
Park, Y., Smith, R. D., Combs, A. B., & Kehrer, J. P. (1988). Prevention of acetaminophen-induced hepatotoxicity by dimethyl sulfoxide. Toxicology, 52(1-2), 165–75.
Patel, M., Tang, B. K., & Kalow, W. (1992). Variability of acetaminophen metabolism in Caucasians and Orientals. Pharmacogenetics, 2(1), 38–45.
Patel, S. J., Milwid, J. M., King, K. R., Bohr, S., Iracheta-Velle, A., Li, M., … Yarmush, M. L. (2012). Gap junction inhibition prevents drug-induced liver toxicity and fulminant hepatic failure. Nature
Biotechnology, 30(2), 179–83.
Patoine, D., Levac, X., Pilote, S., Drolet, B., & Simard, C. (2013). Decreased CYP3A expression and activity in guinea pig models of diet-induced metabolic syndrome: is fatty liver infiltration involved? Drug Metabolism and Disposition: The Biological Fate of Chemicals, 41(5), 952–7.
Patoine, D., Petit, M., Pilote, S., Picard, F., Drolet, B., & Simard, C. (2014). Modulation of CYP3a expression and activity in mice models of type 1 and type 2 diabetes. Pharmacology Research &
Perspectives, 2(6), e00082.
Patten, C. J., Thomas, P. E., Guy, R. L., Lee, M., Gonzalez, F. J., Guengerich, F. P., & Yang, C. S. (1993). Cytochrome P450 enzymes involved in acetaminophen activation by rat and human liver microsomes and their kinetics. Chemical Research in Toxicology, 6(4), 511–8.
Pawella, L. M., Hashani, M., Eiteneuer, E., Renner, M., Bartenschlager, R., Schirmacher, P., & Straub, B. K. (2014). Perilipin discerns chronic from acute hepatocellular steatosis. Journal of
Hepatology, 60(3), 633–642.
Peeters, A., Barendregt, J. J., Willekens, F., Mackenbach, J. P., Al Mamun, A., & Bonneux, L. (2003). Obesity in adulthood and its consequences for life expectancy: a life-table analysis. Annals of
Internal Medicine, 138(1), 24–32.
Pelajo, C. F., Lopez-Benitez, J. M., & Miller, L. C. (2012). Obesity and disease activity in juvenile idiopathic arthritis. Pediatric Rheumatology Online Journal, 10(1), 3. doi:10.1186/1546-0096-10-3
Pelkonen, O., Mäenpää, J., Taavitsainen, P., Rautio, A., & Raunio, H. (1998). Inhibition and induction of human cytochrome P450 (CYP) enzymes. Xenobiotica; the Fate of Foreign Compounds in
Biological Systems, 28(12), 1203–53.
Peng, H. M., & Coon, M. J. (2000). Promoter function and the role of cytokines in the transcriptional regulation of rabbit CYP2E1 and CYP2E2. Archives of Biochemistry and Biophysics, 382(1), 129–37.
Perry, R. J., Samuel, V. T., Petersen, K. F., & Shulman, G. I. (2014). The role of hepatic lipids in hepatic insulin resistance and type 2 diabetes. Nature, 510(7503), 84–91. doi:10.1038/nature13478
Pessayre, D., Wandscheer, J. C., Cobert, B., Level, R., Degott, C., Batt, A. M., … Benhamou, J. P. (1980). Additive effects of inducers and fasting on acetaminophen hepatotoxicity. Biochemical
Pharmacology, 29(16), 2219–23.
214
Peter, R., Böcker, R., Beaune, P. H., Iwasaki, M., Guengerich, F. P., & Yang, C. S. (1990). Hydroxylation of chlorzoxazone as a specific probe for human liver cytochrome P-450IIE1. Chemical Research
in Toxicology, 3(6), 566–73.
Petersen, R. K., Jørgensen, C., Rustan, A. C., Frøyland, L., Muller-Decker, K., Furstenberger, G., … Madsen, L. (2003). Arachidonic acid-dependent inhibition of adipocyte differentiation requires PKA activity and is associated with sustained expression of cyclooxygenases. Journal of Lipid
Research, 44(12), 2320–30.
Pickering, G., Schneider, E., Papet, I., Pujos-Guillot, E., Pereira, B., Simen, E., … Schoeffler, P. (2011). Acetaminophen metabolism after major surgery: a greater challenge with increasing age. Clinical Pharmacology and Therapeutics, 90(5), 707–11.
Pizarro, M., Balasubramaniyan, N., Solís, N., Solar, A., Duarte, I., Miquel, J. F., … Arrese, M. (2004). Bile secretory function in the obese Zucker rat: evidence of cholestasis and altered canalicular transport function. Gut, 53(12), 1837–43.
Placke, M. E., Ginsberg, G. L., Wyand, D. S., & Cohen, S. D. (1987). Ultrastructural changes during acute acetaminophen-induced hepatotoxicity in the mouse: a time and dose study. Toxicologic
Pathology, 15(4), 431–8.
Plewka, D., Plewka, A., Szczepanik, T., Morek, M., Bogunia, E., Wittek, P., & Kijonka, C. (2014). Expression of selected cytochrome P450 isoforms and of cooperating enzymes in colorectal tissues in selected pathological conditions. Pathology, Research and Practice, 210(4), 242–9. doi:10.1016/j.prp.2013.12.010
Polson, J., & Lee, W. M. (2005). AASLD position paper: the management of acute liver failure. Hepatology (Baltimore, Md.), 41(5), 1179–97.
Polson, J., & Lee, W. M. (2007). Etiologies of acute liver failure: location, location, location! Liver
Transplantation : Official Publication of the American Association for the Study of Liver Diseases
and the International Liver Transplantation Society, 13(10), 1362–3.
Porceddu, M., Buron, N., Roussel, C., Labbe, G., Fromenty, B., & Borgne-Sanchez, A. (2012). Prediction of liver injury induced by chemicals in human with a multiparametric assay on isolated mouse liver mitochondria. Toxicological Sciences : An Official Journal of the Society of
Toxicology, 129(2), 332–45.
Porubsky, P. R., Meneely, K. M., & Scott, E. E. (2008). Structures of human cytochrome P-450 2E1. Insights into the binding of inhibitors and both small molecular weight and fatty acid substrates. The Journal of Biological Chemistry, 283(48), 33698–707.
Postic, C., & Girard, J. (2008). Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: lessons from genetically engineered mice. The Journal of Clinical
Investigation, 118(3), 829–38.
Potter, D. W., & Hinson, J. A. (1987). Mechanisms of acetaminophen oxidation to N-acetyl-P-benzoquinone imine by horseradish peroxidase and cytochrome P-450. The Journal of Biological
Chemistry, 262(3), 966–73.
215
Potter, W. Z., Davis, D. C., Mitchell, J. R., Jollow, D. J., Gillette, J. R., & Brodie, B. B. (1973). Acetaminophen-induced hepatic necrosis. 3. Cytochrome P-450-mediated covalent binding in vitro. The Journal of Pharmacology and Experimental Therapeutics, 187(1), 203–10.
Pratt-Hyatt, M., Lin, H., & Hollenberg, P. F. (2010). Mechanism-based inactivation of human CYP2E1 by diethyldithocarbamate. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 38(12), 2286–92.
Prescott, L. F. (1980). Kinetics and metabolism of paracetamol and phenacetin. British Journal of
Clinical Pharmacology, 10 Suppl 2, 291S–298S.
Prescott, L. F., Park, J., Ballantyne, A., Adriaenssens, P., & Proudfoot, A. T. (1977). Treatment of paracetamol (acetaminophen) poisoning with N-acetylcysteine. Lancet, 2(8035), 432–4.
Price, V. F., Miller, M. G., & Jollow, D. J. (1987). Mechanisms of fasting-induced potentiation of acetaminophen hepatotoxicity in the rat. Biochemical Pharmacology, 36(4), 427–33.
Projean, D., Dautrey, S., Vu, H. K., Groblewski, T., Brazier, J.-L., & Ducharme, J. (2005). Selective downregulation of hepatic cytochrome P450 expression and activity in a rat model of inflammatory pain. Pharmaceutical Research, 22(1), 62–70.
Puccinelli, E., Gervasi, P. G., Pelosi, G., Puntoni, M., & Longo, V. (2013). Modulation of cytochrome P450 enzymes in response to continuous or intermittent high-fat diet in pigs. Xenobiotica; the
Fate of Foreign Compounds in Biological Systems, 43(8), 686–98.
Pumford, N. R., Hinson, J. A., Potter, D. W., Rowland, K. L., Benson, R. W., & Roberts, D. W. (1989). Immunochemical quantitation of 3-(cystein-S-yl)acetaminophen adducts in serum and liver proteins of acetaminophen-treated mice. The Journal of Pharmacology and Experimental
Therapeutics, 248(1), 190–6.
Pumford, N. R., Roberts, D. W., Benson, R. W., & Hinson, J. A. (1990). Immunochemical quantitation of 3-(cystein-S-yl)acetaminophen protein adducts in subcellular liver fractions following a hepatotoxic dose of acetaminophen. Biochemical Pharmacology, 40(3), 573–9.
Puri, P., Baillie, R. A., Wiest, M. M., Mirshahi, F., Choudhury, J., Cheung, O., … Sanyal, A. J. (2007). A lipidomic analysis of nonalcoholic fatty liver disease. Hepatology (Baltimore, Md.), 46(4), 1081–90.
Qiu, Y., Benet, L. Z., & Burlingame, A. L. (1998). Identification of the hepatic protein targets of reactive metabolites of acetaminophen in vivo in mice using two-dimensional gel electrophoresis and mass spectrometry. The Journal of Biological Chemistry, 273(28), 17940–53.
Qiu, Y., Benet, L. Z., & Burlingame, A. L. (2001). Identification of hepatic protein targets of the reactive metabolites of the non-hepatotoxic regioisomer of acetaminophen, 3’-hydroxyacetanilide, in the mouse in vivo using two-dimensional gel electrophoresis and mass spectrometry. Advances in Experimental Medicine and Biology, 500, 663–73.
Racha, J. K., Zhao, Z. S., Olejnik, N., Warner, N., Chan, R., Moore, D., & Satoh, H. (2003). Substrate Dependent Inhibition Profiles of Fourteen Drugs on CYP3A4 Activity Measured by A High
216
Throughput LCMS/MS Method with Four Probe Drugs, Midazolam, Testosterone, Nifedipine and Terfenadine. Drug Metabolism and Pharmacokinetics, 18(2), 128–138.
Radosevich, J. J., Patanwala, A. E., & Erstad, B. L. (2013). Hepatotoxicity in Obese Versus Nonobese Patients With Acetaminophen Poisoning Who Are Treated With Intravenous N-Acetylcysteine. American Journal of Therapeutics.
Ramachandran, A., Lebofsky, M., Weinman, S. A., & Jaeschke, H. (2011). The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity. Toxicology and Applied
Pharmacology, 251(3), 226–33.
Raucy, J. L., Lasker, J. M., Kraner, J. C., Salazar, D. E., Lieber, C. S., & Corcoran, G. B. (1991). Induction of cytochrome P450IIE1 in the obese overfed rat. Molecular Pharmacology, 39(3), 275–80. Raucy, J. L., Lasker, J. M., Lieber, C. S., & Black, M. (1989). Acetaminophen activation by human liver cytochromes P450IIE1 and P450IA2. Archives of Biochemistry and Biophysics, 271(2), 270–83.
Raucy, J. L., Lasker, J., Ozaki, K., & Zoleta, V. (2004). Regulation of CYP2E1 by ethanol and palmitic acid and CYP4A11 by clofibrate in primary cultures of human hepatocytes. Toxicological
Sciences : An Official Journal of the Society of Toxicology, 79(2), 233–41.
Ray, S. D., Kamendulis, L. M., Gurule, M. W., Yorkin, R. D., & Corcoran, G. B. (1993). Ca2+ antagonists inhibit DNA fragmentation and toxic cell death induced by acetaminophen. FASEB Journal :
Official Publication of the Federation of American Societies for Experimental Biology, 7(5), 453–63.
Ray, S. D., Sorge, C. L., Raucy, J. L., & Corcoran, G. B. (1990). Early loss of large genomic DNA in vivo with accumulation of Ca2+ in the nucleus during acetaminophen-induced liver injury. Toxicology
and Applied Pharmacology, 106(2), 346–51.
Raza, H., Prabu, S. K., Robin, M.-A., & Avadhani, N. G. (2004). Elevated mitochondrial cytochrome P450 2E1 and glutathione S-transferase A4-4 in streptozotocin-induced diabetic rats: tissue-specific variations and roles in oxidative stress. Diabetes, 53(1), 185–94.
Reid, A. B., Kurten, R. C., McCullough, S. S., Brock, R. W., & Hinson, J. A. (2005). Mechanisms of acetaminophen-induced hepatotoxicity: role of oxidative stress and mitochondrial permeability transition in freshly isolated mouse hepatocytes. The Journal of Pharmacology and
Experimental Therapeutics, 312(2), 509–16.
Rendic, S. (2002). Summary of information on human CYP enzymes: human P450 metabolism data. Drug Metabolism Reviews, 34(1-2), 83–448.
Rendic, S., & Di Carlo, F. J. (1997). Human cytochrome P450 enzymes: a status report summarizing their reactions, substrates, inducers, and inhibitors. Drug Metabolism Reviews, 29(1-2), 413–580.
217
Rezende, G., Roque-Afonso, A. M., Samuel, D., Gigou, M., Nicand, E., Ferre, V., … Féray, C. (2003). Viral and clinical factors associated with the fulminant course of hepatitis A infection. Hepatology (Baltimore, Md.), 38(3), 613–8.
Riches, Z., Stanley, E. L., Bloomer, J. C., & Coughtrie, M. W. H. (2009). Quantitative evaluation of the expression and activity of five major sulfotransferases (SULTs) in human tissues: the SULT “pie”. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 37(11), 2255–61.
Rinella, M. E., & Green, R. M. (2004). The methionine-choline deficient dietary model of steatohepatitis does not exhibit insulin resistance. Journal of Hepatology, 40(1), 47–51.
Rizki, G., Arnaboldi, L., Gabrielli, B., Yan, J., Lee, G. S., Ng, R. K., … Maher, J. J. (2006). Mice fed a lipogenic methionine-choline-deficient diet develop hypermetabolism coincident with hepatic suppression of SCD-1. Journal of Lipid Research, 47(10), 2280–90.
Roberts, B. J., Song, B. J., Soh, Y., Park, S. S., & Shoaf, S. E. (1995). Ethanol induces CYP2E1 by protein stabilization. Role of ubiquitin conjugation in the rapid degradation of CYP2E1. The Journal of
Biological Chemistry, 270(50), 29632–5.
Robin, M. A., Anandatheerthavarada, H. K., Fang, J. K., Cudic, M., Otvos, L., & Avadhani, N. G. (2001). Mitochondrial targeted cytochrome P450 2E1 (P450 MT5) contains an intact N terminus and requires mitochondrial specific electron transfer proteins for activity. The Journal of Biological
Chemistry, 276(27), 24680–9.
Robin, M. A., Le Roy, M., Descatoire, V., & Pessayre, D. (1997). Plasma membrane cytochromes P450 as neoantigens and autoimmune targets in drug-induced hepatitis. Journal of Hepatology, 26
Suppl 1, 23–30.
Robin, M.-A., Anandatheerthavarada, H. K., Biswas, G., Sepuri, N. B. V, Gordon, D. M., Pain, D., & Avadhani, N. G. (2002). Bimodal targeting of microsomal CYP2E1 to mitochondria through activation of an N-terminal chimeric signal by cAMP-mediated phosphorylation. The Journal of
Biological Chemistry, 277(43), 40583–93.
Robin, M.-A., Sauvage, I., Grandperret, T., Descatoire, V., Pessayre, D., & Fromenty, B. (2005b). Ethanol increases mitochondrial cytochrome P450 2E1 in mouse liver and rat hepatocytes. FEBS
Letters, 579(30), 6895–902.
Rocco, A., Compare, D., Angrisani, D., Sanduzzi Zamparelli, M., & Nardone, G. (2014). Alcoholic disease: liver and beyond. World Journal of Gastroenterology : WJG, 20(40), 14652–9.
Rockich, K., & Blouin, R. (1999). Effect of the acute-phase response on the pharmacokinetics of chlorzoxazone and cytochrome P-450 2E1 in vitro activity in rats. Drug Metabolism and
Disposition: The Biological Fate of Chemicals, 27(9), 1074–7.
Rogers, L. K., Moorthy, B., & Smith, C. V. (1997). Acetaminophen binds to mouse hepatic and renal DNA at human therapeutic doses. Chemical Research in Toxicology, 10(4), 470–6.
218
Romero-Corral, A., Somers, V. K., Sierra-Johnson, J., Thomas, R. J., Collazo-Clavell, M. L., Korinek, J., … Lopez-Jimenez, F. (2008). Accuracy of body mass index in diagnosing obesity in the adult general population. International Journal of Obesity (2005), 32(6), 959–66.
Rosen, G. M., Rauckman, E. J., Ellington, S. P., Dahlin, D. C., Christie, J. L., & Nelson, S. D. (1984). Reduction and glutathione conjugation reactions of N-acetyl-p-benzoquinone imine and two dimethylated analogues. Molecular Pharmacology, 25(1), 151–7.
Roth, A., Looser, R., Kaufmann, M., & Meyer, U. A. (2008). Sterol regulatory element binding protein 1 interacts with pregnane X receptor and constitutive androstane receptor and represses their target genes. Pharmacogenetics and Genomics, 18(4), 325–37.
Rubin, K., Janefeldt, A., Andersson, L., Berke, Z., Grime, K., & Andersson, T. B. (2015). HepaRG cells as human-relevant in vitro model to study the effects of inflammatory stimuli on cytochrome P450 isoenzymes. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 43(1), 119–25.
Rumack, B. H. (2002). Acetaminophen hepatotoxicity: the first 35 years. Journal of Toxicology. Clinical
Toxicology, 40(1), 3–20.
Rumack, B. H. (2004). Acetaminophen misconceptions. Hepatology (Baltimore, Md.), 40(1), 10–5.
Rumack, B. H., & Matthew, H. (1975). Acetaminophen poisoning and toxicity. Pediatrics, 55(6), 871–6.
Rutherford, A., Davern, T., Hay, J. E., Murray, N. G., Hassanein, T., Lee, W. M., & Chung, R. T. (2006). Influence of high body mass index on outcome in acute liver failure. Clinical Gastroenterology
and Hepatology : The Official Clinical Practice Journal of the American Gastroenterological
Association, 4(12), 1544–9.
Sabapathy, K., Hochedlinger, K., Nam, S. Y., Bauer, A., Karin, M., & Wagner, E. F. (2004). Distinct roles for JNK1 and JNK2 in regulating JNK activity and c-Jun-dependent cell proliferation. Molecular
Cell, 15(5), 713–25.
Saberi, B., Ybanez, M. D., Johnson, H. S., Gaarde, W. A., Han, D., & Kaplowitz, N. (2014). Protein kinase C (PKC) participates in acetaminophen hepatotoxicity through c-jun-N-terminal kinase (JNK)-dependent and -independent signaling pathways. Hepatology (Baltimore, Md.), 59(4), 1543–54.
Saito, C., Lemasters, J. J., & Jaeschke, H. (2010). c-Jun N-terminal kinase modulates oxidant stress and peroxynitrite formation independent of inducible nitric oxide synthase in acetaminophen hepatotoxicity. Toxicology and Applied Pharmacology, 246(1-2), 8–17.
Saito, C., Zwingmann, C., & Jaeschke, H. (2010). Novel mechanisms of protection against acetaminophen hepatotoxicity in mice by glutathione and N-acetylcysteine. Hepatology
(Baltimore, Md.), 51(1), 246–54.
Salas, V. M., & Corcoran, G. B. (1997). Calcium-dependent DNA damage and adenosine 3?,5?-cyclic monophosphate- independent glycogen phosphorylase activation in anin vitro model of acetaminophen-induced liver injury. Hepatology, 25(6), 1432–1438.
219
Samanez, C. H., Caron, S., Briand, O., Dehondt, H., Duplan, I., Kuipers, F., … Staels, B. (2012). The human hepatocyte cell lines IHH and HepaRG: models to study glucose, lipid and lipoprotein metabolism. Archives of Physiology and Biochemistry, 118(3), 102–11.
Sandilands, E. A., & Bateman, D. N. (2009). Adverse reactions associated with acetylcysteine. Clinical
Toxicology (Philadelphia, Pa.), 47(2), 81–8.
Sato, C., & Lieber, C. S. (1981). Mechanism of the preventive effect of ethanol on acetaminophen-induced hepatoxicity. The Journal of Pharmacology and Experimental Therapeutics, 218(3), 811–5.
Sato, C., Matsuda, Y., & Lieber, C. S. (1981). Increased hepatotoxicity of acetaminophen after chronic ethanol consumption in the rat. Gastroenterology, 80(1), 140–8.
Savary, C. C., Jossé, R., Bruyère, A., Guillet, F., Robin, M.-A., & Guillouzo, A. (2014). Interactions of endosulfan and methoxychlor involving CYP3A4 and CYP2B6 in human HepaRG cells. Drug
Metabolism and Disposition: The Biological Fate of Chemicals, 42(8), 1235–40.
Savino, F., Lupica, M. M., Tarasco, V., Locatelli, E., Garazzino, S., & Tovo, P.-A. (2011). Fulminant hepatitis after 10 days of acetaminophen treatment at recommended dosage in an infant. Pediatrics, 127(2), e494–7.
Saviuc, P., Hanna, J., & Danel, V. (1999). Epidemiologie des intoxications: plus de 2000 décès par an. La Revue Du Praticien. Médecine Générale, (481), 2054–2057.
Schattenberg, J. M., Wang, Y., Singh, R., Rigoli, R. M., & Czaja, M. J. (2005). Hepatocyte CYP2E1 overexpression and steatohepatitis lead to impaired hepatic insulin signaling. The Journal of
Biological Chemistry, 280(11), 9887–94.
Schiødt, F. V, Rochling, F. A., Casey, D. L., & Lee, W. M. (1997). Acetaminophen toxicity in an urban county hospital. The New England Journal of Medicine, 337(16), 1112–7.
Schmidt, L. E., Dalhoff, K., & Poulsen, H. E. (2002). Acute versus chronic alcohol consumption in acetaminophen-induced hepatotoxicity. Hepatology (Baltimore, Md.), 35(4), 876–82.
Schöpfer, F., Riobó, N., Carreras, M. C., Alvarez, B., Radi, R., Boveris, A., … Poderoso, J. J. (2000). Oxidation of ubiquinol by peroxynitrite: implications for protection of mitochondria against nitrosative damage. The Biochemical Journal, 349(Pt 1), 35–42.
Schulz, M., & Schmoldt, A. (2003). Therapeutic and toxic blood concentrations of more than 800 drugs and other xenobiotics. Die Pharmazie, 58(7), 447–74.
Schulze-Osthoff, K., & Bantel, H. (2011). Necrosis versus apoptosis in acetaminophen-induced hepatotoxicity. Hepatology (Baltimore, Md.), 53(3), 1070.
Seeff, L. B., Bonkovsky, H. L., Navarro, V. J., & Wang, G. (2015). Herbal products and the liver: a review of adverse effects and mechanisms. Gastroenterology, 148(3), 517–532.e3.
220
Seitz, H. K., & Wang, X.-D. (2013). The role of cytochrome P450 2E1 in ethanol-mediated carcinogenesis. Sub-Cellular Biochemistry, 67, 131–43.
Seki, S., Kitada, T., & Sakaguchi, H. (2005). Clinicopathological significance of oxidative cellular damage in non-alcoholic fatty liver diseases. Hepatology Research : The Official Journal of the
Japan Society of Hepatology, 33(2), 132–4.
Seppälä-Lindroos, A., Vehkavaara, S., Häkkinen, A.-M., Goto, T., Westerbacka, J., Sovijärvi, A., … Yki-Järvinen, H. (2002). Fat accumulation in the liver is associated with defects in insulin suppression of glucose production and serum free fatty acids independent of obesity in normal men. The Journal of Clinical Endocrinology and Metabolism, 87(7), 3023–8.
Serviddio, G., Bellanti, F., Giudetti, A. M., Gnoni, G. V., Petrella, A., Tamborra, R., … Altomare, E. (2010). A silybin-phospholipid complex prevents mitochondrial dysfunction in a rodent model of nonalcoholic steatohepatitis. The Journal of Pharmacology and Experimental Therapeutics, 332(3), 922–32.
Serviddio, G., Bellanti, F., Tamborra, R., Rollo, T., Romano, A. D., Giudetti, A. M., … Altomare, E. (2008). Alterations of hepatic ATP homeostasis and respiratory chain during development of non-alcoholic steatohepatitis in a rodent model. European Journal of Clinical Investigation, 38(4), 245–52.
Sevrioukova, I. F., & Poulos, T. L. (2014). Ritonavir analogues as a probe for deciphering the cytochrome P450 3A4 inhibitory mechanism. Current Topics in Medicinal Chemistry, 14(11), 1348–55.
Sewer, M. B., Koop, D. R., & Morgan, E. T. (1996). Endotoxemia in rats is associated with induction of the P4504A subfamily and suppression of several other forms of cytochrome P450. Drug
Metabolism and Disposition: The Biological Fate of Chemicals, 24(4), 401–7.
Shen, W., Kamendulis, L. M., Ray, S. D., & Corcoran, G. B. (1991). Acetaminophen-induced cytotoxicity in cultured mouse hepatocytes: correlation of nuclear Ca2+ accumulation and early DNA fragmentation with cell death. Toxicology and Applied Pharmacology, 111(2), 242–54.
Shi, X., Li, J., Zou, X., Greggain, J., Rødkær, S. V, Færgeman, N. J., … Watts, J. L. (2013). Regulation of lipid droplet size and phospholipid composition by stearoyl-CoA desaturase. Journal of Lipid
Research, 54(9), 2504–14.
Shi, X.-J., Xu, H.-B., Ji, W.-B., Liang, Y.-R., Duan, W.-D., He, L., … Zhao, Z.-M. (2011). Efficacy of liver transplantation for acute hepatic failure: a single-center experience. Hepatobiliary & Pancreatic
Diseases International : HBPD INT, 10(4), 369–73.
Shimada, T., Yamazaki, H., Mimura, M., Inui, Y., & Guengerich, F. P. (1994). Interindividual variations in human liver cytochrome P-450 enzymes involved in the oxidation of drugs, carcinogens and toxic chemicals: studies with liver microsomes of 30 Japanese and 30 Caucasians. The Journal of
Pharmacology and Experimental Therapeutics, 270(1), 414–23.
221
Shimojo, N., Ishizaki, T., Imaoka, S., Funae, Y., Fujii, S., & Okuda, K. (1993). Changes in amounts of cytochrome P450 isozymes and levels of catalytic activities in hepatic and renal microsomes of rats with streptozocin-induced diabetes. Biochemical Pharmacology, 46(4), 621–7.
Shinohara, M., Ybanez, M. D., Win, S., Than, T. A., Jain, S., Gaarde, W. A., … Kaplowitz, N. (2010). Silencing glycogen synthase kinase-3beta inhibits acetaminophen hepatotoxicity and attenuates JNK activation and loss of glutamate cysteine ligase and myeloid cell leukemia sequence 1. The
Journal of Biological Chemistry, 285(11), 8244–55.
Shou, M., Lu, T., Krausz, K. W., Sai, Y., Yang, T., Korzekwa, K. R., … Gelboin, H. V. (2000). Use of inhibitory monoclonal antibodies to assess the contribution of cytochromes P450 to human drug metabolism. European Journal of Pharmacology, 394(2-3), 199–209.
Shukla, U., Tumma, N., Gratsch, T., Dombkowski, A., & Novak, R. F. (2013). Insights into insulin-mediated regulation of CYP2E1: miR-132/-212 targeting of CYP2E1 and role of phosphatidylinositol 3-kinase, Akt (protein kinase B), mammalian target of rapamycin signaling in regulating miR-132/-212 and miR-122/-181a expression in pri. Drug Metabolism and
Disposition: The Biological Fate of Chemicals, 41(10), 1769–77.
Sidorik, L., Kyyamova, R., Bobyk, V., Kapustian, L., Rozhko, O., Vigontina, O., … Chaschin, N. A. (2005). Molecular chaperone, HSP60, and cytochrome P450 2E1 co-expression in dilated cardiomyopathy. Cell Biology International, 29(1), 51–5.
Simi, A., & Ingelman-Sundberg, M. (1999). Post-translational inhibition of cytochrome P-450 2E1 expression by chlomethiazole in Fao hepatoma cells. The Journal of Pharmacology and
Experimental Therapeutics, 289(2), 847–52.
Sindhu, R. K., Koo, J.-R., Sindhu, K. K., Ehdaie, A., Farmand, F., & Roberts, C. K. (2006). Differential regulation of hepatic cytochrome P450 monooxygenases in streptozotocin-induced diabetic rats. Free Radical Research, 40(9), 921–8.
Singh, R., Wang, Y., Schattenberg, J. M., Xiang, Y., & Czaja, M. J. (2009). Chronic oxidative stress sensitizes hepatocytes to death from 4-hydroxynonenal by JNK/c-Jun overactivation. American
Journal of Physiology. Gastrointestinal and Liver Physiology, 297(5), G907–17.
Smagris, E., BasuRay, S., Li, J., Huang, Y., Lai, K. V., Gromada, J., … Hobbs, H. H. (2015). Pnpla3I148M knockin mice accumulate PNPLA3 on lipid droplets and develop hepatic steatosis. Hepatology, 61(1), 108–118.
Smith, B. W., & Adams, L. A. (2011). Non-alcoholic fatty liver disease. Critical Reviews in Clinical
Laboratory Sciences, 48(3), 97–113.
Söderberg, C., Marmur, J., Eckes, K., Glaumann, H., Sällberg, M., … Hultcrantz, R. (2011). Microvesicular fat, inter cellular adhesion molecule-1 and regulatory T-lymphocytes are of importance for the inflammatory process in livers with non-alcoholic steatohepatitis. APMIS, 119(7), 412–420.
Somanawat, K., Thong-Ngam, D., & Klaikeaw, N. (2013). Curcumin attenuated paracetamol overdose induced hepatitis. World Journal of Gastroenterology : WJG, 19(12), 1962–7.
222
Song, B. J. (1996). Ethanol-inducible cytochrome P450 (CYP2E1): biochemistry, molecular biology and clinical relevance: 1996 update. Alcoholism, Clinical and Experimental Research, 20(8 Suppl), 138A–146A.
Song, B. J., Veech, R. L., Park, S. S., Gelboin, H. V, & Gonzalez, F. J. (1989). Induction of rat hepatic N-nitrosodimethylamine demethylase by acetone is due to protein stabilization. The Journal of
Biological Chemistry, 264(6), 3568–72.
Song, M., Choi, J.-Y., Yang, J. J., Sung, H., Lee, Y., Lee, H.-W., … Kang, D. (2015). Obesity at adolescence and gastric cancer risk. Cancer Causes & Control : CCC, 26(2), 247–56.
Stamper, B. D., Mohar, I., Kavanagh, T. J., & Nelson, S. D. (2011). Proteomic analysis of acetaminophen-induced changes in mitochondrial protein expression using spectral counting. Chemical Research in Toxicology, 24(4), 549–58.
Starley, B. Q., Calcagno, C. J., & Harrison, S. A. (2010). Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology (Baltimore, Md.), 51(5), 1820–32.
Stine, J. G., & Lewis, J. H. (2011). Drug-induced liver injury: a summary of recent advances. Expert
Opinion on Drug Metabolism & Toxicology, 7(7), 875–90. doi:10.1517/17425255.2011.577415
Stio, M., Iantomasi, T., Favilli, F., Marraccini, P., Lunghi, B., Vincenzini, M. T., & Treves, C. (1994). Glutathione metabolism in heart and liver of the aging rat. Biochemistry and Cell Biology =
Biochimie et Biologie Cellulaire, 72(1-2), 58–61.
Stojsavljević, S., Gomerčić Palčić, M., Virović Jukić, L., Smirčić Duvnjak, L., & Duvnjak, M. (2014). Adipokines and proinflammatory cytokines, the key mediators in the pathogenesis of nonalcoholic fatty liver disease. World Journal of Gastroenterology : WJG, 20(48), 18070–18091.
Streeter, A. J., Dahlin, D. C., Nelson, S. D., & Baillie, T. A. (1984). The covalent binding of acetaminophen to protein. Evidence for cysteine residues as major sites of arylation in vitro. Chemico-Biological Interactions, 48(3), 349–66.
Stuart, B., Lloyd, J., Zhao, L., & Kamal-Bahl, S. (2008). Obesity, disease burden, and prescription spending by community-dwelling Medicare beneficiaries. Current Medical Research and
Opinion, 24(8), 2377–87.
Su, G. M., Sefton, R. M., & Murray, M. (1999). Down-regulation of rat hepatic microsomal cytochromes P-450 in microvesicular steatosis induced by orotic acid. The Journal of
Pharmacology and Experimental Therapeutics, 291(3), 953–9.
Sugatani, J., Wada, T., Osabe, M., Yamakawa, K., Yoshinari, K., & Miwa, M. (2006). Dietary inulin alleviates hepatic steatosis and xenobiotics-induced liver injury in rats fed a high-fat and high-sucrose diet: association with the suppression of hepatic cytochrome P450 and hepatocyte nuclear factor 4alpha expression. Drug Metabolism and Disposition: The Biological Fate of
Chemicals, 34(10), 1677–87.
223
Sung, M., Kim, I., Park, M., Whang, Y., & Lee, M. (2004). Differential effects of dietary fatty acids on the regulation of CYP2E1 and protein kinase C in human hepatoma HepG2 cells. Journal of
Medicinal Food, 7(2), 197–203.
Szentandrássy, N., Pérez-Bido, M. R., Alonzo, E., Negretti, N., & O’Neill, S. C. (2007). Protein kinase A is activated by the n-3 polyunsaturated fatty acid eicosapentaenoic acid in rat ventricular muscle. The Journal of Physiology, 582(Pt 1), 349–58.
Takagi, S., Nakajima, M., Mohri, T., & Yokoi, T. (2008). Post-transcriptional regulation of human pregnane X receptor by micro-RNA affects the expression of cytochrome P450 3A4. The Journal
of Biological Chemistry, 283(15), 9674–80.
Takahashi, K., Oda, Y., Toyoda, Y., Fukami, T., Yokoi, T., & Nakajima, M. (2014). Regulation of cytochrome b5 expression by miR-223 in human liver: effects on cytochrome P450 activities. Pharmaceutical Research, 31(3), 780–94.
Takaya, N., Suzuki, S., Kuwazaki, S., Shoun, H., Maruo, F., Yamaguchi, M., & Takeo, K. (1999). Cytochrome p450nor, a novel class of mitochondrial cytochrome P450 involved in nitrate respiration in the fungus Fusarium oxysporum. Archives of Biochemistry and Biophysics, 372(2), 340–6.
Tamura, Y., Tanaka, Y., Sato, F., Choi, J. B., Watada, H., Niwa, M., … Kawamori, R. (2005). Effects of diet and exercise on muscle and liver intracellular lipid contents and insulin sensitivity in type 2 diabetic patients. The Journal of Clinical Endocrinology and Metabolism, 90(6), 3191–6.
Tanaka, E., Terada, M., & Misawa, S. (2000). Cytochrome P450 2E1: its clinical and toxicological role. Journal of Clinical Pharmacy and Therapeutics, 25(3), 165–75.
Tandra, S., Yeh, M. M., Brunt, E. M., Vuppalanchi, R., Cummings, O. W., Ünalp-Arida, A., … Chalasani, N. (2011). Presence and significance of microvesicular steatosis in nonalcoholic fatty liver disease. Journal of Hepatology, 55(3), 654–659.
Tarantino, G., Conca, P., Basile, V., Gentile, A., Capone, D., Polichetti, G., & Leo, E. (2007). A prospective study of acute drug-induced liver injury in patients suffering from non-alcoholic fatty liver disease. Hepatology Research : The Official Journal of the Japan Society of
Hepatology, 37(6), 410–5.
Tarantino, G., Conca, P., Coppola, A., Vecchione, R., & Di Minno, G. (2007). Serum concentrations of the tissue polypeptide specific antigen in patients suffering from non-alcoholic steatohepatitis. European Journal of Clinical Investigation, 37(1), 48–53.
Teschke, R., Stutz, G., & Strohmeyer, G. (1979). Increased paracetamol-induced hepatotoxicity after chronic alcohol consumption. Biochemical and Biophysical Research Communications, 91(1), 368–74.
Thomas, M., Burk, O., Klumpp, B., Kandel, B. A., Damm, G., Weiss, T. S., … Zanger, U. M. (2013). Direct transcriptional regulation of human hepatic cytochrome P450 3A4 (CYP3A4) by peroxisome proliferator-activated receptor alpha (PPARα). Molecular Pharmacology, 83(3), 709–18.
224
Thomson, J. S., & Prescott, L. F. (1966). Liver damage and impaired glucose tolerance after paracetamol overdosage. British Medical Journal, 2(5512), 506–7.
Thummel, K. E., Lee, C. A., Kunze, K. L., Nelson, S. D., & Slattery, J. T. (1993). Oxidation of acetaminophen to N-acetyl-p-aminobenzoquinone imine by human CYP3A4. Biochemical
Pharmacology, 45(8), 1563–9.
Tilg, H., & Moschen, A. R. (2010). Evolution of inflammation in nonalcoholic fatty liver disease: the multiple parallel hits hypothesis. Hepatology (Baltimore, Md.), 52(5), 1836–46.
Timsit, Y. E., & Negishi, M. (2007). CAR and PXR: the xenobiotic-sensing receptors. Steroids, 72(3), 231–46. doi:10.1016/j.steroids.2006.12.006
Tirmenstein, M. A., & Nelson, S. D. (1989). Subcellular binding and effects on calcium homeostasis produced by acetaminophen and a nonhepatotoxic regioisomer, 3’-hydroxyacetanilide, in mouse liver. The Journal of Biological Chemistry, 264(17), 9814–9.
Tirosh, O., Ilan, E., Anavi, S., Ramadori, G., & Madar, Z. (2009). Nutritional lipid-induced oxidative stress leads to mitochondrial dysfunction followed by necrotic death in FaO hepatocytes. Nutrition (Burbank, Los Angeles County, Calif.), 25(2), 200–8.
Tjølsen, A., Lund, A., & Hole, K. (1991). Antinociceptive effect of paracetamol in rats is partly dependent on spinal serotonergic systems. European Journal of Pharmacology, 193(2), 193–201.
Tobwala, S., Khayyat, A., Fan, W., & Ercal, N. (2015). Comparative evaluation of N-acetylcysteine and N-acetylcysteineamide in acetaminophen-induced hepatotoxicity in human hepatoma HepaRG cells. Experimental Biology and Medicine (Maywood, N.J.), 240(2), 261–72.
Toes, M. J., Jones, A. L., & Prescott, L. (2005). Drug interactions with paracetamol. American Journal
of Therapeutics, 12(1), 56–66.
Tolson, J. K., Dix, D. J., Voellmy, R. W., & Roberts, S. M. (2006). Increased hepatotoxicity of acetaminophen in Hsp70i knockout mice. Toxicology and Applied Pharmacology, 210(1-2), 157–62.
Trak-Smayra, V., Paradis, V., Massart, J., Nasser, S., Jebara, V., & Fromenty, B. (2011). Pathology of the liver in obese and diabetic ob/ob and db/db mice fed a standard or high-calorie diet. International Journal of Experimental Pathology, 92(6), 413–21.
Trasande, L., & Chatterjee, S. (2009). The impact of obesity on health service utilization and costs in childhood. Obesity (Silver Spring, Md.), 17(9), 1749–54.
Truong, N.-T., Moncion, A., Barouki, R., Beaune, P., & de Waziers, I. (2005). Regulatory sequence responsible for insulin destabilization of cytochrome P450 2B1 (CYP2B1) mRNA. The
Biochemical Journal, 388(Pt 1), 227–35.
Tukey, R. H., & Strassburg, C. P. (2000). Human UDP-glucuronosyltransferases: metabolism, expression, and disease. Annual Review of Pharmacology and Toxicology, 40, 581–616.
225
Uehara, T., Kosyk, O., Jeannot, E., Bradford, B. U., Tech, K., Macdonald, J. M., … Rusyn, I. (2013). Acetaminophen-induced acute liver injury in HCV transgenic mice. Toxicology and Applied
Pharmacology, 266(2), 224–32.
Umeno, M., McBride, O. W., Yang, C. S., Gelboin, H. V, & Gonzalez, F. J. (1988). Human ethanol-inducible P450IIE1: complete gene sequence, promoter characterization, chromosome mapping, and cDNA-directed expression. Biochemistry, 27(25), 9006–13.
Uno, T., & Yasui-Furukori, N. (2006). Effect of grapefruit juice in relation to human pharmacokinetic study. Current Clinical Pharmacology, 1(2), 157–61.
Upadhya, S. C., Tirumalai, P. S., Boyd, M. R., Mori, T., & Ravindranath, V. (2000). Cytochrome P4502E (CYP2E) in brain: constitutive expression, induction by ethanol and localization by fluorescence in situ hybridization. Archives of Biochemistry and Biophysics, 373(1), 23–34.
Van der Marel, C. D., Anderson, B. J., van Lingen, R. A., Holford, N. H. G., Pluim, M. A. L., Jansman, F. G. A., … Tibboel, D. (2003). Paracetamol and metabolite pharmacokinetics in infants. European
Journal of Clinical Pharmacology, 59(3), 243–51.
Varela, N. M., Quiñones, L. A., Orellana, M., Poniachik, J., Csendes, A., Smok, G., … Videla, L. A. (2008). Study of cytochrome P450 2E1 and its allele variants in liver injury of nondiabetic, nonalcoholic steatohepatitis obese women. Biological Research, 41(1), 81–92.
Vega, G. L., Chandalia, M., Szczepaniak, L. S., & Grundy, S. M. (2007). Metabolic correlates of nonalcoholic fatty liver in women and men. Hepatology (Baltimore, Md.), 46(3), 716–22.
Verrijken, A., Beckers, S., Francque, S., Hilden, H., Caron, S., Zegers, D., … Van Gaal, L. (2013). A gene variant of PNPLA3, but not of APOC3, is associated with histological parameters of NAFLD in an obese population. Obesity (Silver Spring, Md.), 21(10), 2138–45.
Vesell, E. S., Seaton, T. D., & A-Rahim, Y. I. (1995). Studies on interindividual variations of CYP2E1 using chlorzoxazone as an in vivo probe. Pharmacogenetics, 5(1), 53–7.
Vidali, M., Occhino, G., Ivaldi, A., Serino, R., Moia, S., Alchera, E., … Albano, E. (2007). Detection of auto-antibodies against cytochrome P4502E1 (CYP2E1) in chronic hepatitis C. Journal of
Hepatology, 46(4), 605–12.
Videla, L. A., Rodrigo, R., Orellana, M., Fernandez, V., Tapia, G., Quiñones, L., … Poniachik, J. (2004). Oxidative stress-related parameters in the liver of non-alcoholic fatty liver disease patients. Clinical Science (London, England : 1979), 106(3), 261–8.
Villa, A., Cochet, A., & Guyodo, G. (2008). [Poison episodes reported to French poison control centers in 2006]. La Revue Du Praticien, 58(8), 825–31.
Vornoli, A., Pozzo, L., Della Croce, C. M., Gervasi, P. G., & Longo, V. (2014). Drug metabolism enzymes in a steatotic model of rat treated with a high fat diet and a low dose of streptozotocin. Food
and Chemical Toxicology : An International Journal Published for the British Industrial Biological
Research Association, 70, 54–60.
226
Wahlang, B., Beier, J. I., Clair, H. B., Bellis-Jones, H. J., Falkner, K. C., McClain, C. J., & Cave, M. C. (2013). Toxicant-associated steatohepatitis. Toxicologic Pathology, 41(2), 343–60.
Walker, R. M., Racz, W. J., & McElligott, T. F. (1983). Scanning electron microscopic examination of acetaminophen-induced hepatotoxicity and congestion in mice. The American Journal of
Pathology, 113(3), 321–30.
Wang, C., Li, H., Meng, Q., Du, Y., Xiao, F., Zhang, Q., … Guo, F. (2014). ATF4 deficiency protects hepatocytes from oxidative stress via inhibiting CYP2E1 expression. Journal of Cellular and
Molecular Medicine, 18(1), 80–90.
Wang, J., Hu, Y., Nekvindova, J., Ingelman-Sundberg, M., & Neve, E. P. A. (2010). IL-4-mediated transcriptional regulation of human CYP2E1 by two independent signaling pathways. Biochemical Pharmacology, 80(10), 1592–600.
Wang, K., Zhang, S., Marzolf, B., Troisch, P., Brightman, A., Hu, Z., … Galas, D. J. (2009). Circulating microRNAs, potential biomarkers for drug-induced liver injury. Proceedings of the National
Academy of Sciences of the United States of America, 106(11), 4402–7.
Wang, Z., Hall, S. D., Maya, J. F., Li, L., Asghar, A., & Gorski, J. C. (2003). Diabetes mellitus increases the in vivo activity of cytochrome P450 2E1 in humans. British Journal of Clinical Pharmacology, 55(1), 77–85.
Waring, W. S., Stephen, A. F., Malkowska, A. M., & Robinson, O. D. G. (2008). Acute ethanol coingestion confers a lower risk of hepatotoxicity after deliberate acetaminophen overdose. Academic Emergency Medicine : Official Journal of the Society for Academic Emergency
Medicine, 15(1), 54–8.
Watelet, J., Laurent, V., Bressenot, A., Bronowicki, J.-P., Larrey, D., & Peyrin-Biroulet, L. (2007). Toxicity of chronic paracetamol ingestion. Alimentary Pharmacology & Therapeutics, 26(11-12), 1543–4; author reply 1545–6.
Watkins, P. B., Kaplowitz, N., Slattery, J. T., Colonese, C. R., Colucci, S. V, Stewart, P. W., & Harris, S. C. (2006). Aminotransferase elevations in healthy adults receiving 4 grams of acetaminophen daily: a randomized controlled trial. JAMA, 296(1), 87–93.
Waxman, D. J., & Holloway, M. G. (2009). Sex differences in the expression of hepatic drug metabolizing enzymes. Molecular Pharmacology, 76(2), 215–28.
Wei, Z., Jiang, S., Zhang, Y., Wang, X., Peng, X., Meng, C., … Xing, Q. (2014). The effect of microRNAs in the regulation of human CYP3A4: a systematic study using a mathematical model. Scientific
Reports, 4, 4283.
Weis, M., Kass, G. E., Orrenius, S., & Moldéus, P. (1992). N-acetyl-p-benzoquinone imine induces Ca2+ release from mitochondria by stimulating pyridine nucleotide hydrolysis. The Journal of
Biological Chemistry, 267(2), 804–9.
227
Weltman, M. D., Farrell, G. C., Hall, P., Ingelman-Sundberg, M., & Liddle, C. (1998). Hepatic cytochrome P450 2E1 is increased in patients with nonalcoholic steatohepatitis. Hepatology
(Baltimore, Md.), 27(1), 128–33.
Wendel, A., & Feuerstein, S. (1981). Drug-induced lipid peroxidation in mice--I. Modulation by monooxygenase activity, glutathione and selenium status. Biochemical Pharmacology, 30(18), 2513–20.
Wendel, A., Feuerstein, S., & Konz, K.-H. (1979). Acute paracetamol intoxication of starved mice leads to lipid peroxidation in vivo. Biochemical Pharmacology, 28(13), 2051–2055.
Wendel, A., Jaeschke, H., & Gloger, M. (1982). Drug-induced lipid peroxidation in mice--II. Protection against paracetamol-induced liver necrosis by intravenous liposomally entrapped glutathione. Biochemical Pharmacology, 31(22), 3601–5.
Whitcomb, D. C., & Block, G. D. (1994). Association of acetaminophen hepatotoxicity with fasting and ethanol use. JAMA, 272(23), 1845–50.
Wieckowska, A., McCullough, A. J., & Feldstein, A. E. (2007). Noninvasive diagnosis and monitoring of nonalcoholic steatohepatitis: present and future. Hepatology (Baltimore, Md.), 46(2), 582–9.
Williams, C. D., Koerner, M. R., Lampe, J. N., Farhood, A., & Jaeschke, H. (2011). Mouse strain-dependent caspase activation during acetaminophen hepatotoxicity does not result in apoptosis or modulation of inflammation. Toxicology and Applied Pharmacology, 257(3), 449–58.
Win, S., Than, T. A., Han, D., Petrovic, L. M., & Kaplowitz, N. (2011). c-Jun N-terminal kinase (JNK)-dependent acute liver injury from acetaminophen or tumor necrosis factor (TNF) requires mitochondrial Sab protein expression in mice. The Journal of Biological Chemistry, 286(40), 35071–8.
Winnike, J. H., Li, Z., Wright, F. A., Macdonald, J. M., O’Connell, T. M., & Watkins, P. B. (2010). Use of pharmaco-metabonomics for early prediction of acetaminophen-induced hepatotoxicity in humans. Clinical Pharmacology and Therapeutics, 88(1), 45–51.
Winters, D. K., & Cederbaum, A. I. (1992). Time course characterization of the induction of cytochrome P-450 2E1 by pyrazole and 4-methylpyrazole. Biochimica et Biophysica Acta, 1117(1), 15–24.
Wolf, K. K., Wood, S. G., Allard, J. L., Hunt, J. A., Gorman, N., Walton-Strong, B. W., … Sinclair, J. F. (2007). Role of CYP3A and CYP2E1 in alcohol-mediated increases in acetaminophen hepatotoxicity: comparison of wild-type and Cyp2e1(-/-) mice. Drug Metabolism and
Disposition: The Biological Fate of Chemicals, 35(7), 1223–31.
Woodcroft, K. J., Hafner, M. S., & Novak, R. F. (2002). Insulin signaling in the transcriptional and posttranscriptional regulation of CYP2E1 expression. Hepatology (Baltimore, Md.), 35(2), 263–73.
228
Woodcroft, K. J., & Novak, R. F. (1997). Insulin effects on CYP2E1, 2B, 3A, and 4A expression in primary cultured rat hepatocytes. Chemico-Biological Interactions, 107(1-2), 75–91.
Woodcroft, K. J., & Novak, R. F. (1999a). Insulin differentially affects xenobiotic-enhanced, cytochrome P-450 (CYP)2E1, CYP2B, CYP3A, and CYP4A expression in primary cultured rat hepatocytes. The Journal of Pharmacology and Experimental Therapeutics, 289(2), 1121–7.
Woodcroft, K. J., & Novak, R. F. (1999b). The role of phosphatidylinositol 3-kinase, Src kinase, and protein kinase A signaling pathways in insulin and glucagon regulation of CYP2E1 expression. Biochemical and Biophysical Research Communications, 266(2), 304–7.
Wrighton, S. A., Ring, B. J., Watkins, P. B., & VandenBranden, M. (1989). Identification of a polymorphically expressed member of the human cytochrome P-450III family. Molecular
Pharmacology, 36(1), 97–105.
Wu, D., & Cederbaum, A. I. (1992). Presence of functionally active cytochrome P-450IIE1 in the plasma membrane of rat hepatocytes. Hepatology (Baltimore, Md.), 15(3), 515–24.
Wu, D., & Cederbaum, A. I. (2008). Alcohol. (L. E. Nagy, Ed.)Methods in molecular biology (Clifton,
N.J.) (Vol. 447, pp. 137–50). Totowa, NJ: Humana Press.
Wu, D., Wang, X., Zhou, R., & Cederbaum, A. (2010). CYP2E1 enhances ethanol-induced lipid accumulation but impairs autophagy in HepG2 E47 cells. Biochemical and Biophysical Research
Communications, 402(1), 116–22.
Wu, D., Wang, X., Zhou, R., Yang, L., & Cederbaum, A. I. (2012). Alcohol steatosis and cytotoxicity: the role of cytochrome P4502E1 and autophagy. Free Radical Biology & Medicine, 53(6), 1346–57.
Xie, Y., McGill, M. R., Dorko, K., Kumer, S. C., Schmitt, T. M., Forster, J., & Jaeschke, H. (2014). Mechanisms of acetaminophen-induced cell death in primary human hepatocytes. Toxicology
and Applied Pharmacology, 279(3), 266–74.
Xu, J., Kulkarni, S. R., Li, L., & Slitt, A. L. (2012). UDP-glucuronosyltransferase expression in mouse liver is increased in obesity- and fasting-induced steatosis. Drug Metabolism and Disposition:
The Biological Fate of Chemicals, 40(2), 259–66.
Xu, J., Lai, K. K. Y., Verlinsky, A., Lugea, A., French, S. W., Cooper, M. P., … Tsukamoto, H. (2011). Synergistic steatohepatitis by moderate obesity and alcohol in mice despite increased adiponectin and p-AMPK. Journal of Hepatology, 55(3), 673–82.
Xu, X., So, J.-S., Park, J.-G., & Lee, A.-H. (2013). Transcriptional control of hepatic lipid metabolism by SREBP and ChREBP. Seminars in Liver Disease, 33(4), 301–11.
Yaghi, C., Honein, K., Boujaoude, J., Slim, R., Moucari, R., & Sayegh, R. (2006). Influence of acetaminophen at therapeutic doses on surrogate markers of severity of acute viral hepatitis. Gastroentérologie Clinique et Biologique, 30(5), 763–8.
229
Yang, J., Hao, C., Yang, D., Shi, D., Song, X., Luan, X., … Yan, B. (2010). Pregnane X receptor is required for interleukin-6-mediated down-regulation of cytochrome P450 3A4 in human hepatocytes. Toxicology Letters, 197(3), 219–26.
Yeh, M. M., & Brunt, E. M. (2014). Pathological features of fatty liver disease. Gastroenterology, 147(4), 754–64.
Yoon, M. Y., Kim, S. J., Lee, B.-H., Chung, J.-H., & Kim, Y. C. (2006). Effects of dimethylsulfoxide on metabolism and toxicity of acetaminophen in mice. Biological & Pharmaceutical Bulletin, 29(8), 1618–24.
Yoshinari, K., Takagi, S., Yoshimasa, T., Sugatani, J., & Miwa, M. (2006). Hepatic CYP3A expression is attenuated in obese mice fed a high-fat diet. Pharmaceutical Research, 23(6), 1188–200.
Zaher, H., Buters, J. T., Ward, J. M., Bruno, M. K., Lucas, A. M., Stern, S. T., … Gonzalez, F. J. (1998). Protection against acetaminophen toxicity in CYP1A2 and CYP2E1 double-null mice. Toxicology
and Applied Pharmacology, 152(1), 193–9.
Zaluzny, L., Farrell, G. C., & Murray, M. (1990). Effect of genetic obesity and experimental diabetes on hepatic microsomal mixed function oxidase activities. Journal of Gastroenterology and
Hepatology, 5(3), 256–63.
Zangar, R. C., & Novak, R. F. (1997). Effects of fatty acids and ketone bodies on cytochromes P450 2B, 4A, and 2E1 expression in primary cultured rat hepatocytes. Archives of Biochemistry and
Biophysics, 337(2), 217–24.
Zanger, U. M., & Schwab, M. (2013). Cytochrome P450 enzymes in drug metabolism: regulation of gene expression, enzyme activities, and impact of genetic variation. Pharmacology &
Therapeutics, 138(1), 103–41.
Zarowitz, B. J. (2012). Analgesic warfare: acetaminophen, really? Geriatric Nursing (New York, N.Y.), 33(1), 51–3.
Zhao, L., & Pickering, G. (2011). Paracetamol metabolism and related genetic differences. Drug
Metabolism Reviews, 43(1), 41–52.
Zhao, P., Kalhorn, T. F., & Slattery, J. T. (2002). Selective mitochondrial glutathione depletion by ethanol enhances acetaminophen toxicity in rat liver. Hepatology (Baltimore, Md.), 36(2), 326–35.
Zhukov, A., & Ingelman-Sundberg, M. (1999). Relationship between cytochrome P450 catalytic cycling and stability: fast degradation of ethanol-inducible cytochrome P450 2E1 (CYP2E1) in hepatoma cells is abolished by inactivation of its electron donor NADPH-cytochrome P450 reductase. The Biochemical Journal, 340 ( Pt 2, 453–8.
Zimmerman, H. J., & Maddrey, W. C. (1995). Acetaminophen (paracetamol) hepatotoxicity with regular intake of alcohol: analysis of instances of therapeutic misadventure. Hepatology
(Baltimore, Md.), 22(3), 767–73.
230
Zong, H., Armoni, M., Harel, C., Karnieli, E., & Pessin, J. E. (2012). Cytochrome P-450 CYP2E1 knockout mice are protected against high-fat diet-induced obesity and insulin resistance. American
Journal of Physiology. Endocrinology and Metabolism, 302(5), E532–9.
Zou, Y., Li, J., Lu, C., Wang, J., Ge, J., Huang, Y., … Wang, Y. (2006). High-fat emulsion-induced rat model of nonalcoholic steatohepatitis. Life Sciences, 79(11), 1100–7.
Résumé
L'obésité et les maladies du foie associées (NAFLD) augmentent le risque et la sévérité de l’hépatotoxicité induite par
certains xénobiotiques, mais les mécanismes impliqués sont encore mal compris. Pour l'éthanol et le paracétamol (APAP),
le rôle du cytochrome P450 2E1 (CYP2E1) hépatique est suspecté car l'activité de cette enzyme est augmentée au cours
de ces pathologies dysmétaboliques. Le 1er
objectif de notre travail expérimental a été de mettre au point un modèle
cellulaire de NAFLD caractérisé non seulement par l'accumulation de triglycérides mais aussi par l’augmentation de
l'activité du CYP2E1. Pour cela, des cellules humaines HepaRG différenciées ont été incubées pendant une semaine avec
de l'acide stéarique ou de l'acide oléique, en présence de 3 concentrations différentes d'insuline. Les triglycérides
cellulaires et l'expression de gènes induits au cours de la stéatose étaient similaires avec les deux acides gras. Cependant,
l'activité du CYP2E1 était significativement augmentée uniquement par le stéarate et ceci était associé à une diminution
de l'activité du CYP3A4, une autre caractéristique des NAFLD. L’activité du CYP2E1 dans les cellules HepaRG était réduite
par l'insuline d'une manière concentration-dépendante et cet effet était reproduit sur des hépatocytes humains en
culture primaire. Ainsi, l'activité du CYP2E1 était la plus élevée dans les cellules HepaRG cultivées avec du stéarate et sans
insuline. Le 2ème
but de notre étude était ensuite d'évaluer la cytotoxicité de l’APAP sur des cellules HepaRG présentant
ou non une stéatose et une induction du CYP2E1. Des expériences avec une large gamme de concentrations d’APAP (de 1
à 20 mM) indiquaient que la perte cellulaire d'ATP et du glutathion (GSH) était presque toujours plus forte en présence de
stéarate. Dans les cellules prétraitées avec le chlorméthiazole (CMZ, un inhibiteur du CYP2E1), la moindre diminution
d’ATP était plus importante en présence de stéarate, avec de faibles (2,5 mM) ou de fortes (20 mM) concentrations
d’APAP. Cependant, en l'absence d'insuline, la moindre chute d’ATP induite par le CMZ était significativement plus forte
uniquement pour 20 mM d’APAP. Étonnamment, suite au prétraitement par le CMZ, il n'y avait pas de protection vis-à-vis
de la diminution du GSH et de la formation des adduits APAP-protéines. Enfin, les concentrations du métabolite APAP-
glucuronide étaient significativement augmentées en présence d'insuline. Ainsi, lorsqu’elle est étudiée dans des
conditions spécifiques de culture, la lignée cellulaire HepaRG semble être un modèle intéressant de NAFLD, notamment
en ce qui concerne les activités du CYP2E1 et du CYP3A4. Nos données suggèrent aussi que l’induction du CYP2E1
observée au cours des NAFLD pourrait être secondaire à l'accumulation de certains acides gras et à la présence d’une
faible signalisation insulinique dans le foie. Ainsi, ce modèle cellulaire peut être utilisé pour mettre en évidence les
principaux facteurs métaboliques et hormonaux favorisant hépatotoxicité de l’APAP chez les personnes obèses. Cette
thèse inclut également une revue de la littérature sur l’hépatotoxicité de l’APAP dans le contexte de l’obésité et des
NAFLD (Michaut et al., Liver Int 2014).
Abstract
Obesity and nonalcoholic fatty liver disease (NAFLD) are able to increase the risk and the severity of hepatotoxicity
induced by some xenobiotics including drugs, but the involved mechanisms are still poorly understood. For toxic
compounds such as ethanol and acetaminophen (APAP), a role of hepatic cytochrome P450 2E1 (CYP2E1) is suspected
since the activity of this enzyme is consistently enhanced during obesity and NAFLD. The first aim of our experimental
study was to set up a cellular model of NAFLD characterized not only by triglyceride accumulation but also by higher
CYP2E1 activity. To this end, differentiated human HepaRG cells were incubated during one week with stearic acid, or
oleic acid, in the presence of 3 different concentrations of insulin. Cellular triglycerides and the expression of lipid-
responsive genes were similar with both fatty acids. However, CYP2E1 activity was significantly increased only by stearate
and this was associated with lower CYP3A4 activity, another metabolic feature reported in NAFLD. CYP2E1 activity in
HepaRG cells was reduced by insulin in a concentration-dependent manner and this effect was reproduced in cultured
primary human hepatocytes. Hence, the highest CYP2E1 activity was observed in HepaRG cells with stearate and without
insulin. Next, the second aim of our study was to assess APAP cytotoxicity in HepaRG cells presenting or not lipid
accretion and CYP2E1 induction. Experiments with a large range of APAP concentrations (1 to 20 mM) showed that the
cellular loss of ATP and glutathione (GSH) was almost always stronger in the presence of stearic acid. In cells pretreated
with the CYP2E1 inhibitor chlormethiazole (CMZ), recovery of cellular ATP was significantly higher in the presence of
stearic acid with both low (2.5 mM) and high (20 mM) concentrations of APAP. However, in the absence of insulin, CMZ-
induced ATP recovery was significantly greater only for 20 mM of APAP. Surprisingly, there was no recovery of cellular
GSH and no reduction of APAP-protein adducts following CMZ pretreatment. Finally, levels of APAP-glucuronide were
significantly enhanced in the presence of insulin. Hence, when studied in specific conditions of culture, the HepaRG cell
line can be a valuable model of human NAFLD, especially regarding CYP2E1 and CYP3A4 activity. Our data also suggest
that higher CYP2E1 activity in NAFLD could be secondary to the hepatic accumulation of some fatty acids and to the
presence of low insulin signaling. This cellular model can be thus used to unveil the main metabolic and hormonal factors
favoring APAP hepatotoxicity in obese individuals. This thesis also includes a review on APAP hepatotoxicity in the context
of obesity and NAFLD (Michaut et al., Liver Int 2014).