RICHARD DAIGLE
ÉTUDE THÉORIQUE DE LA
STRUCTURE ET DE LA DYNAMIQUE DE
L’HÉMOGLOBINE TRONQUÉE N
DE Mycobacterium tuberculosis
Thèse présentée
à la Faculté des études supérieures et postdoctorales de l’Université Laval
dans le cadre du programme de doctorat en biochimie
pour l’obtention du grade de Philosophiae doctor (Ph. D.)
DÉPARTEMENT DE BIOCHIMIE, MICROBIOLOGIE et de BIO-INFORMATIQUE
FACULTÉ DES SCIENCES ET DE GÉNIE
UNIVERSITÉ LAVAL
QUÉBEC
2012
© Richard Daigle, 2012
i
Résumé
L’hémoglobine tronquée N de Mycobacterium tuberculosis (TrHbN) protège la respiration
aérobie de Mycobacterium bovis BCG contre l’inhibition causée par le •NO. De plus,
TrHbN catalyse efficacement la dioxygénation du •NO en NO3- (« réaction NOD »,
TrHbN-Fe2+
–O2 + •NO TrHbN-Fe3+
+ NO3-) avec une constante bimoléculaire de
745 µM-1
s-1
à 20°C. Cette haute efficacité, pratiquement limitée que par la vitesse de
diffusion du substrat, a été associée en grande partie à la présence de deux tunnels
hydrophobes visibles dans la structure de tridimensionnelle de TrHbN. L’objectif de cette
thèse s’inscrit dans ce contexte, soit l’étude de la structure et de la dynamique de TrHbN à
l’aide d’outils bio-informatiques, en particulier l’utilisation de simulations de dynamique
moléculaire.
Plusieurs simulations de dynamique moléculaire de TrHbN sous ses formes deoxy,
oxygénée et cyanomet ont été menées. Ces simulations ont permis d’étudier la dynamique
de la chaîne principale, du site actif et en particulier, celle des tunnels. Ces simulations ont
révélé que les tunnels sont dynamiques, davantage complexes que le suggère la structure
cristalline et que ceux-ci prennent place au cœur d’un repliement 2-sur-2 rigide. D’autres
simulations incluant cette fois des molécules de •NO libres ont permis de mettre en
évidence l’utilisation des tunnels de TrHbN par ceux-ci pour diffuser jusqu’au site actif.
Ces simulations ont permis de proposer plusieurs hypothèses sur les routes utilisées et sur
la diffusion des substrats du solvant vers le site actif. Pour valider ces hypothèses et pour
pousser davantage nos connaissances, d’autres simulations couplées à diverses approches
expérimentales ont été employées. D’abord, des simulations de TrHbN sous sa forme
cyanomet couplées à une étude RMN approfondie ont permis de confirmer les résultats de
DM quant à la rigidité du squelette de la protéine. De plus, ces derniers travaux ont révélé i)
des mouvements lents (µs-ms) localisés le long des hélices B et G et ii) que la région pre-A
n’est pas structurée contrairement à ce que suggère la structure cristalline. Enfin, d’autres
simulations et des travaux de cinétiques enzymatiques ont été réalisés sur des mutants avec
tunnel(s) obstrué(s). Ces travaux ont mené à des résultats démontrant que la matrice
ii
enzymatique de TrHbN est très plastique, permettant la diffusion du •NO malgré les
mutations créées. Quoique notre compréhension sur les liens entre la structure et la fonction
de TrHbN soit toujours incomplète, les travaux présentés dans cette thèse constituent un
avancement considérable des connaissances. Plusieurs de nos découvertes mènent à une
meilleure compréhension s’appliquant aux globines en général, aux protéines contenant un
ou plusieurs tunnels et enfin, sur les mécanismes de diffusion des substrats gazeux à
l’intérieur des enzymes.
iii
Abstract
The truncated hemoglobin N from Mycobacterium tuberculosis (TrHbN) protects aerobic
respiration of Mycobacterium bovis BCG cells from the inhibitory effect of •NO. In
addition, TrHbN catalyses the very rapid dioxygenation of •NO into the innocuous NO3-
ions (NOD reaction: TrHbN-Fe2+
–O2 + •NO TrHbN-Fe3+
+ NO3-) with a bimolecular
rate constant of 745 µM-1
s-1
at 20°C. This high efficiency was largely associated to the
presence of two hydrophobic tunnels visible in the 3D-structure of TrHbN. In this context,
the main goal of this thesis is to study TrHbN structure and dynamics with bioinformatics
tools, especially molecular dynamics simulations.
Several molecular dynamics simulations of TrHbN under its deoxy, oxygenated and
cyanomet forms were conducted. These simulations allowed to study dynamics of TrHbN
backbone, that of the active site and especially, that of the tunnels. As a main result, our
simulations revealed that tunnels are highly dynamics, more complex than anticipated from
the 3D-structure and that they are hosted in a very rigid two-on-two fold. Other
simulations, this time including free •NO molecules, highlighted the use of these tunnels to
reach the buried active site. These simulations allowed to propose many hypotheses
regarding the preferred routes and to propose diffusions mechanisms from the solvent to the
active site. In order to validate our hypotheses and to push further our knowledge on
TrHbN, other simulations coupled with some experimental approaches were performed.
First, simulations on TrHbN under its cyanomet form coupled with a detailed NMR
confirmed that the backbone of the protein is ridig. In addition, this work revealed i) the
presence of µs-ms motions localized along B and G helices and ii) that the pre-A region is
not structured in contrast to the alpha helice seen in the crystal structure. Finally, other
simulations along with kinetics characterizations of obstructed tunnel mutants were
conducted. As a main result, the latter work revealed that TrHbN core is quite plastic,
allowing substrate diffusion despite the presence blocking mutations. Our comprehension
on TrHbN is still incomplete, however the work presented in this thesis constitutes a
considerable progress. Moreover, the work presented herein contributes to other fields of
iv
research, especially on globins, to tunnel-containing proteins and finally, to gaseous
substrates diffusion inside proteins.
v
Avant-Propos
Cette thèse renferme quatre articles publiés dans des journaux scientifiques révisés par les
pairs et pour lesquels je suis premier ou second auteur. Leur incoporation dans cette thèse
de doctorat a été réalisée avec l’appobation des journaux scientifiques respectifs. De plus,
suit ces articles, un dernier chapitre sous la forme d’un manuscrit à être soumis pour
révision par les pairs dans une revue à définir. La contribution de chaque auteur dans la
réalisation de ces travaux ainsi que dans la rédaction est décrite ci-après.
CHAPITRE 5
Ce chapitre présente un article portant sur le rôle des résidus distaux en positions B10 et
E11 et sur l’implication d’une molécule d’eau près du fer dans la forme déoxygénée de
TrHbN. Cet article a été publié sous la référence :
Yannick H. Ouellet, Richard Daigle, Patrick Lagüe, David Dantsker, Mario Milani,
Martino Bolognesi, Joel M. Friedman, and Michel Guertin. Ligand Binding to Truncated
Hemoglobin N from Mycobacterium tuberculosisi is Strongly Modulated by the Interplay
Between the Distal Heme Pocket Residues and Internal Water, 2008, The Journal of
Biological Chemistry, vol. 283, no. 40, pp. 27270 –27278.
J’ai personnellement réalisé les travaux de dynamique moléculaire décrits dans cet article.
Pour ce qui est des travaux en laboratoire, ceux-ci ont été en majeure partie réalisés dans le
laboratoire du Dr. Michel Guertin et effectués par le Dr. Yannick Ouellet. L’équipe du Dr.
Friedman a contribué en effectuant des cinétiques de recombinaison dans des conditions de
haute viscosité. L’équipe du Dr. Martino Bolognesi a contribué à l’interprétation des
résultats via leur expertise sur la structure de TrHbN et celles des mutants à l’étude qu’ils
ont eux-mêmes résolues. J’ai participé en partie à la rédaction de l’article sous la
supervision de Dr. Michel Guertin et Dr. Patrick Lagüe, notamment sur les sections portant
sur mes travaux. La majeure partie de l’article a été rédigée par le Dr. Yannick Ouellet.
CHAPITRE 6
vi
Ce chapitre présente et discute les résultats de simulations de dynamique moléculaire de
TrHbN sous ses formes oxygénées et déoxygénées. La dynamique des tunnels de TrHbN a
été le principal aspect traité dans cet article. Il a été publié sous la référence :
Richard Daigle, Michel Guertin, and Patrick Lagüe, Structural characterization of the
tunnels of Mycobacterium tuberculosis truncated hemoglobin N from molecular dynamics
simulations, 2009, PROTEINS Structure function and bioinformatics, volume 75, pages
735-747.
J’ai effectué la totalité des travaux présentés dans cet article. J’ai rédigé l’article sous la
supervision des Dr. Michel Guertin et Dr. Patrick Lagüe.
CHAPITRE 7
Ce chapitre présente l’étude du rôle des tunnels de TrHbN, sous sa forme oxygénée, dans la
diffusion du •NO entre le site actif et le solvant. Il a été publié sous la référence :
Richard Daigle, Julie-Anne Rousseau, Michel Guertin, and Patrick Lagüe, Theoretical
Investigations of Nitric Oxide Channeling in Mycobacterium tuberculosis Truncated
Hemoglobin N, 2009, Biophysical Journal, volume 97, pages 2967–2977
J’ai réalisé la grande partie des travaux présentés dans cet article. Julie-Anne Rousseau, à
ce moment étudiante au baccalauréat en bio-informatique de l’Université Laval et stagiaire
au laboratoire du Dr. Patrick Lagüe, m’a assisté pour les calculs d’échantillonnage implicite
de ligands. Elle a en particulier aidé au démarrage de ces calculs, à leur analyse et à la
génération de figures pour l’article.
vii
CHAPITRE 8
Ce chapitre présente l’étude de la dynamique de TrHbN sous sa forme cyanomet par
résonance magnétique nucléaire et par simulations de dynamique moléculaire. Ce chapitre
est présenté sous la forme d’un manuscrit soumis et récemment accepté pour publication
dans la revue Biochemistry.
Pierre-Yves Savard, Richard Daigle, Sébastien Morin, Anne Sebilo, Fanny Meindre,
Patrick Lagüe, Stéphane M. Gagné and Michel Guertin, Structure and Dynamics of
Mycobacterium tuberculosis Truncated Hemoglobin N: Insights from NMR Spectroscopy
and Molecular Dynamics Simulations. Biochemistry 2011, volume 50, pages 11121-11130
J’ai personnellement réalisé tous les travaux de dynamique moléculaire présentés dans ce
manuscrit. Les travaux de résonance magnétique nucléaire (RMN) ont été pris en charge
par l’équipe du Dr. Stéphane Gagné. Le Dr. Pierre-Yves Savard a effectué l’ensemble des
travaux portant de l’attribution de spectres RMN et l’étude de la dynamique de la chaîne
principale de TrHbN. Ce dernier a été assisté par l’étudiante stagiaire Fanny Meindre. Le
Dr. Sébastien Morin a réalisé les travaux d’échanges d’amides dans la chaîne principale. La
construction du mutant ΔpreA, la synthèse et purification d’enzymes recombinantes et les
cinétiques enzymatiques ont été réalisées au laboratoire du Dr. Michel Guertin. Ces
derniers travaux ont été réalisés par Anne Sebilo. La rédaction de l’article a été
principalement réalisée par Pierre-Yves Savard, Sébastien Morin et par moi. Cette
rédaction s’est faite sous la supervision de Dr. Michel Guertin, Dr. Patrick Lagüe et de Dr.
Stéphane Gagné.
viii
CHAPITRE 9
Ce chapitre, rédigé en anglais, est présentée sous la forme d’un manuscrit à être
éventuellement soumis. Il contient une étude du rôle des tunnels de TrHbN par la
combinaison d’approches expérimentales et théoriques.
Richard Daigle , Anne Sebilo , Sylvain Lanouette, Julie-Anne Rousseau, Patrick Lagüe,
and Michel Guertin, Experimental and Theoretical Investigations Reveal that
Mycobacterium tuberculosis Truncated Hemoglobin N contains Multiple Diffusion Routes
to Sustain Rapid Gaseous Ligand Entry and Exit. Manuscrit en préparation.
Ces travaux ont été initialement entrepris par Sylvain Lanouette alors étudiant à la maîtrise
sous la supervision de Dr. Michel Guertin et la codirection de Dr. Patrick Lagüe. Nous
avons ensuite repris plusieurs expériences et fait murir plusieurs hypothèses découlant des
travaux de Sylvain Lanouette. J’ai personnellement réalisé la grande majorité des travaux
de dynamique moléculaire et procédé à leur analyse. Tout comme pour l’article présenté au
chapitre 7, Julie-Anne Rousseau a participé pour les calculs d’échantillonnage implicite de
ligands. La partie expérimentale a été menée au laboratoire de Dr. Michel Guertin et les
travaux ont été réalisés par la professionnelle de recherche Anne Sébilo. Moi et Michel
Guertin avons rédigé en grande partie ce manuscrit avec le support de Dr. Patrick Lagüe.
Sylvain Lanouette a également participé à la rédaction.
ix
Pour ma femme, ma fille et ceux et celles qui
m’ont toujours soutenu
x
Table des matières
Résumé ..................................................................................................................................... i
Abstract ................................................................................................................................. iii
Avant-Propos .......................................................................................................................... v
Table des matières .................................................................................................................. x
Liste des tableaux et tables .................................................................................................. xiv
Liste des figures .................................................................................................................... xv
Liste des abréviations ......................................................................................................... xvii
Chapitre 1 Introduction ........................................................................................................... 1
1.1. Contexte biologique de TrHbN ............................................................................... 1
1.1.1. Mécanismes d’infection de Mycobacterium tuberculosis .............................. 1
1.1.2. Mécanismes de résistance de Mtb ................................................................... 2
1.2. TrHbN et la superfamille des globines ................................................................... 3
1.2.1. Définition du terme globine ............................................................................ 3
1.2.2. L’hème ............................................................................................................ 4
1.2.3. Phylogénie des globines .................................................................................. 7
1.2.4. Fonctions des globines .................................................................................. 10
1.2.5. La réaction •NO-dioxygénase ....................................................................... 11
1.2.6. La cavité distale ............................................................................................ 16
1.2.7. Le repliement globine ................................................................................... 19
1.2.8. Cavités internes et tunnels ............................................................................ 22
1.3. Relation structure-fonction chez TrHbN de Mtb .................................................. 28
1.4. Organisation de la présente thèse .......................................................................... 32
Chapitre 2 Étude de la diffusion interne des substrats ......................................................... 34
2.1. Cinétiques enzymatiques de mutants .................................................................... 37
2.1.1. Cinétiques de recombinaison ........................................................................ 37
2.1.2. Cinétiques de liaison ..................................................................................... 40
2.1.3. Exemples d’applications ............................................................................... 41
2.2. Diffraction des rayons X à températures cryogéniques ........................................ 42
2.3. Cristallographie de Laue résolue en temps réel .................................................... 42
2.4. Simulations de dynamique moléculaire ................................................................ 45
Chapitre 3 Méthodologie ..................................................................................................... 47
3.1. La dynamique moléculaire .................................................................................... 47
3.1.1. Histoire de la dynamique moléculaire .......................................................... 47
3.1.2. Principes de base ........................................................................................... 49
3.1.2.1. L’énergie interne ....................................................................................... 51
3.1.2.2. L’énergie externe ...................................................................................... 52
3.1.2.3. Les méthodes de troncations ..................................................................... 53
3.1.2.4. La méthode « Particle Mesh Ewald » ....................................................... 54
3.1.2.5. Conditions périodiques aux frontières ...................................................... 54
3.1.3. Production de la trajectoire ........................................................................... 55
3.2. Simulation des protéines par dynamique moléculaire .......................................... 58
3.2.1. Préparation du système ................................................................................. 58
3.2.2. Initiation et équilibration .............................................................................. 59
3.2.3. Production et analyse de la trajectoire .......................................................... 60
xi
3.3. Étude de la dynamique des tunnels ....................................................................... 60
3.3.1. CAVER ......................................................................................................... 61
3.3.2. Échantillonnage implicite de ligand ............................................................. 62
3.3.3. L’échantillonnage amélioré de ligands ......................................................... 64
Chapitre 4 Objectifs du projet de recherche ......................................................................... 66
4.1.1. Objectif général ............................................................................................. 66
4.1.2. Objectifs spécifiques ..................................................................................... 66
Chapitre 5 Ligand Binding to Hemoglobin N from Mycobacterium tuberculosis is Strongly
Modulated by the Interplay between the Distal Heme Pocket Residues and Internal Water
.............................................................................................................................................. 68
5.1. Résumé .................................................................................................................. 68
5.2. Abstract ................................................................................................................. 69
5.3. Introduction ........................................................................................................... 69
5.4. Experimental procedures ...................................................................................... 71
5.4.1. Mutagenesis, expression and purification ..................................................... 71
5.4.2. Geminate and solvent phase recombination experiments ............................. 72
5.4.3. Molecular dynamics simulations .................................................................. 73
Systems setup ............................................................................................................ 74
5.5. Results and discussion .......................................................................................... 75
5.5.1. Kinetic data indicate that Tyr(B10) mainly contributes to the kinetic barrier
to ligand binding to TrHbN(Fe2+). – (i) O2 and CO binding to TrHbN ...................... 75
5.5.2. O2 and CO binding to TrHbN mutants ......................................................... 75
5.5.3. Geminate and solvent phase recombination ................................................. 77
5.5.4. Molecular dynamics simulations suggest that water may constitute the main
kinetic barrier to ligand binding to TrHbN(Fe2+
) ......................................................... 81
5.6. Conclusions ........................................................................................................... 83
5.7. Footnotes ............................................................................................................... 84
5.8. References ............................................................................................................. 86
Table 5.1 Kinetics constants for the reactions of TrHbN and its mutants with O2 and CO. 89
Chapitre 6 Structural characterization of the tunnels of Mycobacterium tuberculosis
truncated hemoglobin N from molecular dynamics simulations .......................................... 97
6.1. Résumé .................................................................................................................. 97
6.2. Abstract ................................................................................................................. 98
6.3. Introduction ........................................................................................................... 99
6.4. Methods .............................................................................................................. 101
6.5. Results and discussion ........................................................................................ 104
6.5.1. Active site configurations ........................................................................... 104
6.5.2. MD simulations of oxygenated TrHbN ...................................................... 104
6.5.3. MD simulations of the ferrous unliganded TrHbN ..................................... 105
6.5.4. Gln58(E11) and Phe62(E15) dynamics are linked ..................................... 105
6.5.5. Characterization of cavities and tunnels ..................................................... 107
6.6. Concluding remarks ............................................................................................ 113
6.7. Acknowledgments .............................................................................................. 114
6.8. References ........................................................................................................... 114
Chapitre 7 Theoretical Investigations of Nitric Oxide Channeling in Mycobacterium
tuberculosis Truncated Hemoglobin N ............................................................................... 131
7.1. Résumé ................................................................................................................ 131
xii
7.2. Abstract ............................................................................................................... 132
7.3. Introduction ......................................................................................................... 133
7.4. Methods .............................................................................................................. 135
7.4.1. Analysis ...................................................................................................... 135
7.4.2. Implicit ligand sampling ............................................................................. 136
7.5. Results and discussion ........................................................................................ 137
7.5.1. •NO enters the protein matrix using the ST, LT, and EHT ........................ 138
7.5.2. Diffusion through tunnels ........................................................................... 138
7.5.3. Ligand binding affinities ............................................................................. 143
7.5.4. Comparison of the different paths .............................................................. 144
7.6. Conclusion .......................................................................................................... 146
7.7. Supporting material ............................................................................................. 148
7.8. References ........................................................................................................... 148
Chapitre 8 Structure and Dynamics of Mycobacterium tuberculosis Truncated Hemoglobin
N: Insights from NMR Spectroscopy and Molecular Dynamics Simulations .................... 161
8.1. Résumé ................................................................................................................ 161
8.2. Abstract ............................................................................................................... 162
8.3. Introduction ......................................................................................................... 163
8.4. Material and methods .......................................................................................... 165
8.4.1. NMR ........................................................................................................... 165
8.4.2. Molecular dynamics simulations ................................................................ 166
8.5. Results ................................................................................................................. 168
8.5.1. NMR ........................................................................................................... 168
8.5.2. Molecular dynamics simulation and comparison with NMR results .......... 173
8.6. Discussion ........................................................................................................... 174
8.7. Conclusion .......................................................................................................... 178
8.8. Acknowledgments .............................................................................................. 179
8.9. Supporting information ....................................................................................... 179
8.10. References ........................................................................................................... 180
Chapitre 9 Experimental and Theoretical Investigations Reveal that Mycobacterium
tuberculosis Truncated Hemoglobin N contains Multiple Diffusion Routes to Sustain Rapid
Gaseous Ligand Entry and Exit. ......................................................................................... 193
9.1. Résumé ................................................................................................................ 193
9.2. Abstract ............................................................................................................... 194
9.3. Introduction ......................................................................................................... 195
9.4. Experimental procedures .................................................................................... 197
9.5. Results ................................................................................................................. 200
9.5.1. NOD reaction of TrHbN. ............................................................................ 200
9.5.2. Mutants with obstructed tunnel entrance(s) show ns geminate rebinding of
the •NO…. .................................................................................................................. 202
9.5.3. MD simulations emphasize the importance of side-chain flexibility on ligand
diffusion.. .................................................................................................................... 203
9.6. Conclusions ......................................................................................................... 208
9.7. References ........................................................................................................... 209
9.8. Footnotes ............................................................................................................. 213
Chapitre 10 Discussion ...................................................................................................... 223
10.1. Structure et dynamique de la poche distale de l’hème ........................................ 223
xiii
10.2. Structure et dynamique des tunnels de TrHbN ................................................... 225
10.3. Rôle des tunnels dans la diffusion des substrats entre le solvant et le site actif . 226
10.4. Perspective de recherche sur les relations structure-fonction des tunnels de
TrHbN.. ........................................................................................................................... 229
10.5. Routes de diffusions multiples et pertinence fonctionnelle ................................ 229
10.6. Comparaisons de TrHbN avec d’autres protéines liant des gaz et perspectives . 230
10.7. Localisation de TrHbN au niveau des membranes – nouvelles perpectives de
recherche ......................................................................................................................... 232
10.8. Conclusion .......................................................................................................... 234
Bibliographie ...................................................................................................................... 235
Annexe 1 ............................................................................................................................. 246
Matériel supplémentaire du chapitre 6 ................................................................................ 246
Annexe 2 ............................................................................................................................. 250
Matériel supplémentaire du chapitre 7 ................................................................................ 250
Annexe 3 ............................................................................................................................. 257
Matériel supplémentaire du chapitre 8 ................................................................................ 257
Annexe 4 ............................................................................................................................. 280
Matériel supplémentaire du chapitre 9 ................................................................................ 280
xiv
Liste des tableaux et tables
CHAPITRE 1
Tableau 1-1 Activité NOD chez certaines globines .............................................................. 15
Tableau 1-2 Résidus de la poche distale de certaines globines en lien avec les constantes de
liaison et de dissociation de l’O2. .................................................................................. 18
Tableau 1-3 Structures tridimensionnelles résolues chez les hémoglobines tronquées ........ 21
Tableau 1-4 Volume total interne des cavités de quelques globines .................................... 23
Tableau 1-5 Tunnels observés chez diverses protéines ........................................................ 27
CHAPITRE 5
Table 5.1 Kinetics constants for the reactions of TrHbN and its mutants with O2 and CO. 89
Table 5.2 Average minimum interatomic distances between non-hydrogen atoms and the
heme iron. ..................................................................................................................... 90
Table 5.3 . Cavity formation frequency and volume over the iron atom. ............................. 91
Table 6.1 Interatomic Distances Between Relevant Atoms From Trajectories .................. 119
Table 6.2 Distribution of the Different Rotameric Species Encountered During Simulations
for Q(E11) and F(E15) ................................................................................................ 120
Table 6.3 Tunnels Physical Properties ................................................................................ 121
Table 7.1 Calculated affinities for NO and solvent-excluded volume at tunnel entrances
detected for TrHbN and multiple polar mutant. ......................................................... 152
Table 7.2 Rotamers observed for two residues upon the absence or presence of •NO
molecule in specific cavities. ...................................................................................... 153
Table 8.1 Average R1 and R2 relaxation rates (s-1
) and {1H}-
15N NOEs at 500, 600, and 800
MHz. ........................................................................................................................... 185
Table 9.1 Kinetics constants for the NOD reactions of TrHbN and its tunnel mutants. .... 214
Table 9.2 Number of MD snapshots showing a tunnel open at its entrance from simulations
of TrHbN and the triple mutant. ................................................................................. 215
Table 9.3 Exit and entry events observed in LES simulations of the wild type and triple
mutant. ........................................................................................................................ 216
xv
Liste des figures
Figure 1.1. Structure de l’hème (protoporphyrine IX).. .......................................................... 6
Figure 1.2 Évolution et distribution des globines dans les règnes du vivant.. ........................ 9
Figure 1.3 Cycle de la réaction NOD catalysée par les globines.. ........................................ 12
Figure 1.4 Mécanisme réactionnel de la réaction NOD impliquant la rupture homolytique
du lien O-O.. ................................................................................................................. 13
Figure 1.5 Mécanisme concerté pour la réaction NOD… .................................................... 13
Figure 1.6 Comparaison des repliements globines 2-sur-2 et 3-sur-3. ................................. 20
Figure 1.7 Cavités observées dans la structure de quelques globines. ................................. 25
Figure 1.8 Structure tertiaire de TrHbN.. .............................................................................. 26
Figure 1.9 Site actif de TrHbN.. ........................................................................................... 29
Figure 1.10 Cavité distale de TrHbN sous sa forme oxygénée. ........................................... 31
Figure 1.11 Conformations alternatives de la Phe62(E15).. ................................................. 33
Figure 2.1 Modèles de diffusion des substrats chez la Mb.. ................................................. 36
Figure 2.2 Cinétiques de recombinaison hypothétiques pour une globine donnée sous sa
forme sauvage et pour un mutant. ................................................................................. 39
Figure 2.3 Échelles de temps des différents mouvements se produisant dans les protéines..
...................................................................................................................................... 44
Figure 3.1 Mouvements internes dans les molécules. .......................................................... 52
Figure 3.2. Conditions périodiques aux frontières d’un système en 2D.. ............................. 55
Figure 3.3 Algorithme de Verlet pour l’intégration de l’équation de mouvement. .............. 57
Figure 3.4 Schéma des grandes étapes de la dynamique moléculaire .................................. 58
Figure 5.1 View of the distal heme pocket and the tunnels of cyanomet-TrHbN chain B
under xenon pressure (PDB 1S56). ............................................................................... 92
Figure 5.2 Equilibrium absorption spectra of TrHbN(Fe3+
-H2O), TrHbN(Fe3+
-NO) and
TrHbN Tyr(B10)Leu/Gln(E11)Val(Fe3+
) mutant at pH 7.5. ....................................... 93
Figure 5.3 The time courses of O2 and CO recombination to TrHbN. ................................ 94
Figure 5.4 Kinetic traces showing the recombination of CO subsequent to nanosecond
photodissociation of the CO saturated derivatives of wild-type TrHbN and its distal
mutants.. ........................................................................................................................ 95
Figure 5.5 Kinetic traces illustrating the absorbance changes following photodissociation of
TrHbN(Fe3+
-NO) and Mb(Fe3+
-NO) at 23 °C.. ............................................................ 96
Figure 6.1 TrHbN structure (PDB entry 1IDR, subunit A). ............................................... 122
Figure 6.2 Active site configurations from typical MD frames for oxy-TrHbN and deoxy-
TrHbN. ........................................................................................................................ 123
Figure 6.3 Phe62(E15) χ1 as function of χ2 for oxy-TrHbN and deoxy-TrHbN…. .......... 124
Figure 6.4 Gln58(E11) and Phe62(E15) χ1 dihedral angle as function of simulation time for
oxy-TrHbN and deoxy-TrHbN ................................................................................... 125
Figure 6.5 Different snapshots of cavities in TrHbN. ......................................................... 126
Figure 6.6 Backbone 1H-
15N order parameters as function of residue sequence number
calculated from trajectories of A-TrHbN and B-TrHbN in oxy-TrHbN and deoxy-
TrHbN.. ....................................................................................................................... 127
Figure 6.7 Representation of the long , short, EH, LEH and BE tunnels. .......................... 128
Figure 6.8 Profiles generated for each tunnel leading from distal heme pocket to the bulk
solvent. ........................................................................................................................ 129
xvi
Figure 6.9 Averaged minimum radius (bottleneck) of the long and EH tunnels according to
the Phe62(E15) χ2 dihedral. ........................................................................................ 130
Figure 7.1 TrHbN structure (PDB entry 1IDR, subunit A). ............................................... 154
Figure 7.2 Time of contact between •NO molecules and TrHbN relative to the MD
simulation time.. ......................................................................................................... 156
Figure 7.3 Representative solvent-excluded volume formed over the ST entrance. ......... 157
Figure 7.4 Density probability of •NO derived from explicit MD simulations and implicit
ligand PMF for •NO inside TrHbN calculated from MD frames having the Phe62(E15)
in the M state and T state.. .......................................................................................... 158
Figure 7.5 PMF profiles for •NO diffusion in ST regardless and as function of different
Ile119(H11) rotamers.. ................................................................................................ 159
Figure 7.6 Phe62(E15) χ1 and χ2 dihedral angles as function of the simulation time. ...... 160
Figure 8.1 Structure of TrHbN displaying the four tunnels: Long tunnel (LT), Short tunnel
(ST), EH tunnel, and BE tunnel. ................................................................................. 186
Figure 8.2 Assigned 1H-
15N HSQC spectrum of TrHbN cyanomet ................................... 187
Figure 8.3 NMR raw relaxation data (R1, R2, R2/R1, NOE) at 500, 600, and 800 MHz.;
Model-free parameters (S2, Rex, and τe) for TrHbN cyanomet; Comparision of S
2
parameters obtained either from NMR or MD simulations; NMR amide exchange
data: amide exchanges rates (kex) at pH 7.5and 8.5, and free energy for the opening of
the protecting structure (ΔGHX) at pH 7.5. Molecular Dynamics data: Average
backbone ASA and Backbone amide hydrogen bond occupancy; Secondary structure
of TrHbN calculated by NMR, MD, or taken from the X-ray structure PDB 1S61B.
.................................................................................................................................... 189
Figure 9.1 TrHbN tunnel system. ....................................................................................... 217
Figure 9.2 Reaction of TrHbNFeII(O2) with one equivalent of •NO at 5 ºC, pH 9.5. ........ 218
Figure 9.3 Reaction of the FeII(O2) form of TrHbN and tunnel mutants LT/ST and
LT/ST/EHT with one equivalent of •NO at 5 ºC, pH 9.5. .......................................... 219
Figure 9.4 Kinetic traces illustrating the absorbance changes after photo-dissociation of
TrHbNFeIII
(•NO), ST-FeIII
(•NO), LT/ST-FeIII
(•NO), and LT/ST/EHT-FeIII
(•NO) at
23 °C. .......................................................................................................................... 220
Figure 9.5 PMF profiles for •NO diffusion in the different tunnels for the TrHbN and
mutant. ........................................................................................................................ 221
Figure 9.6 Typical closed and open tunnels at the surface observed for the triple mutant
protein.. ....................................................................................................................... 222
xvii
Liste des abréviations
A Alanine
Ala Alanine
Arg Arginine
Asp Aspartate
BCG Bacille de Calmette-Guerin
D Aspartate
DHP Distal heme pocket
DM Dynamique moléculaire
E Glutamate
ÉIL Échantillonnage implicite de ligand
F Phénylalanine
Gln Glutamine
Glu Glutamate
K Kelvin
H Histidine
Hb Hémoglobine
His Histidine
I Isoleucine
Ile Isoleucine
L Leucine
Leu Leucine
OMS Organisation Mondiale de la Santé
Phe Phénylalanine
P Proline
ms Milliseconde
Mtb Mycobacterium tuberculosis
ns nanoseconde
PFM Potentiel de force moyen
ps picoseconde
xviii
Q Glutamine
R Arginine
RMN Résonance magnétique nucléaire
S Sérine
Ser Sérine
T Thréonine
Thr Thréonine
TrHb Hémoglobine tronquée
TrHbN Hémoglobine tronquée N
Trp Tryptophane
Tyr Tyrosine
µs microseconde
V Valine
Val Valine
VIH Virus de l’immunodéficience humaine
W Tryptophane
Y Tyrosine
1
1.
Chapitre 1
Introduction
1.1. Contexte biologique de TrHbN
Selon le plus récent rapport de l’Organisation mondiale de la santé (OMS), près d’une
personne sur trois sur la planète est porteuse du germe responsable de la tuberculose, c’est-
à-dire la bactérie Mycobacterium tuberculosis (Mtb) [1]. Chez la plupart des personnes
infectées, Mtb est contraint à un stade de dormance par le système immunitaire. Environ
10 % des personnes infectées développeront une pathologie au cours de leur vie et environ
2 millions de personnes en meurent chaque année [1]. Le nombre de nouveaux cas de
tuberculose déclarés chaque année est stable, soit 8.9 millions en 2004 [2] et 9.4 millions en
2008 [1] suivant le rythme d’accroissement de la population mondiale [1]. Parmi les
personnes décédant de la tuberculose, près du tiers sont également porteuses du virus de
l’immunodéficience humaine (VIH). La co-infection Mtb-VIH augmente de 20 à 40 fois le
risque de développement de la tuberculose [1]. Enfin, environ 5% des nouveaux cas de
tuberculose sont causés par une souche Mtb multirésistante aux traitements de première
ligne (antibiotiques rifampicine et isoniazide) ce qui amène une nouvelle inquiétude [3, 4].
1.1.1. Mécanismes d’infection de Mycobacterium tuberculosis
La tuberculose est une maladie complexe et les relations hôte-pathogène sont encore
aujourd’hui partiellement comprises. L’infection se produit généralement chez les
personnes exposées à répétitions à des gens infectés par Mtb et générant des expectorations
via leur toux [5]. Les bacilles sont ainsi transmis par l’inhalation d`aérosols causés par la
toux de personnes malades [5]. Chez les personnes en santé, les bacilles inhalés sont
2
rapidement pris en charge par le système immunitaire de l’hôte [5]. Cette réponse
immunitaire débute par le recrutement de macrophages alvéolaires qui phagocytent les
bacilles. Un premier mécanisme de résistance de Mtb survient alors par l’arrêt de la
maturation du phagosome et par l’évitement de la fusion avec la membrane lysosomale [6-
8]. À ce stade, Mtb prolifère à l’intérieur du macrophage [5]. En réponse, les macrophages
infectés sécrètent des cytokines recrutant d’autres cellules de l’immunité [9-11]. Ce second
mécanisme de défense permet d’empêcher la dissémination de Mtb à tout le poumon et aux
autres tissus. Ces régions isolées portent le nom de granulomes. Il est proposé que les
conditions régnant à l’intérieur des granulomes soient hostiles à Mtb. L’hypoxie, la
présence de molécules réactives dérivées de l’oxygène (ion superoxyde) et de l’azote
(oxyde nitrique, peroxynitrite) et la présence d’acides gras libres seraient les conditions
auxquelles Mtb aurait à faire face [9, 12-15]. À l’intérieur de cet environnement hostile,
Mtb survit, mais est latent. Ce stade de l’infection peut perdurer pendant de nombreuses
années et est habituellement asymptomatique [5]. Durant cette longue période, une lutte
entre le système immunitaire et Mtb a lieu au cœur des granulomes [16]. Avec le temps, les
granulomes peuvent se calcifier emprisonnant les bacilles de manière durable. Dans
d’autres cas, les granulomes se liquéfient, phénomène également appelé la caséation, ce qui
permet à nouveau la prolifération bactérienne dans le poumon [5]. L’infection peut
également s’étendre à d’autres tissus et on parle alors de tuberculose disséminée. Ces
derniers cas se produisent généralement chez les personnes faibles, âgées, stressées, mal
nourries, immunodéprimées ou infectées par le VIH [5].
1.1.2. Mécanismes de résistance de Mtb
Parmi les stratégies d’actions contre la bactérie Mtb émise par l’OMS, l’étude des
mécanismes de résistance et de latence de Mtb a été ciblée [17]. La résistance de Mtb face
aux espèces réactives de l’oxygène et de l’azote est particulièrement visée [9, 12-15]. La
production d’oxyde nitrique (•NO) et la faible concentration d’oxygène moléculaire
disponible empêchent la prolifération de Mtb et favorisent l’entrée en phase
3
stationnaire [15]. Le •NO compromet la respiration aérobie en inhibant des enzymes clefs
du cycle de Krebs telles que l’aconitase et les cytochromes oxydases respiratoires
terminales [18, 19]. Le •NO peut également réagir avec l’ion superoxyde (O2-) et former
d’autres espèces réactives et toxiques, dont l’oxyde nitreux (•NO2), le trioxyde d’azote
(N2O3) et l’ion peroxynitrite (OONO-) [20, 21]. La capacité de Mtb à survivre durant
plusieurs années sous ces conditions ne peut se faire sans la présence d’un mécanisme
endogène de résistance contre le •NO.
L’hémoglobine tronquée TrHbN exprimée par Mtb a été ciblée comme un acteur
potentiellement important dans cette défense contre le •NO. Il a été démontré que TrHbN
est capable de protéger la respiration aérobie de Mycobacterium tuberculosis BCG contre
l’effet inhibiteur du •NO. De plus, TrHbN catalyse très efficacement la conversion du •NO
en nitrate avec une constante bimoléculaire de 745 µM-1
s-1
à 23 °C (réaction
•NO-dioxygénase ou NOD) [22]. À elles seules, ces propriétés biochimiques justifient
pleinement l’intérêt scientifique porté vers TrHbN
1.2. TrHbN et la superfamille des globines
1.2.1. Définition du terme globine
Par définition, les globines constituent une superfamille de protéines dont la structure
tridimensionnelle, plutôt globulaire, renferme un cofacteur appelé l’hème. Certaines d’entre
elles sont des modèles largement étudiés en biochimie telle que la myoglobine (Mb) et
l’hémoglobine tétramérique mammalienne (Hb) dont les fonctions principales sont le
stockage et le transport de l’O2 respectivement. La structure tridimensionnelle des globines
adopte un arrangement structural typique communément appelé « repliement globine ».
Celui-ci est caractérisé par une série d’hélices α organisées dans l’espace afin de contenir
l’hème et le placer dans un environnement adéquat pour assurer la fonction de la globine.
Cet environnement permet notamment la liaison réversible de l’oxygène moléculaire avec
le fer sous sa forme ferreuse et prévient l’oxydation du fer [23].
4
1.2.2. L’hème
L’hème est une molécule chimique composée d’un atome de fer prenant place au centre
d’un large anneau organique hétérocyclique que l’on nomme porphyrine. Des groupements
chimiques (méthyle, vinyle, propionate) bordent la porphyrine. Ces groupements chimiques
peuvent varier donnant lieu à différents types d’hèmes. Le type d’hème retrouvé chez les
globines est l’hème b, également connu sous le nom protoporphyrine IX (Figure 1.1). Ce
type d’hème contient trois groupements méthyles, deux groupements vinyles et deux
propionates.
Le fer de l’hème se retrouve principalement sous deux états d’oxydation, soit ferreux (Fe2+
)
et ferrique (Fe3+
). Lors de certaines réactions d’oxydoréduction, dont la réaction NOD, le
fer peut se retrouver transitoirement sous une forme ferryle (Fe4+
) [24]. En fonction de
l’état d’oxydation, l’hème peut se lier à diverses molécules gazeuses diatomiques et
catalyser des réactions d’oxydoréduction. Sous sa forme Fe2+
, l’hème peut se lier à l’O2, au
CO et au •NO. L’hème sous sa forme Fe3+
peut se lier avec l’eau, le •NO, l’imidazole, l’ion
cyanure (CN-), l’ion hydroxyde (OH
-) et d’autres anions (COO
-, NO2
-, N3
-, Cl
-, F
-). Le fer
peut aussi se présenter sous différents types de coordination. Lorsque le fer n’est chélaté
que par les quatre azotes de l’anneau porphyrique, le fer est dit tétracoordonné (4C).
Lorsqu’en plus l’histidine proximale (His(F8)) est liée au fer, l’hème est alors dit
pentacoordonné (5C). Sous sa forme 5C, une globine est communément appelée « deoxy »
ou « met » selon si le fer est Fe2+
ou Fe3+
, respectivement. Finalement, lorsqu’un ligand est
lié au fer sur la face distale, l’hème est hexacoordonné (6C).
L’état d’oxydation du fer ferrique est un facteur majeur influençant la liaison des ligands. À
un pH près de la neutralité, l’hème ferrique a une charge nette de +1 (+3 pour le fer et -2
pour quatre pyroles) alors que le fer ferreux est neutre (+2 pour le fer, et -2 pour les azotes
des pyroles). L’hème ferrique tend naturellement à réagir plus fortement avec les ligands
anioniques étant donné l’attraction électrostatique [25]. L’hème ferreux quant-à-lui interagit
préférentiellement avec des ligands gazeux neutres (O2, CO, •NO) et ceci est imputable à
5
l’augmentation du nombre d’interactions dans les orbitales d : le fer ferreux (d6) a un
électron additionnel dans une orbitale d comparativement à l’hème ferrique (d5). Cet
électron additionnel permet de doubler l’interaction entre l’orbitale dxx/dxy du fer et
l’orbitale anti-liante p du carbone (CO) ou de l’azote (•NO) [25]. Ceci jouerait un rôle
important dans l’interaction entre le fer et les ligands gazeux. La force du ligand avec le fer
ferreux varie (•NO > CO > O2) et ceci s’explique par certaines différences au niveau des
interactions dans les orbitales. Il est proposé que pour l’O2, l’hybridation soit de type sp2
avec l’hème alors que le CO présenterait une hybridation de type sp [25]. Pour l’O2, la
présence de deux électrons dans des orbitales anti-liantes diminue la force du lien avec le
fer. Par conséquent, le lien Fe-C est plus court que le lien Fe-O. Le cas du •NO (Fe-N-O)
est particulier. L’azote peut se lier selon une hydribation sp ou sp2. Le •NO présente un
nombre impair d’électrons conférant une polarité à la molécule lui permettant de se lier à
un hème ferrique. Le •NO peut partager 2 ou 3 électrons faisant de lui un ligand plus fort
que le CO. Dans l’espace, l’arrangement structural varie également. Fe-C-N est linéaire
alors que l’arrangement Fe-O-O est penchée (angle ~120º) [25]. L’arrangement structural
Fe-N-O peut se présenter selon les deux types configurations.
Il est important de noter que l’O2 liée au fer hémique présente typiquement un caractère
superoxyde (Fe3+
O2-) [24]. Ce caractère serait en particulier important dans la catalyse de la
réaction de dioxygénation du •NO (réaction NOD) tel que proposé initialement par Doyle et
Hoekstra [26].
6
Figure 1.1. Structure de l’hème (protoporphyrine IX). Le fer, les azotes, les oxygènes les
carbones et les hydrogènes sont respectivement colorés en rouge brique, bleu, rouge, gris et
blanc. Les coordonnées sont celles de l’hème contenu dans l’hémoglobine tronquée N de
Mycobacterium tuberculosis (Accession PDB 1IDR, chaîne A). La figure a été produite à
l’aide de PyMOL [27].
7
1.2.3. Phylogénie des globines
Les globines se retrouvent dans tous les règnes du vivant. Le modèle phylogénétique de
l’évolution des globines est présenté à la Figure 1.2 [28]. L’origine des globines est très
ancienne. Les premières seraient apparues il y a environ 3.5 milliards d’années. Il est
proposé que les globines aient évolué à partir d’un gène de globine ancestral [28]. Cette
globine ancestrale serait apparue peu après l’apparition de la vie à une époque où la
concentration atmosphérique en O2 était très faible (< 0.8x10-3
atm), soit avant l’avènement
de la photosynthèse. À cette époque, sa fonction aurait été la détection, la séquestration et la
détoxification de l’O2 [28]. L’évolution de cet ancêtre aurait donné lieu à deux types de
repliements globines, les globines 2-sur-2 et les globines 3-sur-3. Les caractéristiques de
ces repliements sont traitées à la section 1.2.7.
La distribution actuelle des globines place les hémoglobines 2-sur-2 chez les
archaebactéries, les bactéries, les plantes et les eucaryotes unicellulaires. Les
flavohémoglobines se retrouvent chez les archaebactéries et les bactéries. Enfin, les
hémoglobines 3-sur-3 (à simple domaine) se retrouvent chez les bactéries et les
eucaryotes [28]. Lors de la découverte des premières globines 2-sur-2, ces globines étaient
appelées « hémoglobines tronquées » (TrHbs) puisqu’elles présentaient d’importantes
délétions par rapport aux globines dites classiques dites « 3-sur-3 » [28]. La terminologie
« 2-sur-2 » est apparue ensuite et celle-ci s’appuie sur l’arrangement structural en
3-dimensions. La terminologie « hémoglobine tronquée » tend à disparaître au profit de
l’autre appellation. Néanmoins, cette thèse utilisera les deux appellations sans préférence.
Les TrHbs sont subdivisées selon trois groupes distincts : le groupe I (ou N), le groupe II
(ou O) et le groupe III (ou P) [28-30]. De manière étonnante, il existe moins de 20 %
d’identité entre ces trois groupes. L’identité est par contre plus élevée à l’intérieur d’un
même groupe et peut atteindre près de 80 %. Les déterminants structuraux sont orthologues
à l’intérieur du même groupe et sont paralogues d’un groupe à l’autre [31]. Le groupe III
présente le plus haut niveau de conservation. Le groupe II serait la forme ancestrale alors
que les groupes I et III seraient le résultat d’évènements de réplications et de transferts
8
génétiques [31]. La présence des TrHbs des trois groupes chez certains organismes appuie
cette hypothèse. Les TrHbs des différents groupes auraient donc évolué en donnant lieu à
différentes fonctions. Parmi les fonctions suggérées des TrHbs, il y a la détoxification du
•NO et de l’O2, le stockage de substrat, source d’O2 en réponse à l’hypoxie et la détection
de ligand (O2/•NO) [28, 32].
9
Figure 1.2 Évolution et distribution des globines dans les règnes du vivant. Figure adaptée
de Vinogradov et al. [28] avec l’accord du journal.
10
1.2.4. Fonctions des globines
D’une globine à une autre, les fonctions peuvent diverger [32]. Parmi les fonctions
possibles, notons le stockage, le transport et la détection et la détoxification de l’oxygène
moléculaire (O2). À ceci s’ajoute la catalyse de réactions d’oxydo-reduction telles que
l’oxydation de l’oxyde nitrique en nitrate (réaction NOD), la réduction du nitrite, la
nitrosylation de l’O2 et la réduction du •NO [32]. Une même globine peut assurer plusieurs
fonctions [32]. Par exemple, en plus de son rôle de transport de l’O2, l’Hb catalyse la
réaction NOD (section 1.2.5) ce qui permet de réguler la pression artérielle [33]. Quant à la
Mb, en plus de sa fonction de stockage de l’O2, elle jouerait un rôle important dans le
contrôle du niveau intracellulaire en nitrite (NO2-) et •NO. Pour ce faire, en présence d’O2
et de •NO, le Mb abaisserait la concentration en •NO en catalysant la réaction NOD. À
l’inverse, en condition pauvre en oxygène, la Mb sous sa forme deoxy réagit avec le NO2-
pour produire du •NO [34, 35]. En causant la vasodilatation, cette dernière réaction
préviendrait les dommages aux tissus causés lors d’une période d’ischémie prolongée.
La fonction d’une globine donnée est grandement dictée par la réactivité de son hème.
Cette réactivité varie d’une globine à une autre. La nature et le positionnement des acides
aminés bordant l’hème influencent cette réactivité. La nature des acides aminées
permettront ou non certaines interactions directes avec le ligand tel que des ponts
hydrogènes. Ces interactions sont susceptibles de stabiliser ou non le ligand. De plus, la
taille de ces résidus causera plus ou moins d’encombrement stérique modulant l’accès au
site actif. D’autres facteurs peuvent également l’influencer dont le repliement
tridimensionnel et l’allostérie. La présence de tunnel(s) dans la matrice de certaines
globines [36-41] et le phénomène de coopérativité observée pour l’hémoglobine
tétramérique de mammifère [42] sont des bons exemples. Certaines globines sont formées
d’un seul domaine globine alors que d’autres sont chimériques. Ces dernières contiennent
un domaine globine en N-terminal alors que le domaine en C-terminal peut être soit une
réductase (FAD) (les flavohémoglobines) ou encore un domaine de régulation de génique
(globines couplées à un senseur) [32].
11
1.2.5. La réaction •NO-dioxygénase
La réaction •NO-dioxygénase, également appelée « NOD », est une réaction
d’oxydoréduction dont l’équation chimique globale est donnée par :
• →
(Équation 1.1)
En solution, la réaction non enzymatique entre le •NO et l’anion superoxyde (•O2-) est très
rapide, n’étant limitée que par la vitesse de diffusion des molécules (constante
bimoléculaire ~6700 µM-1
s-1
) [43, 44]. Le produit de cette réaction est l’anion peroxynitrite
ONOO-, un oxydant puissant également toxique. La forme déprotonée ONOO
- est stable,
perdurant des jours [45], mais la forme acide ONOOH (pKa=6.8) s’isomérise spontanément
en nitrate à un taux de 1.3 s-1
[44]. À l’intérieur des cellules, ONOO-
peut oxyder les
groupements thiols, hydroxyler les phénylalanines (ONOOH ↔ O=N-O…OH → OH• +
•NO2-, le radical hydroxyle réagissant avec la phénylalanine pour former la m-, o- ou p-
tyrosine), nitrater les tyrosines via le radical •NO2-, cliver l’ADN et oxyder ou nitrater les
guanosines [20, 21, 45, 46].
Étant donné la toxicité du •NO, les niveaux intracellulaires doivent être modulés. La
réaction entre le •NO et l’anion •O2- est très rapide, cependant la concentration
intracellulaire de •O2- est très faible et ne constitue donc pas une voie de détoxification
efficace (~10-10
M) [24]. Par contre, la concentration intracellulaire plus élevée des globines
(flavohémoglobines, hémoglobines et myoglobines) (≥ 10-7
M) permet une régulation plus
efficace des niveaux de •NO [24].
Le cycle de transformation du •NO en nitrate catalysé par les globines est représenté à la
Figure 1.3. Il n’y a toujours pas de consensus quant au mécanisme réactionnel précis
prenant place à l’hème. Deux mécanismes sont proposés. Dans un premier, décrit à la
Figure 1.4, la molécule de •NO se rend d’abord au site actif de la globine sous sa forme
oxygénée. L’O2 lié réagit alors avec la molécule de •NO pour former l’ion ONOO-. Par la
suite, un clivage homolytique survient entre les deux atomes de l’oxygène lié formant un
12
radical dioxyde d’azote (•NO2) et l’hème adopte la forme oxo-ferryl (FeIV
-O). Ces
intermédiaires se réorganisent ensuite pour former l’ion nitrate lié au fer. Une fois formé,
l’ion nitrate, qui a une faible affinité pour le fer, est relâché dans le cytoplasme [47].
Figure 1.3 Cycle de la réaction NOD catalysée par les globines. La forme oxygénée
(Fe2+
O2) réagit avec le •NO pour former une molécule de nitrate. Le nitrate se déplace
ensuite vers le solvant. Une molécule d’eau du solvant peut alors se fixer au Fer3+
. La
forme Fe2+
est régénérée suivant une réduction (réductase, molécule réductrice
cytoplasmique). L’oxygène moléculaire peut se fixer à nouveau au fer et la globine est
prête pour un second tour réactionnel.
Fe2+
O2
Fe3+
NO3- Fe
3+H2O
•N
O
H2O NO3-
Fe2+
O2
H2
O
é
13
Figure 1.4 Mécanisme réactionnel de la réaction NOD impliquant la rupture homolytique
du lien O-O. Les crochets dénotent des intermédiaires réactionnels.
Puisque l’intermédiaire peroxynitrite n’a jamais été observé expérimentalement, un autre
mécanisme a été proposé, soit le mécanisme concerté (Figure 1.5) [24]. Dans ce
mécanisme, la vibration du lien peroxo (O-O) et la contraction du lien Fe-OO-NO
favorisent le déplacement de la paire d’électrons libres sur l’azote vers l’oxygène lié au fer.
Ce déplacement causerait la rupture du lien O-O de concert avec la formation simultanée du
troisième lien O-N. Ainsi, la réaction suivrait le même mécanisme d’isomérisation que
celui de l’acide peroxynitrique (ONOOH) en nitrate en solution [24, 45, 48].
Figure 1.5 Mécanisme concerté pour la réaction NOD. Les crochets dénotent des
intermédiaires réactionnels.
14
De récents calculs de QM/MM ont permis d’étudier ces deux mécanismes réactionnels chez
TrHbN [49]. Ces travaux ont conclu que le mécanisme concerté serait le plus favorable
chez TrHbN. L’autre mécanisme serait également possible mais serait beaucoup plus lent
car limité par la rupture du lien O-O. Dans ce mécanisme, la configuration du site actif de
TrHbN serait cruciale pour le maintien des intermédiaires réactionnels près du fer et éviter
que ceux-ci s’échappent du site actif et diffusent dans la matrice protéique pour réagir avec
la protéine, en particulier les tyrosines souvent retrouvées dans la poche distale. De plus,
cette réaction se ferait très rapidement, soit dans l’ordre de quelques dizaines picosecondes,
faisant vraisemblablement de la diffusion des •NO du solvant vers le site actif comme
l’étape limitante pour la réaction NOD [49].
Comme le montre le Tableau 1-1, la vitesse de la réaction NOD varie beaucoup selon les
globines. Les enzymes catalysant le plus efficacement la réaction NOD se retrouvent chez
les bactéries. En particulier, les flavohémoglobines (FHbs) et l’hémoglobine tronquée
TrHbN présentent des niveaux d’activité très élevés et où les constantes bimoléculaires
atteignent de 745 à 2900 µM-1
s-1
[22, 50, 51]. Ces taux de catalyse s’approchent de la
réaction en solution entre l’ion O2- et •NO, soit 6700 µM
-1s
-1, considérée comme étant
limitée que par la vitesse de diffusion des substrats.
De telles vitesses sont inusitées puisque l’hème des globines se trouve enfoui à l’intérieur
de la matrice protéique. En effet, de telles vitesses suggèrent que la diffusion du •NO entre
le solvant et le site actif se fait très rapidement. Ce phénomène chez TrHbN fait d’ailleurs
l’objet d’une attention particulière dans la présente thèse.
15
Tableau 1-1 Activité NOD chez certaines globines
Organisme Type de globine k’NOD
µM-1
s-1
Références
Escherichia coli FHb 2400 a [50]
Alcaligenes eeutrophus FHb 2900 a [50]
Bacillus subtilis FHb 860 b [51]
Deinococcus radiodurans FHb 3 b [51]
Mtb TrHbN 745 c [22]
Mtb TrHbO 0.6 c [52]
Ascaris suum Hb 0.07 d [53]
Homme Hb 50 e [54]
Cachalot Mb 34 e [54]
•NO + O2- (en solution) - 6700 [24]
a. 37 °C, pH 7.8, mesure par électrode de la consommation du •NO.
b. Température de la pièce, pH=7, Consommation du •NO suivie par un analyseur de •NO
couplée à un détecteur de chimiluminescence.
c. 23 °C, pH 7.5, spectrométrie en flux arrêté.
d. Température non spécifiée, pH 6.0, Spectrométrie en flux arrêté
e. 20 °C - pH 7.0 (Mb), 7.4 (Hb), Spectrométrie en flux arrêté
16
1.2.6. La cavité distale
Près du fer, on retrouve une cavité définie par les chaînes latérales de résidus occupant des
positions bien précises. C’est dans cet espace disponible que viennent se lier les ligands et
où les réactions redox sont catalysées. Étant donné que les ligands se fixent sur la face
distale de l’hème, cette cavité est appelée la cavité distale de l’hème. La nomenclature
utilisée pour les acides aminés délimitant cette cavité suit celle utilisée chez la Mb de
cachalot [23, 55]. Ces positions sont : B10, CD1, E7, E11, G8. Par exemple, chez la Mb, la
position 7 de l’hélice E est occupée par une histidine et celle-ci est nommée His(E7).
Comme le montre le Tableau 1-2, la nature des acides aminés à ces positions varie d’une
globine à une autre [31].
Chez les TrHbs du groupe I, les positions E7, E11 et B10 sont occupées principalement par
des acides aminés polaires. En position B10 on retrouve avant tout une tyrosine avec
toutefois certaines exceptions comme chez Nostoc commune, Nostoc punctiform,
Synchosystis sp. et Gemmata obscuriglobus où on retrouve un acide aminé apolaire [30].
Aux positions E7 et E11, on observe au moins une glutamine à l’une ou l’autre des
positions. Parfois, une thréonine est observée en position E7. Enfin, le résidu G8 chez le
groupe I est apolaire et de petite taille comparativement au tryptophane observé chez les
groupes II et III.
Chez les TrHbs du groupe II, on observe une corrélation entre la nature du résidu CD1 et
celle du résidu E11 [29]. Alors que toutes les TrHbs des groupes I et III présentent une
phénylalanine en position CD1, un polymorphisme est présent chez le groupe II
(phénylalanine, tyrosine ou histidine). Lorsqu’un acide aminé donneur de pont hydrogène
est présent en position CD1 (Tyr ou His), le résidu en position E11 est toujours apolaire
(leucine ou phénylalanine). Dans le cas inverse Phe(CD1), un acide aminé polaire (sérine
ou glutamine) est observé en position E11. Des analyses Raman ont permis de conclure que
la Tyr(CD1), lorsque présente, est impliquée dans la stabilisation du substrat lié au lieu de
la Tyr(B10) [56]. Toutes les TrHbs du groupe II connues présentent une Tyr(B10) et une
Trp(G8) [30]. L’atome NE1 de l’anneau indole du Trp(G8) est à une distance permettant
17
des interactions avec le substrat lié. Ce résidu est donc susceptible d’affecter la vitesse de
liaison et de dissociation du ligand. Le groupe III est le groupe le plus homogène. Il est
caractérisé par la présence d’une histidine en position E7 complètement conservée à
l’intérieur de ce groupe [30].
Les résidus polaires de la cavité distale peuvent interagir avec le substrat lié et influencer
l’affinité de la globine pour les ligands. Chez TrHbN, la haute affinité pour l’O2 est
attribuable à l’effet stabilisateur de la Tyr33(B10) [22]. En plus de la polarité, la
configuration spatiale des résidus de la poche distale est importante. Par exemple, les
nématodes Cerebratulus lacteus et Ascaris suum présentent des cavités distales où seul le
résidu en position E11 diffère (Tableau 1-2). Chez C. lacteus [57], la constante
d’association est près de 200 fois plus élevée que celle de A. suum [58]. Par contre, le taux
de dissociation de l’O2 est près de 45 000 fois supérieur chez C. lacteus. Ce taux de
dissociation élevée s’explique par la présence de la thréonine en position E11 qui forme un
pont hydrogène avec de la Tyr(B10). Cette interaction empêche la Tyr(B10) de stabiliser
l’O2 lié [57]. Le changement de la Thr(E11) pour une valine permet de réduire près de 1000
fois la vitesse de dissociation de l’O2 [57]. La vitesse d’association plus élevée chez C.
lacteus, s’explique par une autre caractéristique de sa structure tridimensionnelle. En effet,
la structure de C. lacteus renferme un tunnel permettant la diffusion rapide des ligands [57,
59].
18
Tableau 1-2 Résidus de la poche distale de certaines globines en lien avec les constantes de liaison et de dissociation de l’O2.
Protéines Organismes Positions Constantes cinétiques Références
B10 CD1 E7 E11 G8 KO2 (µM-1
s-1
) KO2 (s-1
)
TrHbN Mycobacterium tuberculosis Y F L Q V 25 0.2 [38]
Paramecium caudatum Y F Q T V 30 25 [60]
Chlamydomonas eugametos Y F Q Q V > 10 1.4×10-2
[60]
TrHbO Mycobacterium tuberculosis Y Y A L W 0.1
1.4×10-3
[52]
TrHbP Campylobacter jejuni Y F H I W 0.9 4.1×10-3
[61]
FHb Escherichia coli Y F L I V 38 0.4 [50]
Hb Ascaris suum Y F Q I L 1.5 4.0×10-3
[58]
MiniHb
Cerebratulus lacteus Y F Q T L 240 180 [57]
Cytoglobine Homme F F H V L 300 0.4 [62]
Neuroglobine Homme F F H V V 140 0.8 [63]
Myoglobine Cachalot L F H V I 14 12 [64, 65]
19
1.2.7. Le repliement globine
Les premières structures de globines résolues ont été celles de la Mb de cachalot et de l’Hb
tétramérique humaine. Ces structures ont été déterminées par cristallographie et diffraction
des rayons X par Kendrew [66] et Perutz [67] respectivement. Ces derniers ont d’ailleurs
obtenu le prix Nobel de chimie en 1962 pour leurs travaux. Toutes les globines partagent
dans leur structure une caractéristique commune, soit la présence d’un domaine nommé le
« domaine globine ». Le domaine globine est formé d’une seule chaîne d’acides aminés
comptant généralement de 140 à 160 acides aminés [28]. Il renferme une série d’hélices α
définissant un cœur hydrophobe dans lequel prend place l’hème. Il existe deux types de
repliement globine, le repliement classique dit « 3-sur-3 » et le repliement « 2-sur-2 ».
Même lorsque deux globines présentent une très faible homologie de séquence, il est
possible de superposer leur structure de manière remarquable (Figure 1.6). Les différences
entre les repliements 3-sur-3 et 2-sur-2 sont illustrées à la Figure 1.6.
Les globines 3-sur-3 renferment habituellement sept ou huit hélices α (hélices A à H).
Parmi ces hélices, six composent le repliement 3-sur-3 (hélices A, B, E, F, G, et H). Le
repliement 2-sur-2 est caractéristique des hémoglobines tronquées. Comme mentionné
précédemment, l’appellation « hémoglobine tronquée » tend à disparaître pour faire place à
« hémoglobine 2-sur-2 ». Ce repliement repose sur quatre hélices α (hélices B, E, G et H).
L’hélice F, renfermant l’histidine proximale, est grandement raccourcie (un seul tour pour
les groupes I et III). Quant à l’hélice A, elle est très courte (groupes I et II) voire même
absente (groupe III). L’hélice D est toujours absente. En plus des changements qui
concernent les hélices α, on note la présence d’une longue boucle séparant les hélices E et
F. Chez TrHbN, on remarque la présence d’une hélice supplémentaire caractéristique du
côté N terminal; l’hélice pré-A. Les hémoglobines tronquées portent leur nom du fait que
leur structure présente d’importantes simplifications (raccourcissements et délétions
d’hélices α) par rapport aux globines classiques. Le nombre de globines 2-sur-2 dont la
structure a été résolue est encore aujourd’hui limité. Le Tableau 1-3 résume les différentes
structures de TrHbs disponibles et les différentes méthodes employées. Jusqu’à maintenant,
on note quatre structures du groupe I, cinq pour le groupe II et une pour le groupe III.
20
Figure 1.6 Comparaison des repliements globines 2-sur-2 et 3-sur-3. La structure cristalline
de la forme oxygénée de TrHbN (gauche, Accession PDB 1IDR, chaîne A) a été alignée
avec celle de la Mb oxygénée de cachalot (droite, Accession PDB 1AM6). La figure a été
réalisée à l’aide de PyMOL [27].
21
Tableau 1-3 Structures tridimensionnelles résolues chez les hémoglobines tronquées
Groupes Organismes Formes Méthodes*
Code
PDB Références
I (TrHbN)
Mtb
Fe2+
O2
Fe3+
CN-
Fe3+
CN-
X
X
X + Xe
1IDR
1RTE
1S56
[38]
[68]
[69]
Chlamydomonas
eugametos
Fe3+
CN- X
X + Xe
1DLY
1UVX
[36]
[69]
Paramecium caudatum
Fe3+
CN- X
X + Xe
1DLW
1UVY
[36]
[69]
Synechosystis sp.
bis-His
Fe3+
CN-
RMN
X
1MWB
1RTX
[70]
[62, 71]
II (TrHbO) Mtb
Fe3+
CN- X 1NGK [72]
Bacillus subtilis
Fe3+
CN- X 1UX8 [73]
Geobacillus
stearothermophilus
Fe3+
COO-
+ Fe2+
O2
X 2BKM [74]
Thermobifida fusca
Fe3+
COO- X 2BMM [75]
Agrobacterium
tumefaciens
Fe3+
OH2 X 2XYK [76]
III (TrHbP) Campylobacter jejuni Fe3+
CN- X 2IG3 [77]
* X : Cristallographie et diffraction des rayons X; Xe : sous haute pression de xénon.
22
1.2.8. Cavités internes et tunnels
Les structures des TrHbs contiennent des cavités hydrophobes (Figure 1.7 Cavités
observées dans la structure de quelques globines. Les cavités sont définies pas la zone
grillagée. A: Mtb TrHbN (1RTE, chaîne A) B: Chlamydomonas eugametos TrHbN (PDB :
1DLY), C: Paramecium caudatum TrHbN (PDB : 1DLW), D: Synechocystis sp. TrHbN
(PDB : 1S69), E : Mtb TrHbO (PDB 1NGK, chaîne G), F: Bacillus subtilis TrHbO
(PDB : 1UX8), G : Campylobacter jejuni TrHbP (PDB : 2IG3, chaîne A), H : Myoglobine
cachalot (PDB 1AM6)). Le volume total de ces cavités est nettement supérieur chez les
TrHbs du groupe I [69] (Tableau 1-4). En ce qui a trait aux TrHbs des groupes II et III, les
cavités observées sont de plus petites tailles et plus isolées, telles que celles présentes dans
la structure de la Mb [72, 77, 78].
Initialement, les cavités internes observées à l’intérieur des protéines n’étaient perçues que
comme des emboîtements imparfaits de chaînes latérales internes [79]. Cette description
simpliste s’est grandement bonifiée avec l’avènement de nouvelles méthodes telles que les
simulations de dynamique moléculaire [80] et la cristallographie en temps réel [81-83]. En
particulier, la MD a mis en évidence que les protéines bougent, chaque atome les
composant ayant un caractère diffusionel [80]. Les mouvements intramoléculaires sont
propices au remodelage de ces cavités et la formation de routes transitoires entre elles et
avec la surface de la protéine. Ainsi, il a été proposé que les ligands puissent diffuser de
cavités en cavité [84-90]. Ce phénomène a été non seulement décrit pour la Mb mais
également chez d’autres protéines [37, 91-96].
Chez la Mb, les cavités sont isolées les unes des autres et leur volume est modeste (Tableau
1-4). Il existe d’autres globines, dont les hémoglobines tronquées du groupe I de Mtb ou
encore celle de Chlamydomonas eugametos, où la structure renferme des cavités tellement
importantes qu’elles s’étirent de la surface au site actif [36-41]. On parle alors de tunnel. La
Figure 1.7 illustre les cavités observées chez quelques globines.
23
Tableau 1-4 Volume total interne des cavités de quelques globines
Groupes Organismes Formes Volume *
Å3
Code
PDB Références
I (TrHbN) M. tuberculosis Fe3+
CN- 299 (265) 1RTE [69]
Chlamydomonas
eugametos
Fe3+
CN- 465 (400) 1DLY [36]
Paramecium caudatum Fe3+
CN- 280 (180) 1DLW [36]
Synechosystis sp. Fe3+
CN-
357 1RTX [62, 71]
II (TrHbO) M. tuberculosis Fe3+
CN- 120 1NGK [72]
Bacillus subtilis Fe3+
CN- 124 1UX8 [73]
III (TrHbP) Campylobacter jejuni Fe3+
CN- 62 2IG3 [77]
Mb Myoglobine de cachalot Fe2+
O2 73 1AM6 [97]
* Volume estimé à partir d’une sonde de 1.4 Å de rayon. L’erreur sur la valeur calculée est
inférieure à 1%. La valeur entre parenthèses provient de la référence [69] alors que toutes
les autres ont été calculées. Les différences avec les valeurs publiées peuvent s’expliquer de
différentes façons : rayon de sonde utilisé, frontière de cavité en continuum avec la solvant
(entrée des tunnels), rayon de Van der Waals des différents types d’atomes.
24
La détermination de la structure de TrHbN a été marquée par la présence de deux
tunnels [38] (voir Figure 1.8). Le premier tunnel, appelé le tunnel Long, s’étire du site
distal pour rejoindre la surface de l’enzyme entre les boucles A-B et G-H. L’autre tunnel,
appelé le tunnel Court, s’étire du site distal jusqu’à la surface entre les hélices G et H. Ces
tunnels sont présentés plus en détail à la section 1.3. La présence de cavités s’alignant sur
l’axe du tunnel Long est une caractéristique commune à toutes les structures du groupe I
résolues jusqu`à maintenant [69] (Figure 1.7). Les fonctions qui ont été initialement
proposées pour ces tunnels seraient de permettre la diffusion sélective et le stockage de
substrats apolaires [38, 69].
Au moment de la publication de la structure de TrHbN, la présence des tunnels était
inusitée car ceux-ci n’étaient observés que chez des enzymes multimériques [98, 99]. Le
Tableau 1-5 présente une liste de différentes enzymes comportant un ou plusieurs tunnel(s).
La fonction associée à ces tunnels est toujours liée à la diffusion des substrats ou
d’intermédiaires réactionnels. La première structure d’enzyme révélant un tunnel fut la
tryptophane synthase, un α2β2-tétramère [100]. La sous-unité α catalyse le clivage de
l’indole-3-glycérol phosphate produisant un intermédiaire indole et une molécule de
glycérol-3-phosphate. La sous-unité β contient un site actif catalysant la condensation de
l’indole sur la L-sérine. Ces deux sites actifs, séparés de 25 Å, sont reliés par un tunnel
permettant la diffusion de la molécule d’indole de la sous-unité α vers la sous-unité β. Au
cours des années suivantes, d’autres structures de complexes enzymatiques, notamment
certaines synthases d’acides aminés, ont également révélé de tels tunnels [101-107]. Chez
ces protéines, le tunnel permet d’acheminer des intermédiaires réactionnels d’un site actif à
un autre et très souvent, il s’agit d’une molécule d’ammoniac [102, 104, 105, 107]. En plus
d’assurer la diffusion entre les sites actifs, ces tunnels évitent la perte d’un intermédiaire
réactionnel pouvant être instable et/ou toxique pour la cellule. Il existe d’autres protéines
chez lesquelles des tunnels relient la surface au site actif tel que certaines hydrogénases et
lipoxygénases [37, 91, 108-114] et quelques globines [36-41]. Le chapitre 2 est dédié à
l’étude de la diffusion des substrats à l’intérieur des enzymes.
25
Figure 1.7 Cavités observées dans la structure de quelques globines. Les cavités sont
définies pas la zone grillagée. A: Mtb TrHbN (1RTE, chaîne A) B: Chlamydomonas
eugametos TrHbN (PDB : 1DLY), C: Paramecium caudatum TrHbN (PDB : 1DLW),
D: Synechocystis sp. TrHbN (PDB : 1S69), E : Mtb TrHbO (PDB 1NGK, chaîne G),
F: Bacillus subtilis TrHbO (PDB : 1UX8), G : Campylobacter jejuni TrHbP (PDB : 2IG3,
chaîne A), H : Myoglobine cachalot (PDB 1AM6)
26
Figure 1.8 Structure tertiaire de TrHbN. Les tunnels, les sites de liaison du xénon et l’hélice
pré-A sont identifiés. L’espace des tunnels est représenté par la surface orange. Les hélices
B, E, G et H sont colorées respectivement en bleu, vert, jaune et mauve. Les tunnels ont été
calculés avec le programme CAVER [115] et la figure a été produite avec PyMOL [27].
27
Tableau 1-5 Tunnels observés chez diverses protéines
Protéine Organisme Diffusion Méthodes # PDB Référence(s)
TrHbN Mtb O2 / •NO X* 1IDR/1RTE [38]
Protoglobin Methanosarcina acetivorans O2 / •NO X 2VEB [40]
Neuroglobine Rongeur O2 / •NO X 1Q1F [40, 41]
MiniHb Cerebratulus lacteus O2 / •NO X 1KR7 [39, 116]
Oxydase Cu-amine Hanseluna polymorpha O2 / H2O2 X 1EKM [108]
12/15 Lipoxygénase Soja O2 X 2SBL/1YGE [110, 112]
Cholesterol oxydase Brevibacterium sterolicum O2 X 1I19 [113, 114]
Cytochrome c oxydase Bovin O2 X / DM 1OCC [37]
Cycloxygenase Ovisaries O2 DM 1PRH [111]
ACS-CODH † Moorella thermoacetica CO X 1JJY [101]
Hydrogenase Bactéries diverses O2 / H2 X Plusieurs [109]
Catalase Proteusmicrabilis O2 / H2O2 X 1M85 [91]
Tryptophane syntase Salmonella typhimurium Indole X 1BKS [100]
Carbamoyl phosphate syntase Escherichia coli NH3 / Carbamate X 1JDB [102]
GPA‡ Escherichia coli NH3 X 1ECF [103]
Asparagine synthétase Escherichia coli NH3 X 1CT9 [104]
Glutamate syntase Azospirillum brasilense NH3 X 1EA0 [105]
IGPS § Saccaromyces cerevisiae NH3 X 1JVN [106]
Glucosamine 6-phosphate
syntase
Escherichia coli NH3 X 1JXA [107]
* X : Cristallographie et diffraction des rayons X
† Acetyl-CoA synthase / CO déshydrogénase
‡ Phosphoribosylpyrophosphate amidotransferase
§ Imidazole glycerol phosphate syntase
28
1.3. Relation structure-fonction chez TrHbN de Mtb
L’hémoglobine tronquée N de Mtb est une globine ayant une très haute affinité pour l’O2.
En effet, cette affinité (Kd=7 nM) [117] est plus de 100 fois supérieure à celle de la Mb
(857 nM) [118]. Cette différence est principalement due au faible taux de dissociation de
l’O2 lié (koff = 0.2 s-1
) [117]. Il est proposé que cette haute affinité soit cruciale pour
permettre la détoxification efficace du •NO sous une faible tension en O2 tel qu’il
prévaudrait au sein du granulome [9]. Les structures tridimensionnelles de la forme
oxygénée (Fe+2
O2) et cyanomet (Fe3+
CN-) de TrHbN ont été déterminées par
cristallographie et diffraction des rayons X [38, 68]. Bien que la maille cristalline de ces
structures contienne deux molécules de TrHbN, des expériences de tamisage moléculaire,
de résonance magnétique nucléaire et de diffusion dynamique de la lumière soutiennent que
TrHbN est monomérique en solution (données non publiées).
La Figure 1.9 montre l’arrangement structural du site actif de TrHbN. L’angle formé par les
atomes Fe-O-O est penché par ≈ 120°, l’oxygène distal pointant en direction du résidu
Val94(G8). Les deux atomes d’oxygène sont équidistants de l’atome d’oxygène du
groupement phénol de la tyrosine en position 10 de l’hélice B (Tyr33(B10)). Le
groupement amide de la glutamine en position 11 de l’hélice E, la Gln58(E11), est
également à une distance permettant la formation de pont hydrogène avec la Tyr33(B10) et
le substrat lié. Les autres résidus complétant la cavité distale sont la Phe46(CD1), la
Leu54(E7) et la Val94(G8). Le mutant Tyr33(B10)Phe présente une constante de
dissociation de l’O2 près de 150 fois supérieure à celle de l’enzyme sauvage, suggérant que
la tyrosine stabilise l’O2 lié [22]. De récentes études en spectroscopie de résonance Raman
ont confirmé les interactions entre la Tyr33(B10) et l’O2 lié [56].
29
Figure 1.9 Site actif de TrHbN. Configuration de la cavité distale polaire de TrHbN sous sa
forme oxygénée. L’anneau porphyrique, l’O2 lié, la Tyr33(B10), la Gln58(E11), la
Phe62(E15) et l’His81(F8) proximale sont représentés en bâtons et boules. Les hélices α
sont colorées en bleu (hélice B), vert (hélice E) et mauve (hélice H). La Phe62(E15) montre
deux conformations dans la structure cristalline. Une seule d’entre elles est représentée
pour la clarté de l’image. Pour la même raison, l’hélice G n’apparaît pas. Les coordonnées
des atomes sont celles de la structure cristalline de TrHbN sous sa forme oxygénée
(Accession PDB 1IDR, chaîne A). La figure a été réalisée à l’aide de PyMOL [27].
30
Comme mentionné précédemment, la structure de TrHbN montre deux tunnels
hydrophobes reliant la surface et le site actif de l’enzyme. Ces tunnels sont nommés
« tunnel Court » et « tunnel Long » (Figure 1.8). Le tunnel Court se termine à environ 13 Å
du site actif à une position centrale entre les hélices G et H. Il est formé par les résidus
hydrophobes compris dans les hélices G (Phe91(G5), Val94(G8), Ala95(G9), Leu98(G12)
et H (Leu116(H8), Ile119(H11) et Ala120(H12)). L’entrée du tunnel Court se retrouve à la
base d’un large entonnoir hydrophobe. Pour ce qui est du tunnel Long, sa longueur fait
environ 20 Å. L’entrée du tunnel Long est définie par deux segments de la chaîne
principale formant les boucles A-B et G-H. Les résidus qui définissent l’intérieur du tunnel
Long sont également hydrophobes et sont issus des quatre hélices α formant le repliement
2-sur-2 (Ile19(A15), Ala24(B1), Ile25(B2), Val28(B5), Val29(B6), Phe62(E15),
Leu66(E19), Leu98(G12), Leu102(G16), Ala105(G19) et Ile115(H7)).
La structure obtenue à partir des patrons de diffraction de cristaux de TrHbN sous haute
pression de xénon a permis d’identifier cinq sites de liaison au xénon (Figure 1.8) [69].
Deux de ces sites se retrouvent dans le tunnel Court (Xe3 et Xe4), deux se trouvent dans le
tunnel Long (Xe1 et Xe5) et un dernier est positionné au point de rencontre des deux
tunnels (Xe2). Ces sites de liaison du xénon suggèrent que les tunnels de TrHbN jouent un
rôle dans la diffusion des substrats et des produits à l’intérieur de l’enzyme [69]. L’activité
NOD élevée de TrHbN, n’étant limitée pratiquement que par la diffusion des substrats,
appuie cette hypothèse.
Les tunnels Court et Long se rejoignent près de l’hème, soit à une cavité délimitée par la
chaîne latérale des résidus Phe32(B9), Gln58(E11), Phe62(E15), Leu98(G12) et
Ile119(H11) (Figure 1.10). Cette cavité correspond au site Xe2 et celle-ci communique
avec la cavité distale. La disposition des tunnels de TrHbN permet donc d’acheminer les
substrats directement au site actif de l’enzyme sans qu’aucun changement structural ne soit
requis [38]. En comparaison, la Mb n’a pas de tunnel évident et des fluctuations
structurales importantes sont nécessaires pour permettre un accès au substrat [119] (Figure
2.1).
31
Figure 1.10 Cavité distale de TrHbN sous sa forme oxygénée. L’hème, l’histidine
proximale en position F8, la Phe32(B9) et la Phe62(E15) sont représentés par des bâtons.
Les résidus distaux Gln58(E11) et Val94(G8) de même que l’O2 lié sont identifiés. Les
sites de liaison du xénon Xe5, Xe2 et Xe3 sont identifiés. Les coordonnées des atomes sont
celles de la structure cristalline de TrHbN sous sa forme oxygénée (Accession PDB 1IDR,
chaîne A). La figure a été réalisée à l’aide de PyMOL [27].
32
Il existe une autre caractéristique structurale qui suscite une attention particulière. Il s’agit
de la phénylalanine en position 15 de l’hélice E (Phe62(E15)). Cet acide aminé est
positionné au centre du tunnel Long et présente deux conformations lesquelles se
distinguent par une rotation autour de l’angle de torsion χ1 (Figure 1.11). Ces
conformations sont observées autant chez la forme oxygénée (Accession PDB 1IDR) [38]
que pour la forme cyanomet (Accession PDB 1RTE) [68]. Étant donné cette double
conformation, il a été proposé que ce résidu est mobile et qu’il pourrait jouer un rôle dans
la diffusion des substrats dans le tunnel Long en agissant comme une porte contrôlant le
flux des substrats et des produits [38].
1.4. Organisation de la présente thèse
La présente thèse de doctorat porte sur une étude théorique de la structure et de la
dynamique de l’hémoglobine tronquée N de Mycobacterium tuberculosis. Dans cette étude,
une attention particulière a été portée sur la dynamique des cavités et des tunnels de TrHbN
ainsi que sur le rôle de ceux-ci sur la diffusion des substrats vers le site actif.
Dans un premier temps, le prochain chapitre sera portera sur la diffusion et des substrats à
l’intérieur des protéines. Par après, les outils bio-informatiques employés, principalement la
dynamique moléculaire, seront présentés. Les objectifs de cette thèse ensuite énumérés.
Enfin, les six derniers chapitres suivants présenteront et discuterons tour à tour l’ensemble
des résultats obtenus.
33
Figure 1.11 Conformations alternatives de la Phe62(E15). La Phe62(E15) est représentée
par des bâtons et boules. Les sites de liaison du xénon Xe1, Xe2 et Xe5 sont identifiés.
L’angle χ1 est en « trans » (~180°) pour la conformation dont le cycle pointe vers Xe1.
L’angle χ1 est en « minus » (~ -60°) pour celle où le cycle aromatique pointe vers Xe2. Une
partie de l’hème apparaît sur la droite. Les hélices B, E, G et H sont colorées en bleu, vert,
jaune et mauve respectivement. Le tunnel Long est représenté par la zone grillagée. La
structure est celle de la forme oxygénée (Accession PDB 1IDR, chaîne A). Le tunnel a été
calculé avec le programme CAVER [115]. Les coordonnées des atomes sont celles de la
structure cristalline de TrHbN sous sa forme oxygénée (Accession PDB 1IDR, chaîne A).
La figure a été réalisée à l’aide de PyMOL [27].
34
2.
Chapitre 2
Étude de la diffusion interne des substrats
La structure tertaire de TrHbN présente deux tunnels hydrophobes reliant la surface et le
site actif (Figure 1.8). Il a été proposé que ces derniers jouent un rôle dans la diffusion des
substrats apolaire (O2, •NO) du solvant vers le site actif [38, 69]. Une grande part de des
travaux présentés dans cette thèse de doctorat se concentre sur cette hypothèse. Par
conséquent, ce chapitre porte sur la diffusion des substrats à l’intérieur des protéines et
présente différentes approches pour étudier ce phénomène.
La Mb est le modèle le plus étudié en ce qui a trait à la diffusion des substrats à l’intérieur
des protéines. Cette quête de savoir chez la Mb dure depuis maintenant près d’un demi-
siècle, soit depuis que sa structure ait été élucidée [66]. Ces nombreuses années de
recherches ont permis d’émettre plusieurs concepts généraux sur les relations entre la
structure et la fonction des protéines. Elles ont également motivé le développement de
plusieurs approches expérimentales et théoriques permettant de mieux comprendre la
diffusion des substrats se produisant entre le solvant et le site actif.
Dès l’obtention de la structure de la Mb, une première question a émergé : comment les
substrats gazeux atteignent la cavité distale en apparence isolée du solvant? D’abord, en
l’absence d’indices structurales montrant des routes de diffusions définies, il a été proposé
que les substrats gazeux peuvent accéder toutes les régions internes des protéines, même
celles considérées inaccessibles, grâce à des mouvements des protéines se produisant dans
l’échelle de temps nanoseconde [120]. Cette hypothèse a été par la suite réfutée par
plusieurs groupes de recherche qui ont démontré l’utilisation de routes de diffusion
particulières. Il existe deux grands modèles expliquant ce phénomène. Le premier consiste
au déplacement d’une chaîne latérale, l’histidine en position E7, vers le solvant (modèle de
la porte E7, Figure 2.1) [121]. Ce mouvement engendre la formation d’un tunnel reliant la
surface à la cavité distale permettant l’accès au site actif. Au début des années 80, ce
modèle a été complexifié suite à l’obtention de la structure de la Mb déterminée à partir de
35
cristaux placés sous haute pression de xénon [122]. Cette structure a révélé quatre sites de
liaison au xénon positionnés au cœur de la Mb (Figure 2.1). Puisque ces sites n’étaient pas
positionnés dans l’axe de la porte E7, un second modèle a été proposé. Ce dernier décrit
une diffusion interne des ligands le long de certaines routes précises ne passant pas par les
cavités de xénon (Figure 2.1) [85, 86, 88, 90, 122]. Afin de faire la lumière sur les
mécanismes de diffusion interne des substrats chez la Mb, de nombreuses méthodes
expérimentales et théoriques ont été développées. Ces travaux ont tantôt favorisé l’un ou
l’autre des modèles, tantôt les deux. Encore aujourd’hui, il n’existe pas de consensus.
Les prochaines sections décrivent les principales approches utilisées pour étudier la
diffusion des substrats chez les globines. Ces approches regroupent des méthodes
théoriques et expérimentales. Les méthodes expérimentales renferment les études
cinétiques de mutants, la diffraction des rayons X à température cryogénique et la
cristallographie de Laue résolue en temps réel. Quant à elles, les approchent théoriques
exploitent principalement les trajectoires issues de simulation de dynamique moléculaire.
36
Figure 2.1 Modèles de diffusion des substrats chez la Mb. Les coordonnées proviennent de
la structure de la Mb déterminée à partir de cristaux traités sous haute pression de xénon
(Accession PDB 1J52). La figure du haut montre la position des sites xénon par rapport à la
structure de la Mb. Les hélices B, E, G et H sont colorées respectivement en bleu, vert,
jaune et violet. Les sites xénon, l’hème, l’histidine E7 sont identifiés dans la figure du bas.
La figure a été réalisée à l’aide de PyMOL [27].
37
2.1. Cinétiques enzymatiques de mutants
Des essais en laboratoire sont nécessaires pour tester les hypothèses émises en ce qui a trait
aux voies de diffusion qui serait empruntées par les molécules de substrats. Le plus
couramment, des résidus prenant place le long des routes de diffusion proposées sont
mutés. Les mutations sont réalisées de manière à obstruer ou à élargir une voie d’accès
ciblée [59, 93, 96, 123-125]. La caractérisation cinétique des mutants créés est ensuite
réalisée pour mesurer l’impact des mutations. Idéalement, les mutations ne doivent
qu’obstruer les routes de diffusion sans en affecter la réactivité du site actif. Deux types de
caractérisations cinétiques sont généralement employés chez les globines: les cinétiques de
recombinaison et les cinétiques de liaison. On peut également suivre d’autres réactions
catalysées telles que la NOD.
2.1.1. Cinétiques de recombinaison
Pour les cinétiques de recombinaison, on exploite une propriété biochimique des protéines
hémiques, soit la photosensibilité du lien fer-ligand [126]. En effet, en soumettant un
échantillon à une brève et intense impulsion laser, on provoque la rupture du lien fer-
ligand. Cette propriété est très utile puisque les espèces liées et non liées présentent des
propriétés optiques différentes. Suivant sa photodissociation, un ligand peut soit diffuser à
l’extérieur de la protéine, soit se recombiner au fer. Le phénomène par lequel un ligand
photodissocié revient se fixer au fer est appelé la recombinaison géminée. Il est donc
possible de suivre dans le temps le retour vers la forme liée. Ce phénomène peut se
décomposer en différentes phases en fonction du temps (Figure 2.2). Lorsqu’un ligand
photodissocié demeure près du fer, celui-ci est susceptible de se recombiner très
rapidement. On parle alors de la phase géminée rapide. Lorsque le ligand s’éloigne
davantage du fer, le ligand est susceptible d’être piégé transitoirement à l’intérieur de
cavités. Le retour du ligand est alors retardé et on peut suivre dans le temps cette phase.
Enfin, une dernière phase concerne les ligands arrivant du solvant. La vitesse de cette phase
38
est fonction de la concentration du substrat à l’extérieur de la protéine. On parle alors de
cinétique bimoléculaire. Pour influencer l’une ou l’autre de ces phases, des mutations
peuvent être créées. Celles-ci sont alors susceptibles d’accélérer ou de retarder certaines
phases. Par exemple, à la figure Figure 2.2 (graphique de droite) montre un cas
hypothétique où une mutation limite la diffusion entre le fer et les cavités internes. Dans ce
cas, une plus grande proportion des ligands se combinent à nouveau au fer. Toutefois, pour
ce qui est des ligands s’étant éloignés davantage et étant contenu dans une ou plusieurs
cavités internes distantes, ceux-ci se recombinent moins fréquemment et cette phase se
trouve ralentie.
39
Figure 2.2 Cinétiques de recombinaison hypothétiques pour une globine donnée sous sa
forme sauvage (gauche) et pour un mutant (droite). Le moment de la photolyse du ligand
est indiqué par la flèche et les phases de recombinaison subséquentes sont identifiées. Chez
le mutant, la diffusion des ligands entre le site actif et les cavités internes est altérée. Dans
cet exemple schématique, la forme dissociée (5C) absorbe davantage que la forme associée
(6C) à la longueur d’onde utilisée. Ainsi, le bris du lien fer-ligand provoqué par l’impulsion
laser engendre une augmentation presque instantanée de l’absorbance. Dans le mutant, une
plus grande proportion des ligands photodissociés demeurent près du fer et se recombinent
rapidement. Pour la fraction des ligands ayant exploré la matrice enzymatique, les phases
subséquentes sont ralenties.
40
2.1.2. Cinétiques de liaison
Les cinétiques de liaison concernent l’étude de la diffusion du solvant vers le site actif du
ligand et la formation du lien avec le fer. Pour ce faire, on fait réagir un ligand gazeux avec
une préparation de la globine sous sa forme 5C (ferreux ou ferrique dépendamment du
ligand) et on mesure les vitesses de formation de la liaison fer-ligand. En portant en
graphique la vitesse de liaison en fonction de la concentration du substrat, on obtient la
constante bimoléculaire. Plus cette constante est élevée, plus rapidement le substrat atteint
le site actif. Dans certains cas, l’association du ligand au fer n’est limitée que par la vitesse
diffusion des molécules. Ceci indique que l’accès au fer est libre d’obstacle stérique et que
le fer est très réactif.
Chez la Mb, les cinétiques de liaison et de recombinaison ont été étudiées chez un grand
nombre de mutants [123, 124]. Les mutations ont été créées pour les résidus distaux et pour
un grand nombre de résidus éloignés du site actif. Certaines mutations ont provoqué des
effets plus importants que d’autres. Parmi celles-ci, le changement de l’histidine en position
E7 (His(E7)) pour un acide aminé de petite taille tel que l’alanine provoque l’accélération
des vitesses de liaison et favorise l’échappement du ligand photodissocié vers le solvant.
Les résultats de ces travaux suggèrent que les substrats transitent majoritairement par une
route contrôlée par la porte His(E7). Or, d’autres mutations éloignées du site actif ont
également provoqué des effets modérés. Ces mutations concernent en particulier les résidus
bordant des cavités qui correspondent aux sites Xe1 et Xe4 (Figure 2.1).
Pour obtenir des interprétations structurales et dynamiques de la diffusion interne des
ligands, d’autres méthodes doivent être employées. Ces méthodes renferment la diffraction
des rayons X à températures cryogéniques, la cristallographie de Laue résolue en temps réel
et les simulations de dynamique moléculaire.
41
2.1.3. Exemples d’applications
Chez les enzymes démontrant un seul tunnel spécifique, la mutagenèse dans le but de
restreindre la diffusion des substrats est généralement efficace afin de mettre en évidence
son rôle dans l’accès au site actif [96, 127-132]. La cytochrome c oxydase en est un bon
exemple [129]. Cette protéine présente dans sa structure un tunnel hydrophobe qui serait
favorable à la diffusion des ligands gazeux. D’autres routes sont également notées mais
celles-ci sont hydrophiles et permettraient la diffusion de l’eau et le transfert de protons.
Une seule substitution Gly→Val créée dans le but de bloquer la route hydrophobe a ralenti
les évènements de combinaison de l’O2 et du CO au site actif par plusieurs ordres de
magnitude [129]. Pour expliquer cet effet drastique, les auteurs ont postulé que la structure
de cette enzyme devait être très rigide près du site muté empêchant que d’autres routes se
forment dans le temps. Ceci donc confirmait en même temps que les routes hydrophiles
sont obstruées par des molécules d’eau.
Chez les protéines dont les structures révèlent plusieurs routes, les conclusions sont moins
claires. Chez la 12/15-lypoxygénase, seule une route parmi les trois prédites à l’aide de
calculs théoriques (échantillonnage implicite de ligands ou ÉIL) a été confirmée
expérimentalement [96]. Cette route confirmée permet à l’oxygène moléculaire d’atteindre
le site actif alors que les deux autres sont bloquées par le substrat, c’est-à-dire l’acide
linoléique. Chez l’amine oxydase à cuivre (AOC), deux chemins majeurs pour la diffusion
de l’O2 ont été identifiés par ÉIL[93]. Ces deux chemins se rejoignent au site actif de
l’enzyme. Des mutants créés dans le but de bloquer ces chemins individuellement a
provoqué de très faibles effets sur le ratio kcat/km signifiant que d’autres chemins
existent [93]. Pour expliquer ces résultats, les auteurs de ces travaux ont émis l’hypothèse
que d’autres routes peuvent se former suite à des mouvements dans la structure de
l’enzyme.
42
2.2. Diffraction des rayons X à températures cryogéniques
En 1994, la diffraction des rayons X à températures cryogéniques a permis les premières
observations expérimentales révélant la diffusion interne des substrats gazeux au cœur de la
Mb [133]. Avec cette méthode, on place d’abord les cristaux à très basses températures (10
à 20 K). Ensuite, le cristal est soumis à une impulsion laser afin de briser le lien fer-ligand.
Le bris du lien confère suffisamment d’énergie cinétique au ligand pour que celui-ci
explore momentanément la matrice protéique. Le ligand est alors susceptible d’être piégé à
l’intérieur d’une cavité interne. La température très basse limite par la suite grandement la
diffusion subséquente du ligand. L’acquisition des données de diffraction est ensuite
réalisée. Chez la Mb, ces travaux ont permis confirmer que le ligand photodissocié occupe
les différentes cavités correspondantes à différents sites xénon [119, 133-135]. Cette
méthode a servi de base pour le développement d’une autre technique beaucoup plus
puissante; la cristallographie de Laue résolue en temps réel.
2.3. Cristallographie de Laue résolue en temps réel
L’arrivée de la cristallographie de Laue résolue en temps réel constitue une avancée
majeure dans la compréhension de la dynamique des protéines et de la diffusion des
ligands [81-83]. Cette technique est devenue disponible au milieu des années 90 notamment
grâce à l’arrivée des synchrotrons de troisième génération. Ces derniers permettent de
générer des impulsions de rayon X très intenses en un temps court, soit environ 100
picosecondes (ps)) [82]. Cette technique permet de suivre dans le temps la position d’un
ligand suite à sa photodissociation à des températures ambiantes. En plus de la diffusion du
ligand, elle permet de caractériser en détail la relaxation de la protéine après la
photodissociation. Les échelles de temps couverts par cette méthode s’échelonnent de
100 ps à quelques millisecondes (ms). Comme avantage majeur, cette technique permet de
couvrir la plupart des différents mouvements se produisant chez les protéines (Figure 2.3).
43
Avec cette technique, le cristal est d’abord soumis à une impulsion laser de 7 ns provoquant
le bris du lien fer-ligand. L’acquisition des patrons de diffraction se fait à des intervalles de
temps prédéterminés après l’impulsion laser. Ces patrons de diffraction peuvent être
enregistrés plusieurs fois pour un même cristal, mais puisque les rayons X endommagent
les cristaux, plus d’un peuvent être nécessaires [82, 136]. Une fois les données analysées,
on obtient un film à l’échelle atomique montrant la diffusion du ligand photodissocié et de
la relaxation de la protéine. Comme découverte importante chez la Mb, il a été montré que
les hélices E et F relaxent rapidement suivant la photodissociation (~1 ns). Les molécules
de CO occupent principalement deux régions, soit la cavité distale et la cavité Xe1 [136].
L’occupation maximale du CO au site Xe1 survient 100 ns après la photodissociation de
concert avec la réorganisation d’une chaîne latérale (Leu89). Ces travaux n’ont pas révélé
d’augmentation de la densité électronique aux sites Xe2, Xe3 et Xe4. En ce qui concerne la
porte E7, ces travaux n’ont pas révélé de mouvement permettant le passage des ligands vers
l’extérieur [83, 136].
44
Figure 2.3 Échelles de temps des différents mouvements se produisant dans les protéines.
Les différentes méthodes permettant pour leur étude sont indiquées. Figure adaptée
de [137].
45
2.4. Simulations de dynamique moléculaire
La dynamique moléculaire (DM) permet de simuler le comportement d’un ensemble
d’atomes et de molécules en fonction du temps [80]. Les échelles de temps couvertes par la
DM s’échelonnent de la femtoseconde à la microseconde (Figure 2.3). Puisque la DM est la
méthode principale des travaux décrits dans cette thèse, le prochain chapitre y est dédié.
La DM a permis des avancées remarquables dans la compréhension de la diffusion des
ligands chez la Mb. D’abord, en 1979, l’utilisation de la porte E7 a été remise en question
par Case et Karplus [138]. Ces derniers s’étaient basés sur des trajectoires de DM et des
minimisations d’énergie montrant que le déplacement de l’His(E7) implique un coût trop
élevé en énergie. Ce faisant, l’ouverture de la porte His(E7) serait peu fréquente et
nécessiterait des fluctuations structurales importantes [138]. Deux autres voies de diffusion
à l’intérieur de la matrice protéique ont été proposées. Des travaux subséquents de DM et la
découverte des sites xénons ont également permis de proposer diverses routes de diffusion
internes [85, 88, 90, 122]. En 1990, Elber et Karplus ont précisé le modèle en montrant que
les ligands gazeux diffusent de cavité en cavité à l’intérieur de la Mb [88]. Ces derniers
avaient alors développé une nouvelle technique de simulation biaisée (« Locally Enhanced
Sampling ») favorisant l’exploration du ligand gazeux au cœur de la protéine. Cette
méthode a été utilisée dans cette thèse et elle est décrite plus en détail au prochain chapitre.
En 2004, le groupe d’Alfredo di Nola a été le premier à décrire les résultats d’une
simulation non biaisée de la diffusion du CO à l’intérieur de la Mb. Cette trajectoire, d’une
durée de 90 ns, mimait la diffusion du CO après sa photolyse. Les résultats de ces travaux
étaient grandement en accord avec les données de cristallographie de Laue résolue en temps
réel. Leurs travaux ont également permis de montrer que la diffusion du CO
s’accompagnait de la réorganisation de certaines chaînes latérales. Enfin, une importante
étude a été récemment publiée par Ruscio et coll [90]. Dans cette étude, un impressionnant
total de 68 simulations de 90 ns chacune ont été réalisées dans le but d’étudier la diffusion
du CO entre le solvant et le site actif. Dans 48 de ces simulations, le CO était dans le
solvant au départ des simulations et 16 évènements d’entrée ont été observés. Neuf
différents points d’entrées à la surface de la Mb ont été identifiés dont la porte E7. Une fois
46
internalisé dans la matrice de la Mb, le CO diffuse de cavité en cavité, en accord avec les
travaux précédents [85, 88]. Une approche similaire a également été menée dans les travaux
de cette thèse pour étudier la diffusion du •NO du solvant vers le site actif de TrHbN. Ces
travaux font l’objet du chapitre 7.
47
3.
Chapitre 3
Méthodologie
Le projet de doctorat présenté a été réalisé à l’aide d’une série d’outils bio-informatiques.
Le principal outil employé a été la dynamique moléculaire. D’autres programmes utiles à
l’étude des cavités et tunnels à l’intérieur de protéines ont également été utilisés. Ce
chapitre est dédié à présenter ces outils.
3.1. La dynamique moléculaire
La dynamique moléculaire est une méthode permettant de simuler numériquement le
comportement d’un ensemble de molécules et d’atomes en fonction du temps [80]. Elle est
employée dans plusieurs domaines de recherche. Parmi ceux-ci, notons la physique, la
science des matériaux et plus particulièrement la biochimie et la biophysique [139]. Avec
la puissance actuelle des ordinateurs, ces simulations permettent d’étudier des phénomènes
s’échelonnant de la femtoseconde (fs) jusqu’à la microseconde (μs). La dynamique
moléculaire (DM) est utilisée afin de répondre à plusieurs questions qui sont partiellement
accessibles, voire même inaccessibles, expérimentalement. En plus d’aider à
l’interprétation de données expérimentales, la DM sert également à émettre et à tester de
nouvelles hypothèses. Étant donné que la DM est la principale méthode utilisée au cours de
cette thèse de doctorat, celle-ci sera exposée plus en détail dans les prochaines sections.
3.1.1. Histoire de la dynamique moléculaire
Dès ses premiers pas, la DM a permis des avancées scientifiques importantes. La
méthodologie a été introduite par Alder et Wainwright à la fin des années 50 [140, 141].
48
Leurs travaux ont permis d’étudier le comportement d’un ensemble de sphères dures et
leurs simulations ont permis de faire des liens avec le comportement des liquides. En 1964,
un bond important a été fait avec la publication des résultats d’une simulation de l’argon
liquide [142]. En effet, ces simulations étaient plus réalistes car les atomes de xénon étaient
représentés à l’aide de sphères pénétrables (potentiel de Lennard-Jones). Les premières
simulations réalistes de l’eau liquide ont suivi 10 ans plus tard [143]. Dans ces travaux, les
molécules d’eau étaient représentées par un modèle à quatre charges. Ce modèle a permis
de reproduire plusieurs propriétés physiques de l’eau telles que la densité et le coefficient
de diffusion à différentes températures. Ce n’est qu’en 1977 que la première simulation
d’une protéine a été publiée par le groupe de Martin Karplus [80]. La protéine simulée était
l’inhibiteur trypsique pancréatique de bovin, une petite protéine monomérique composée de
58 acides aminés. Martin Karplus a qualifié cette protéine comme « l’atome d’hydrogène »
de la DM étant donné sa petite taille, sa grande stabilité et la disponibilité de sa structure
tridimensionnelle à une haute résolution (1.5Å) [144]. La trajectoire produite, d’une durée
de 9.2 ps et en absence de solvant, a permis de montrer que cette protéine bouge. Malgré le
temps de simulation court et le champ de force encore primitif, ces travaux ont permis de
révolutionner la biochimie structurale, remettant en question la conception des protéines en
tant que molécules rigides. Cette découverte a appuyé une nouvelle hypothèse reliant la
flexibilité des macromolécules biologiques à leurs propriétés biochimiques et leur
fonction [139]. Cette hypothèse a été confirmée par différents travaux. Par exemple, il a été
démontré que l’accès des substrats au site actif du lysozyme et de l’alcool déshydrogénase
est contrôlé par le mouvement d’une boucle [145, 146]. De même, la DM a permis de tester
et de proposer divers mécanismes reliant la dynamique de la Mb et la diffusion de l’O2 et
du CO entre le solvant et son site actif [88-90, 92, 138].
Bien que la DM soit apparue dans les années cinquante, son premier véritable essor est
survenu durant les années 80. Plusieurs phénomènes biophysiques ont été étudiés chez
diverses protéines et acides nucléiques. En plus de ces travaux, la DM s’est révélée un outil
précieux pour l’interprétation des paramètres de relaxation en résonance magnétique
nucléaire (RMN) [147, 148]. Également, un des premiers sujets traités par la DM est l’effet
de la température sur la structure et la dynamique des protéines [149-151]. Enfin, la DM
49
fait partie intégrante du raffinement des structures obtenues par cristallographie et
diffraction des rayons X et par RMN. Au cours des 20 dernières années, la DM s’est
grandement développée et popularisée d’une part grâce à l’amélioration des algorithmes de
calculs et d’autre part, à l’amélioration fulgurante du matériel informatique : accroissement
de la puissance des processeurs, parallélisation des ordinateurs, capacité de stockage
grandement augmentée, réseaux de plus en plus rapides. Ces améliorations ont permis
l’utilisation de modèles plus rigoureux, de simuler des systèmes de plus en plus grands et
d’étendre considérablement les temps de simulations [152]. L’applicabilité de la DM a du
même coup augmenté en permettant l’étude de mouvements se produisant sur de plus
grandes échelles de temps et de plus grande amplitude. Au début des années 90, les
systèmes typiques comprenaient quelques milliers d’atomes et les temps de simulations
pouvaient atteindre la centaine de picosecondes (ps). La plupart des simulations étaient
réalisées dans le vide. Dix ans plus tard, les systèmes comprenaient typiquement jusqu’à
quelques dizaines de milliers d’atomes et les temps de simulations pouvaient atteindre
quelques nanosecondes (ns) [152]. Ces simulations employaient également un solvant
explicite, c’est-à-dire en présence de molécules d’eau. Au début de 2010, le temps de
simulation dépasse couramment 100 ns et les systèmes comptent plusieurs dizaines de
milliers d’atomes.
3.1.2. Principes de base
La DM est une application dérivée de la mécanique moléculaire (MM). La MM est apparue
en 1930 [153] mais celle-ci ne s’est véritablement développée qu’à partir de la fin des
années cinquante, avec l’augmentation de la puissance des ordinateurs. La MM se base sur
l’approximation de Born-Oppenheimer [154]. Dans cette dernière, puisque les électrons ont
une vitesse grandement supérieure à celle des noyaux, ceux-ci sont implicitement décrits.
En MM, les atomes sont décrits comme des sphères ayant une masse, un rayon et une
charge. Le rayon est nécessaire au calcul du potentiel de Lennard-Jones alors que la charge
est requise pour le calcul de l’énergie électrostatique. Lorsque des molécules composent le
50
système simulé, des termes additionnels sont inclus pour représenter l’énergie interne. Ces
termes sont les énergies de liaison, d’angle et de torsion (dièdre). Le potentiel d’un système
donné est ainsi calculé à l’aide d’une fonction empirique appelée « champ de force » qui
inclut tous les termes d’énergie. Il existe plusieurs champs de forces, certains étant mieux
adaptés pour simuler certains types de système. Dans ce qui suit, nous nous concentrerons
sur celui qui a été utilisé pour les travaux effectués dans le cadre de cette thèse, soit
CHARMM22 [155]. Ce champ de force a été préféré pour les travaux de cette thèse
puisque celui-ci est optimisé pour la simulation des protéines.
La DM vise à simuler le comportement d’un ensemble d’atomes à une température finie en
fonction du temps. La DM s’appuie sur la seconde loi du mouvement Newton qui relie la
force avec l’accélération d’une particule et sa masse. L’accélération est liée au changement
de vitesse de la particule dans le temps.
(équation 3-1)
La position des atomes est connue au départ de la trajectoire. On utilise le plus souvent les
coordonnées issues d’une structure expérimentale. L’objectif de la DM est de déterminer
quelle sera la position de ces mêmes atomes au temps t + dt. En connaissant la vitesse de
chaque atome, on peut déterminer leur position dans le temps. Cependant, étant donné que
le système contient plusieurs atomes, il faut que dt soit court pour éviter des collisions entre
les atomes ou encore l’adoption de géométries non favorables comme par exemple un lien
covalent trop étiré. Pour les molécules étudiées en DM, le mouvement le plus rapide est la
vibration des liens C-H; pour une bonne intégration des équations du mouvement, il faut
choisir un intervalle de temps de 1/10 de cette fréquence, soit 1fs. La force est calculée en
dérivant une fonction d’énergie potentielle appelée communément champ de force.
( )
(équation 3-2)
51
La fonction d’énergie potentielle utilisée par CHARMM [156] est donnée par :
(équation3-3)
( ) ∑ ( )
∑ ( )
∑
( ( ))
∑
( ) ∑ ( )
∑
(( )
( )
) ∑
Les différents termes contenus dans cette équation sont explicités dans les prochaines
sections.
3.1.2.1. L’énergie interne
L’énergie interne est fonction de la géométrie des molécules composant le système.
Différents types de mouvements affectent cette géométrie (Figure 3.1). L’énergie de liaison
fluctue en fonction du mouvement de vibration entre deux atomes liés. L’énergie d’angle
est fonction du mouvement de cisaillement entre trois atomes liés. Quant à l’énergie
d’angle dièdre, celle-ci est fonction de l’angle décrit par deux plans définis par quatre
atomes liés. Par exemple, pour une phénylalanine, l’angle χ1 correspond à l’angle entre le
plan des atomes N-Cα-Cβ et le plan des atomes Cα-Cβ-Cγ. L’énergie d’angle dièdre impose à
la molécule d’adopter préférentiellement certaines conformations dans l’espace, celles-ci
correspondent à des minimums d’énergie locaux. Pour la chaîne latérale des acides aminés,
les différentes combinaisons favorables d’angles dièdres portent le nom de rotamères [157].
Le champ de force de CHARMM inclut d’autres termes d’énergie pour satisfaire certaines
contraintes structurales. L’énergie d’angle impropre sert à satisfaire différentes contraintes
structurales. Elle sert notamment à préserver la chiralité et la planarité de certaines
molécules. Le terme Urey-Bradley est un potentiel harmonique qui est fonction de la
distance entre atomes séparés par deux liens (interactions 1-3). Les termes d’énergie pour
les liaisons, les angles et les angles impropres se calculent selon un potentiel harmonique
alors que l’énergie d’angle dièdre se calcule à l’aide d’un terme
trigonométrique (équation 3-3).
52
Figure 3.1 Mouvements internes dans les molécules. Les mouvements de vibrations, de
cisaillement et de torsion sont illustrés.
3.1.2.2. L’énergie externe
L’énergie externe concerne les interactions entre atomes non liés et généralement séparés
par plus de 2 ou 3 liens. Ces interactions, appelées « interactions non liées », se
décomposent en l’énergie électrostatique (Coulomb), le potentiel de Lennard-Jones (L-J) et
les liaisons hydrogènes. L’énergie électrostatique entre deux atomes est fonction de la
charge portée par chaque atome. Deux atomes non liés de charges opposées vont s’attirer.
Ils se repousseront dans le cas contraire. Le potentiel de Lennard-Jones est aussi connu sous
l’appellation « potentiel 6-12 ». Le terme à la puissance 6 est la composante attractive
communément appelée forces de Van der Waals. Le terme à la puissance 12 est la
composante répulsive et celui-ci devient dominant à mesure que la distance devient courte
par rapport à la distance optimale (exclusion de Pauli). En ce qui a trait aux ponts
hydrogènes, les premiers champs de force utilisaient une variante du potentiel de
Lennard-Jones, soit le potentiel 10-12 :
((
)
(
)
) (équation 3-4)
Aujourd’hui, les champs de forces modernes traitent la liaison hydrogène à même l’énergie
électrostatique et le potentiel 6-12. Cette simplification permet de réduire les temps de
calcul sans réduire la précision du champ de force.
53
3.1.2.3. Les méthodes de troncations
Le nombre d’interactions non liées à calculer dans un système contenant plusieurs milliers
d’atomes représente une lourde charge informatique. En effet, la complexité de ce calcul est
de l’ordre Ο(N2) lorsque toutes les paires d’atomes non liés sont considérées. Pour réduire
cette complexité, on fait appel à des méthodes de troncations [158]. Ainsi, seules les paires
d’atomes séparés d’une distance inférieure à une limite fixée sont considérées.
Généralement, les distances de troncation sont de l’ordre de 8 Å à 12 Å [152]. L’utilisation
des méthodes de troncation réduit la complexité du calcul à Ο(N). Le fait d’annuler
abruptement le potentiel d’interaction au-delà de la limite de distance engendre des effets
non désirables sur la validité de la trajectoire [159]. En effet, cette manière de procéder
introduit une discontinuité dans les forces à la distance de troncation empêchant l’énergie
d’être conservée [152]. Pour éviter ce problème, il existe différentes méthodes où l’énergie
est amenée progressivement à zéro [158]. La méthode « Switch » amène le potentiel
d’interaction progressivement à zéro sur un court intervalle de distance prédéterminé,
généralement sur les derniers 2 à 4 Å [158]. Il existe également la méthode « Shift » où le
potentiel d’interaction est progressivement amené à zéro sur l’ensemble de la distance
considérée [158]. Il existe des variantes de ces méthodes où les potentiels sont altérés de
manière à annuler progressivement la force (méthodes « FSwith » et « FShift ») [158]. Les
méthodes de troncation sont convenables pour l’énergie de Van der Waals lors de la
simulation de système employant un solvant explicite car elle devient négligeable au-delà
de la distance de troncation.
Par contre, pour certaines paires d’atomes non liés, le potentiel électrostatique demeure non
négligeable à la distance de troncation. Ce problème peut être évité en employant la
méthode connue sous l’appellation anglaise « Particle Mesh Ewald ». Cette méthode est
présentée à la prochaine section.
54
3.1.2.4. La méthode « Particle Mesh Ewald »
La méthode connue sous l’appellation anglaise « Particle Mesh Ewald » (PME), est une
variante de la sommation d’Ewald [160]. Cette méthode a révolutionné la dynamique
moléculaire en considérant efficacement les interactions électrostatiques à longue distance.
Il a été démontré qu’il est important d’inclure ces interactions dans différents
systèmes [161], notamment pour la simulation des acides nucléiques. Son emploi augmente
par contre légèrement le temps de calcul, sa complexité étant de l’ordre Ο(N•log N).
Cette méthode requiert des systèmes avec conditions périodiques aux frontières (explicité à
la prochaine section, Figure 3.2). La méthode PME s’effectue en subdivisant d’abord le
système en une fine grille tridimensionnelle (résolution ~ 1 Å3). En fonction de la position
des atomes du système, une charge est assignée à chaque point de la grille. L’énergie
électrostatique est calculée en deux sommes. La première somme concerne les interactions
de courte portée qui sont explicitement calculées. Pour cette étape, les interactions à
calculer sont déterminées à partir d’une distance de troncation déterminée. La seconde
somme est réalisée par une transformée de Fourier rapide (FFT) pour obtenir le potentiel
électrostatique en fonction de la distribution des charges sur la grille. Pour chaque point de
la grille, l’énergie est calculée en différenciant numériquement le potentiel. La force
s’exerçant sur chaque atome est calculée en interpolant l’énergie sur la grille.
3.1.2.5. Conditions périodiques aux frontières
De manière courante, les simulations de protéines sont réalisées en présence d’un solvant
explicite, c’est-à-dire en incluant les molécules d’eau dans le système. Le système est alors
contenu à l’intérieur d’une boîte de simulation dont la géométrie permet l’utilisation de
conditions périodiques aux frontières (Figure 3.2). Pour appliquer des conditions
périodiques aux frontières, il suffit de répliquer le système simulé de manière à remplir
complètement l’espace tridimensionnel autour de ce système. Les répliques portent le nom
d’images. Lorsqu’une molécule sort à l’extérieur de la boîte de simulation, la molécule est
remplacée par la molécule correspondante provenant d’une image voisine. Ainsi, le nombre
55
de particules dans le système demeure constant. Les interactions non liées aux frontières
tiennent compte des particules contenues dans les images voisines.
Figure 3.2. Conditions périodiques aux frontières d’un système en 2D. Le système simulé,
au centre, est répliqué 8 fois. Dans un système cubique, 26 images sont requises.
3.1.3. Production de la trajectoire
Comme mentionné précédemment, l’objectif de la DM est de simuler le mouvement des
atomes et des molécules dans le temps. Grâce au champ de force, on peut résoudre
l’équation du mouvement en dérivant la fonction d’énergie potentielle :
( )
(équation 3-5)
Pour connaître la nouvelle position, il faut intégrer la force :
∬ ∬
(équation 3-6)
56
L’intégration numérique se fait sur des intervalles de temps très courts. L’intervalle de
temps (Δt), ou pas de temps, est fixé de manière à ce qu’il soit plus court que la période du
mouvement avec la plus haute fréquence. Pour les systèmes biologiques, la vibration des
liens covalents impliquant un atome d’hydrogène présente la plus courte période de temps
(~10-14
s), donc utilisation d’un temps d’intégration de 10-15
s). Pour atteindre des
simulations plus longues sans augmenter le temps de calcul, il est avantageux de restreindre
ces liens à leur longueur d’équilibre. Ceci permet d’utiliser un pas de temps (Δt) plus long.
Il existe différentes méthodes pour y parvenir, SHAKE étant celle utilisée avec CHARMM
[162]. En utilisant ces approximations, le pas de temps permis est alors typiquement de une
à deux femtoseconde(s) (fs).
Pour obtenir une trajectoire, l’intégration se fait de manière itérative jusqu’à l’obtention de
la durée de simulation désirée. Ce processus peut se faire selon divers algorithmes
informatiques appelés « intégrateurs ». L’intégrateur le plus couramment utilisé est celui de
Verlet (« leapfrog ») [163]. La méthode de Verlet est basée sur une série de Taylor et se
décompose en trois étapes (Figure 3.3). Au départ du calcul, la position de chaque atome
est connue et la force peut être calculée par la fonction d’énergie potentielle (équation 3-5),
et une vélocité de départ est assignée à chaque atome. Ensuite la vitesse au temps t+Δt/2 est
obtenue par :
(
) (
)
( ) (équation 3-7)
On se sert ensuite de la force et des positions au temps t et des vitesses estimées aux temps
t-Δt/2 et t+ Δt/2 pour déterminer la position au temps t+Δt.
( ) ( )
[ (
) (
)]
( )
(équation 3-8)
Le processus est ensuite recommencé un grand nombre de fois jusqu’à la durée de
trajectoire désirée.
57
Figure 3.3 Algorithme de Verlet pour l’intégration de l’équation de mouvement. La
première étape consiste à calculer les forces en fonction de la position de tous les atomes. À
la deuxième étape, les forces et les masses des atomes sont utilisées pour calculer les
vitesses aux temps t ± Δt/2. À partir des vitesses, on peut déterminer la nouvelle position
des atomes au temps t + Δt.
58
3.2. Simulation des protéines par dynamique moléculaire
La simulation d’une protéine par DM se fait selon quatre grandes étapes (Figure 3.4)
Figure 3.4 Schéma des grandes étapes de la dynamique moléculaire
3.2.1. Préparation du système
La première étape consiste à la préparation du système que l’on veut simuler. Le système
idéal est celui qui reflète le plus fidèlement les conditions expérimentales pour lesquelles
nous avons des données (ex. force ionique, pH, concentration du substrat, état de
protonation des acides aminés ionisables). Pour construire ce système, il faut d’abord
obtenir les coordonnées cartésiennes de la protéine. Le plus souvent, on utilise une structure
déterminée expérimentalement, le plus couramment par cristallographie et diffraction des
rayons X. Si les coordonnées expérimentales ne sont pas disponibles, celles-ci peuvent être
parfois obtenues par modelage par homologie ou à l’aide d’outils de prédiction de
structures tridimensionnelles. Dans ce dernier cas, la structure obtenue peut contenir des
erreurs se répercutant sur le calcul de DM et ainsi, sur la validité des données que l’on en
tirera. L’état de protonation des résidus ionisables doit être fixé en fonction de leur pKa
respectif et le pH expérimental. Le plus souvent, les protéines sont simulées en présence
d’un solvant explicite. Dans ce cas, la protéine est placée à l’intérieur d’une boîte d’eau qui
a été préalablement équilibrée à la température de simulation désirée. Les molécules d’eau
se trouvant à moins d’une certaine distance (~2.4 à 2.8 Å) de tout atome de la protéine sont
Préparation
du système
Initiation et
équilibration Production Analyse de la
trajectoire
Dynamique moléculaire
59
éliminées du système. La couche d’eau entre la protéine et les frontières de la boîte de
simulation est d’au moins 10 Å [152]. Des ions sont ajoutés dans la boîte de simulation
afin de neutraliser le système et/ou reproduire la force ionique expérimentale. La neutralité
du système est nécessaire si l’énergie électrostatique est évaluée à l’aide de la méthode
« Particle Mesh Ewald (PME) »[160]. Avant de démarrer le calcul de DM, une
minimisation d’énergie peut être nécessaire. Généralement, la minimisation se fait en
conservant les coordonnées de la protéine fixées et ce faisant, les contacts entre la protéine
et le solvant sont optimisés. Il arrive parfois que la structure de la protéine renferme des
conformations non favorables nécessitant une minimisation d’énergie appliquée localement
(exemple, distance entre deux atomes trop courte).
3.2.2. Initiation et équilibration
La seconde étape consiste à l’initiation du calcul de DM et à l’équilibration. Pour ce faire,
une vitesse initiale est attribuée à chaque atome du système. Ces vitesses sont tirées d’une
distribution gaussienne en accord avec la température désirée. La température de départ est
habituellement plus basse que la température de simulation désirée. Le système est ensuite
réchauffé en augmentant progressivement les vitesses jusqu’à la température désirée.
Lorsque le réchauffement est terminé, la simulation entre en mode « équilibration ». Le
temps de simulation requis à l’équilibration varie d’un système à un autre. Pour vérifier si
le système est à l’équilibre, plusieurs observables physiques et biophysiques sont analysés.
Parmi ceux-ci, il y a l’énergie du système, le volume de la boîte de simulation, la
température et la pression. Pour ce qui est des observables biophysiques, la déviation de la
structure par rapport la structure de départ (« RMSD » ou « root mean squared deviation »)
ou encore la fluctuation de la surface accessible au solvant en fonction du temps peuvent
être suivies.
60
3.2.3. Production et analyse de la trajectoire
Lorsque l’équilibre est atteint, la simulation se poursuit, mais on dit alors que la simulation
entre en mode « production ». C’est cette partie de la trajectoire qui est utilisée pour les
analyses. De façon périodique, les coordonnées du système sont enregistrées pour ces
analyses, généralement une fois à chaque ps.
Le temps de simulation en mode production dépend des phénomènes que l’on veut étudier.
De longues simulations permettront d’étudier des phénomènes plus lents ou encore
observer des changements de conformation moins fréquents (meilleur échantillonnage). La
Figure 2.3 montre les échelles de temps des différents mouvements dans les protéines en
lien avec différentes méthodes utilisées. Dans l’optique de la présente thèse, les temps de
simulations total nécessaire pour étudier la diffusion des molécules de substrat gazeux à
l’intérieur de différentes enzymes varie typiquement entre 10 ns et 6 µs [85, 90, 92, 93, 96].
L’analyse d’une trajectoire donnée débute dès l’initiation du calcul de DM. Plusieurs
éléments doivent être analysés. Certains d’entre eux sont importants pour s’assurer que la
trajectoire en cours est stable. Entre autres, l’évolution dans le temps de l’énergie
potentielle, de la température, du volume et de la pression du système simulé. En ce qui a
trait à la protéine simulée, les observables d’intérêts sont nombreux et variés. Par exemple,
on peut s’intéresser à la dynamique de la chaîne principale, à la conformation dynamique
du site actif de la protéine ou encore à la dynamique essentielle. Pour TrHbN, l’étude de la
dynamique des tunnels présente un intérêt certain. Les principales méthodes utilisées pour
ce type d’étude sont traitées à la section suivante.
3.3. Étude de la dynamique des tunnels
Le rôle des tunnels dans les protéines est lié à la diffusion des substrats et des produits.
L’utilisation de la DM a révélé que la morphologie des tunnels est changeante en fonction
61
du temps et pour cette raison, l’étude de la dynamique des tunnels n’est pas triviale [115].
L’inspection visuelle des trajectoires en utilisant des outils de visualisation moléculaire tel
que PyMOL [27] peut permettre d’identifier une ou plusieurs route(s) de diffusion
potentielle(s). Par contre, pour obtenir une meilleure description de la dynamique de ces
tunnels, d’autres outils doivent être utilisés en complément. Il existe quelques outils bio-
informatiques récents et spécialement conçus à cette fin. Les outils les plus utilisés sont
CAVER [115] (MOLE [164]) et l’échantillonnage implicite de ligands [89]. Il existe
également le programme HOLE, dédié à l’étude des canaux ioniques dans les membranes,
mais celui-ci est plutôt mal adapté pour l’étude des tunnels dans les protéines [165]. Pour
étudier la dynamique des tunnels, ces outils bio-informatiques nécessitent d’abord une
trajectoire de DM.
3.3.1. CAVER
CAVER est un outil qui permet de détecter et de caractériser les routes de diffusion les plus
probables à l’intérieur d’une protéine [115]. Le programme MOLE [164] est une version
dérivée de CAVER mais c’est encore ce dernier qui continu à être préféré et développé.
CAVER utilise la théorie des graphes et plus précisément une variation de l’algorithme de
Dijkstra [166] afin de trouver le ou les meilleur(s) chemin(s) pour atteindre l’extérieur de la
protéine à partir d’une coordonnée interne définie par l’utilisateur. L’algorithme de
CAVER découpe d’abord la protéine selon une grille tridimensionnelle puis calcule en tout
point la distance avec l’atome de la protéine le plus près. Dans une seconde étape,
l’algorithme trouve le(s) tunnel(s) le(s) plus facile(s) permettant d’atteindre l’extérieur de la
protéine. Pour chaque tunnel détecté, CAVER décrit l’amplitude de l’ouverture le long du
tunnel. En analysant plusieurs étapes de DM avec CAVER, on obtient une meilleure
caractérisation du ou des tunnels. Il existe d’autres programmes dédiés au calcul du volume
de cavités (analyse volumétrique) tel que VOIDOO [167] mais CAVER présente deux
avantages majeurs par rapport à ceux-ci. Le premier consiste au fait que CAVER n’utilise
pas une sphère de rayon de sonde fixe ce qui permet de passer à travers les pincements le
long du tunnel. À l’opposé, les outils d’analyses volumétriques ne peuvent détecter qu’une
62
seule cavité isolée. Le second avantage est que CAVER, avant l’analyse même des tunnels,
délimite la surface de la protéine. Cette étape est cruciale pour permettre à CAVER de
déterminer où se termine un tunnel. Chez les outils d’analyses volumétriques, l’absence de
cette fonctionnalité est problématique lorsque la cavité est en continuum est l’extérieur de
la protéine. Le volume calculé est alors largement surestimé.
3.3.2. Échantillonnage implicite de ligand
L’échantillonnage implicite de ligand (ÉIL) est une méthode puissante qui est devenue
disponible au cours des travaux décrits dans cette thèse [89]. L’ÉIL permet de déterminer
les routes de diffusion de molécules gazeuses les plus probables à l`intérieur d’une
protéine. Pour y parvenir, le changement d’énergie libre associé au placement d’une
molécule mono- ou diatomique donnée (ex. O2, CO, Xe) est calculé en tout point à
l’intérieur de la protéine. Cette méthode s’appuie sur l’hypothèse que les molécules de gaz
interagissent faiblement avec la protéine et donc affectent peu la dynamique de la protéine.
Un grand nombre de jeux de coordonnées, tirées de la trajectoire de DM est nécessaire, soit
généralement > 5000 pour assurer une erreur minimale. Une fine grille tridimensionnelle
(résolution ~ 1 Å3) couvrant tout le système est d’abord définie. Dans chacun des cubes de
cette grille, un ligand donné est positionné sous diverses positions et orientations (si ligand
diatomique). Le potentiel de Lennard-Jones est calculé pour chacune de ces conformations
(équation 3-4). Le potentiel de force moyen (PFM), c’est-à-dire le changement d’énergie
libre associé au positionnement du ligand en un point quelconque du système, peut donc
être estimé. Le changement d’énergie libre est une quantité très pertinente, car celle-ci est
directement reliée à la probabilité de trouver un ligand à une position donnée. L’énergie
libre est calculée selon l’équation
63
( ) ∑∑ ( )
(équation 3-9)
où G(r) est le changement d’énergie libre associé au placement d’un ligand donné à la
position r, kB est la constante de Boltzmann, T est la température, N est le nombre d’étapes
de DM utilisées, C est le nombre de conformations du ligand testées (positions et rotations),
ΔEn,k(r) est l’énergie d’interaction entre le ligand et le système à la position r à une
conformation (k) et une étape de DM (n) données. Les calculs sont réalisés par l’outil
volutil disponible sur le site internet du groupe du Pr. Klaus Schulten
(http://www.ks.uiuc.edu/Development/MDTools/volutil). Après ces calculs, une carte
tridimensionnelle du PFM est obtenue. Cette carte peut être facilement interprétée avec
l’outil de modélisation moléculaire VMD [168].
Comme mentionné précédemment, l’énergie d’interaction calculée ne prend en compte que
le potentiel de Lennard-Jones. Ceci peut être problématique lorsque le ligand utilisé a un
dipôle comme le monoxyde de carbone ou l’oxyde nitrique. Malgré cette approximation,
les énergies libres de solvatation obtenue avec cette méthode sont très près des valeurs
expérimentales [89]. L’ÉIL présente une autre limitation, soit la surestimation des valeurs
d’énergie libre élevées [89]. Cette tendance se vérifie par l’équation
( ) [ [ ( ) ]
]
Équation 3-10
où ΔG-(r) est l’erreur inférieure sur le PFM calculé G(r), N est le nombre d’étapes de DM
utilisées, ΔEmin est une valeur d’énergie correspondant à l’énergie d’interaction entre le
ligand gazeux et son environnement dans les conditions les plus favorables. Cette dernière
valeur d’énergie est déterminée à partir d’une simulation d’un ligand explicite dans une
boîte d’eau. Lorsque la valeur du PFM est élevée par rapport à ΔEmin, l’erreur tend à être
64
beaucoup plus importante. Cette erreur doit alors être contrebalancée par un
échantillonnage plus élevé sans quoi la valeur du PFM risque d’être surestimée.
3.3.3. L’échantillonnage amélioré de ligands
L’échantillonnage amélioré de ligand (« Ligand Enhanced Sampling ») (LES) est une
technique de simulation biaisée développée il y a près de 20 ans. Elle a été utilisée pour la
première fois par Elber et Karplus pour l’étude de la diffusion du CO à l’intérieur de la
myoglobine [88]. Il a été démontré très récemment que la diffusion complète du CO entre
la cavité distale et l’hème nécessite plusieurs dizaines de nanosecondes [90, 169]. Au début
des années 90, la puissance des ordinateurs ne permettait pas de produire de telles
trajectoires. La méthode LES utilise une astuce pour favoriser l’exploration du CO à
l’intérieur des protéines. Dans cette technique, le substrat simulé est libre et répliqué un
certain nombre de fois. Chacune des copies du substrat est invisible l’une par rapport à
l’autre. Les interactions non liées entre la protéine et le substrat sont quant à elles
multipliées par un facteur 1/N, où N est le nombre de copies du substrat. Ce faisant, les
molécules de substrats peuvent plus facilement traverser les barrières stériques et donc
explorer plus rapidement l’espace interne accessible à l’intérieur de la protéine. Le grand
nombre de copies augmente du même coup l’échantillonnage. Les routes de diffusion mises
en évidences peuvent ensuite être caractérisées plus en détail.
Contrairement à l’ÉIL, cette méthode permet difficilement de calculer précisément le PFM
pour la diffusion des ligands. Le PFM étant fonction de la probabilité de trouver un ligand
en tout point dans la protéine [89], il faut générer un grand nombre de simulations pour y
parvenir. Sans PFM, il est de plus ardu de prédire quelle sera la ou les route(s) de diffusion
privilégiée(s). Malgré que plusieurs molécules de substrats soient inclues dans le système
lors d’une simulation, les copies de substrats s’influencent indirectement par leur
interaction avec la protéine. Par conséquent, elles visiteront plus fréquemment les mêmes
endroits. De plus, dans ce type de simulation, l’exploration de la matrice protéique est
souvent contrainte artificiellement à une région limitée de l’espace [89]. En somme, la
65
méthode LES est efficace pour rapidement mettre en évidence plusieurs routes de diffusion
possible. Par contre, la carte tridimensionnelle de la diffusion des ligands à l’intérieur de la
matrice protéique ainsi que sa compréhension (PFM) peut ne pas être complète.
66
4.
Chapitre 4
Objectifs du projet de recherche
L’enzyme TrHbN protège la respiration aérobie de Mycobacterium bovis BCG contre
l’effet inhibiteur du •NO et catalyse efficacement la réaction NOD (k`NOD ≈ 745 µM-1
s-1
à
23°C) [22]. La vitesse de cette réaction s’approche même de celles limitées par la diffusion
des substrats [43, 44]. Dans ce contexte, le sujet de cette thèse vise à mieux comprendre les
relations existant entre la structure de TrHbN, sa dynamique et sa fonction. En particulier,
la dynamique du site actif et des tunnels ainsi que la diffusion interne •NO ont étudié en
détail.
4.1.1. Objectif général
L’objectif général de ce projet de doctorat est la caractérisation de la structure et de la
dynamique de TrHbN en solution sous ses formes oxygénée, deoxy et cyanomet en
présence et en absence de substrats libres à l’aide de différentes approches théoriques.
4.1.2. Objectifs spécifiques
1. Étude de la dynamique d’une molécule d’eau au site actif de deoxy-TrHbN et son
impact sur les cinétiques de liaison de substrat gazeux.
1.1. Étudier la persistance et l’espace visité par une molécule d’eau dans la cavité
distale de la forme deoxy de TrHbN et celle des mutants Gln58(E11)Val,
Tyr33(B10)Phe et le double mutant Gln58(E11)Val+Tyr33(B10)Phe.
1.2. Interpréter les résultats en relation avec les données expérimentales.
67
2. Investigation de la diffusion du •NO dans les tunnels de TrHbN.
2.1. Identifier le ou les site(s) d’entrée et/ou de sortie à la surface de TrHbN.
2.2. Étudier la diffusion du •NO dans la matrice de TrHbN.
2.3. Étudier les interactions entre le •NO libre et TrHbN et leurs impacts sur la structure
et la dynamique de TrHbN.
2.4. Étudier par dynamique moléculaire des mutants dont les tunnels ont été bloqués et
interpréter les résultats en relation avec des données de cinétiques enzymatiques.
3. Étude de TrHbN sous sa forme Fe3+
CN- en alliant conjointement la dynamique
moléculaire et la résonance magnétique nucléaire.
3.1. Étudier de la dynamique de la chaîne principale.
3.1.1. Comparer et interpréter les paramètres d’ordre généralisés S2 des liens N-H
du plan peptidique.
3.1.2. Comparer et interpréter les modèles de relaxation des vecteurs N-H du plan
peptidique
3.1.3. Comparer et analyser différents observables issus de trajectoires de DM en
lien avec des données d’échange d’amides du plan peptidique.
Cette thèse de doctorat présente les résultats obtenus en vue de la réalisation de ces
objectifs. Les résultats obtenus pour l’objectif 1 sont détaillés dans le chapitre 5. Les
travaux en lien avec les objectifs 2.1 et 2.2 sont détaillés dans le chapitre 6. Les chapitres 7
et 8 présentent des travaux en lien avec les objectifs 2.3 et 2.4 respectivement. Quant-à-lui,
le chapitre 9 décrit les travaux réalisés dans le cadre de l’objectif 3. Enfin, le chapitre 10
présente une discussion générale sur les travaux réalisés et propose des perspectives de
recerches.
68
5.
Chapitre 5
Ligand Binding to Hemoglobin N from Mycobacterium
tuberculosis is Strongly Modulated by the Interplay between
the Distal Heme Pocket Residues and Internal Water
5.1. Résumé
La survie de Mycobacterium tuberculosis requiert la détoxification du •NO produit par l’hôte. La
forme oxygénée de l’hémoglobine tronquée N de Mycobacterium tuberculosis catalyse
efficacement l’oxydation du •NO en nitrate (constante bimoléculaire de second ordre de k´NOD ≈
745 × 106 M
-1s
-1), soit 15 fois plus que la réaction catalysée par la myoglobine extrait du cœur du
cheval. Nous nous sommes intéressés à déterminer quels sont les aspects de la structure et/ou de
la dynamique de la protéine qui confèrent une telle réactivité. Une première étape consiste à
exposer les éléments contrôlant la liaison des ligands et substrats à l’hème. Nos travaux ont
soulevé des indices selon lesquels la barrière principale à la liaison des ligands à deoxy-TrHbN
consiste au déplacement d’une molécule d’eau présente dans la cavité distale de l’hème, laquelle
étant principalement stabilisée par la Y(B10) tout en demeurant non-coordonnée au fer. Comme
observé dans des mutants apolaires des résidus Tyr(B10)/Gln(E11) chez lesquels cette barrière
cinétique est moindre, la liaison du CO et de l’O2 est très rapide avec des vitesses avoisinant de 1
à 2 × 109 M
-1s
-1. De telles vitesses représentent presque certainement les vitesses de liaison à une
hemoprotéine les plus rapides connues et indiquent que l’atome de fer à l’intérieur de TrHbN est
hautement réactif. Des mesures cinétiques sur le produit photodissocié de la forme •NO de met-
TrHbN, où le •NO et l’eau peuvent être suivis directement, révèlent que la liaison de l’eau est
très rapide (1.49 × 108 s
-1) et est responsable de la faible fraction de recombinaison géminée chez
TrHbN. Des simulations de dynamique moléculaire, réalisée avec TrHbN et quelques mutants du
site distal, indiquent que dans l’absence de la molécule d’eau distale, l’accès du ligand au fer est
libre. Ces simulations montrent aussi que la molécule d’eau est stabilisée tout près du fer par
l’entremise de liaison hydrogènes avec les résidus Tyr(B10) et Gln(E11).
69
5.2. Abstract
The survival of Mycobacterium tuberculosis requires detoxification of host •NO. Oxygenate
Mycobacterium tuberculosis truncated hemoglobin N catalyzes the rapid oxidation of nitric
oxide to innocuous nitrate with a second-order rate constant (k´NOD ≈ 745 x 106 M
-1·s
-1), which is
~15-fold faster than the reaction of horse heart Mb. We ask what aspects of structure and/or
dynamics give rise to this enhanced reactivity. A first step is to expose what controls
ligand/substrate binding to the heme. We present evidence that the main barrier to ligand binding
to deoxy-TrHbN is the displacement of a distal cavity water molecule, which is mainly stabilized
by residue Tyr(B10) but not coordinated to the heme iron. As observed in the
Tyr(B10)/Gln(E11) apolar mutants, once this kinetic barrier is lowered, CO and O2 binding is
very rapid with rates approaching 1-2 x 109 M
-1·s
-1. These large values almost certainly represent
the upper limit for ligand binding to a heme protein and also indicate that the iron atom in
TrHbN is highly reactive. Kinetic measurements on the photoproduct of the •NO derivative of
met-TrHbN, where both the •NO and water can be directly followed, revealed that water
rebinding is quite fast (~ 1.49 x 108 s
-1) and is responsible for the low geminate yield in TrHbN.
Molecular dynamics simulations, performed with TrHbN and its distal mutants, indicated that in
the absence of a distal water molecule, ligand access to the heme iron is not hindered. They also
showed that a water molecule is stabilized next to the heme iron through hydrogen-bonding with
Tyr(B10) and Gln(E11).
5.3. Introduction
•NO plays an important role in host defense against microbial pathogens by inhibiting or
inactivating key enzymes such as the terminal respiratory oxidases (1-5) and the iron/sulfur
protein aconitase (6,7). •NO also combines at near diffusion-limited rate with superoxide
produced by respiring cells to form the highly oxidizing agent peroxynitrite (8,9). •NO-
metabolizing reactions are thus required to defend microbial pathogens against •NO poisoning.
70
In Mycobacterium tuberculosis the glbN gene encodes the truncated hemoglobin N (TrHbN)
(Fig. 5.1). Inactivation of glbN in Mycobacterium bovis BCG impairs the ability of stationary
phase cells to protect aerobic respiration from nitric oxide (•NO) inhibition, suggesting that
TrHbN may protect M. tuberculosis from •NO toxicity in vivo (10). This functional assessment
is supported by the observation that TrHbN catalyzes the rapid oxidation of •NO to nitrate
[TrHbN(Fe2+
-O2) + •NO → TrHbN(Fe3+
) + NO3-], with a second-order rate constant k´NOD ≈ 745
x 106 M
-1·s
-1 (23°C) (10). The nitric oxide dioxygenase (NOD) reaction catalyzed by TrHbN is at
least 15-fold faster (k´NOD ≈ 45 x 106 M
-1·s
-1 at 23°C) than the one recorded for horse heart
myoglobin (Mb) and is almost as efficient as the diffusion-controlled reaction of •NO with free
O2 . A critical issue in this context is what aspects of structure and/or dynamics give rise to this
enhanced reactivity. A first step is to expose what controls ligand/substrate binding to the heme.
Once the ligand/substrate accesses the distal heme pocket (DHP), the issue of reactivity focuses
on local factors such as iron reactivity and steric effects originating within the DHP. Inspection
of Mb and TrHbN structures shows that in Mb the imidazole ring of the proximal His is in an
eclipsed orientation with respect to the pyrrole nitrogen atoms. In contrast, that in TrHbN is in a
staggered geometry, suggesting reduced repulsive interactions between the imidazole ring and
the pyrrole nitrogen atoms and a stronger heme-iron bond (higher iron reactivity). This
assessment is supported by resonance Raman studies of deoxy-TrHbN and Mb also indicating a
stronger Fe-His bond in TrHbN (11). Based on the favorable proximal environment, one would
anticipate faster combination rates and higher geminate yields for TrHbN relative to Mb.
Surprisingly both proteins bind O2 with relatively similar rates and the geminate yields for CO
are both comparably low in the few percent range at ambient conditions (12,13). These
observations reveal that significant distal factors dictate the binding properties of TrHbN.
There are several categories of distal effects that can modulate ligand binding. Steric effects from
the side chains of distal residues can increase the barrier for binding through either static
positioning or relaxation subsequent to ligand dissociation and diffusion. In our earlier work, that
showed a dramatic increase in the geminate yield with increasing solvent viscosity, we
postulated that viscosity dependent relaxations of side chains were responsible for the large
changes in the geminate yield (13). In the present study, this hypothesis is reexamined along with
consideration for another potential distal contribution arising from water occupying the DHP.
71
Ligand binding to ferrous (Fe2+
) and ferric (Fe3+
) Mb requires the displacement of a water
molecule that is hydrogen-bonded to the distal His(E7) residue side chain (14-21). In ferric Mb,
the distal water molecule coordinates as a weak ligand, while in the ferrous derivative it occupies
a site in the DHP, blocking access to the heme iron but, at most, it only transiently interacts with
the ferrous heme iron (22). Kinetic data supports the concept that the distal water molecule
increases the enthalpic contribution to the kinetic barrier by sterically hindering ligand access to
the heme iron (14,17-19,23,24). Static and dynamic steric contributions to such barrier have been
previously shown for various DHP side chains including that of His(E7) in Mb (14,15,17-
19,23,25-29). The His(E7) stabilized DHP water molecule can be viewed as increasing the
effective size of the sterically active His(E7) side chain. In agreement, photolysis experiments on
Mb(Fe2+
-CO) and Mb(Fe3+
-NO) show that substitutions of His(E7) by different apolar residues
resulted in enhanced ligand rebinding rates which are quantitatively related to the lack of
occupancy of the distal water molecule (14-21,30).
In the present work, we examined the ligand binding properties of TrHbN bearing mutations at
residues Tyr(B10) and Gln(E11). Our results indicate that both the main barrier to ligand binding
to deoxy-TrHbN and the origin of the low geminate yield are due to the presence of Tyr(B10)
stabilized water within the DHP at a site that blocks access to the heme iron. Such proposal is
further supported by the observation that in the Tyr(B10)/Gln(E11) double mutants, where side
chain stabilization of the DHP water molecule is not possible, the combination rate becomes very
rapid with rates approaching those measured for diffusion-controlled reactions and the geminate
yield increases by almost two orders of magnitude.
5.4. Experimental procedures
5.4.1. Mutagenesis, expression and purification
Recombinant TrHbN and mutants were expressed and purified as previously described (31).
Flash-photolysis experiments – Laser flash-photolysis studies were carried out using the LKS.60
Spectrometer from Applied Photolysis (Leatherhead, U.K.) at 23°C. Photolysis was initiated by a
72
5 ns pulse of light at 532 nm provided by a Brillant B Nd:YAG laser (QUANTEL S.A., Fr.).
Absorbance changes were measured using the monochromator-filtered light from a 150 W xenon
arc lamp. Passing through the sample, the probe light beam was refocused on the slits (slits
widths at 1 mm) of a second monochromator. Changes in transmitted probe light intensity were
detected by a 1P28 PMT coupled with a HP 54830B DSO digital oscilloscope (Agilent
Technologies Inc., USA) and transferred on a RISC platform PC (Acorn, U.K.) for processing.
An average of at least ten kinetic traces from at least two separate experiments were averaged
and analyzed with the instrument manufacturer software (Applied Photolysis, U.K.) to obtain the
rate constants. Plots of the pseudo first-order rate constants and plots showing absorbance
changes following •NO photolysis were obtained using the KaleidaGraph software (Synergy
Software, USA).
Protein samples for the flash-photolysis experiments were used at concentrations ranging from
1.5 μM to 10 μM and buffered in anaerobic 50 mM potassium phosphate pH 7.5 containing
50 μM EDTA The ferric and deoxy protein samples were prepared in a glovebox as described
previously (31) and put into a gastight quartz cuvette with a 5 mm path length. To obtain the
desired complexes, the deoxy and ferric samples were equilibrated with different concentrations
of either O2, CO or •NO provided by a series 4000 gas mixing system from Environics (Tolland,
CT). Combination rates for CO and O2 were followed at wavelengths ascribed to maxima and
minima in either the TrHb(Fe2+
-CO) or the TrHb(Fe2+
-O2) minus the TrHb(Fe2+
) differencial
spectra. In order to study the extend of water regulation on ligand binding to Mb and TrHbN,
•NO recombination kinetics were followed over a broad timescale (ns - ms) and at specific
wavelengths corresponding to isobestic points between the (Fe3+
-H2O), (Fe3+
-NO) and (Fe3+
)
5-coordinate (5C) species [Fig. 5.2 and ref (21)]. Absorption spectra were recorded before and
after time course measurements to ensure the integrity of the samples.
5.4.2. Geminate and solvent phase recombination experiments
Geminate and solvent phase recombination measurements were carried out using 8 ns 532 nm
pulses at 1 Hz from a Nd:YAG laser (Minilite, Continuum, Santa Clara, CA) as a
73
photodissociation source and a greatly attenuated continuous wave 442 nm probe beam from a
He:Cd laser to monitor time dependent changes in absorption. Details of the apparatus, data
collection and data display can be found in a previous publication and citations therein
(13,26,32). The kinetic traces are displayed on a log-log plot of normalized absorbance
(proportional to the survival probability of the photoproduct) versus time.
Kinetic measurements were typically carried out on solution samples (~ 0.25 - 0.5 mM in heme)
contained in standard 1 mm stoppered cuvettes placed in a custom-built dry N2 purged variable
temperature cuvette holder (-15 to +65°C). The one sol-gel encapsulated sample was prepared as
a thin layer lining the bottom portion of a 10 mm diameter NMR tube as previously
described (33) but with the protocol modified (no added glycerol) in order to minimize the
increase in internal viscosity.
5.4.3. Molecular dynamics simulations
Simulations were performed using CHARMM (34) and the CHARMM22 all-atom potential
energy parameter set (35) with phi, psi cross term map correction (CMAP) (36) and modified
TIP3P waters (37). Electrostatic interactions were calculated via the Particle Mesh Ewald (PME)
method (38), using a sixth order spline interpolation for complementary function, with
κ = 0.34 Å-1
and a fast-Fourier grid density of ≈ 1 Å-1
. Cutoffs for the real space portion of the
PME calculation and the truncation of the Lennard-Jones interactions were 10 Å, with the latter
smoothed via a shifting function over the range of 8 Å to 10 Å. The SHAKE algorithm (39) was
used to constrain all covalent bonds involving hydrogen atoms. All simulations employed the
leapfrog algorithm and an integration step of 1 fs. Coordinates were saved every ps. Non-bond
and image lists were updated heuristically. All simulations were performed at constant pressure
and temperature (NPT ensemble) of 1 atm and 298 K, respectively. The mass of the thermal
piston was 20 000 kcal·mol-1
·ps2 and the mass of the pressure piston equaled 1000 amu. The net
translation and rotation of the systems were removed every 10 000 steps.
74
Systems setup – Coordinates for MD simulations were taken from the crystal structure of wild-
type oxy-TrHbN (PDB entry 1IDR). All ionizable residues were considered in their standard
protonation state at pH 7 and the histidines with the proton on ND1 position. Missing coordinates
from crystal structure were built using the internal coordinate definitions of CHARMM. For each
subunit, the carboxy terminal end was optimally positioned by performing 3 ns Langevin
dynamics with a 1 fs time step and a friction coefficient FBETA of 5 ps-1
while keeping
constrained all coordinates from the crystal structure. The converged structures were immersed
in a rhombic dodecahedron unit cell containing pre-equilibrated TIP3P water molecules (8330
molecules). Six sodium ions were added to neutralize the charge of the systems. Water molecules
within 2.8 Å of any protein atom were deleted yielding to about 24350 atoms for each system.
Prior to the initiation of MD simulations, the energy of the solvated systems was minimized with
two cycles of 500 steps of steepest descent followed by 500 steps of Adopted Basis Newton-
Raphson minimizations. During energy minimization, the protein coordinates were kept
constrained.
To increase sampling, two 20 ns trajectories were generated using the A and B crystal subunits in
absence of the coordinated dioxygen molecule. From these simulations, the last MD coordinates
were taken to produce two 20 ns trajectories of deoxy-TrHbN with and without a water molecule
in the DHP, for a total of four 20 ns trajectories. The water molecule was arbitrarily positioned in
the DHP in a cavity located between the heme iron and the B10 residue, and the initial position
was optimized with a short energy minimization, keeping all other coordinates constrained.
Because of their high structural similarities (31), mutant systems were built from equilibrated
wild-type coordinates. Three trajectories were produced for each deoxy form of both
Tyr(B10)Phe and Gln(E11)Val single mutants with a water molecule in the DHP, while five
trajectories were produced for the Tyr(B10)Phe/Gln(E11)Val double mutant. The number of
trajectories and their length were set in order to obtain a good sampling of the measured values.
For each mutant, one 10 ns trajectory without a water molecule in the DHP was performed.
Analysis of the DHP accessible volume – The accessible volumes located in the DHP were
studied using VOIDOO (40). The detected cavities were refined using a < 0.2 Å grid spacing and
a probe radius of 1.4 Å. One coordinate set every 10 ps was used for analysis.
75
5.5. Results and discussion
5.5.1. Kinetic data indicate that Tyr(B10) mainly contributes to the kinetic
barrier to ligand binding to TrHbN(Fe2+). – (i) O2 and CO binding to TrHbN
Combination of O2 and CO to most TrHbN mutants was too rapid to be measured by stopped-
flow spectrophotometry. As a consequence, these reactions were studied by laser flash-
photolysis. Since the previously published binding rate constants for O2 (k´on) and CO (l´on) of
TrHbN have been determined by stopped-flow spectrophotometry (12), we reexamined the
reactions using flash-photolysis. The measured reactions for O2 and CO corresponded to about
25 % and 63 %, respectively, of the expected changes in absorbance. The residuals of the fitted
curves generated by applying a single exponential mathematical term to the kinetic data were
nearly random, implying that under these conditions, O2 and CO combination processes are
monophasic (Fig. 5.3). As shown in Table 5.1, k´on (55.8 x 106 M
-1·s
-1) value is higher than that
previously determined by stopped-flow spectrophotometry (k´on = 25 x 106 M
-1·s
-1), indicating
that the starting deoxy forms are different.
5.5.2. O2 and CO binding to TrHbN mutants
With the exception of the double Tyr(B10)Phe/Gln(E11)Val mutant, all mutant proteins bound
O2 in a concentration-dependent manner requiring one exponential term to fit the pseudo-first-
order time courses. No reaction could be measured for the Tyr(B10)Phe/Gln(E11)Val mutant,
indicating either rapid geminate rebinding following O2 dissociation or failure to photodissociate
the bound O2. As shown in Table 5.1, k´on values of Tyr(B10)Phe (540 x 106 M
-1·s
-1) and
Tyr(B10)Leu (621.2 x 106 M
-1·s
-1) mutants were ~ 10-fold higher than that of TrHbN indicating
that Tyr(B10) contributes significantly to the energy barrier to O2 binding. In contrast, k´on values
for the oxygenation of Gln(E11)Ala (37.5 x 106 M
-1·s
-1) and Gln(E11)Val (32.6 x 10
6 M
-1·s
-1)
mutants were slightly lower than that of TrHbN (55.8 x 106 M
-1·s
-1). Substituting both Tyr(B10)
76
and Gln(E11) for Leu and Val respectively, creating the Tyr(B10)Leu/Gln(E11)Val mutant,
caused an additional increase of the k´on rate to 1811.8 x 106 M
-1·s
-1.
All mutants bound CO in a concentration-dependent manner requiring a single exponential term
to fit the kinetic traces. As observed for O2, single substitutions at Tyr(B10) position resulted in a
~ 10-fold increase of the l´on with values attaining 77.2 x 106 M
-1·s
-1 and 92.56 x 10
6 M
-1·s
-1 for
Tyr(B10)Phe and Tyr(B10)Leu, respectively (Table 5.1). In contrast, the Gln(E11)Ala and
Gln(E11)Val mutants showed only small changes in the l´on values. The
Tyr(B10)Phe/Gln(E11)Val and Tyr(B10)Leu/Gln(E11)Val double mutants combined with CO
with similar rates (Table 5.1). These latter reactions are quite fast, approaching values for
diffusion-controlled reactions (41,42).
Table 5.1 shows that replacement of Tyr(B10) with either Phe or Leu results in a over an order of
magnitude increase of both k´on and l´on. That both ligands are similarly affected implies a direct
steric effect associated with the Tyr(B10). Replacement of Gln(E11) with either Ala or Val has
very little influence on the binding rates; however, for the double mutant combining the
Tyr(B10) and Gln(E11) replacements, there is a synergistic effect that substantially enhances
both k´on and l´on relative to the increase due to the Tyr(B10) substitutions alone. The question
remains as to what structural and/or dynamical processes are responsible for these side chain
specific effects on the combination rates.
As a first step, we examined the ns and slower recombination occurring subsequent to ligand
photodissociation using a 8 ns laser pulse. In many instances, geminate recombination which
occurs on the sub-microsecond time scale reflects the influence of the initial conformation prior
to substantial relaxation. By monitoring the geminate recombination on these faster time scales,
it is possible to establish whether the elements responsible for the very large differences in
combination rates are operational from the onset when the ligand is initially dissociated and
localized within the local environment near the heme binding site.
77
5.5.3. Geminate and solvent phase recombination
Figure 5.4 compares kinetic traces of the geminate and solvent phase recombination of CO to
TrHbN and several distal mutants displayed on a log-log plot. The rebinding to TrHbN (green
trace) consists of a single exponential phase. This phase, which slows with decreasing
concentrations of CO (not shown) is assigned to solvent phase recombination. The double mutant
Tyr(B10)Phe/Gln(E11)Val (red trace) shows two very fast phases. Only the second phase slows
in response to a decrease in CO concentration (data not shown) indicating that this kinetic phase
is a very fast solvent phase recombination. The even faster recombination phase is consistent
with the notion that it is a geminate recombination reaction based on both time scale and
insensitivity to the external CO concentration. The recombination trace for the oxy derivative of
this mutant showed two similar phases and geminate yields on the ns time scale (data not
shown). It was also concluded, based on the photolysis yield at 10 ns, that for the double
B10/E11 mutant as well as the wild-type protein, there is a faster subnanosecond geminate phase
for dioxygen that decreases the ns quantum yield relative to the CO derivatives. In contrast to the
CO derivative of the double B10/E11 mutant, which displays an exceptionally fast ns geminate
process with very large amplitude (> 0.8) that is among the largest for any CO derivative of an
Hb or Mb under ambient low viscosity conditions, there is almost no discernable geminate yield
under these conditions for TrHbN. The Tyr(B10)Leu/Gln(E11)Val double mutant exhibits very
similar enhanced kinetics to those from the Tyr(B10)Phe/Gln(E11)Val double mutant, both
under low and high viscosity conditions (data not shown) The two single mutants Tyr(B10)Phe
(black trace) and Gln(E11)Val (blue trace) manifest a measurable geminate process but with a
geminate yield in the range of 0.2.
The geminate recombination data show that the factors that are responsible for the large
differences in the combination rates and the solvent phase kinetics are operative at early times
subsequent to photodissociation. We now consider possible factors contributing to these
differences. The enhancement of the binding rates and the solvent phase recombination in going
from Tyr(B10) to Phe(B10) might be the result of a decrease in the effect of the tyrosine side
chain relaxing to a position that blocks access to the heme iron. If this relaxation was fast
enough, it could account for the very low geminate yield for TrHbN. The further enhancement in
78
combination rates seen for the double B10/E11 mutant could be attributable to a further
reduction in steric factors due a change in the positioning of the Phe(B10) side chain due to the
change in the E11 side chain.
There are several observations that raise questions about the validity of this side chain-based
steric explanation. The B10 side chain explanation can only account for the observed kinetics if
one also invokes modulation of the positioning of the side chain by the E11 side chain.
Arguments against that scenario come from the observation that the replacement of Gln(E11)
with valine or alanine has minimal effect on the on rates and on the geminate yield (data not
shown for Gln(E11)Ala, which is essentially identical to that of the Gln(E11)Val mutant).
Furthermore, the binding rates for Tyr(B10)Phe and Tyr(B10)Leu are very similar. Geminate
recombination studies comparing these two mutants both at low and high viscosity show very
little difference (data not shown) suggesting that if the B10 side chain was contributing through a
pure steric effect (due to the side chain alone), the leucine and phenylalanine side chains would
have behaved similarly with respect to this proposed steric interaction. A similar steric effect by
these two residues seems implausible given the difference in flexibility and volume of the two
side chains. Finally, both the Tyr(B10)Phe and Tyr(B10)Leu double mutants with Gln(E11)Val
show similar recombination kinetics. If the further substantial enhancement in combination rates,
solvent phase recombination rates, geminate yield and rates of geminate recombination were due
to the further reduction in a steric effect due to a change in the B10-E11 interaction, it would
seem very implausible that the two different B10 side chains would behave so similarly. While
these arguments are not definitive, they certainly weaken any explanation based solely on steric
effects arising solely from the side chains of the B10 and E11 residues. Given these points
together with the absence of large ligand-binding induced conformational changes involving the
proximal heme environment associated with TrHbN (11), we consider yet additional factors that
can contribute to the control of ligand binding kinetics.
Water in the DHP of Mb and Hb is known to significantly contribute to the kinetic barrier for
ligand binding (14-21). In these two cases, water occupies the DHP of the deoxy derivative and
only populates the DHP of the liganded species subsequent to ligand dissociation and the onset
of conformational fluctuations that open the so-called distal His(E7) gate. Thus, there is a delay
between the moment of the ligand dissociation and the reentry of water back into the DHP. It has
79
been claimed that this delayed water reentry process is essential for ensuring a high probability
of escape by the dissociated ligand once the ligand has accessed the Xe cavities of Mb and Hb.
Delayed occupancy of the DHP by water subsequent to ligand dissociation is also a significant
factor contributing to the geminate yield for the slower geminate phase arising from the
recombination after the ligand has access to the Xe cavities. If the dynamics of water controlling
occupancy of the DHP of TrHbN is a factor contributing to the observed kinetic patterns, it
would suggest that water participates very early in the recombination process and require that the
B10 and E11 side chains modulate its dynamics and/or occupancy factors. Thus, in contrast to
Mb, where water is observed to enter the DHP of Mb only after 50 to 100 ns, in the case of
TrHbN, the water would have to be present within a few ns if it is responsible for the low
geminate yield in wild-type TrHbN. The high yield and fast rates for the double B10/E11 mutant
would be attributable to the very low occupancy of water within the DHP. To test this
hypothesis, we have conducted both kinetic measurements on the photoproduct of the •NO
derivative of met-TrHbN where both the •NO and water can be directly followed and MD
simulations to establish the behavior of water within the DHP of TrHbN as a function of B10 and
E11 side chain substitutions.
Water controls ligand binding to ferric TrHbN – Combined mutagenesis and spectroscopic
studies indicated that Tyr(B10) and Gln(E11) residues stabilize the coordinated water molecule
in ferric TrHbN at 23°C and pH 7.5 (31). Accordingly, the optical spectra of ferric double
mutants bearing apolar residues at Tyr(B10) and Gln(E11) positions were found typical of ferric
heme proteins with no water coordinated to the iron atom (31).
We used laser-flash photolysis of the TrHbN(Fe3+
-NO) complex to study the kinetics of water
entry and binding to the heme iron at 23ºC and pH 7.5. Photodissociation of the horse heart
Mb(Fe3+
-NO) complex leaves the heme distal site in a ferric dehydrated state 5C Mb(Fe3+
) (21).
After •NO photolysis and escape a water molecule enters the DHP and binds to the heme iron
forming the aquomet Mb state [Mb(Fe3+
-H2O)]. At longer times, •NO displaces the bound water
molecule to reestablish the equilibrium Mb(Fe3+
-NO) complex.
80
For monitoring H2O kinetics in TrHbN, the experimental wavelength is the isobestic point
between TrHbN(Fe3+
-NO) and TrHbN Tyr(B10)Phe/Gln(E11)Val(Fe3+
) mutant, which is located
near the Soret band of native ferric TrHbN at 406 nm (Fig. 5.2). Figure 5.5A shows the changes
in absorbance at 408.5 nm. We interpret the experimental results in terms of three optical states:
TrHbN(Fe3+
-NO), TrHbN(Fe3+
-H2O) and TrHbN(Fe3+
). Accordingly, following •NO-photolysis
most of the •NO directly rebinds without leaving TrHbN. After the non-geminate fraction of •NO
escapes to solvent, forming a short-lived 5C ferric dehydrated state, a water molecule rebinds
very rapidly (1.49 x 108 s
-1), forming the TrHbN(Fe
3+-H2O) state. Finally, under •NO saturating
conditions (∼ 1.8 mM), the bound H2O is rapidly displaced (2.0 x 105 s
-1) leading to the decrease
in absorbance seen in Figure 5.5A. As expected, increasing the •NO concentration shortens the
duration of the TrHbN(Fe3+
-H2O) complex and has no effect on the rate of formation of
TrHbN(Fe3+
-H2O) (Fig. 5.5B). As shown in Fig. 5.5A and ref (21), water binding to 5C ferric
horse heart Mb following •NO-photolysis is significantly slower (5.7 x 106 s
-1), suggesting a
lower barrier for migration of water molecule in TrHbN.
Figure 5.5C shows the kinetic trace obtained when the reaction is monitored at 421 nm. This
wavelength corresponds to the maximum absorbance of the Soret band of the TrHbN(Fe3+
-NO)
species (Fig. 5.2). At this wavelength, we shall monitor the reaction: TrHbN(Fe3+
-NO) →
TrHbN(Fe3+
) → TrHbN(Fe3+
-H2O) → TrHbN(Fe3+
-NO). Initially a decrease in absorbance is
observed (2.1 x 108 s
-1), corresponding to the formation of 5C ferric dehydrated state from
TrHbN(Fe3+
-NO) followed by a small increase in absorbance (1.1 x 108 s
-1) associated to
[TrHbN(Fe3+
) → TrHbN(Fe3+
-H2O] and finally by a further increase in absorbance (2.3 x 105 s
-1)
corresponding to •NO replacing the bound water molecule.
Thus water appears to constitute the main barrier to ligand rebinding to TrHbN. Unlike Mb and
human HbA, where water does not appear to impact geminate recombination due to delayed
reentry of water into the DHP subsequent to ligand dissociation, in the case of TrHbN, the water
occupancy occurs on the time scale of the geminate recombination. This observation indicates
that water has access to the reactive site over the heme iron on a time scale that is much faster
than for Mb. This acceleration is consistent either with water being stabilized within the protein
at a site near the heme iron or with water being able to enter the DHP from the solvent on a ns
time scale. Although the state of hydration of the DHP of deoxy-TrHbN is not known, the
81
present flash-photolysis experiments with TrHbN(Fe3+
-NO) strongly suggest that a non-
coordinated water molecule, stabilized by Tyr(B10) and Gln(E11), may be close to the heme iron
in deoxy-TrHbN. To investigate the fate of a water molecule in the DHP of deoxy-TrHbN and its
distal mutants and to gain further insights into the role of Tyr(B10) and Gln(E11), MD
simulations were performed.
5.5.4. Molecular dynamics simulations suggest that water may constitute the
main kinetic barrier to ligand binding to TrHbN(Fe2+
)
All simulations showed stable trajectories with protein backbone r.m.s.d around 1 Å. The
positioning of the different DHP residues B10, E11, CD1 and the free DHP water molecule was
studied. Table 5.2 shows the average minimum interatomic distances between non- hydrogen
atoms and the heme-Fe atom extracted from the different trajectories produced. To measure
access to the heme-Fe atom (accessible volume), we used a probe of 1.4 Ǻ radius, which
approximates to the radius of a water molecule. The results are presented in Table 5.3 and are
expressed as the fraction of MD snapshots showing an accessible volume over the iron.
Wild-type TrHbN(Fe2+
) trajectories - Two 20 ns trajectories were produced for the wild-type
protein, and in both cases the water molecule was stabilized by strong hydrogen-bonds involving
both the Gln(E11) and Tyr(B10) residues. As a result, the water molecule occupied a main
position close to the iron atom, at a mean H2O-Fe distance of 3.5 Å. On some rare occasions
(0.7 % of MD frames) the water molecule left this main position to get closer to the Gln(E11)
side chain, creating an accessible volume over the iron atom (Table 5.3). In the absence of a
water molecule, the Tyr(B10) hydroxyl group was hydrogen-bonded to the OE1 atom of
Gln(E11). This H-bond pulled the Tyr(B10) side chain further away from the heme-Fe atom at a
mean minimum distance of 5.7 Å. This configuration prevailed in 89.3 % of the time. In this
configuration, the B10 residue does not hamper ligand coordination and the closest residue from
the iron atom is Phe(CD1) at 4.0 Å. As a consequence, an accessible volume over the heme iron
was found 10 times more often (7.1 % of the MD frames) than in TrHbN hydrated trajectories.
82
Tyr(B10)Phe(Fe2+
) mutant trajectories – In the Tyr(B10)Phe mutant, the Gln(E11) residue
pulled the water molecule away from the heme center, at a mean distance of 4.9 Å. The water
molecule no longer occupied a well defined position, being constantly in motion around the
Gln(E11) side chain. Also, the Phe(B10) residue showed increased flexibility and explored two
χ1 dihedral domains (χ1 in minus and trans), compared to only one for TrHbN. Consequently,
accessible volume over the heme-Fe atom was observed more frequently (~ 8-fold) than in
TrHbN (Table 5.3). The average volume was also larger than in TrHbN by ~ 25 Å3. Consistent
with MD simulations, kinetic data showed a similar increase in both O2 and CO combination
rates.
In the absence of a water molecule, the access to the heme-Fe atom was slightly reduced with
respect to TrHbN (Table 5.3), predicting lower or similar k´on and l´on for the Tyr(B10)Phe
mutant. This is due to the Gln(E11) side chain which moves closer to the heme iron ( by 0.9 Å),
as also observed in the crystal structure of the cyanomet derivative (31). MD data for the
Tyr(B10)Phe mutant are thus consistent with kinetic data if a water molecule is present in the
DHP.
Gln(E11)Val(Fe2+
) mutant trajectories – In the Gln(E11)Val mutant, the DHP water molecule
occupied a position similar to that seen in TrHbN (Table 5.2) and was stabilized by a strong
H-bond to the Tyr(B10) hydroxyl group. Access to the heme iron was slightly decreased with
respect to TrHbN, accounting for only 0.6 % of the MD frames analyzed. This is due to the
absence of electrostatic attraction by the E11 residue favoring water location near the Tyr(B10)
hydroxyl group. Consistent with these data, k´on and l´on for the Gln(E11)Val mutant were found
similar to those of TrHbN (Table 5.1).
In contrast, in the absence of a DHP water molecule, cavity formation over the heme-Fe atom in
the Gln(E11)Val mutant increased ∼ 3-fold compared to TrHbN. In this case the Val(E11) side
chain (5.8 Å) is unable to get as close to the heme-Fe atom as the Gln(E11) residue in the
Tyr(B10)Phe mutant (4.4 Å). In TrHbN, Tyr(B10) maintains Gln(E11) side chain at a greater
distance from the heme-Fe atom (4.9 Å) through H-bonding. As a consequence, the cavities
detected over the iron atom in the Gln(E11)Val mutant were larger by about 10 Å3 than those
83
formed in TrHbN (Table 5.3). Thus in contrast to kinetic data, MD simulations in absence of a
distal water molecule would predict an increase in O2 and CO combination rates.
Tyr(B10)Phe/Gln(E11)Val(Fe2+
) mutant trajectories – The B10/E11 double apolar
substitution had a dramatic effect on the DHP water molecule stabilization. In all simulations, the
water molecule rapidly escaped the protein matrix through the short tunnel. These results
indicate that a water molecule is unlikely to reside within the DHP of the B10/E11 apolar
mutants.
The analysis of the accessible volume revealed that apolar substitutions of the B10/E11 pair
increased the accessible volume, by more than 15 Å3, compared to TrHbN (Table 5.3).
Additionally, in the absence of a water molecule, over 54.7 % of the MD data showed an
accessible volume over the heme-Fe atom (Table 5.3). Overall, the MD results are in accord with
the measured k´on and l´on, which indicates that iron coordination of small gaseous substrates, in
this case should only be limited by their diffusion from the solvent to the tunnel and then to the
active site.
5.6. Conclusions
The present kinetic data and MD simulations indicate that the main barrier to ligand binding
from solvent and geminate phase to deoxy-TrHbN is the displacement of a non-coordinated
distal site water molecule, which is mainly stabilized by the Tyr(B10) residue. As observed for
TrHbN Tyr(B10)/Gln(E11) double mutants, once this kinetic barrier is eliminated, geminate
yield is dramatically increased and ligand binding is very rapid with rates approaching those
measured for diffusion-controlled reactions. Such proposal is further supported by the
observation that the rates measured for •NO binding to ferric heme-iron increases dramatically in
the Tyr(B10)Leu/Gln(E11)Val double mutant (1585 x 106 M
-1·s
-1) compare to wild-type TrHbN
(114.2 x 106 M
-1·s
-1), being as fast as CO and O2 binding to the deoxy-form of the double mutant
(not shown). These large combination rates almost certainly represent the upper limit for ligand
binding to a heme protein (44,45) and also indicate that the heme iron in TrHbN is highly
reactive. Such rapid access to the active site is attributed to the hydrophobic nature of the
tunnels, which may favor rapid docking and partitioning of the apolar gas into the polar distal
84
heme cavity. In turn, the rapid diffusion of apolar ligand to the active site may be responsible for
the efficient NOD reaction catalyzed by TrHbN (745 x 106 M
-1·s
-1). In addition to ligand
binding, water molecules in the DHP can participate actively in other important processes
including proton transfer reactions, catalysis, folding and redox processes. Recent quantum
mechanics/molecular mechanics and MD simulations with ferric TrHbN suggest that formation
of the Fe3+
-ONO2- complex triggers rapid hydration (few ns) of the distal heme cavity, which
causes weakening of the Fe3+
-O bond and rapid egress of the nitrate ion from the active site (43).
Thus water in the DHP facilitates the rapid release of NO3-, which is necessary to guarantee an
efficient NO detoxification and enhance survival of the microorganism under stress conditions.
Photolysis experiments with TrHbN(Fe3+
-NO) indicate that water rebinds to the distal heme site
at a rate of ∼ 1.49 x 108 s
-1. Similar experiments with Mb(Fe
3+-NO) and Mb(Fe
2+-CO) estimated
that water enters into the distal heme pocket at a rate of 5.7 x 106 s
-1 and 9 x 10
6 s
-1, respectively.
The large difference in the rates of water rebinding emphasizes a lower barrier for water in
TrHbN, which can be attributed in part to the electrostatic interactions of water with the distal
residues Tyr(B10) and Gln(E11). The difference in binding rates of water between Mb and
TrHbN may also be attributed to a much faster access to the DHP from the solvent due to the
absence of a distal gate in TrHbN (15,19,44,45). The results of the geminate recombination
studies are consistent with the water either being near the heme from the start or accessing the
DHP on an unprecedently fast time scale. Whatever the situation, these results point to an
important role for water in control of ligand reactivity in TrHbN.
5.7. Footnotes
We are grateful to Dr. Beatrice A. Wittenberg and Dr. Jonathan B. Wittenberg from the Albert
Einstein College of Medicine (NY, USA) for insightful discussions. This work was supported by
the National Sciences and Engineering Research Council (NSERC) grant 46306-01 (2005-2010),
the NIH grant 1-R01-AI052258 (2004-2007) (through Dr. Joel M. Friedman) and the Fonds
Québécois de la Recherche sur la Nature et les Technologies (FQRNT) grant 104897 to Dr.
Michel Guertin. Mario Milani is recipient of a post-doctoral fellowship supported through the
NIH grant 1-R01-AI052258 (2004-2007). Dr. Martino Bolognesi is grateful to CIMAINA
85
(Milano - Italy). Part of this study was supported by the Italian Ministry for University and
Scientific Research FIRB Project “Biologia Strutturale” to Dr. Martino Bolognesi, Contract
RBLA03B3KC. Patrick Lagüe is supported by the Canadian Foundation for Innovation (CFI)
grant 12428 and the Fonds Québécois de la Recherche sur la Nature et les Technologies
(FQRNT) grant 104897.
The abbreviations used are: BCG, bacillus Calmette-Guérin; Hb, hemoglobin; Mb, myoglobin;
TrHb, truncated hemoglobin; TrHbN, Mycobacterium tuberculosis truncated hemoglobin N;
MD, molecular dynamics; DHP, distal heme pocket; 5C, 5 coordinated; •NO, nitric oxide.
86
5.8. References
1. Brunori, M. (2001) Trends in Biochemical Sciences 26(1), 21-23
2. Brunori, M., Giuffre, A., Sarti, P., Stubauer, G., and Wilson, M. T. (1999) Cell Mol Life Sci
56(7-8), 549-557
3. Stevanin, T. M., Ioannidis, N., Mills, C. E., Kim, S. O., Hughes, M. N., and Poole, R. K.
(2000) J Biol Chem 275(46), 35868-35875
4. Cleeter, M. W., Cooper, J. M., Darley-Usmar, V. M., Moncada, S., and Schapira, A. H.
(1994) FEBS Lett 345(1), 50-54
5. Brown, G. C., and Cooper, C. E. (1994) FEBS Lett 356(2-3), 295-298
6. Gardner, P. R., Costantino, G., and Salzman, A. L. (1998) J. Biol. Chem. 273(41), 26528-
26533
7. Gardner, P. R., Costantino, G., Szabo, C., and Salzman, A. L. (1997) J. Biol. Chem. 272(40),
25071-25076
8. Kissner, R., Nauser, T., Bugnon, P., Lye, P. G., and Koppenol, W. H. (1997) Chem. Res.
Toxicol. 10(11), 1285-1292
9. Pfeiffer, S., Gorren, A. C. F., Schmidt, K., Werner, E., Hansert, B., Bohle, D. S., and Mayer,
B. (1997) J. Biol. Chem. 272(6), 3465-3470
10. Ouellet, H., Ouellet, Y., Richard, C., Labarre, M., Wittenberg, B., Wittenberg, J., and
Guertin, M. (2002) Proc Natl Acad Sci U S A 99(9), 5902-5907
11. Samuni, U., Ouellet, Y., Guertin, M., Friedman, J. M., and Yeh, S. R. (2004) J A Chem Soc
126(9), 2682-2683
12. Couture, M., Yeh, S. R., Wittenberg, B. A., Wittenberg, J. B., Ouellet, Y., Rousseau, D. L.,
and Guertin, M. (1999) Proc Natl Acad Sci U S A 96(20), 11223-11228
13. Dantsker, D., Samuni, U., Ouellet, Y., Wittenberg, B. A., Wittenberg, J. B., Milani, M.,
Bolognesi, M., Guertin, M., and Friedman, J. M. (2004) J Biol Chem 279(37), 38844-38853
14. Springer, B. A., Sligar, S. G., Olson, J. S., and Phillips, G. N., Jr. (1994) Chem Rev 94(3),
699-714
15. Vojtechovsky, J., Chu, K., Berendzen, J., Sweet, R. M., and Schlichting, I. (1999) Biophys J
77(4), 2153-2174
87
16. Rohlfs, R. J., Mathews, A. J., Carver, T. E., Olson, J. S., Springer, B. A., Egeberg, K. D., and
Sligar, S. G. (1990) J Biol Chem 265(6), 3168-3176
17. Olson, J. S., and Phillips, G. N., Jr. (1996) J Biol Chem 271(30), 17593-17596
18. Olson, J. S., and Phillips, G. N., Jr. (1997) J Biol Inorg Chem 2(4), 544-552
19. Scott, E. E., Gibson, Q. H., and Olson, J. S. (2001) J Biol Chem 276(7), 5177-5188
20. Goldbeck, R. A., Bhaskaran, S., Ortega, C., Mendoza, J. L., Olson, J. S., Soman, J., Kliger,
D. S., and Esquerra, R. M. (2006) Proc Natl Acad Sci U S A 103(5), 1254-1259
21. Cao, W., Christian, J. F., Champion, P. M., Rosca, F., and Sage, J. T. (2001) Biochemistry
40(19), 5728-5737
22. Christian, J. F., Unno, M., Sage, J. T., Champion, P. M., Chien, E., and Sligar, S. G. (1997)
Biochemistry 36(37), 11198-11204
23. Quillin, M. L., Li, T., Olson, J. S., Phillips, G. N., Jr., Dou, Y., Ikeda-Saito, M., Regan, R.,
Carlson, M., Gibson, Q. H., Li, H., and et al. (1995) J Mol Biol 245(4), 416-436
24. Quillin, M. L., Arduini, R. M., Olson, J. S., and Phillips, G. N., Jr. (1993) J Mol Biol 234(1),
140-155
25. Dantsker, D., Samuni, U., Friedman, J. M., and Agmon, N. (2005) Biochim Biophy Acta
1749(2), 234-251
26. Dantsker, D., Roche, C., Samuni, U., Blouin, G., Olson, J. S., and Friedman, J. M. (2005) J
Biol Chem 280(46), 38740-38755
27. Samuni, U., Dantsker, D., Roche, C. J., and Friedman, J. M. (2007) Gene 398(1-2), 234-248
28. Draghi, F., Miele, A. E., Travaglini-Allocatelli, C., Vallone, B., Brunori, M., Gibson, Q. H.,
and Olson, J. S. (2002) J Biol Chem 277(9), 7509-7519
29. Samuni, U., Roche, C. J., Dantsker, D., and Friedman, J. M. (2007) J Am Chem Soc 129(42),
12756-12764
30. Eich, R. F., Li, T., Lemon, D. D., Doherty, D. H., Curry, S. R., Aitken, J. F., Mathews, A. J.,
Johnson, K. A., Smith, R. D., Phillips, G. N., Jr., and Olson, J. S. (1996) Biochemistry
35(22), 6976-6983
31. Ouellet, Y., Milani, M., Couture, M., Bolognesi, M., and Guertin, M. (2006) Biochemistry
45(29), 8770-8781
88
32. Samuni, U., Roche, C. J., Dantsker, D., Juszczak, L. J., and Friedman, J. M. (2006)
Biochemistry 45(9), 2820-2835
33. Samuni, U., Dantsker, D., Khan, I., Friedman, A. J., Peterson, E., and Friedman, J. M. (2002)
J Biol Chem 277(28), 25783-25790
34. Brooks, B. R., Bruccoleri, R. E., Olafson, B. D., States, D. J., Swaminathan, S., and Karplus,
M. (1983) J Comput Chem 4(2), 187-217
35. MacKerell, A. D., Bashford, D., Bellott, M., Dunbrack, R. L., Evanseck, J. D., Field, M. J.,
Fischer, S., Gao, J., Guo, H., Ha, S., Joseph-McCarthy, D., Kuchnir, L., Kuczera, K., Lau, F.
T. K., Mattos, C., Michnick, S., Ngo, T., Nguyen, D. T., Prodhom, B., Reiher, W. E., Roux,
B., Schlenkrich, M., Smith, J. C., Stote, R., Straub, J., Watanabe, M., Wiorkiewicz-Kuczera,
J., Yin, D., and Karplus, M. (1998) J. Phys. Chem. B 102(18), 3586-3616
36. Mackerell, A. D., Jr., Feig, M., and Brooks, C. L., 3rd. (2004) J Comput Chem 25(11), 1400-
1415
37. Price, D. J., and Brooks III, C. L. (2004) J Chem Phys 121(20), 10096-10103
38. Feller, S. E., Pastor, R. W., Rojnuckarin, A., Bogusz, S., and Brooks, B. R. (1996) J. Phys.
Chem. 100(42), 17011-17020
39. Ryckaert, J.-P., Ciccotti, G., and Berendsen, H. J. C. (1977) Journal of Computational
Physics 23(3), 327-341
40. Kleywegt, G. J., and Jones, T. A. (1994) Acta Crystallographica Section D 50(2), 178- 185
41. Huie, R. E., and Padmaja, S. (1993) Free Radic Res Commun 18(4), 195-199
42. Blough, N. V., and Zafiriou, O. C. (1985) Inorg. Chem. 24(22), 3502-3504
43. Marti, M. A., Bidon-Chanal, A., Crespo, A., Yeh, S. R., Guallar, V., Luque, F. J., and Estrin,
D. A. (2008) J Am Chem Soc 130(5), 1688-1693
44. Milani, M., Pesce, A., Ouellet, Y., Ascenzi, P., Guertin, M., and Bolognesi, M. (2001) Embo
J 20(15), 3902-3909
45. Bolognesi, M., Cannillo, E., Ascenzi, P., Giacometti, G. M., Merli, A., and Brunori, M.
(1982) J Mol Biol 158(2), 305-315
89
Table 5.1 Kinetics constants for the reactions of TrHbN and its mutants with O2 and CO.
Protein k´on (O2)
x 106 M-1·s-1
l´on (CO)
x 106 M-1·s-1
TrHbN 25a
55.8 ± 4.1 (25 %)b
6.75a
7.80 ± 0.15 (63 %)
Tyr(B10)Phe 540.0 ± 14.3 (15 %) 77.2 ± 1.3 (74 %)
Tyr(B10)Leu 621.2 ± 7.0 (24 %) 92.56 ± 0.75 (83 %)
Gln(E11)Val 32.6 ± 1.0 (26 %) 6.81 ± 0.26 (56 %)
Gln(E11)Ala 37.5 ± 4.0 (29 %) 9.34 ± 0.27 (69 %)
Tyr(B10)Phe / Gln(E11)Val * 1119.2 ± 13.4 (33 %)
Tyr(B10)Leu / Gln(E11)Val 1811.8 ± 51.3 (8 %) 1148.4 ± 50.5 (15 %)
a Rate determined by stopped-flow experiment (12).
b Percentage of the expected amplitude measured for the reaction.
* Binding of O2 may occur in the dead time of the apparatus.
90
Table 5.2 Average minimum interatomic distances between non-hydrogen atoms and the heme irona.
Proteinb iron–residue distance (Å)
Water B10 E11 F(CD1)
TrHbN-d - 5.7 4.9 4.0
Tyr(B10)Phe-d - 6.7 4.4 4.4
Gln(E11)Val-d - 5.2 5.8 4.2
Tyr(B10)Phe/Gln(E11)Val-d - 6.6 5.5 4.8
TrHbN-w 3.5 5.4 5.3 4.9
Tyr(B10)Phe-w 4.9 7.2 4.4 4.7
Gln(E11)Val-w 3.8 5.2 5.5 4.9
Tyr(B10)Phe/Gln(E11)Val-w c - - - -
a Other distal heme pocket residues (Leu(E7), Phe(B9) and Val(G8)) showed longer distance from the
iron ranging from 5.5Å to 7.5Å.
b Protein with (w) and without (d) a water molecule in the distal heme pocket.
c The water molecule escaped too fast the distal heme pocket to get a proper measurement.
91
Table 5.3 . Cavity formation frequency and volume over the iron atom.
Proteina Frequency
(%)
Volume
(Å3)
TrHbN-d 7.1 46.8
Tyr(B10)Phe-d 5.0 62.2
Gln(E11)Val-d 19.5 58.3
Tyr(B10)Phe/Gln(E11)Val-d 90.7 81.8
TrHbN-w 0.7 50.9
Tyr(B10)Phe-w 5.4 77.5
Gln(E11)Val-w 0.6 74.0
Tyr(B10)Phe/Gln(E11)Val-w 43.5 69.6
a Protein with (w) and without (d) a water molecule in the distal heme pocket.
92
Figure 5.1 View of the distal heme pocket and the tunnels of cyanomet-TrHbN chain B under
xenon pressure (PDB 1S56). Besides the protein backbone (blue ribbon, with labelled α-helices),
the figure shows hydrogen-bonding (dashed red lines) between the distal residues Tyr(B10) and
Gln(E11) and the heme-bound cyanide. The path of the two tunnels is shown in orange. The
short tunnel (~ 8 Å) connects the heme distal site to the outer solvent space at a location
comprised between the central region of the G and H helices (left in the figure). The long tunnel
(~ 20 Å) extends from the heme distal cavity to a solvent access site located between the inter-
helical loops AB and GH (upper part of the figure); note the gating role of Phe(E15) on the long
tunnel. The arrows point to the tunnel entrance sites facing the solvent. The figure was produced
using the PyMOL software (Delano Scientific, USA)
93
Figure 5.2 Equilibrium absorption spectra of TrHbN(Fe3+
-H2O) (solid line), TrHbN(Fe3+
-NO)
(dashed line) and TrHbN Tyr(B10)Leu/Gln(E11)Val(Fe3+
) mutant (dashed and dotted line) at pH
7.5. The protein concentrations were 10 μM. The Tyr(B10)Leu/Gln(E11)Val double mutant (31)
is 5C in the ferric oxidation state and is analogous to the photoproduct generated when
TrHbN(Fe3+-NO) is dissociated. The isobestic point at 408.5 nm was used to follow the water
coordination subsequent to TrHbN(Fe3+
-NO) photolysis. At this wavelength we expect an
increase in absorbance when H2O binds to the heme iron and a decrease when •NO replaces
H2O. The experimental wavelength at 421 nm was employed to monitor the overall reaction:
TrHbN(Fe3+
-NO) → TrHbN(Fe3+
) → TrHbN(Fe3+
-H2O) → TrHbN(Fe3+
-NO).
94
Figure 5.3 The time courses of (panel A) O2 (68.7 μM) and (panel B) CO (50.7 μM)
recombination to TrHbN (5 μM in heme) following photolysis in 50 mM KPO4 pH 7.5 + 50 μM
EDTA at 23 °C. The figure shows the single exponential fits and residuals to the kinetic traces
measured at 411 and 420 nm for O2 and CO, respectively.
95
Figure 5.4 Kinetic traces showing the recombination of CO subsequent to nanosecond
photodissociation of the CO saturated derivatives of wild-type TrHbN and its distal mutants. The
recombination traces are displayed on a log-log plot with the Y axis corresponding to normalized
absorbance and the X axis to time subsequent to photodissociation. The traces are color coded as
follows: wild-type TrHbN in green, the Tyr(B10)Phe/Gln(E11)Val double mutant in red; the
Tyr(B10)Phe single mutant in black and the Gln(E11)Val single mutant in blue. All the samples
except the double mutant are solution phase at pH 7.5. The trace from the double B10/E11
mutant (red) is from a sample encapsulated in a thin porous sol-gel bathed in buffer. Essentially
identical kinetics were obtained for the solution phase sample of the double B10/E11 mutant but
due to the low concentration of the sample that trace was of poor quality.
96
Figure 5.5 Kinetic traces illustrating the absorbance changes following photodissociation of
TrHbN(Fe3+
-NO) and Mb(Fe3+
-NO) at 23 °C. Panel A shows the absorbance changes
corresponding to the water coordination processes followed at 408.5 nm (red) for TrHbN(Fe3+
-
NO) (8.31 μM in heme) and 410 nm (blue) for Mb(Fe3+
-NO) (7.37 μM in heme) preequilibrated
with 100% •NO. The solid lines are the results of the exponential fits (black). Panel B shows the
kinetic traces acquired at 410 nm for TrHbN(Fe3+
-NO) (9.6 μM in heme) preequilibrated with
25 % (black), 50 % (blue) and 100 % (red) •NO. Panel C shows kinetic traces obtained at
421 nm following photolysis of TrHbN(Fe3+
-NO) (8.31 μM in heme) preequilibrated with
100% •NO.
97
6.
Chapitre 6
Structural characterization of the tunnels of Mycobacterium
tuberculosis truncated hemoglobin N from molecular
dynamics simulations
6.1. Résumé
La structure de la forme oxygénée de TrHbN de Mycobacterium tuberculosis montre un réseau
de ponts hydrogène au site distal incluant la Tyr33(B10), la Gln58(E11) ainsi que l’O2 lié à
l’hème. De plus, la structure de TrHbN montre un réseau de cavités hydrophobes organisé dans
l’expace selon deux branches orthogonales. Dans les présents travaux, la structure et la
dynamique de la forme oxygénée et deoxygénée de TrHbN en présence d’un solvant explicite a
été étudiée à partir de 100 ns de simulation de dynamique moléculaire (DM). Les résultats
montrent que dépendamment de la présence ou absence d’une molécule d’O2 coordonnée au fer,
la chaîne latérale de Tyr33(B10) et celle de Gln58(E11) adoptent deux configurations distinctes
de concert avec la réorganisation du réseau de pont hydrogènes. En addition, nos données
indiquent que la Tyr33(B10) et la Gln58(E11) contrôlent la dynamique de la Phe62(E15). Chez
deoxy-TrHbN, la Phe62(E15) est restreinte à une configuration. Suivant la liaison à l’hème d’une
molécule d’O2, la conformation de Gln58(E11) change et la Phe62(E15) fluctue entre deux
configurations. Nous avons aussi réalisé une étude systématique des tunnels de TrHbN en
analysant des milliers d’instannés de trajectoire à l’aide de CAVER. Les résultats montrent que
la formation des tunnels résulte de la réorganisation dynamique des cavités hydrophobes. Les
analyses indiquent que la présence de ces cavités est liée à la structure rigide de TrHbN et ont
aussi mis en évidence deux autres tunnels non observés dans la structure cristalline, soient les
tunnels EH et BE, liant la surface au site actif de TrHbN. Les cavités ont un volume suffisant
pour accueillir et entreposer plusieurs molécules de ligand. La dynamique des tunnels est
contrôlée par la conformation de la chaîne latérale de Tyr33(B10), de Gln58(E11) et de
Phe62(E15). Aussi, en contraste avec de récents travaux récemment publiés, notre approche
98
systématique montre que la présence ou l’absence d’une molécule d’O2 ne contrôle pas
l’ouverture du tunnel long mais plutôt celle du tunnel EH. De plus, nos données ont mené à une
conclusion nouvelle et différente sur l’impact de la Phe62(E15) sur la configuration des tunnels.
Nous proposons que le tunnel EH et le tunnel long sont utilisés pour entreposer des ligands. Dans
l’ensemble, nos travaux poussent notre compréhension sur la fonction de TrHbN et sur la
diffusion des substrats à l’intérieur des protéines.
6.2. Abstract
The structure of oxygenated TrHbN from Mycobacterium tuberculosis shows an extended heme
distal hydrogen-bond network that includes Tyr33(B10), Gln58(E11), and the bound O2. In
addition, TrHbN structure shows a network of hydrophobic cavities organized in two orthogonal
branches. In the present work, the structure and the dynamics of oxygenated and deoxygenated
TrHbN in explicit water was investigated from 100 ns molecular dynamics (MD) simulations.
Results show that, depending on the presence or the absence of a coordinated O2, the Tyr33(B10)
and Gln58(E11) side chains adopt two different configurations in concert with hydrogen bond
network rearrangement. In addition, our data indicate that Tyr33(B10) and Gln58(E11) control
the dynamics of Phe62(E15). In deoxy TrHbN, Phe62(E15) is restricted to one conformation.
Upon O2 binding, the conformation of Gln58(E11) changes and residue Phe62(E15) fluctuates
between two conformations. We also conducted a systematic study of TrHbN tunnels by
analyzing thousands of MD snapshots with CAVER. The results show that tunnel formation is
the result of the dynamic reshaping of short-lived hydrophobic cavities. The analyses indicate
that the presence of these cavities is likely linked to the rigid structure of TrHbN and also reveal
two tunnels, EH and BE, that link the protein surface to the buried distal heme pocket and not
present in the crystallographic structure. The cavities are sufficiently large to accommodate and
store ligands. Tunnel dynamics in TrHbN was found to be controlled by the side-chain
conformation of the Tyr33(B10), Gln58(E11), and Phe62(E15) residues. Importantly, in contrast
to recently published works, our extensive systematic studies show that the presence or absence
of a coordinated dioxygen does not control the opening of the long tunnel but rather the opening
of the EH tunnel. In addition, the data lead to new and distinctly different conclusion on the
99
impact of the Phe62(E15) residue on TrHbN tunnels. We propose that the EH and the long
tunnels are used for apolar ligands storage. The trajectories bring important new structural
insights related to TrHbN function and to ligand diffusion in proteins.
6.3. Introduction
In Mycobacterium tuberculosis, the glbN gene encodes the truncated hemoglobin TrHbN.
Disruption of glbN in M. bovis BCG results in a dramatic reduction in the NO consuming
activity of stationary phase cells and impairs the ability of cells to protect aerobic respiration
from the inhibition by NO.1 This functional assessment is supported by the observation that
oxygenated TrHbN catalyses the very rapid oxidation of nitric oxide (NO) into nitrate with a
second-order rate constant k ≈ 745 μM-1
s-1
at 23°C.
The dioxygen ligand in TrHbN is fully buried within the distal site cavity. In both crystal
subunits (PDB accession code 1IDR2), the O2 is tilted by ≈ 110° relative to the Fe axial bond
pointing in the direction of residue Val94(G8). Thus, both oxygen atoms in the O2 are at
hydrogen bonding distance from the phenolic OH group of Tyr33(B10) (average 3.12 Å), which
also forms a hydrogen bond with the NE2 atom of Gln58(E11). Notably, resonance Raman
investigations on oxy-TrHbN have suggested that stabilization of the heme-bound O2 occurs
through a hydrogen bond between the Tyr33(B10) OH group and the proximal O atom of the
ligand.3 Accordingly, site-specific mutations of Tyr33(B10) to either Leu or Phe result in a shift
of the Fe–O bond stretching frequency from 560 to 570 cm-1
, that is, to a stretching frequency
identical to that of vertebrate and nonvertebrate oxygenated Hbs and Mbs.3,4
Kinetic analysis of
the Tyr33(B10)Phe mutant showed a 150-fold increase in the dissociation rate of O2 pointing to a
crucial role for this residue in O2 stabilization. The possible role of Gln58(E11) in O2
stabilization remains to be established.
In contrast to myoglogin and hemoglobin, ligand diffusion to the heme in TrHbN may occur via
an apolar cavity system connecting the heme distal cavity to two distinct protein surface sites.2 In
the crystal structure of TrHbN, the cavity system is organized in two roughly orthogonal
branches (hereafter referred as the long and short tunnels) linking the protein surface to the distal
100
heme pocket (Fig. 6.1). The access to the long tunnel is defined by surface residues Ile19(A15),
Ala24(B1), Val28(B5), Ala105(G19), and Val107(GH5) from the AB and GH loops (hinges).
Access to the short tunnel is defined by residues Phe91(G5), Ala95(G9), Leu116(H8), and
Ala119(H11) from the G and H helices. Treatment of TrHbN crystals under xenon pressure led
to binding of xenon atoms at five binding sites along the protein matrix tunnel (see Fig. 6.1)
supporting the potential role of the tunnels in diffusion and accumulation of low-polarity
molecules/ligands.5 The Xe1 and Xe5 binding sites are located along the long tunnel. The Xe2
binding site lies in the short tunnel while the Xe3 is located at the short tunnel entrance. Finally,
the Xe4 is located in a hydrophobic crevice leading to the short tunnel entrance.
Crystallographic studies on oxygenated2 and cyanomet
6 TrHbN derivatives revealed that in
TrHbN, the short and the long tunnels are separated by Phe62(E15), which can adopt two
conformations, referred as the open and closed conformations. In addition, molecular dynamics
simulations of TrHbN suggested that Phe62(E15) may act as a gating residue that would control
the diffusion of apolar substrate molecules along the long tunnel.5,7,8
It was also proposed that
dioxygen binding to the iron triggers structural fluctuations leading to the opening of the long
tunnel, a possible explanation to the higher bimolecular rate constant of the NO-dioxygenase
reaction (745 lM21s21) than that of the O2 binding (25 μM-1
s-1
).8
Although tunnels are observed in many other proteins,9–15
very little or nothing is known about
their formation and dynamics, nor the typical protein features necessary for their presence.
Relying simply on the crystal structure for the identification of the tunnels is not absolute as
protein dynamics is sometimes necessary for a tunnel to form.11,16
Similarly, the diffusion of
apolar ligands cannot always be predicted from the static crystal structure as they proceed
through packing defects arising at specific positions observable from protein dynamics.11
Recently, a study of the O2 migration pathways inside 12 monomeric globins13
led to the
conclusion that there is no direct relation between the conserved tertiary structure fold and the
shape and topology of O2 pathway networks. The only correlation between these pathways found
by the authors is the presence of hydrophobic residues. To our knowledge, there is not yet a
study describing the dynamical behavior of tunnels in proteins, and there is no structural
indication to what is necessary for tunnel formation. The systematic characterization of the
tunnel system in TrHbN is thus crucial to understand its function and is of fundamental interest
101
to other tunnel containing proteins. In the present work, a total of 100 nanoseconds of
simulations were generated on both oxy-TrHbN and deoxy-TrHbN. These simulations allowed
us to revisit the TrHbN tunnel system. First, we examined the impact of the presence of the O2
bound to the heme on the active site key residues Tyr33(B10) and Gln58(E11), and the
consequences for Phe62(E15) in the long tunnel. Next, we investigated tunnel formation from
the dynamics of cavities and the structural features of TrHbN leading to the formation of
cavities, that is, the rigidity of its structure and the mobility of residues lining the cavities.
Finally, we systematically characterized the different tunnels of TrHbN and their relationship
with the dynamics of the key residues. Trajectory analysis revealed that the tunnels are formed
from short-lived cavities of various shapes and volumes, and that TrHbN structure hosts a tunnel
system more complex than that which we first expected from the crystal structure. In addition to
the long and the short tunnels, two additional tunnels were identified. The Phe62(E15) residue
was found to control the dynamics of two of these tunnels, but in contrast to the conclusions of
previous studies,8 this is not triggered by the binding of the dioxygen to the iron.
6.4. Methods
Force field optimization of the oxygenated-heme atomic charges and Fe–O–O angle
parameter – CHARMM22 6-liganded heme force field parameters were developed by Kuczera
et al.17
to simulate CO-bound hemoprotein. To simulate O2-bound hemoprotein, the atomic
charges of heme prosthetic group as well as the coordinated oxygen and the Fe–O–O angle
parameter were optimized following the standard parametrization protocol for the CHARMM22
force field.18
Ab initio quantum mechanical (QM) calculations were performed using the
program Gaussian 03.19
The B3LYP/6-31G* level of theory was used for the initial geometry
optimization and subsequent single point calculations. This level of theory was applied
successfully to the parametrization of the CHARMM force field of iron–porphyrin systems.20
The atoms included for this procedure are those of the central iron–porphyrin ring and those of
the linking molecules O2 and imidazole. The heme side groups were omitted. Initial atom
coordinates were taken from the oxygenated TrHbN crystal structure (PDB accession code
102
1IDR 2). Missing hydrogen atoms were added using WebMO
21. The CHARMM atom types used
in this optimization are presented as supplemental material (Annexe 1, Fig. S1).
The optimized charges as well as the force constant for the Fe–O–O angle are presented in
Annexe 1, Table S1 and S2. The atomic charges were obtained from the optimized geometry
Mulliken charges, adjusted consistently with the electrostatic fitting procedure of the
parametrization protocol. The potential energy of interaction between the dioxygen ligand and a
water molecule was calculated from the difference in QM energies of a gas-phase system-water
complex and the isolated molecules. For this calculation, the single point calculations were
performed while keeping the intramolecular geometry of each molecule fixed. The force constant
for the Fe–O–O bond angle and the corresponding equilibrium angle were calculated from the
QM optimized geometries. The potential energy surface was obtained from increments of 10°
from 60° to 300°, with smaller increments around the minimum (122.22°) and the maximum
(180°).
Simulation details – Simulations were performed using CHARMM22 and the CHARMM22 all-
atom potential energy parameter set18
with phi, psi cross term map correction (CMAP)23
and
modified TIP3P waters.24
Electrostatic interactions were calculated via the Particle Mesh Ewald
method,25
using a sixth-order spline interpolation for complementary function, with κ = 0.34 Å-1
,
and a fast-Fourier grid density of ≈ 1 Å-1
. Cutoffs for the real space portion of the Particle Mesh
Ewald calculation and the truncation of the Lennard-Jones interactions were 10 Å, with the latter
smoothed via a shifting function over the range of 8 Å to 10 Å. The SHAKE algorithm26
was
used to constrain all covalent bonds involving hydrogen atoms. All simulations employed the
leapfrog algorithm and an integration step of 1 femtosecond (fs). Coordinates were saved every
picosecond (ps) for analysis. Nonbond and image lists were updated heuristically. All
simulations were performed at constant pressure and temperature (NPT ensemble) using Hoover
algorithm for temperature control.27
The mass of the thermal piston was 20,000 kcal•mol-1
•ps2
and the mass of the pressure piston equalled 1000 amu. All simulations were carried out at 298 K
and 1 atm. The net translation and rotation of the systems were removed every 10,000 steps.
103
Systems setup – Coordinates for MD simulations were taken from the crystal structure of wild-
type oxy-TrHbN (PDB entry 1IDR2). As there is no experimental structure of deoxy-TrHbN
available, the deoxy structure was obtained by deleting the oxygen molecule. This methodology
is supported by the low RMSD observed between the experimental structures of liganded and
unliganded states of hemoglobins available from the PDB database. As expected, no noticeable
reorganization of TrHbN in the absence of the heme-bound oxygen (except for residues
Tyr33(B10), Gln58(E11), and Phe62(E15)) was observed from the simulations (average RMSD
of 0.86 Å). It is worth mentioning that the same methodology was used by another group
studying the same protein.7,8
All ionizable residues were considered in their standard protonation state at pH 7 with neutral
histidines proton placed at the ND1 position. Missing coordinates from crystal structure were
built using the internal coordinates definition of CHARMM. For each subunit, the carboxy
terminal end was optimally positioned by performing 3 nanoseconds (ns) Langevin dynamics
with a 1 fs time step and a friction coefficient FBETA of 5 ps-1
while keeping constrained all
coordinates from crystal structure. The converged structures were immersed in a rhombic
dodecahedron unit cell containing pre-equilibrated TIP3P water molecules (8330 molecules). Six
sodium ions were added to neutralize the charge of the systems. Water molecules within 2.8 Å of
any protein atom were deleted yielding to about 24,350 atoms for each system. Before to the
initiation of MD simulations, the energy of the solvated systems was minimized with two cycles
of 500 steps of steepest descent followed by 500 steps of Adopted Basis Newton-Raphson.
During energy minimization, the protein coordinates were kept constrained.
To increase sampling, two trajectories were generated using A and B crystal subunits, either in
presence or absence of the coordinated oxygen, for a total of four trajectories of 25 ns. Data were
collected for the last 20 ns for further analysis. A 25 ns trajectory took about 1250 h to produce
on 8 AMD 2.2 GHz Opteron 248 processors interconnected with Infiniband network adapters.
Analysis of tunnels – CAVER28
was used to study TrHbN tunnels with a grid resolution of
0.5 Å. The dynamic character of each tunnel was determined using 2000 MD frames from each
simulation, covering the whole simulation over the last 20 ns (1 frame every 10 ps). Tunnel
104
profiles, that is, the average tunnel radius along its length, were calculated from the accessible
paths detected by CAVER.
6.5. Results and discussion
6.5.1. Active site configurations
Resonance Raman spectrometry and X-ray crystallography revealed that in TrHbN both
Tyr33(B10) and Gln58(E11) can interact with the ligand.2,29
Also, previous molecular dynamics
simulations showed that the hydrogen bond network topology differs depending on the presence
of the iron bounded O2.8 Therefore, the conformations of Tyr33(B10) and Gln58(E11) were
studied depending on the presence or absence of a coordinated O2.
6.5.2. MD simulations of oxygenated TrHbN
Two trajectories were produced, one for each crystal subunit. The active site configuration
observed throughout these trajectories corresponded to that of the crystal structure, similarly to
recent MD simulations7,8
and is shown in Figure 6.2, top. The configuration of the active site can
be expressed by the distance separating the different chemical groups lying in the distal heme
pocket. A summary of the average distance separating the relevant atoms is shown in Table 6.1.
The average distances between Tyr33(B10) OH atom and the proximal and distal oxygens of the
bound O2 are 3.52 ± 0.01 Å and 2.83 ± 0.01 Å respectively. These distances are in agreement
with the strong interactions observed experimentally between Tyr33(B10) and the heme-bound
O2.29
It is noteworthy that these distances are slightly different than the distances observed in the
crystal structure where both oxgyens are practically equidistant to Tyr33(B10) OH atom (~3.1
Å).2 Partial charges on the proximal and distal oxygens of -0.18e and -0.32e, respectively, lead
the Tyr33(B10) OH atom to come closer to the distal oxygen. Similar distances (3.27 Å and 2.76
Å) were obtained with oxy-TrHbN simulations by Bidon-Chanal and coworkers.8 The very small
deviation of this residue from the PDB structure (RMSD of 0.52 A for backbone heavy atoms)
105
indicates that there is no reorganization of the distal heme pocket residues. Although the Fe–O–
O optimized angle is 122.22°, close to the angle values of the structures, the average value
observed from the simulations is 132.6 ± 0.01°.
6.5.3. MD simulations of the ferrous unliganded TrHbN
The absence of a coordinated dioxygen causes a reorganization of the active site configuration.
In this case, the side chain of Gln58(E11) experiences a lower steric hindrance and comes closer
to the iron atom (Fig. 6.2, bottom). Following rotation of the Gln58(E11) side chain, the
Tyr33(B10) phenolic OH group becomes hydrogen bonded to the OE1 atom of Gln58(E11). This
major configuration predominates and occurs 89.3 ± 4.9% of the time. A minor configuration
corresponding to that found in oxy-TrHbN, is observed 8.7 ± 4.9% of the time. As for oxy-
TrHbN trajectories, the H-bond involving the HE21 or HE22 atom of the Gln58(E11) residue
with O atom of Tyr33(B10) is observed but is weak because of the 3.76 Å distance (Table 6.1)
and the more obtuse angle of 48°.
6.5.4. Gln58(E11) and Phe62(E15) dynamics are linked
The two conformations of the Phe62(E15) side chain observed in crystal structures suggest
mobility of the Phe62(E15) residue. Gln58(E11) is within contact distance of the Phe62(E15)
residue.2,6
Phe62(E15) was proposed to act as a gate controlling ligand diffusion in the long
tunnel.2,7,8
Furthermore, extended molecular dynamics simulations show that position of the
Gln58(E11) residue influences Phe62(E15) dynamics.8 Therefore, the side-chain dihedral angles
of these two residues were calculated from MD simulations. The results, expressed according to
the rotameric species nomenclature of Lovell et al,30
are given in Table 6.2 and represented in
Figures 6.3 and 6.4.
106
In oxy-TrHbN the Gln58(E11) side chain is confined to two rotamers, tp-100° and mm100°.
Both show the same hydrogen bonding with the Tyr33(B10) residue (Annexe 1, Fig. S2). The
side chain of Phe62(E15) moves within the long tunnel by visiting two χ1 domains, [-180°: -
140°] and [-110°: -60°] (Table 6.2, Fig. 6.3, top and Fig. 6.4, bottom left), corresponding to the
t80° (χ1 ‘‘trans’’) and m-30°/m-85° (χ1 ‘‘minus’’) rotamers, respectively. For the remainder of
the text, the Phe62(E15) t80° rotamer will be referred to as the T (‘‘trans’’) state and the m-
30°/m-85° rotamers as the M (‘‘minus’’) state. When Phe62(E15) is in the T state, the phenyl
ring is located farther from the heme and χ2 is mainly found in the domain [0°: +90°]. In
contrast, when Phe62(E15) is in the M state, the phenyl ring is closer to the heme and χ2 is
unrestricted. The M state prevails in oxy-TrHbN accounting for 84.8 ± 2.5% of the
conformations, with an average χ1 of -84.2 ± 1.2°. The difference in potential energy between M
and T states is about 0.6 kcal/mol in favour of the M state.
Deoxy-TrHbN behaves differently. Here, Gln58(E11) adopts two new rotamers (Table 6.2): tt0°
(χ1 ‘‘trans’’ and χ2 ‘‘trans’’) and mt-30° (χ1 ‘‘minus’’, χ2 ‘‘trans’’). It is noteworthy that the tp-
100° and mm100° rotamers adopted by Gln58(E11) in the oxy complex are rare, and that the tt0°
and mt-30° conformations found in the deoxy state are more typical.30
The residue Phe62(E15) is
almost restricted to the M state and the χ2 angle mainly allowed within the domain [-75°: +15°]
(Fig. 6.3, bottom , and Fig. 6.4, bottom right). The restriction of Phe62(E15) to the M state is a
direct consequence of the displacement of the Gln58(E11) OE1 atom (Fig. 6.2), which
experiences a lower steric hindrance than in oxy-TrHbN. As a consequence, the χ1 average angle
of the Phe62(E15) residue in the M state is -74.6 ± 1.2°. The relation between Gln58(E11) and
Phe62(E15) was also observed experimentally from mutants. The crystal structure of single
mutants Tyr33(B10)Phe (PDB ID: 2GKM) and Gln58(E11)(Ala/Val) (PDB ID: 2GKN and
2GLN), and the double mutant Tyr33(B10)Phe/Gln58(E11)Val (PDB ID: 2GL3) shows only one
Phe62(E15) conformation (M state).29
These experimental observations clearly support that the
dynamics of Gln58(E11) and Phe62(E15) are linked in wild type TrHbN and that Tyr33(B10) is
involved.
In conclusion, our MD simulations clearly demonstrated that Phe62(E15) and Gln58(E11)
dynamics are linked (see Fig. 6.4), and that Tyr33(B10) conformation is involved. In addition,
the ligand state of the heme also influences the dynamics of Phe62(E15) and Gln58(E11). Upon
107
O2 binding, the conformation of Gln58(E11) and Tyr33(B10) change, and consequently residue
Phe62(E15) fluctuates between the M and T states. Some of these observations are in accord
with earlier reports8,31
; however, our data lead to very different conclusions on the tunnel
dynamics (vide infra).
6.5.5. Characterization of cavities and tunnels
Dynamic modelling of tunnels from cavities – The crystal structure of TrHbN treated at high
xenon pressure shows that the protein harbors several xenon atoms at distinct sites while
showing low root-mean-square deviation (RMSD) of the backbone chain position.5 This
indicates that the TrHbN two-on-two helical fold is rigid. Figure 6.5 presents snapshots of
cavities in the protein taken from the four MD trajectories produced in this work (a movie is
available as supplemental material and at CHARMM-GUI web site32,33
). These cavities show
various shapes and volumes, and are short-lived appearing and disappearing repeatedly. On very
rare occasions, a cavity was found wide open extending from the protein surface to the distal
heme pocket. These cavities form along particular paths, hereafter referred to as tunnels (vide
infra).
To determine whether TrHbN backbone is involved in the formation of cavities, the backbone
1H–
15N order parameters (S
2) were calculated. Here, S
2 measures the degree of spatial restriction
of the 1H–
15N bond vector; its value varies from 0 to 1, where lower values indicate larger
amplitudes of internal motion.34
Typically, structured regions (α-helices and β-strands) show an
average S2 near 0.85 while exposed loops and terminal regions exhibit lower values.
35 Values of
S2 were calculated from an ensemble generated with the last 20 ns of each of the four trajectories
according to the ‘‘model-free’’ formalism introduced by Lipari and Szabo36
and the procedure
described in 37
. Briefly, S2 were calculated as the plateau value of the autocorrelation function:
108
)(lim 2
2 tCSt
Where
)()(
)]()([)(
33
22
trr
tPAtC
Here, A is a constant such that C2(0) = 1; P2 is the second order Legendre polynomial,
P2[x] = 1/2(3x2 – 1); and r(τ) is the N–H bond length at time τ. The angle brackets represent
the average over the ensemble. The unit vectors μ(τ) and μ(τ + t) describe the orientation of the
N–H vector at time τ and (τ + t) in relation to a fixed reference frame. To construct this frame,
global translational and rotational motions were removed from the trajectory by a RMSD
optimized superposition of all the backbone heavy atoms (N, C, Ca, and O) on the first
coordinate frame. Thus, S2 reflects the internal motion of the peptide plan. The recently
developed CMAP correction to the CHARMM22 force field23
greatly improved the agreement
between the MD-derived and NMR-derived dynamical parameters.38
Although a similar
agreement is expected for the S2 values obtained in the present study, validation with
experimental data is under way.
As shown in Figure 6.6, the pre-A-A loop, the E-F loop, and the loops contiguous to the C-helix
exhibit low values of S2. Not surprisingly, helical regions show the highest values of S
2. In
particular, helices B, E, G, and H that surround the cavities show an average S2 of 0.90 ± 0.03,
which is higher than the typical value of 0.85 found for structured regions. Both TrHbN termini
show maximum flexibility, notably the C-terminus, which does not adopt any secondary
structure pattern. These results emphasize that the TrHbN two-on-two a-helical fold is rigid. This
rigidity is likely necessary to generate empty volumes in the protein matrix. The inspection of the
trajectories revealed that the side-chain motions of the residues lying along the tunnels are
responsible for the dynamic reshaping of cavities. It is noteworthy that for some residues
[Ile19(A15), Val28(B5), and Ile119(H11)], the rotamers adopted by the side chains are not
typical.
109
Tunnel characterization – This section presents a systematic study of TrHbN tunnels. As
previously reported, protein dynamics is sometimes necessary to allow the formation of
tunnels.11,16
In the same concept, TrHbN cavities form along particular discrete paths in the
protein matrix leading to the formation of tunnels. The different tunnels observed are presented
in Figure 6.7. In addition to the long and the short tunnels,2 we report two tunnels, named EH
and BE, that join the protein surface to the buried distal heme pocket. These tunnels are not
present in the crystallographic structure, and are analogous to the E helix/H helix and B helix/E
helix tunnels reported by Golden and Olsen39
using Locally Enhanced Sampling MD. In contrast
to our results, these tunnels were observed only when both A and B subunits of the
crystallographic structure were present in the system.
Tunnels linking the protein surface to the distal heme pocket were rarely observed using the
usual 1.4 Å probe radius. Because substrate molecules may diffuse transiently from different
cavities, the tunnels do not need to be continuously open at the same time. Also, the bottlenecks
and broadenings located along the different tunnels may govern the substrate diffusion process.
Thus, it is important to analyze both the narrower and the broader regions of each tunnels.
CAVER used here28
is specifically designed to find and analyze paths leading from buried
protein cavities to the outside solvent. Because CAVER does not depend on a given probe
radius, it is able to pass through bottlenecks to find a path.
The profile of each tunnel, that is the average tunnel radius along the tunnels, was produced from
the analysis of thousand of MD snapshots (see Method) and are given in Figure 6.8. The length
of each tunnel as well as the average volume of the different profiles in oxy-TrHbN and deoxy-
TrHbN are summarized in Table 6.3. All distances were calculated from an arbitrarily chosen
position located at 3.8 Å from the iron centre above the pyrrole NB atom. This position was used
as the starting point for each profile as it is common to all tunnels and located outside the volume
occupied by the ligand.
Long tunnel – The long tunnel (Fig. 6.7, A) has a length of 20 Å, and as a consequence has the
biggest average volume. Two profiles were observed for the long tunnel (Fig. 6.8, A), according
to the Phe62(E15) state (M or T). When Phe62(E15) is in the M state, the profile shows a
bottleneck of 1.2 Å radius located at 6.3 Å from the starting point. This is followed by a
110
broadening of 1.6 Å radius at 11.0 Å from the origin [Fig. 6.8, A, profile P1 (circles)]. The
broader part of this profile corresponds to the Xe1 binding site reported by Milani et al.5 (see also
Fig. 6.1). Recall that Phe62(E15) is restricted to the M state in deoxy-TrHbN and fluctuates
between the M and T states in oxy-TrHbN. As a consequence, the P1 profile was observed for
99.6% of the time in deoxy-TrHbN, while it accounts for 84.8 ± 2.5% of the time in oxy-TrHbN.
The P1 profile is inverted to generate the P2 profile when Phe62(E15) is in the T state. The
broader region now is closer to the distal pocket (radius of 1.6 Å, centered at 6.0 Å) and is
followed by a bottleneck (radius of 1.2 Å, centered at 11.6 Å), [Fig. 6.8, A (squares)]. The broad
region of the P2 profile comprises the Xe5 binding site5 (Fig. 6.1). Interestingly, the Xe5 binding
site, not seen in the B subunit and observed in the A subunit of the crystal structure, has a low
occupancy factor of 0.30 (PDB ID. 1S56), which is in accord with the low frequency of
occurrence of profile P2 in oxy-TrHbN simulations. The averaged tunnel volume is similar for
both profiles, with values of 169 ± 4 Å3 for profile P1, and 173 ± 2 Å
3 for profile P2.
As mentioned earlier and as shown in Figure 6.3, the Phe62(E15) χ2 adopts a wide range of
values. To determine the impact of this dihedral angle on the profiles of the long tunnel, the
bottleneck radii were extracted with respect to χ2. As can be seen in Figure 6.9, the bottleneck
radius of the long tunnel varies according to χ2, both for the M or T Phe62(E15) states.
Physically, when χ2 varies between 50° and +90°, and between -90° and -40°, the phenyl ring of
Phe62(E15) tends to be parallel to the long tunnel axis, and therefore the average radius of the
bottleneck radius increases up to ~1.3 Å. On the other hand, when the phenyl ring is orthogonal
to the long tunnel axis (χ2 range of values [-40°: +40°]) the bottleneck radius decreases below 1.1
Å and therefore the tunnel becomes too narrow to permit the diffusion of a substrate. These
observations are in agreement with the open/closed concept from the crystallographic structure
(PDB ID: 1IDR).5 In this concept the Phe62(E15) closed conformation has dihedral angle values
of χ1 = -155.0° and χ2 = 36.5°, and the open conformation, with the phenyl ring closer to the
heme, has dihedral values of χ1 = -90.8° and χ2 = -68.4°.
Our results are in disagreement with recent MD simulations from Estrin’s group7,8
for the
closed/open concept and for the long tunnel width. From their simulations, the authors identify
the closed state with the Phe62(E15) phenyl ring closer to the heme, whereas the open state has
the Phe62(E15) phenyl ring lying roughly parallel to the axis of the tunnel. Further, Crespo et al.7
111
report that the opening of the long tunnel increases its narrowest width to values of ≈ 3.4 Å of
diameter, which is much larger than the values reported in Figure 6.9. These disagreements
might be explained by a reorganization of the pre-A and A helices reported by Bidon-Chanal et
al.8 In the crystal structure, the pre-A and A helices stabilize the region near the long tunnel
entrance with multiple salt bridges and hydrogen bonds involving residues Arg6, Ser14, Asp17,
Lys18, Gly68, and Glu114. Bidon-Chanal et al.8 report an important reorientation of the pre-A
helix to form a salt bridge between residues Arg10 and Glu70. The atoms involved in this salt
bridge are separated by ≈ 25 Å in the crystal structure; thus, this reorganization involves the
rupture of all the interactions stabilizing the region near the long tunnel entrance present in the
crystal structure. This salt bridge is not always present, and according to their observations, in its
absence the dynamical fluctuations of the backbone facilitates the relative displacement helices B
and E, which has an impact on the dynamics of Phe62(E15) residue and the long tunnel. In our
simulations, the preA helix was found flexible (Fig. 6.6), but no such reorganization was
observed.
Finally, Figure 6.9 also clearly indicates that the orientation of the Phe62(E15) χ2 dihedral angle
is the principal determinant controlling the opening of the long tunnel. This is consistent with the
observations from the trajectories of the long tunnel fully open without discontinuity in either M
or T state for both oxy and deoxy-TrHbN (recall that the T state is mostly populated by oxy-
TrHbN). Again, our results are in disagreement with the mechanism proposed by Bidon-Chanal
et al.8 where upon dioxygen binding Phe62(E15) side chain changes conformation to open the
long tunnel. In Ref. 8 there is no systematic study of the Phe62(E15) χ2 dihedral angle on the
impact of the opening of the long tunnel.
EH tunnel – The surface entrance of the EH tunnel (Fig. 6.7, C) is defined by residues
Phe61(E14), Ala65(E18), Val118(H10), and Leu122(H14), situated between the E and H helices.
As observed for the long tunnel, the Phe62(E15) side chain controls substrate access from the EH
tunnel to the distal heme pocket. The EH tunnel is approximately 15 Å long, and its volume
varies according to the conformation of the Phe62(E15) side chain (Table 6.3). As shown in
Figure 6.8, the Phe62(E15) T state favors the opening of the EH tunnel whereas the M state
drastically impairs communication with the distal heme pocket. The profiles, extracted as
function of the Phe62(E15) M and T states, are shown in Figure 6.8, B. The first 4 Å from the
112
starting point are common to both the EH and the long tunnels. In the M state, the average
volume of the EH tunnel is 118 ± 1 Å3, and its profile [Profile P1, Fig. 6.8, B (circles)] exhibits
one bottleneck located at 7.3 Å from the starting point, close to the Phe62(E15) residue.
When Phe62(E15) is in the T state, the average tunnel volume increases to 147 ± 2 Å3, and the
profile [profile P2, Fig. 6.8, B (squares)] shows now an enlargement comprising the Xe5 and the
Xe2 binding sites. As shown from the plot of the average bottleneck radius as function of the
Phe62(E15) χ2 for both the M and T states (Fig. 6.9), the opening of the EH tunnel is controlled
by χ1 but not by χ2. Figure 6.9 also shows that the bottleneck is always broader when the
Phe62(E15) is in the T state than in the M state.
When the Phe62(E15) is in the M state, the EH tunnel often merges with the long tunnel, giving
the LEH tunnel (Fig. 6.7, D). Because the M state predominates in the trajectories, the diffusion
of ligands through the EH tunnel is likely to occur most of the time in a two-step mechanism:
during the first, the substrate penetrates the protein matrix and then, crosses the Phe62(E15)
barrier. This is the first report of the EH tunnel. In the A-chain of the crystal structure of the
oxygenated form (PDB ID 1IDR), the Phe62(E15) residue shows two conformations that
correspond to the M and the T states. In agreement, in the crystal structure, the EH tunnel is
observed only when the Phe62(E15) position corresponds to the T state. Interestingly, the crystal
structure of Chlamydomonas eugametos shows the long and the EH tunnel (PDB entry 1DLY).40
Short tunnel - The surface entrance of the short tunnel (Fig. 6.7, B) is defined by residues
Phe91(G5), Ala95(G9), Leu116(H8), and Ala120(H12) and is situated between the G and H
helices. The short tunnel (Fig. 6.7, B) has a length of about 13 Å and has an average volume of
_116 ± 2 Å3 (Table 6.3). The radius of the short tunnel does not vary significantly (Fig. 6.8, B),
with only one bottleneck of 1.10Å located near to the protein surface and defined by the residues
Val94(G8), Leu98(G12), Ile119(H11), and the heme. The Xe2 and Xe3 binding sites5 are
enclosed in the short tunnel and located on either sides of this bottleneck. Trajectory analysis
revealed that the Ile119(H11) have a highest mobility than either Val94(G8) and Leu98(G12).
For the majority of the MD frames analyzed, Ile119(H11) partly hindered the short tunnel space.
The residue Ile119(H11) was found displaced for the MD frame having a continuously open
113
short tunnel. In some occasions, the short tunnel was found shifted in the direction of the
Phe91(G5) residue.
BE tunnel - The BE tunnel (Fig. 6.7, E) extends from between Tyr33(B10) and Phe46(CD1)
side chains and reaches the solvent between the B and E helices. The entrance of the BE tunnel is
defined by Tyr33(B10) backbone and by the side chains of Leu37(B14) and Met51(E4). The BE
tunnel has a length of 10.5 Å and shows two profiles according to Tyr33(B10) conformation
(Table 6.3). The first profile [profile P1, Fig. 6.8, D (circles)] occurs when the χ2 dihedral of
Tyr33(B10) lies within the domain [+75°: +135°]. In this conformation the tunnel has an average
volume of 69 ± 2 Å3 and the profile shows a bottleneck of 0.97 Å of radius at 7.1 Å from the
reference point in the distal site, making it the narrowest tunnel found in TrHbN. This bottleneck
is close to the protein surface and is located near the side chain of Leu37(B14) and Met51(E4)
and the backbone of Tyr33(B10). The BE tunnel is considerably enlarged when the aromatic ring
of the Tyr33(B10) becomes parallel to the ring of Phe46(CD1). This particular movement creates
a large opening of the BE path over the first 6 Å [profile P2, Fig. 6.8, D (squares)] increasing the
volume of the cavity by 13 Å3. Nevertheless, the narrow bottleneck near the protein surface is
kept. This movement is rare and occurs only in the simulations of deoxy-TrHbN.
6.6. Concluding remarks
Our results clearly show that (1) TrHbN hosts a complex tunnel system; (2) tunnels in TrHbN are
not static, but are rather a result of a dynamic reshaping of the cavities along a given path and (3)
the rigid structure of TrHbN backbone is required to generate and maintain the cavities. MD
simulations strongly suggest that gaseous substrates would access the active site through definite
pathways that are rarely open from the protein surface to the distal heme pocket as suggested
from the X-ray crystal structures. Rather, substrates would migrate through short-lived cavities
of various shapes and volumes.
Contrary to Estrin’s group,7,8
our data lead to different conclusions regarding the impacts of the
iron bounded dioxygen and the Phe62(E15) residue on the opening/closing of TrHbN tunnels.
First, we found that opening or closing of the long tunnel cannot be connected to the fluctuations
114
of Phe62(E15) residue around χ1 dihedral angle. Rather these fluctuations cause only a
displacement of the bottleneck along the long tunnel. Second, our data show that fluctuations
around the χ2 dihedral angle, which are associated with the phenyl ring rotation, control the
opening of the long tunnel. Third, the opening and closing of the newly discovered EH tunnel
was found to depend on the χ1 dihedral angle while χ2 dihedral angle has no effect.
Finally, the tunnels average volumes are large enough to accomodate few small apolar ligands.
As the long and the EH tunnels are the largest, and their opening is controlled via the residue
Phe62(E15) and the presence of an iron bounded dioxygen, we propose that these tunnels can be
used as storage to sustain the active site with ligands.
6.7. Acknowledgments
We are grateful to Dr. Joel M. Friedman, Dr. Beatrice A. Wittenberg, and Dr. Jonathan B.
Wittenberg for insightful discussions.
6.8. References
1. Ouellet H, Ouellet Y, Richard C, Labarre M, Wittenberg B, Wittenberg J, Guertin M.
Truncated hemoglobin HbN protects Mycobacterium bovis from nitric oxide. Proc Natl Acad
Sci USA 2002; 99:5902–5907
2. Milani M, Pesce A, Ouellet Y, Ascenzi P, Guertin M, Bolognesi M. Mycobacterium
tuberculosis hemoglobin N displays a protein tunnel suited for O2 diffusion to the heme.
EMBO J 2001;20:3902–3909.
3. Yeh SR, Couture M, Ouellet Y, Guertin M, Rousseau DL. A cooperative oxygen binding
hemoglobin from Mycobacterium tuberculosis. Stabilization of heme ligands by a distal
tyrosine residue. J Biol Chem 2000;275:1679–1684.
4. Couture M, Das TK, Lee HC, Peisach J, Rousseau DL, Wittenberg BA, Wittenberg JB,
Guertin M. Chlamydomonas chloroplast ferrous hemoglobin. Heme pocket structure and
reactions with ligands. J Biol Chem 1999;274:6898–6910.
115
5. Milani M, Pesce A, Ouellet Y, Dewilde S, Friedman J, Ascenzi P, Guertin M, Bolognesi M.
Heme-ligand tunneling in group I truncated hemoglobins. J Biol Chem 2004;279:21520–
21525.
6. Milani M, Ouellet Y, Ouellet H, Boffi MGA, Antonini G, Bocedi A, Mattu M, Bolognesi M,
Ascenzi P. Cyanide binding to truncated hemoglobins: a crystallographic and kinetic study.
Biochemistry 2004;43:5213–5221.
7. Crespo A, Marti MA, Kalko SG, Morreale A, Orozco M, Gelpi JL, Luque FJ, Estrin DA.
Theoretical study of the truncated hemoglobin HbN: exploring the molecular basis of the NO
detoxification mechanism. J Am Chem Soc 2005;127:4433–4444.
8. Bidon-Chanal A, Marti MA, Crespo A, Milani M, Orozco M, Bolognesi M, Luque FJ, Estrin
DA. Ligand-induced dynamical regulation of NO conversion in Mycobacterium tuberculosis
truncated hemoglobin-N. Proteins 2006;64:457–464.
9. Huang X, Holden HM, Raushel FM. Channeling of substrates and intermediates in enzyme-
catalyzed reactions. Ann Rev Biochem 2001;70:149–150.
10. Ciacchi L, Payne M. The entry pathway of O2 into human ferritin. Chem Phys Lett
2004;390:491–495.
11. Cohen J, Kim K, King P, Seibert M, Schulten K. Finding gas diffusion pathways in proteins:
application to O2 and H2 transport in CpI [FeFe]-hydrogenase and the role of packing defects.
Structure 2005;13:1321–1329.
12. Furse KE, Pratt DA, Schneider C, Brash AR, Porter NA, Lybrand TP. Molecular dynamics
simulations of arachidonic acid-derived pentadienyl radical intermediate complexes with
COX-1 and COX-2: insights into oxygenation regio- and stereoselectivity. Biochemistry
2006;45:3206–3208.
13. Cohen J, Schulten K. O2 migration pathways are not conserved across proteins of a similar
fold. Biophys J 2007;93:3591–3600.
14. Johnson BJ, Cohen J, Welford RW, Pearson AR, Schulten K, Klinman JP, Wilmot CM.
Exploring molecular oxygen pathways in Hansenula polymorpha copper-containing amine
oxidase. J Biol Chem 2007;282:17767–17776.
15. Saam J, Ivanov I, Walther M, Holzhutter H-G, Kuhn H. Molecular dioxygen enters the active
site of 12/15-lipoxygenase via dynamic oxygen access channels. Proc Natl Acad Sci USA
2007;104:13319–13324.
16. Amara P, Andreoletti P, Jouve HM, Field MJ. Ligand diffusion in the catalase from Proteus
mirabilis: a molecular dynamics study. Prot Sci 2001;10:1927–1935.
116
17. Kuczera K, Kuriyan J, Karplus M. Temperature dependence of the structure and dynamics of
myoglobin. A simulation approach. J Mol Biol 1990;213:351–373.
18. Mackerell AD, Bashford D, Bellott M, Dunbrack RL, Evanseck JD, Field MJ, Fischer S, Gao
J, Guo H, Ha S, Joseph-Mccarthy D, Kuchnir L, Kuczera K, Lau FTK, Mattos C, Michnick
S, Ngo T, Nguyen DT, Prodhom B, Reiher WE, Roux B, Schlenkrich M, Smith JC, Stote R,
Straub J, Watanabe M, Wiorkiewicz-Kuczera J, Yin D, Karplus M. All-atom empirical
potential for molecular modeling and dynamics studies of proteins. J Phys Chem B
1998;102:3586–3616.
19. Frisch MJ, Trucks GW, Schlegel HB, Scuseria GE, Robb MA, Cheeseman JR, Montgomery
Jr.JA, Vreven T, Kudin KN, Burant JC, Millam JM, Iyengar SS, Tomasi J, Barone V,
Mennucci B, Cossi M, Scalmani G, Rega N, Petersson GA, Nakatsuji H, Hada M, Ehara M,
Toyota K, Fukuda R, Hasegawa J, Ishida M, Nakajima T, Honda Y, Kitao O, Nakai H, Klene
M, Li X, Knox JE, Hratchian HP, Cross JB, Bakken V, Adamo C, Jaramillo J, Gomperts R,
Stratmann RE, Yazyev O, Austin AJ, Cammi R, Pomelli C, Ochterski JW, Ayala PY,
Morokuma K, Voth GA, Salvador P, Dannenberg JJ, Zakrzewski VG, Dapprich S, Daniels
AD, Strain MC, Farkas O, Malick DK, Rabuck AD, Raghavachari K, Foresman JB, Ortiz JV,
Cui Q, Baboul AG, Clifford S, Cioslowski J, Stefanov BB, Liu G, Liashenko A, Piskorz P,
Komaromi I, Martin RL, Fox DJ, Keith T, Al-Laham MA, Peng CY, Nanayakkara A,
Challacombe M, Gill PMW, Johnson B, Chen W, Wong MW, Gonzalez C, Pople JA.
Gaussian 03, Revision C.02. Wallingford, CT: Gaussian, Inc.; 2004.
20. Autenrieth F, Tajkhorshid E, Baudry J, Luthey-Schulten Z. Classical force field parameters
for the heme prosthetic group of cytochrome c. J Comput Chem 2004;25:1613–1622.
21. WebMO 7.0. Available at: www.webmo.net.
22. Brooks BR, Bruccoleri RE, Olafson BD, Karplus DJ. Charmm: a program for
macromolecular energy, minimization, and dynamics calculations. J Comput Chem
1983;4:187.
23. Mackerell AD, Feig M, Brooks CL. Extending the treatment of backbone energetics in
protein force fields: Limitations of gas-phase quantum mechanics in reproducing protein
conformational distributions in molecular dynamics simulations. J Comput Chem 2004;
25:1400–1415.
24. Price DJ, CLB, III. A modified TIP3P water potential for simulation with Ewald summation.
J Chem Phys 2004;121:10096–10103.
25. Darden T, York D, Pedersen L. Particle mesh Ewald: an Nlog(N) method for Ewald sums in
large systems. J Chem Phys 1993;98: 10089–10092.
26. Ryckaert J-P, Ciccotti G, Berendsen HJC. Numerical integration of the cartesian equations of
motion of a system with constraints: molecular dynamics of n-alkanes. J Comput Phys
1977;23:327–341.
117
27. Feller SE, Zhang Y, Pastor RW, Brooks BR. Constant pressure molecular dynamics
simulation: the Langevin piston method. J Chem Phys 1995;103:4613–4621.
28. Petrek M, Otyepka M, Banas P, Kosinova P, Koca J, Damborsky J. CAVER: a new tool to
explore routes from protein clefts, pockets and cavities. BMC Bioinform 2006;7:3161.
29. Ouellet Y, Milani M, Couture M, Bolognesi M, Guertin M. Ligand interactions in the distal
heme pocket of Mycobacterium tuberculosis truncated hemoglobin N: roles of TyrB10 and
GlnE11 residues. Biochemistry 2006;45:8770–8781.
30. Lovell SC, Word JM, Richardson JS, Richardson DC. The penultimate rotamer library.
Proteins 2000;40:389–408.
31. Bidon-Chanal A, Martı´ MA, Estrin DA, Luque FJ. Dynamical regulation of ligand migration
by a gate-opening molecular switch in truncated hemoglobin-N from Mycobacterium
tuberculosis. J Am Chem Soc 2007;129:6782–6788.
32. Jo S, Kim T, Iyer V, Im W. 2007 CHARMM-GUI: a Web-based Graphical User Interface for
CHARMM. Available at: http://www.charmm-gui.org
33. Daigle R. 2008. Mycobacterium tuberculosis hemoglobin N cavities. Available at:
http://www.charmm-gui.org/?doc5gallery&id533.
34. Cavanagh J, Fairbrother WJ, Palmer IAG, Skelton NJ. Protein NMR spectroscopy: principles
and practice. San Diego, CA: Academic Press, Inc.; 1996.
35. Palmer AG. NMR probes of molecular dynamics: overview and comparison with other
techniques. Annu Rev Biophys Biomol Struct 2001;30:129–155.
36. Lipari G, Szabo A. Model-free approach to the interpretation of nuclear magnetic resonance
relaxation in macromolecules. 1. Theory and range of validity. J Am Chem Soc
1982;104:4546–4559.
37. Buck M, Karplus M. Internal and overall peptide group motion in proteins: molecular
dynamics simulations for lysozyme compared with results from X-ray and NMR
spectroscopy. J Am Chem Soc 1999;121:9645–9658.
38. Buck M, Bouguet-Bonnet S, Pastor RW, MacKerell AD. Importance of the CMAP
correction to the CHARMM22 protein force field: dynamics of hen lysozyme. Biophys J
2006;90:L36–L38. Available at: http://dx.doi.org/10.1529/biophysj.105.078154.
39. Golden SD, Olsen KW. Identification of ligand-binding pathways in truncated hemoglobins
using locally enhanced sampling molecular dynamics. GLOBINS AND OTHER NITRIC
OXIDE-REACTIVE PROTEINS, PART B 2008;437:459–475.
118
40. Pesce A, Couture M, Dewilde S, Guertin M, Yamauchi K, Ascenzi P, Moens L, Bolognesi
M. A novel two-over-two alpha-helical sandwich fold is characteristic of the truncated
hemoglobin family. EMBO J 2000;19:2424–2434.
41. DeLano WL. 2002. The PyMOL Molecular Graphics System. Available at:
http//www.pymol.org.
119
Table 6.1 Interatomic Distances Between Relevant Atoms From Trajectories
Atom pair* Oxy-TrHbN Deoxy-TrHbN major Deoxy-TrHbN minor
B10-E11-N 3.30 ± 0.03 2.83 ± 0.04 3.76 ± 0.04
B10-E11-O 5.37 ± 0.02 1.87 ± 0.04 5.83 ± 0.04
B10-O1 3.52 ± 0.02 – –
B10-O2 2.83 ± 0.01 – –
B10-Iron 5.20 ± 0.02 5.73 ± 0.10 5.16 ± 0.07
E11-N-Iron 4.78 ± 0.05 3.79 ± 0.08 4.70 ± 0.04
E11-N-Pyrrol-A 4.46 ± 0.04 3.87 ± 0.08 4.26 ± 0.03
E11-N-Pyrrol-B 3.99 ± 0.04 3.54 ± 0.03 3.95 ± 0.06
* E11–N, side chain amide N atom; E11–O, side chain amide O atom; B10, phenolic O atom; O1, proximal oxygen;
O2, distal oxygen; pyrrole, heme pyrrolic N
atom.
120
Table 6.2 Distribution of the Different Rotameric Species Encountered During Simulations for
Q(E11) and F(E15)
Amino acid Rotamera Oxy-TrHbN Deoxy-
TrHbN
Deoxy-
TrHbN-minor
Q(E11) tp-100° 75.7 – 80.5
mm100° 21.8 – 13.5
tt0° – 13.0 –
mt-30° – 80.7 –
outliers/othersb 2.7 6.3 6.0
F(E15) t80° 11.6 0.3 9.8
m-30° 32.4 53.3 33.7
m-85° 52.4 46.3 54.2
outliers 3.6 0.1 2.3
a Nomenclature according to Lovell et al.
30
b Results include 1.6% and 2.7% of rotamer mm-40° in oxy-TrHbN and deoxy-TrHbN
respectively.
121
Table 6.3 Tunnels Physical Properties
Tunnels Length (Å) Profile Volume (Å3)
Long 20.0 P1
P2
170 ± 4
173 ± 2
Short 13.0 – 116 ± 2
EH 15.0 P1
P2
118 ± 1
147 ± 2
BE 10.5 P1
P2
69 ± 2
83 ± 4
122
Figure 6.1 TrHbN structure (PDB entry 1IDR, subunit A). Helical regions are identified. The
B,E,G and H helices are colored in blue, green, yellow, and purple, respectively. The five Xenon
binding sites5 from crystal structure PDB ID 1S56 are represented by the blue hard spheres. The
long and the short tunnels are indicated by the shaded zones. The picture was generated using
PyMOL.41
123
Figure 6.2 Active site configurations from typical MD frames for oxy-TrHbN (top) and deoxy-
TrHbN (bottom). The heme, the proximal histidine, Phe62(E15), Gln58(E11), and Tyr33(B10)
are represented with balls and sticks. Hydrogen bonds are represented by dashed lines with their
corresponding length. Additional pictures from different rotamers are available as supplemental
material (Annexe 1, Fig. S3). Pictures were generated using PyMOL.41
The stereo view
representation of this figure is also available as supplemental material (Annexe 1, Fig. S3).
124
Figure 6.3 Phe62(E15) χ1 as function of χ2 for oxy-TrHbN (top) and deoxy-TrHbN (bottom).
The T state corresponds to the v1 dihedral domain [-180°:-140°] while it is [-110°: -60°] for the
M state. By convention, χ2 range is [-90°: +90°] for phenylalanine and tyrosine. For each
configuration, 2000 MD frames were randomly selected.
125
Figure 6.4 Gln58(E11) (top) and Phe62(E15) (bottom) χ1 dihedral angle as function of simulation
time for oxy-TrHbN (left) and deoxy-TrHbN (right). Only the results from subunit A are shown.
126
Figure 6.5 Different snapshots of cavities in TrHbN. The BEG, and H helices are colored in blue,
green, yellow, and purple, respectively. The cavities are represented in grey. The pictures were
generated using PyMOL.41
127
Figure 6.6 Backbone 1H-
15N order parameters as function of residue sequence number calculated
from trajectories of A-TrHbN (continuous) and B-TrHbN (dotted) in oxy-TrHbN (top) and
deoxy-TrHbN (bottom). TrHbN helices are indicated by the boxes and their corresponding code
letter. Order parameters of residues 2 and 130 to 136 did not converge.
128
Figure 6.7 Representation of the long (A), short (B), EH (C), LEH (D), and BE (E) tunnels.
Helices B, E, G, and H are colored in blue, green, yellow, and purple, respectively. The pictures
were generated using PyMOL41
and PyMOL plugin CAVER28
.
129
Figure 6.8 Profiles generated for each tunnel leading from distal heme pocket to the bulk solvent.
Profiles of the (A) long and (B) EH tunnels were extracted regarding to the Phe62(E15) M
(circles) and T (squares) states. (C) Averaged profile of the short tunnel. (D) BE tunnel profiles
extracted from MD frames having the typical Tyr33(B10) χ2 dihedral domain (within [70°:
135°]) (circles) and from flipping events of the aromatic ring (squares). The relative position of
some Xenon binding sites are shown.5 Standard errors typically fall below 0.01 Å. Profiles were
generated using CAVER.28
130
Figure 6.9 Averaged minimum radius (bottleneck) of the (A) long and (B) EH tunnels according
to the Phe62(E15) χ2 dihedral. MD frames having the Phe62(E15) in the T (grey) and the M
(black) states were used. Data were collected using CAVER.28
A
B
131
7.
Chapitre 7
Theoretical Investigations of Nitric Oxide Channeling in
Mycobacterium tuberculosis Truncated Hemoglobin N
7.1. Résumé
L’hémoglobine tronquée du groupe I TrHbN de Mycobacterium tuberculolsis catalyse
l’oxydation de l’oxyde nitrique en nitrate selon la constante de vitesse d’ordre 2
k’NOD ≈ 745µM-1
•s-1
à 23°C (communément appelée NOD pour « nitric oxide dioxygenase
reaction »). Il a été proposé que cette haute efficacité soit associée à la présence de tunnels
hydrophobes prenant place à l’intérieur de la structure de TrHbN en permettant la diffusion
rapide des substrats vers le site actif. Dans ce travail, nous avons étudié les mécanismes de
diffusion du •NO à l’intérieur de la structure de TrHbN dans le contexte de la réaction NOD en
utilisant deux approches différentes. Des simulations de dynamiques moléculaires de TrHbN ont
été réalisées en présence de molécules de •NO explicites. La diffusion de •NO du solvant
jusqu’au site actif a été observée pour chacune des simulations réalisées. Ces simulations ont
révélé que les •NO interagissent avec des régions spécifiques de la surface de TrHbN constituées
de chaînes hydrophobes et situées aux entrées des tunnels. L’entrée de •NO et la diffusion
interne se sont produites par les tunnels Long, Court et EH identifiés précédemment. Le tunnel
Court a été préférentiellement utilisé pour atteindre le site actif. Cette préférence est attribuée à la
topologie en entonnoir ainsi qu’au caractère hautement hydrophobe couvrant une large zone
autour de l’entrée de ce tunnel. Ces propriétés favorisent la formation fréquente de cavités à
l’interface entre le solvant et la protéine suffisamment grandes pour accueillir trois molécules de
•NO. Ceci accélère la capture du •NO et son entrée subséquente. L’importance du caractère
hydrophobe est soulignée davantage par la comparaison avec un mutant ayant les entrées mutées
par des résidus polaires. Une carte complète des sentiers de diffusion du •NO à l’intérieur de
TrHbN a été calculée et il a été démontré que les •NO diffusent d’une cavité xénon vers une
autre. Ce schéma est en parfait accord avec la carte tridimensionnelle de l’énergie libre calculée
132
par échantillonnage implicite de ligands (ligand implicit sampling). Les trajectoires ont démontré
que le •NO modifie significativement la dynamique de résidus clefs : la Phe62(E15) proposé
comme une barrière contrôlant le trafic à l’intérieur du tunnel Long ainsi que la Ile119(H11)
localisée à l’entrée du tunnel Court. Il est important de noter que la diffusion du •NO est
beaucoup plus rapide que celle reportée précédemment chez la myoglobine. Les résultats
présentés dans ce travail contribuent à l’avancement des connaissances sur les mécanismes de
diffusions des substrats gazeux apolaires à l’intérieur des protéines.
7.2. Abstract
Mycobacterium tuberculosis group I truncated hemoglobin TrHbN catalyzes the oxidation of
nitric oxide (•NO) to nitrate with a second-order rate constant k ≈745µM-1
•s-1
at 23°C (nitric
oxide dioxygenase reaction). It was proposed that this high efficiency is associated with the
presence of hydrophobic tunnels inside TrHbN structure that allow substrate diffusion to the
distal heme pocket. In this work, we investigated the mechanisms of •NO diffusion within
TrHbN tunnels in the context of the nitric oxide dioxygenase reaction using two independent
approaches. Molecular dynamics simulations of TrHbN were performed in the presence of
explicit •NO molecules. Successful •NO diffusion from the bulk solvent to the distal heme
pocket was observed in all simulations performed. The simulations revealed that •NO interacts
with TrHbN at specific surface sites, composed of hydrophobic residues located at tunnel
entrances. The entry and the internal diffusion of •NO inside TrHbN were performed using the
Long, Short, and EH tunnels reported earlier. The Short tunnel was preferentially used by •NO to
reach the distal heme pocket. This preference is ascribed to its hydrophobic funnel-shape
entrance, covering a large area extending far from the tunnel entrance. This funnel-shape
entrance triggers the frequent formation of solvent-excluded cavities capable of hosting up to
three •NO molecules, thereby accelerating •NO capture and entry. The importance of
hydrophobicity of entrances for •NO capture is highlighted by a comparison with a polar mutant
for which residues at entrances were mutated with polar residues. A complete map of •NO
diffusion pathways inside TrHbN matrix was calculated, and •NO molecules were found to
diffuse from Xe cavity to Xe cavity. This scheme was in perfect agreement with the three-
133
dimensional free-energy distribution calculated using implicit ligand sampling. The trajectories
showed that •NO significantly alters the dynamics of the key amino acids of Phe62(E15), a
residue proposed to act as a gate controlling ligand traffic inside the Long tunnel, and also of
Ile119(H11), at the entrance of the Short tunnel. It is noteworthy that •NO diffusion inside
TrHbN tunnels is much faster than that reported previously for myoglobin. The results presented
in this work shed light on the diffusion mechanism of apolar gaseous substrates inside protein
matrix.
7.3. Introduction
•NO plays an important role in host defense against microbial pathogens by inhibiting or
inactivating key enzymes such as the terminal respiratory oxidases (1–5) and the iron/sulfur
protein aconitase (6,7). •NO also combines at near-diffusion-limited rate, with superoxide
produced by respiring cells to form the highly oxidizing agent peroxynitrite (8,9). •NO-
metabolizing reactions are thus required to defend microbial pathogens against •NO poisoning.
The truncated hemoglobin N (TrHbN) from Mycobacterium tuberculosis (Mtb) is thought to play
pivotal roles in the cellular metabolism of this organism during stress and hypoxia. TrHbN is
expressed during the stationary phase of Mycobacterium bovis BCG (10) and Mtb H37Ra (11).
In Mtb H37Ra, the activity of the glbN gene encoding TrHbN is upregulated by the general
nitrosative stress inducer, nitrite, by the •NO releaser sodium nitroprusside and by hypoxia. The
activity of the glbN gene is also enhanced during Mtb H37Ra invasion of THP-1 activated
macrophages (producing •NO) (11). Recent studies by our laboratory indicated that TrHbN has a
potent ability to detoxify •NO to nitrate (nitric oxide dioxygenase (NOD) reaction) and to protect
aerobic respiration from the inhibition by •NO in stationary phase cells of M. bovis BCG (10).
The high rate of •NO oxidation (k’NOD ≈ 745 µM-1
•s-1
at 23°C) catalyzed by oxygenated TrHbN
suggests that dioxygenation of •NO may be one of the vital defense systems in Mtb for coping
with the toxic effects of •NO, and may be important for allowing the intracellular survival of the
bacterium in macrophages. This hypothesis is also supported by the observation that expression
of TrHbN in a •NO-sensitive mutant of Salmonella enterica enhances the survival of the mutant
under nitrosative stress conditions and during growth within macrophages (12).
134
The oxygenated TrHbN crystal structure (13) presents two tunnels connecting the distal heme
pocket to the bulk solvent: the Short tunnel (ST) and the Long tunnel (LT). Molecular dynamics
(MD) simulations (14) revealed two additional tunnels: EH (EHT) and BE (BET) (Fig. 7.1, top).
Previous MD simulations suggested that gaseous substrates such as O2, CO, and •NO would
access the active site through these apolar tunnels, which are by nature composed of short-lived
cavities of various shapes and volumes (14). We also proposed that the character of these tunnels
makes them suitable to store ligands accessible to the active site. A similar proposition was
invoked to account for the bimodal solvent phase recombination of CO with the truncated Hb
from Paramecium caudatum (15). Finally, the configuration of the active site allows the bound
O2 to remain optimally oriented and stabilized by Tyr33(B10) and Gln58(E11) for reaction with
•NO (10,13,14,16,17). These singular TrHbN characteristics are believed to generate the
unequalled NOD rate constant, which is 15-fold and 34-fold faster than that of horse-heart Mb
and sperm-whale Mb, respectively (10,18).
Previous work using steered MD simulations aimed at understanding O2 and •NO diffusion in
TrHbN (19). The results suggested that O2 reaches the active site of deoxy-TrHbN through the
ST while •NO accesses bound O2 through the LT (referred as the dual-path mechanism).
However, due to the limitations of the method (a biasing force drives ligand diffusion along
predefined coordinates), important aspects of ligand diffusion before the actual NOD reaction
were not addressed in this study. How ligands interact with TrHbN surface, how they enter the
protein matrix, and how they diffuse to the active site are events that may influence the NOD
reaction. In this work, we address these specific issues using unbiased explicit MD simulations
where •NO molecules were initially placed in the bulk solvent. In addition, we present a detailed
description of •NO diffusion processes along the different pathways, as well as the free-energy
cost associated with •NO diffusion inside the different TrHbN channels. Two major findings
arise from this study: the hydrophobic nature of entrances is responsible for •NO capture before
diffusion to DHP; and the dual-path mechanism is refuted.
135
7.4. Methods
Molecular dynamics (MD) simulations MD simulations were performed using CHARMM
software (20) with the CHARMM22 all-atom potential energy parameter set (21) and O2-bound
heme force-field parameters (14). Simulations were performed as described previously (14). A
complete description of the simulation protocol is given as Supporting Material enclosed in
Annexe 2. A total of 260 ns of trajectories were produced: two trajectories of 30 ns each without
free •NO molecule and 10 trajectories of 20 ns each including 10 free •NO molecules. An
additional 20-ns MD trajectory of a TrHbN multiple polar mutant was carried in absence of •NO.
Mutations were designed to increase polarity of tunnel entrances without filling cavities (this
design is discussed in the Supporting Material enclose in Annexe 2). The mutations consisted in
the replacement of hydrophobic amino acids located at tunnel entrances by polar residues:
Ala95(G9)Ser and Ala120(H12)Asp for ST, and Ala24(B1)Ser for LT, and Val118(H10)Asp for
EHT. The trajectory was calculated using NAMD (22). Only the last 15 ns of the trajectory were
used for analysis.
7.4.1. Analysis
To study •NO interactions with TrHbN surface, the time of contact between •NO molecules and
all TrHbN atoms was calculated using whole trajectories and a distance cutoff of 3.5 Å. The
solvent-excluded accessible volumes at the tunnel entrances were calculated using the VOIDOO
software with a probe radius of 1.4 Å (23). The probability density (or probability distribution)
of •NO at the surface and inside TrHbN was determined using all •NO coordinates along the last
15 ns of the 10 simulations performed, giving a total of 150,000 sets of coordinates. A distance
cutoff of 3 Å from the •NO center-of-mass was taken for the calculation of •NO probability
density.
136
7.4.2. Implicit ligand sampling
The ligand potential of mean force (PMF) inside TrHbN was determined using the implicit
ligand sampling (ILS) method (24) included in the open source VMD 1.8.6 software package
(25). The errors on PMF values were estimated as described in Cohen et al. (24). A drawback of
the method concerns the overestimation of energy barriers due to the absence of the ligand (24).
For each ILS calculation, five sets of 5000 MD frames covering entire equilibrium trajectories of
TrHbN in absence of free ligand were used. Details about ligand parameters used with this
method are given as Supporting Material (Annexe 2).
The impacts of free •NO molecule on the residues lining the tunnels were studied. The rotameric
distribution of each residue was collected as function of the presence or absence of •NO inside
respective internal cavities (Xe1, Xe2, Xe3, Xe5, and EHc). For the residues that displayed a
different behavior in response to the presence of a •NO molecule, individual ILS computations
were performed using a subset of 5000 representative MD snapshots (e.g., according to different
rotamers). To increase sampling, MD snapshots were selected from simulations of oxy-TrHbN
with and without free NO molecules. For the snapshots taken from simulations with explicit
•NO, only the part of the trajectory before the first •NO entry inside the protein core was
considered. If >5000 MD representative snapshots were available, a random selection was
performed. The binding affinities (Kb) of the ligands were estimated from the PMF maps
obtained from the ILS calculations using the relation (26,27)
β ( ) ( ')w r w r
bK dre
(1)
where r represents the positions of the grid maps, β = 1/kBT, w the PMF between the ligand and
the protein, and r’ is a reference position far away in the bulk. In our calculations, w(r’) was
calculated as the average PMF of the ligand in a water box (more details in the Supporting
Material enclose d in Annexe 2). Unless otherwise noted, all affinity numbers given in this study
refer to Kd = 1/Kb.
137
7.5. Results and discussion
•NO interacts with specific regions of the TrHbN surface. The times of contact between •NO
molecules and TrHbN surface are represented in Fig. 7.2. This figure shows that tunnel
entryways constitute discrete domains with enhanced affinity for •NO due to the hydrophobic
nature of the residues at these positions. •NO capture is promoted by formation of short-lived
hydrophobic cavities at the surface of TrHbN, creating free solvent volumes, as presented in Fig.
7.3 for ST entrance. The solvent-excluded volumes arise from the energy cost related to the
hydrophobic hydration (28), the excluded volume size being in relation with the enriched content
of hydrophobic residues at the tunnel entrances. The favorable interactions between •NO and the
hydrophobic cavities are also related to the hydrophobic hydration, leading to the association of
apolar entities (28). The enhanced affinity observed at tunnel entrances is thought to be important
for the capture of apolar ligands. Consequently, it is expected that entrances delimited by polar
residues may result in lower affinities for apolar ligands. To verify this, a mutant was designed
where the polarity near the ST, LT, and EHT entryways was increased with polar residues (see
Methods).
The formation frequency and average solvent-excluded volumes are given in Table 7.1 for each
of the entrances, for both the WT and the polar mutant. The biggest solvent-excluded volumes
(average volume of 89 Å3) were observed at the ST entrance of WT in 43% of the MD snapshots
(Table 7.1), providing enough room to host up to three •NO molecules. Smaller solvent-excluded
volumes were also observed at the entrance of LT, EHT, and BET, although with a lower
incidence. Because of the presence of polar residues located at the entrances, solvent-excluded
volumes are much lower and less frequent for the ST entrance of the polar mutant. The effect is
less significant for LT and EHT entrances due to an increased side-chain dynamics experienced
by the mutated residues in the solvent, similar to what was reported in Leroux et al. (29).
The particular funnel shape of the ST entrance (Fig. 7.3 c), combined with its hydrophobic
nature, is responsible for higher free volumes than for other tunnel entrances. To our knowledge,
this is the first time that such physical characteristics at the surface of a protein are reported. We
hypothesize that this physical property contributes to the high efficiency of the NOD reaction
catalyzed by TrHbN.
138
7.5.1. •NO enters the protein matrix using the ST, LT, and EHT
•NO enters the protein matrix using the ST, LT, and EHT At least one •NO molecule reached the
distal heme pocket (DHP) from the bulk solvent in each of the 10 simulations performed. The
first •NO entry typically occurred within the first 3 ns. In agreement with the particular character
of the ST entrance, the first •NO to reach the DHP came from the ST in six of ten occurrences;
the LT and the EHT were used twice each. The time required to diffuse from the protein surface
to the DHP ranged from hundreds of picoseconds to several nanoseconds, the shorter times being
associated with the ST. The BET was not used although several short-lived contacts between
•NO molecules and the BET entryway were observed, likely due to the narrow bottleneck (<1 Å)
of this tunnel (14).
The greater propensity of •NO to use ST to reach DHP observed in this work is clearly in
disagreement with previous modeling studies, where the authors reached the conclusion that the
diffusion of •NO occurs preferentially via LT in oxy-TrHbN (19). This disagreement will be
addressed in the next section.
Ruscio et al. used a very similar approach to study CO entry and diffusion within Mb (30). In
contrast to what was observed in this article, a CO molecule reached the active site in only one-
third of the 48 90-ns trajectories. In the other cases, CO entered Mb matrix but could not reach
the active site. This comparison highlights the higher efficiency of substrate diffusion from the
solvent to the DHP in the TrHbN matrix than in Mb. This higher efficiency is in agreement with
the 15-fold (horse-heart Mb) and 34-fold (sperm-whale Mb) higher bimolecular rate constant for
the NOD reaction (10,18).
7.5.2. Diffusion through tunnels
MD simulations showed that tunnels in TrHbN are not open channels but are formed of
neighboring hydrophobic cavities that are temporally interconnected due to side-chain flexibility
139
(thermal fluctuations) (14,31). Therefore, it is expected that ligand diffusion through the different
tunnels takes place by hopping from one cavity to another.
Occupancy of •NO in the protein matrix was calculated using two approaches: ILS (24), using
trajectories without •NO, and the probability distributions from the trajectories with •NO (see
Methods). The results are presented in Fig. 7.4, a and b, for the probability distributions and ILS,
respectively. Interestingly, both methods show that the TrHbN matrix contains cavities with high
occupancy for •NO, and that most of these cavities correspond to the Xe binding sites identified
by x-ray crystallography (32). In addition to Xe binding sites, the distal heme pocket and a cavity
lying inside the EHT were found favorable to •NO (Fig. 7.4). The latter cavity is located between
the EHT entrance and the side chain of the Phe62(E15) residue. The ILS isosurface maps (Fig.
7.4 b) confirmed that ST, LT, and EHT are the most favorable routes. Fig. 7.1 (bottom) shows all
diffusion pathways observed from the trajectories calculated using explicit •NO. Every •NO that
reached the DHP was found to transit through the Xe2 site, which is located at the intersection of
the ST, LT, and EHT.
The possibility that •NO molecules have local impacts on TrHbN, and therefore influence its
diffusion through tunnels, was investigated. Because TrHbN matrix can hold more than one •NO
molecule at the same time, and as it is expected that substrate concentrations are relatively low in
vivo, this specific study focused on the simpler cases, i.e., when only one •NO was inside
TrHbN. To determine the effect of local impacts, the side-chain dihedral angles of all the
residues lining the tunnels were monitored in presence or absence of •NO near that residue.
These residues, as well as the Xe binding sites, are sketched in Fig. 7.1 (bottom). Only two
residues were influenced by the presence of •NO: Ile119(H11), located along the ST, between
Xe2 and Xe3 sites and shaping part of the EHT; and Phe62(E15), located along the LT. The
rotamers adopted in the different cases are reported in Table 7.2.
In the next subsections, the diffusion process through the different tunnels is analyzed separately.
The PMF profiles for each tunnel are presented in Fig. 7.5. Movie S1, Movie S2, and Movie S3,
illustrating •NO diffusion in each of the three tunnels, extracted from the trajectories, are
available at http://www.cell.com/biophysj/supplemental/S0006-3495(09)01450-7.
140
Short tunnel - Diffusion through the ST begins by docking to the surface (Fig. 7.5 a, at ~14 Å
with a value of 3.5±0.3 kcal/mol), in the funnel-shape entryway, close to Xe3. Entry is
performed by transit from Xe3 to Xe2. For this process, a •NO molecule must cross a bottleneck
region (radius of 1.2 Å) defined by the side chain of Ile119(H11), Leu98(G12), and the heme
pyrrole B (vinyl group) (14). MD simulations in absence of free •NO revealed that the
Ile119(H11) side chain adopts four rotamers (mm, mt, pp, and pt) with various distributions
(Table 7.2). The pp and pt rotamers are rarely found inside a-helices, whereas the mm and mt
rotamers are more typical (33). In the absence of •NO, mm and pt rotamers dominate with 56%
and 37% of the conformations, respectively. When a •NO is docked inside Xe2 or Xe3 (ST
entrance), the mm and mt rotamers increase significantly (Table 7.2). Fig. 7.5 b shows the PMF
profiles according to the Ile119(H11) rotamers. The mt and mm rotamers are found to be the
most favorable for •NO diffusion inside ST, from Xe3 to Xe2, with energy barriers of
2.7±0.6 kcal/mol and 3.5±0.6 kcal/mol, respectively, centered at 9 Å. This result is in agreement
with the TrHbN crystallographic structure under high xenon pressure, where a xenon atom
occupies Xe3 while Ile119(H11) displays the mt rotamer (PDB ID No. 1S56, B chain) (32). On
the other hand, pt and pp rotamers are unfavorable, causing a high free energy barrier of >5 -
0.8/+0.6 kcal/mol. These unfavorable free energy profiles agree with the observation of explicit
•NO molecules docked for several hundreds of picoseconds while Ile119(H11) adopted pt and pp
rotamers. Interestingly, when a •NO molecule docks inside Xe1 (in the LT, Fig. 7.1, top), the
occurrence of mm rotamers decreases, accounting for 18% of the conformations, whereas it
increases to 72% for pt rotamer (Table 7.2). This has the effect of significantly reducing
diffusion through ST.
Long tunnel - Entry into the LT is performed by transition from the solvent to the Xe1 binding
site. This process is unhampered and fast because of the wide LT entrance. This is in agreement
with our earlier report on TrHbN tunnels dynamics, where the LT was found to display the
widest entrance with an average aperture of ~1.8 Å radius (14).
To reach Xe2 from Xe1, a •NO molecule must transit by the Xe5 binding site (Fig. 7.1, bottom).
However, the tunnel radius at the Xe5 binding site is quite narrow due to the side chains of
Val29(B6), Phe62(E15), and Leu98(G12) residues so that rotation of the Phe62(E15) phenyl ring
(fluctuation of the χ2 dihedral angle) is required. Before the arrival of •NO, as observed in a
141
previous work (14), the Phe62(E15) side chain explores two χ1 domains (sweeping motion)
while a wide range of values is allowed for χ2. The two χ1 domains were referred as the M and T
states. The M state regroups two rotameric species, m-85 and m-30, whereas the T state is mainly
characterized by the t80 rotamer. In this rotameric nomenclature, m stands for gauche negative
and t for trans (33). The phenyl ring fills Xe1 when in T state, while for the M state, it is located
between Xe5, Xe2, and EHc cavities. The radius of the LT (and EHT), and consequently their
opening, is determined by χ2 (see Fig. 7.9 of (14).).
The impact of •NO on the side-chain dynamics of Phe62(E15) is represented in Fig. 7.6 and the
rotamers observed for the different cases are reported in Table 7.2. When a •NO molecule
occupies Xe1, the Phe62(E15) side chain is almost limited to the M state (98% of occupancy)
and χ2 is restricted to a narrower range: [-90°:-60°] and [80°:90°] (χ2 ranges from -90° to 90° by
convention) (Fig. 7.6). This range corresponds to the maximum radii for LT (~1.3 Å), while EHT
radius is at a minimum (~1.0 Å) (14). Therefore, LT would be in the open state with this
configuration, in agreement with the observation of the passage of one •NO to Xe5 (more on this
in the next paragraph). Similarly, when a •NO occupies Xe5, the Phe62(E15) side chain is almost
limited to the T state (86.3% of occupancy, the T state has a broader definition than the t80
rotamer, which has a limited χ2 range), and χ2 is restricted to the range [+20°:+75°]. This range
of conformations corresponds to a radius between 0.9 Å and 1.1Å, similar to the BET average
radius where no diffusion was observed. In fact, no diffusion of •NO from Xe5 to Xe1 was
observed via the Phe62(E15) barrier. We conclude that LT was closed in this conformation.
Instead, •NO can escape via EHT to Xe1 (more on this in the next subsection).
Because •NO has significant effects on Phe62(E15) dynamics, PMF profiles were calculated
when Phe62(E15) is either in the M or the T state. The PMF profiles are given in Fig. 7.5 c. For
both M and T states, the entry is found favorable for docking of •NO, as reported in a previous
section, with a docking free energy of -2.7±0.3 kcal/mol. For the M state (Fig. 7.5 c, solid line),
the PMF profile revealed that the Xe1 and Xe2 binding sites are favorable to •NO, with docking
free energies of -3.7±0.3 kcal/mol and -3.6±0.3 kcal/mol, respectively. This is reflected in the
high probability of finding •NO at these positions in explicit simulations (Fig. 7.4 a). To diffuse
from Xe1 to Xe2 in the LT, a •NO molecule must overcome a free energy barrier of 3.2±0.6
kcal/mol, indicating that •NO molecules seldom cross the Phe62(E15) side chain. Only one event
142
was observed over the 200 ns of trajectories. This energy barrier comes from the steric
encumbrance of Phe62(E15), which has to change its conformation at the time of the transit
between Xe1 and Xe5 to accommodate a •NO at Xe5. Many events were observed where a •NO
tried to transit from Xe1 to Xe5 but came back to Xe1. For the T state, the PMF profile is
inverted, showing a maximum free energy level in the tunnel of -1.7±0.3 kcal/mol near Xe1
while the most favorable region is found between Xe5 and Xe2, with a potential well of -4.0±0.3
kcal/mol. Even if the free energy barrier is lower by 2.1±0.6 kcal/mol, this path was not used by
•NO because Phe62(E15) quickly returns to M state as a •NO enters the LT. Due to the high
energy barriers involved for the path Xe1-Xe5-Xe2, the path via EHT (Xe1-EHC-Xe2) was used
more frequently. This path is presented in the next subsection.
EH tunnel - As for the LT, two PMF profiles were calculated according to the Phe62(E15)
conformation. The PMF profiles are given in Fig. 7.5 d. For this tunnel, •NO diffuses from the
bulk solvent to an internal cavity (EHc) (Fig. 7.1, bottom), which does not correspond to any
identified Xe binding site. This cavity is located between the EHT entrance and the side chain of
the Phe62(E15) residue. To reach EHc from the bulk, a •NO must cross a bottleneck region of
1.3 Å radius at the protein surface.
As for the LT, EHT shows two different PMF profiles according to the Phe62(E15)
conformation. For both PMF profiles, the first few Å between the protein surface and the EHc do
not differ (Fig. 7.5 d). The EHc was found favorable to •NO, with a free energy of -3.1±0.3
kcal/mol (≈-4.5±0.3 kcal/mol from the solvent), and no escape of •NO to the solvent was
observed. When EHc is filled with a •NO, the Phe62(E15) side chain fluctuates between M and T
states, with a prevalence for the M state. When Phe62(E15) is in T state, there is no barrier
between EHc and Xe2, and frequent exchanges between these sites were observed from the
trajectories (Fig. 7.1, bottom, blue arrow). In contrast, when Phe62(E15) is in the M state, the
PMF profile shows an energy barrier of 4.0±0.6 kcal/mol. In this case, frequent exchanges
between Xe1 (located in LT) and EHc are observed (Fig. 1, bottom, yellow arrow), although a
small free energy barrier of 1.5±0.6 kcal/mol (relative to EHc) exists between the two sites (data
not shown).
143
DHP - Once a •NO reaches the DHP, it remains at contact distance with the bound O2 and
Val94(G8) side chain for up to hundreds of picoseconds before returning to Xe2. Since the
energy barrier between these two sites is low (0.8±0.6 kcal/mol), frequent Xe2 ↔ DHP
transitions were observed. The presence of •NO in the DHP does not trigger motions or
reorganization of nearby side chains.
7.5.3. Ligand binding affinities
The binding affinities for •NO and O2 ligands were estimated from the PMF maps obtained from
the ILS calculations (see Methods). The affinities were calculated for the whole protein (global
affinities) and for the entrances at the surface of the protein, for both WT and the polar mutant.
The results are presented in Table 7.1. WT global affinities for •NO and O2 were evaluated as
6.20±0.04 mM and 8.72±0.04 mM, respectively. It is noteworthy that the high precision
estimated for the ligand affinities arises from the methodology used and does not account for the
error due to the imprecision of the force field and the tendency of MD simulations to
undersample. Under identical experimental conditions, •NO affinity may always be 25–75%
greater than for O2 for the same conditions due to the chemical nature of the ligands, the Van der
Waals interactions being more significant for •NO. It is expected that the affinities of free
ligands should be similar for deoxy-TrHbN. The affinity of the heme-iron for the ligands was not
calculated in this work. However, a much larger affinity for O2 arises upon binding to the heme-
iron. A change in its chemical character upon binding leads to a stabilization of the Fe-O2
complex by Tyr33(B10) (10). In vivo, ligand concentration in activated macrophages are
believed to be low (~1 mM) (34), suggesting that tunnels may be free of ligand at equilibrium.
However, such affinity increases the chances by >73 times to find a •NO molecule bound to
TrHbN compared to the solvent.
As expected from times of contact (Fig. 2), •NO occupancies and ILS results (Fig. 4), the
affinities presented in Table 7.1 also reveal that the entrances are favorable to •NO (see also
Annexe 2, Fig. S1). Quantitatively, ST entrance has the highest affinity (Kb), accounting for as
much as the affinities of LT and EHT taken together. The gradient of affinity of ST entrance
144
extends far from the tunnel entrance and covers a large area (Annexe 2, Fig. S1). This large area
may play an important role by trapping •NO molecule and thus increasing the use of ST.
Binding affinities for the WT and the polar mutant are compared in Table 7.1. The global affinity
of the mutant for •NO is only slightly lower than for the WT because the tunnels, unchanged in
the mutant, account for ~50% of the global affinity. The biggest differences are observed for the
ST entrance, where the affinity of the mutant is >13 times lower than for the WT (67.6±1.1 mM
for the WT, and 926±33 mM for the mutant). Since the affinity of the ST entrance of the mutant
is greatly reduced we predict that ST should be almost unused by apolar ligands to reach the
DHP.
On the other side, the affinity of LT entrance was modestly lowered while EHT entrance affinity
was mostly unchanged. The limited decrease of affinity observed for the LT entrance is because
the entrance is defined by backbone residues from AB and GH hinges. As a consequence,
substitution of a side chain can only partially affect the character of the entrance.
Similarly, the unchanged affinity of the mutant EHT entrance is due to the Asp118(H10) side
chain that moved toward the solvent, triggering enlargement of the tunnel entrance. The move
toward the solvent of a mutated residue at the entrance of a tunnel, leading to a limited change in
protein kinetics, was also observed for a NiFe hydrogenase (29).
Despite a dramatic ST entrance affinity decrease observed for the mutant, we predict only a
twofold reduced NOD activity. Effectively, the almost unchanged affinities of the LT and EHT
entrances, accounting for as much as the ST entrance of the WT, would continue to supply the
active site with apolar ligands. This example illustrates the complexity to plan efficient
mutagenesis of a protein containing multiple tunnels, as in Johnson et al. (35).
7.5.4. Comparison of the different paths
The free energy difference between the solvent and the DHP is ~4.5±0.3 kcal/mol in favor of
DHP. When the tunnels are compared between each other, the ST has the biggest
145
solvent-excluded volume at its entrance, the lowest energy barrier, and also the shortest distance
to reach the DHP. Therefore, it is natural that this tunnel is the most used by •NO to reach DHP,
as observed from explicit simulations. However, one should not neglect the LT/EHT in their
capacity to supply ligands to the active site. Effectively, their numerous binding sites can
accommodate up to three ligands, which can reach DHP at the appropriate time.
As in our previous study of TrHbN tunnels (14), the results presented here disagree with the
results reported by Bidon-Chanal et al. (19). Effectively, using steered MD , they came to the
conclusion that LT is the most favorable diffusion pathway for •NO to reach DHP. In this study,
the high energy barrier near the Phe62(E15) side chain explains why LT is rarely used by •NO to
reach DHP. Bidon-Chanal et al. did not take into account the more favorable EHT pathway for
•NO diffusion to the DHP. In addition, Bidon-Chanal et al. observed a progressive rise in free
energy for the migration of •NO through ST, making it less suitable than LT (surprisingly, their
PMF values for ST near the DHP indicate that this position is less favorable to •NO than in the
solvent). This result is clearly in disagreement with the results obtained using two different
approaches (explicit MD simulations and ILS) in this work. Moreover, our MD simulations with
explicit NO molecules clearly showed that LT and ST merge at the Xe2 binding site with the
same binding energy, which is not the case in the work of Bidon-Chanal et al. Both MD and ILS
approaches identified the ST as the most favorable route for •NO to reach oxy-TrHbN DHP. This
is explained by the presence of the funnel-shape hydrophobic entrance of the ST, the shorter
diffusion length, and the lowest energy barrier experienced by •NO.
It is interesting to note that the diffusion of •NO from the solvent to EHc, Xe1, or Xe2 involves a
decrease in free energy of ~4.5 ± 0.3 kcal/mol. Such an energy value ensures efficient capture of
•NO in TrHbN matrix, preventing the release to the solvent. Over the 200 ns of trajectories, only
two such events involving a single •NO was observed and proceeded through the ST (events
involving multiple •NO, energetically more complex, were observed but will not be reported in
this study). We propose that this efficient capture of •NO by TrHbN is related to its high NOD
catalytic.
There are few other resolved group I TrHb structures from the protozoan Paramecium caudatum
(pc-TrHbN–PDB 1DLW), the unicellular alga Chlamydomonas eugametos (ce-TrHbN–PDB
146
1DLY), and the cyanobacterium Synechocystis sp. (ss-TrHbN–PDB 1S69). All these structures
display significant internal empty volumes (pc-TrHbN: 180 Å3, ce-TrHbN: 400 Å
3, and mt-
TrHbN: 265 Å3) defined by hydrophobic residues (32). The hydrophobic character of these
residues is conserved (36). On the other hand, the hydrophobic nature of the residues lining the
tunnel entrances is not as well conserved between the different TrHbNs. The free volume present
in ce-TrHbNs structure is organized into two tunnels corresponding to the LT and EHT. In
addition, ce-TrHbN accommodates a large hydrophobic funnel-shaped surface at the ST
entrance, suggesting that this tunnel may be functional. Three additional diffusion routes were
found from modeling studies of pc-TrHbN: between helices B and G; between helices B and E;
and between the heme and helix C (37). TrHbs from groups II and III do not display tunnels.
These observations suggest that the redundancy in access ways in TrHbN is an evolved feature
of the group I TrHb.
Finally, during the review process, an article bearing on •NO diffusion in TrHbN was published
by Mishra and Meuwly (38). This study is based on multiple 2-ns MD simulations of TrHbN
with one •NO starting in different cavities (total of 24 2-ns trajectories). Some important
differences arise from both works. First, unlike our work, they observed many escapes of •NO to
the solvent and rare •NO captures from TrHbN, which is surprising given the energy difference
of ~4.5 kcal/mol in favor of the protein matrix observed in this work. Second, they observed •NO
diffusion from Xe2 to the solvent, through helices C and H, and did not observe diffusion
through the EHT. Finally, the heme force field parameters are not convenient for simulations of
oxygenated hemoprotein, favoring unlikely conformation of DHP residues as well as
Phe62(E15) (14). Substantial methodological differences between the works could explain these
discrepancies.
7.6. Conclusion
The simulations presented here show that substrate diffusion in TrHbN follows discrete paths
showing enhanced affinity for apolar gaseous ligands. Diffusion toward the TrHbN active site
(DHP) begins with favorable hydrophobic interactions at the protein surface, corresponding to
147
tunnel entryways. The strongly hydrophobic funnel-shape entrance of ST makes it the most
favorable tunnel in TrHbN. This funnel constitutes a discrete surface domain with enhanced
affinity for •NO. •NO capture is promoted by formation of short-lived hydrophobic cavities at the
protein surface, creating free solvent volumes sufficient to host up to three •NO molecules
simultaneously. These molecules, once captured, do not escape and enter the ST. Once inside the
protein, •NO diffuses from one cavity to another. Most of these cavities correspond to
experimental xenon binding pockets (32).
When docked inside specific cavities (Xe1, Xe2, Xe3, and Xe5), •NO was found to affect the
dynamics of Phe62(E15) and Ile119(H11) residues in LT and ST, respectively. In contrast to
what was observed in Bidon-Chanal et al. (19), •NO diffusion in the LT was found to be
hindered by the Phe62(E15) side-chain obstruction, refuting the dual-path mechanism proposed
by Bidon-Chanal et al. (19). Moreover, •NO entering the LT preferentially bypasses the
Phe62(E15) barrier by passing through EHT. Our results suggest that these paths would be better
suited to provide substrates to the active site once the reaction cycles have begun.
Our MD simulations suggest that •NO diffusion between the TrHbN surface and the active site is
fast. In all 10 simulations performed, a •NO molecule reached the distal heme pocket within 20
ns. This contrasts with a similar earlier work using Mb that required more simulations and longer
trajectories to study a similar process (30). This is in accord with the fact that the bimolecular
rate constant for the NOD reaction catalyzed by TrHbN is ~15-fold higher than that of horse
myoglobin (10).
148
7.7. Supporting material
Three movies, one figure, and two tables are available at
http://www.biophysj.org/biophysj/supplemental/S0006-3495(09)01450-7.
The authors thank Beatrice A. Wittenberg and Jonathan B. Wittenberg for helpful discussion.
This work was supported by the Natural Sciences and Engineering Research Council of Canada
(grant No. 46306-01 (2005–2010)), the Fonds Québécois de la Recherche sur la Nature et les
Technologies (grant No. 104897), and the Canada Foundation for Innovation (grant No. 12428).
R.D. is supported by a postgraduate scholarship from the Fonds Québécois de la Recherche sur
la Nature et les Technologies (scholarship No. 106627).
7.8. References
1. Brunori, M. 2001. Nitric oxide, cytochrome-c oxidase and myoglobin. Trends Biochem. Sci.
26:21–23.
2. Brunori, M., A. Giuffre, P. Sarti, G. Stubauer, and M. T. Wilson. 1999. Nitric oxide and
cellular respiration. Cell. Mol. Life Sci. 56:549–557.
3. Stevanin, T. M., N. Ioannidis, C. E. Mills, S. O. Kim, M. N. Hughes, et al. 2000.
Flavohemoglobin hmp affords inducible protection for Escherichia coli respiration, catalyzed
by cytochromes bo’ or bd, from nitric oxide. J. Biol. Chem. 275:35868–35875.
4. Cleeter, M. W. J., J. M. Cooper, V. M. Darleyusmar, S. Moncada, and A. H. V. Schapira.
1994. Reversible inhibition of cytochrome-c oxidase, the terminal enzyme of the
mitochondrial respiratory-chain, by nitric-oxide - implications for the neurodegenerative
diseases. FEBS Lett. 345:50–54.
5. Brown, G. C., and C. E. Cooper. 1994. Nanomolar concentrations of nitric-oxide reversibly
inhibit synaptosomal respiration by competing with oxygen at cytochrome-oxidase. FEBS
Lett. 356:295–298.
6. Gardner, P. R., G. Costantino, and A. L. Salzman. 1998. Constitutive and adaptive
detoxification of nitric oxide in Escherichia coli - role of nitric-oxide dioxygenase in the
protection of aconitase. J. Biol. Chem. 273:26528–26533.
7. Gardner, P. R., G. Costantino, C. Szabo, and A. L. Salzman. 1997. Nitric oxide sensitivity of
the aconitases. J. Biol. Chem. 272:25071–25076.
149
8. Kissner, R., T. Nauser, P. Bugnon, P. G. Lye, and W. H. Koppenol. 1997. Formation and
properties of peroxynitrite as studied by laser flash photolysis, high-pressure stopped-flow
technique, and pulse radiolysis. Chem. Res. Toxicol. 10:1285–1292.
9. Pfeiffer, S., A. C. F. Gorren, K. Schmidt, E. R. Werner, B. Hansert, et al. 1997. Metabolic
fate of peroxynitrite in aqueous solution - reaction with nitric oxide and pH-dependent
decomposition to nitrite and oxygen in a 2:1 stoichiometry. J. Biol. Chem. 272:3465–3470.
10. Ouellet, H., Y. Ouellet, C. Richard, M. Labarre, B. Wittenberg, et al. 2002. Truncated
hemoglobin HbN protects Mycobacterium bovis from nitric oxide. Proc. Natl. Acad. Sci.
USA. 99:5902–5907.
11. Pawaria, S., A. Lama, M. Raje, and K. L. Dikshit. 2008. Responses of Mycobacterium
tuberculosis hemoglobin promoters to in vitro and in vivo growth conditions. Appl. Environ.
Microbiol. 74: 3512–3522.
12. Pawaria, S., G. Rajamohan, V. Gambhir, A. Lama, G. C. Varshney, et al. 2007. Intracellular
growth and survival of Salmonella enterica serovar Typhimurium carrying truncated
hemoglobins of Mycobacterium tuberculosis. Microb. Pathog. 42:119–128.
13. Milani, M., A. Pesce, Y. Ouellet, P. Ascenzi, M. Guertin, et al. 2001. Mycobacterium
tuberculosis hemoglobin N displays a protein tunnel suited for O2 diffusion to the heme.
EMBO J. 20:3902–3909.
14. Daigle, R., M. Guertin, and P. Lague. 2009. Structural characterization of the tunnels of
Mycobacterium tuberculosis truncated hemoglobin N from molecular dynamics simulations.
Proteins: Struct. Funct. Bioinf. 75:735–747.
15. Samuni, U., D. Dantsker, A. Ray, J. B. Wittenberg, B. A. Wittenberg, et al. 2003. Kinetic
modulation in carbonmonoxy derivatives of truncated hemoglobins: the role of distal heme
pocket residues and extended apolar tunnel. J. Biol. Chem. 278:27241–27250.
16. Crespo, A., M. A. Marti, S. G. Kalko, A. Morreale, M. Orozco, et al. 2005. Theoretical study
of the truncated hemoglobin HbN: exploring the molecular basis of the NO detoxification
mechanism. J. Am. Chem. Soc. 127:4433–4444.
17. Ouellet, Y., M. Milani, M. Couture, M. Bolognesi, and M. Guertin. 2006. Ligand interactions
in the distal heme pocket of Mycobacterium tuberculosis truncated hemoglobin N: roles of
TyrB10 and GlnE11 residues. Biochemistry. 45:8770–8781.
18. Scott, E. E., Q. H. Gibson, and J. S. Olson. 2001. Mapping the pathways for O2 entry into
and exit from myoglobin. J. Biol. Chem. 276:5177–5188.
150
19. Bidon-Chanal, A., M. A. Marti, A. Crespo, M. Milani, M. Orozco, et al. 2006. Ligand-
induced dynamical regulation of NO conversion in Mycobacterium tuberculosis truncated
hemoglobin-N. Proteins. 64:457–464.
20. Brooks, B. R., R. E. Bruccoleri, B. D. Olafson, D. J. States, S. Swaminathan, et al. 1983.
CHARMM: a program for macromolecular energy, minimization, and dynamics calculations.
J. Comput. Chem. 4:187–217.
21. MacKerell, A. D., D. Bashford, M. Bellott, R. L. Dunbrack, J. D. Evanseck, et al. 1998. All-
atom empirical potential for molecular modeling and dynamics studies of proteins. J. Phys.
Chem. B. 102:3586–3616.
22. Phillips, J. C., R. Braun, W. Wang, J. Gumbart, E. Tajkhorshid, et al. 2005. Scalable
molecular dynamics with NAMD. J. Comput. Chem.26:1781–1802.
23. Kleywegt, G. J., and T. A. Jones. 1994. Detection, delineation, measurement and display of
cavities in macromolecular structures. Acta Crystallogr. D Biol. Crystallogr. 50:178–185.
24. Cohen, J., A. Arkhipov, R. Braun, and K. Schulten. 2006. Imaging the migration pathways
for O2, CO, NO, and Xe inside myoglobin. Biophys. J. 91:1844–1857.25.
25. Humphrey, W., A. Dalke, and K. Schulten. 1996. VMD—visual molecular dynamics. J. Mol.
Graph. 14:33–38.
26. Chandler, D., and L. R. Pratt. 1976. Statistical mechanics of chemical equilibria and
intramolecular structures of nonrigid molecules in condensed phases. J. Chem. Phys.
65:2925–2940.
27. Roux, B., and T. Simonson. 1999. Implicit solvent models. Biophys.Chem. 78:1–20.
28. Hummer, G., S. Garde, A. E. Garcıa, A. Pohorille, and L. R. Pratt. 1996. An information
theory model of hydrophobic interactions. Proc. Natl. Acad. Sci. USA. 93:8951–8955.
29. Leroux, F., S. Dementin, B. Burlat, L. Cournac, A. Volbeda, et al. 2008. Experimental
approaches to kinetics of gas diffusion in hydrogenase. Proc. Natl. Acad. Sci. USA.
105:11188–11193.
30. Ruscio, J. Z., D. Kumar, M. Shukla, M. G. Prisant, T. M. Murali, et al. 2008. Atomic level
computational identification of ligand migration pathways between solvent and binding site
in myoglobin. Proc. Natl. Acad. Sci. USA. 105:9204–9209.
31. Saam, J., I. Ivanov, M. Walther, H.-G. Holzhutter, and H. Kuhn. 2007. Molecular dioxygen
enters the active site of 12/15-lipoxygenase via dynamic oxygen access channels. Proc. Natl.
Acad. Sci. USA. 104:13319–13324.
151
32. Milani, M., A. Pesce, Y. Ouellet, S. Dewilde, J. Friedman, et al. 2004. Heme-ligand
tunneling in group I truncated hemoglobins. J. Biol. Chem. 279:21520–21525.
33. Lovell, S. C., J. M. Word, J. S. Richardson, and D. C. Richardson. 2000. The penultimate
rotamer library. Proteins. 40:389–408.
34. Lewis, R. S., S. Tamir, S. R. Tannenbaum, and W. M. Deen. 1995. Kinetic analysis of the
fate of nitric oxide synthesized by macrophages in vitro. J. Biol. Chem. 270:29350–29355.
35. Johnson, B. J., J. Cohen, R. W. Welford, A. R. Pearson, K. Schulten, et al. 2007. Exploring
molecular oxygen pathways in Hansenula polymorpha copper-containing amine oxidase. J.
Biol. Chem. 282:17767–17776.
36. Vuletich, D. A., and J. T. J. Lecomte. 2006. A phylogenetic and structural analysis of
truncated hemoglobins. J. Mol. Evol. 62:196–210.
37. Cohen, J., K. W. Olsen, and K. Schulten. 2008. Finding gas migration pathways in proteins
using implicit ligand sampling. Methods Enzymol. 487:439–457.
38. Mishra, S., and M. Meuwly. 2009. Nitric oxide dynamics in truncated hemoglobin: docking
sites, migration pathways, and vibrational spectroscopy from molecular dynamics
simulations. Biophys. J. 96:2105–2108.
39. DeLano, W.L. 2002. The PyMOL Molecular Graphics System. http://www.pymol.org.
152
Table 7.1 Calculated affinities for NO and solvent-excluded volume at tunnel entrances detected
for TrHbN and multiple polar mutant.
TrHbN Mutant
Tunnel Kd solvent-excluded
volume‡ Kd
solvent-excluded
volume‡
(mM) (%) (Å3) (mM) (%) (Å
3)
Global*
6.20 ± 0.04
(8.72 ± 0.04)†
7.92 ± 0.24
(10.5 ± 0.5)†
Surface 12.3 ± 0.03 18.5 ± 0.3
ST entrance 67.6 ± 1.1 43 89 ± 60 926 ± 33 7.8 45 ± 26
LT entrance 103 ± 1 32 66 ± 40 159 ± 10 25 61 ± 35
EHT entrance 199 ± 2 24 56 ± 38 196 ± 18 20 65 ± 41
* Affinities are calculated for the tunnels and the surface.
† Numbers in parentheses are for the calculated affinity for O2 (Surface and Tunnels).
‡The formation frequency and the average solvent-excluded volume detected.
153
Table 7.2 Rotamers observed for two residues upon the absence or presence of •NO molecule in
specific cavities.
Residue Rotamer empty Xe1 Xe2 Xe3 Xe5 EHc
Ile119(H11) mm 56 18 75 34 60 40
mt 2 3 9 37 3 17
pt 37 72 14 23 31 37
pp 3 4 1 0 2 1
others/outliers 2 3 1 6 4 5
Phe62(E15) m-30 30 19 22 29 1 40
m-85 50 79 44 45 8 35
t80 15 0 25 13 75 13
outliers 5 2 9 13 16 12
154
Figure 7.1 TrHbN structure (PDB entry 1IDR, subunit A). (Full legend on next page)
155
Figure 7.1 (legend) (top) TrHbN structure (PDB entry 1IDR, subunit A). The different tunnels
observed in TrHbN from MD simulations are represented by the orange surface (14). The B, E,
G and H helices are represented by blue, green, yellow and purple, respectively. The picture was
generated using PyMOL (39). (bottom) Schema of cavity-to-cavity diffusion routes found in the
present work. The amino acids separating the different cavities are identified. Diffusion in LT,
EHT and ST are represented by the green, blue and red arrows, respectively. The yellow arrow
indicates diffusion between EHc and the Xe1. BET was not used by •NO over 200 ns total MD
simulation time. The letter ’S’ indicates the solvent. Briefly, a •NO molecule can reach the distal
heme pocket using the ST, LT or EHT. Diffusion occurs by hopping from a cavity to another.
Using the ST, •NO leaves the bulk and enters the funnel-shape entrance nearby Xe3. Then, •NO
hops to Xe2 from where it can hop to the DHP (gray arrow). In the DHP, •NO is within contact
distance of the bound O2. Diffusion in the LT is quite different. First, •NO molecule enters the
protein matrix and docks inside Xe1, and constrains the Phe62(E15) residue to stay in the M
state. Diffusion toward Xe2 via Xe5 is sterically compromised but not impossible. This is
performed by hoping from Xe1 to Xe5 and then to Xe2 (Xe1→Xe5→Xe2). This scenario
involves a free energy barrier of 3.2±0.6 kcal/mol. An alternative route with a lower barrier
exists: Xe1→EHc→Xe2. The diffusion Xe1→EHc involves a free energy barrier of ~1.5±0.6
kcal/mol. When •NO occupies EHc, Phe62(E15) is unconstrained and therefore can adopt either
the M or the T state. In the T state, there is no free energy barrier between EHc and Xe2 and
diffusion between these two sites is allowed. For the EHT, diffusion begins with the •NO
passage from the bulk to the EHc. The next diffusion step toward the DHP occur as described for
LT. •NO escape to the bulk is unlikely because of the free energy cost (≈4.5±0.3 kcal/mol). Only
two such events were observed through the ST. A •NO molecule can also leaves DHP to dock
inside farther cavities (Xe2→EHc→Xe1). Diffusion through Xe5 (Xe2→Xe5→Xe1) is sterically
compromised by Phe62(E15) side chain which is restricted to the T state when •NO reaches Xe5
(Xe1 cavity is filled by the Phe62(E15) aromatic ring).
156
Figure 7.2 Time of contact between •NO molecules and TrHbN relative to the MD simulation
time. Atom coordinates were taken from the oxygenated TrHbN crystal structure (PDB entry
1IDR, subunit A). The entryway to the LT, EHT, ST and BET are indicated. The picture was
generated using PyMOL (39).
157
Figure 7.3 Representative solvent-excluded volume (105 Å3) formed over the ST entrance. a)
Overall view, b) zoomed view and c) side view of the solvent-excluded over the funnel-shaped
ST entrance. The solvent-excluded volume is represented by the gray mesh. The B, E, G and H
helices are colored in blue, green, yellow and purple, respectively. The picture was generated
using PyMOL (39).
158
Figure 7.4 (a) Density probability of •NO derived from explicit MD simulations and (b) implicit
ligand PMF for •NO inside TrHbN calculated from MD frames having the Phe62(E15) in the
(top) M state and (bottom) T state. In (a), higher •NO probability densities are represented by
colored isosurfaces. In (b), the free energy isosurfaces correspond to regions of measured PMF
of -1.5±0.3 kcal/mol (blue), -2.5±0.3 kcal/mol (yellow) and -3.5±0.3 kcal/mol (orange),
0 kcal/mol corresponding to ligand in vacuum. Tunnel entrances and cavities are indicated in a
and b, respectively. Pictures were generated using (a) PyMOL (39) and (b) VMD (25).
159
Figure 7.5 PMF profiles for •NO diffusion in ST (a) regardless and (b) as function of different
Ile119(H11) rotamers. For these ILS profiles, only 2988 and 3263 MD frames were available for
the mt and pp rotamers, respectively. Smaller samplings lead to overestimated PMF (24). PMF
profiles for the (c) LT and (d) EHT were calculated as function of Phe62(E15) M state (solid
line) and T state (dashed). The letter ’S’ indicates the TrHbN surface location.
160
Figure 7.6 Phe62(E15) χ1 and χ2 dihedral angles as function of the simulation time. The arrow,
at t ≈ 5.3 ns, indicates the entry of one •NO molecule in LT. This •NO diffused quickly from the
protein surface to the Xe1 binding site where it stayed for the remaining of the trajectory.
161
8.
Chapitre 8
Structure and Dynamics of Mycobacterium tuberculosis
Truncated Hemoglobin N: Insights from NMR Spectroscopy
and Molecular Dynamics Simulations
8.1. Résumé
L’activité oxyde nitrique dioxygénase (NOD) de l’enzyme TrHbN de Mycobacterium
tuberculosis (TrHbN-Fe2+
–O2 + •NO TrHbN-Fe3+
–OH2 + NO3-) protège la respiration aérobie
contre l’inhibition par le •NO. L’activité élévée de TrHbN a été attribuée en partie à la présence
de plusieurs cavités hydrophobes dynamiques permettant la partition et la diffusion des substrats
gazeux •NO et O2 au site actif. Nous avons étudié la relation existant entre ces cavités et la
dynamique de la protéine en utilisant la spectroscopie de résonance RMN en solution et par des
simulations de dynamique moléculaire (DM). Les résultats provenant des deux approches
indiquent que la protéine est principalement rigide avec des mouvements très limités des liens
amides (N-H) sur l’échelle de temps ps-ns. Ceci indique que la diffusion et la partition des
substrats à l’intérieur de TrHbN doit être controllées par les mouvements des chaînes latérales.
Des analyses de type « Model-free » ont aussi révélé la présence de mouvement lents (µs-ms),
non-observés en DM, pour plusieurs résidus positionnés le long des hélices B et G incluant le
résidu distal Tyr33(B10). Toutes les structures et les données de dynamique moléculaire
d’hémoglobines tronquées ayant une exension en N-terminal appelée région « pre-A » suggère
que celle-ci possède une structure secondaire stable en hélice alpha. De plus, une étude récente a
attribué un rôle crucial pour cette hélice pre-A pour l’activité NOD. Or, nos données RMN en
solution ont montré clairement que dans des conditions proches de celles physiologiques, ces
résidus n’adoptent pas une conformation en hélice alpha et sont plutôt significativement
désordonés. La conformation observée dans les cristaux serait attribuable à des contacts
cristallins. Aussi, le manque d’ordre dans la pre-A ne signifie pas pour autant que cette région ne
joue pas un rôle fonctionnel important mais s’il existe, que celui-ci ne peut être expliqué par la
162
conformation en hélice de ces résidus. De plus, les simulations de DM futures ne devraient pas
être démarrées avec la pre-A avec une conformation en hélice afin d’éviter des biais basés sur
des structures initiales erronnées. Ce travail constitue la première étude dynamique de la
structure d’une hémoglobine tronquée par spectroscopie RMN en solution.
8.2. Abstract
The potent nitric oxide dioxygenase (NOD) activity (TrHbN-Fe2+
–O2 + •NO TrHbN-Fe3+
–
OH2 + NO3-) of Mycobacterium tuberculosis truncated hemoglobin N (TrHbN) protects aerobic
respiration from inhibition by •NO. The high activity of TrHbN has been attributed in part to the
presence of numerous short-lived hydrophobic cavities that allow partition and diffusion of the
gaseous substrates •NO and O2 to the active site. We investigated the relation between these
cavities and the dynamics of the protein using solution NMR spectroscopy and molecular
dynamics (MD). Results from both approaches indicate that the protein is mainly rigid with very
limited motions of the backbone N−H bond vectors on the picoseconds-nanoseconds timescale
indicating that substrate diffusion and partition within TrHbN may be controlled by side-chains
movements. Model-free analysis also revealed the presence of slow motions (μs-ms), not
observed in MD simulations, for many residues located in helices B and G including the distal
heme pocket Tyr33(B10). All currently known crystal structures and molecular dynamics data of
truncated hemoglobins with the so-called pre-A N-terminal extension suggest a stable alpha-
helical conformation that extends in solution. Moreover, a recent study attributed a crucial role to
the pre-A helix for NOD activity. However, solution NMR data clearly show that in near-
physiological conditions, these residues do not adopt an alpha-helical conformation and are
significantly disordered, and that the helical conformation seen in crystal structures is likely
induced by crystal contacts. Although, this lack of order for the pre-A does not disagree with an
important functional role for these residues, our data show that one should not assume an helical
conformation for these residues in any functional interpretation. Moreover, future molecular
dynamics simulations should not use an initial alpha-helical conformation for these residues in
order to avoid a bias based on an erroneous initial structure for the N-termini residues. This work
163
constitutes the first study of a truncated hemoglobin structure and dynamics performed by
solution NMR spectroscopy.
8.3. Introduction
Tuberculosis infects one-third of the world’s population. Most infected individuals fail to
progress to complete disease because the TB bacilli are maintained in a latency state by the
immune system. During latent infection mycobacteria are exposed to low O2 concentrations and
to nitric oxide (•NO) produced by the immune system of the host. Since •NO can inhibit or
inactivate key enzymes such as the terminal respiratory oxidases and the iron/sulfur protein
aconitase and can generate secondary reactive nitrogen species displaying varied reactivity and
toxicity (1-7), •NO-metabolizing reactions are thus required for Mycobacterium tuberculosis
(Mtb) to fight •NO poisoning. The truncated hemoglobin N (TrHbN) from the pathogenic
bacterium Mtb has a potent ability to detoxify •NO to nitrate (nitric oxide dioxygenase reaction
(NOD)) and to protect aerobic respiration from the inhibition by •NO in stationary phase cells of
M. bovis BCG (8). The high rate of •NO oxidation (kNOD ≈ 745 µM-1
s-1
at 23°C) catalyzed by
oxygenated TrHbN and the large affinity (Kd = 8 nM) for O2 suggests that the NOD reaction
may be one of the vital defense systems in Mtb for coping with the toxic effects of •NO under the
low O2 concentration (1-4 µM) prevailing in infected lesions (9). An understanding of the
structure and dynamics characteristics leading to this high reactivity is essential, hence the need
to study the molecular mechanisms controlling ligand/substrate access to the distal heme pocket
(DHP).
A striking feature of TrHbN is the presence of multiple narrow hydrophobic tunnels connecting
the active site to distinct protein surface sites. Fig. 8.1 shows the tunnels that have been
identified using MD simulations (10) and X-ray crystallography (11): Short Tunnel (ST), Long
Tunnel (LT), EH Tunnel (EHT) and BE Tunnel (BET). These tunnels are not open channels but
are formed of short-lived hydrophobic neighboring cavities of various shapes and volumes (10)
that partition substrates from solvent. These cavities are temporally interconnected due to side-
chain flexibility. The high rigidity of TrHbN backbone as observed in MD simulations (10)
164
enables these numerous cavities. Interestingly, except for one, all these cavities correspond to the
Xe binding pockets identified by X-ray crystallography (11). Dynamic hydrophobic tunnels of
narrow diameter, as observed in TrHbN, may also prevent the formation of hydrogen bonded
water clusters that can hinder passage of other molecules through the tunnel. Water molecules
and other polar substrates in hydrophobic tunnels typically have very rapid sub-nanosecond
transit times that insure that water will not hinder passage of less polar substrates. In contrast to
the Xe cavities in myoglobin, the hydrophobic tunnels in TrHbN constitute the trajectory linking
the DHP to the solvent (10, 12-15)[170-174].
As we reported earlier, the local entrance of the tunnels also contributes to the overall reactivity
both through substrate selectivity and through the dynamics controlling the transit between the
external solvent and the internal tunnel (12). The hydrophobicity and polarity of the cluster of
residue side chains localized at the tunnel entrance can create domains that favor local
enhancements in the concentration of potential substrates (12). Reactants such as •NO are
soluble in aqueous environments but have higher solubility in hydrophobic environments. Thus
hydrophobic patches in the region of the tunnel entrance on an otherwise hydrophilic/polar
surface may serve to create an enhanced build up of •NO at the proposed site of entry. Our recent
results (12) show •NO molecules interacting with oxygenated TrHbN preferentially at the
entrance of the tunnels. In TrHbN the hydrophobic nature of the entrances forces water
molecules partitioning away from the protein surface and thus favors •NO capture.
A functional consequence of the tunnels is that •NO reaches the bound O2 without the need for
important structural changes allowing TrHbN to catalyze NOD reaction at a rate approaching
that of diffusion-controlled reactions. Interestingly, myoglobin requires the distal His64(E7) to
swing out of the DHP, resulting in a much slower NOD activity (kNOD ≈ 45 µM-1
s-1
at 23°C).
Another unusual feature of TrHbN is the presence of the so-called pre-A helix, located at the N-
terminus. This “floating” tail was recently assigned a functional role by influencing the diffusion
of ligands to the active site (16). The authors proposed that the deletion of the pre-A helix alters
protein dynamics, especially the conformational state of the Phe62(E15) residue restricting the
passage of NO to the DHP, thus affecting the ability of TrHbN for •NO detoxification (16).
However, since the protruding and rigid conformation of the pre-A helix observed in the crystal
165
lattice could be questionable, it may be ill-advised to interpret the functional role of the pre-A
helix based on the unusual conformation observed in the crystal structure.
To this day, no experimental data are available on the structure and dynamics of TrHbN in
solution. The present work describes the first study of a truncated hemoglobin by solution NMR
spectroscopy. The structure and dynamics of TrHbN in the cyanomet form were studied using
NMR chemical shifts, relaxation data acquired at three magnetic fields, and NMR amide
exchange experiments. The cyanomet form was studied since the majority of currently available
structures for TrHbN, including the structure with Xe atoms highlighting the tunnel network,
were obtained in complexes with cyanide in the ferric state, and that cyanide represents a
valuable diatomic ligand model system. In order to evaluate the structural integrity of the pre-A
helix in solution, we have studied both the wild type protein and the ∆pre-A mutant. To
complement the NMR data, the characterization was carried out in combination with MD
simulations.
8.4. Material and methods
8.4.1. NMR
Protein expression, labeling, and purification - The genes coding for the mature wild-type
TrHbN protein (136 residues) as well as for the Δpre-A mutant (lacking residues 1 to 12) were
cloned in E. coli BL21(DE3) cells. Proteins were prepared by reconstitution of the apoprotein
with heme in a manner similar to the one described by Scott and Lecomte (17). Details of protein
preparation methods can be found in Supporting Material (Annexe 3).
Samples preparation and NMR spectra recording - 15
N- or 15
N/13
C-uniformly labeled protein
samples were prepared at a concentration of 0.8 mM in a 20 mM KPO4 pH 7.5 buffer containing
50 μM EDTA, 3 mM KCN, 10% D2O, 1X Complete protease inhibitors (Roche) and 0.1 mM
DSS. All experiments were performed at 26.4°C (calibrated using MeOH) on Varian INOVA
600 (Université Laval, Québec, Canada), 500, and 800 (Québec / Eastern Canada High Field
166
NMR Facility, McGill University, Montréal, Canada), all equipped with z-axis, pulsed-field
gradient, triple-resonance cold probe.
NMR resonance assignment - For backbone and side-chains resonances assignment, the
following spectra were collected using pulse sequences from Biopack (Varian Inc, Palo Alto,
CA): 2D 15
N-HSQC, 2D 13
C-HSQC (both aliphatic and aromatic), 3D HNCO, 3D
CBCA(CO)NH, 3D HNCACB, 3D C(CO)NH, 3D HC(CO)NH, 3D HCCH-TOCSY, 3D 13
C-
NOESY-HSQC, and 3D HNHB. All these experiments were performed on a Varian INOVA 600
spectrometer (Université Laval, Québec, Canada). All spectra were processed using
NMRPipe/NMRDraw (18) and analyzed within NMRView (19).
15N spin relaxation experiments -
15N-R1,
15N-R2, and {
1H}-
15N NOE
NMR relaxation
experiments were recorded at proton frequencies of 500, 600, and 800 MHz. Pulse sequences
from the Kay group were used (20, 21). More details are available in the Supporting
Material (Annexe 3).
Model-free analysis - The model-free analysis (22, 23) was performed using an axially
symmetric diffusion tensor within the program MODELFREE 4.20 (A.G. Palmer III, Columbia
University, New York, NY). Details are available in the Supporting Material (Annexe 3).
Amide exchange experiments - Amide exchange experiments were performed as described in
Morin and Gagné (24). Data were recorded at 600 MHz at both pH 7.5 and 8.5. At pH 7.5, a total
of 45 15
N-TROSY-HSQC spectra (BIOPACK, Varian, Palo Alto, CA) were recorded. Details
can be found in Supporting Material (Annexe 3).
8.4.2. Molecular dynamics simulations
Force field optimization of the cyanide-bound heme atomic charges and Fe-C-N angle
parameter - CHARMM22 (25) force field lacks parameters for the cyanide-bound heme. To
simulate CN-bound TrHbN in this study, the atomic charges of heme prosthetic group as well as
the cyanide and the Fe-C-N angle parameter were optimized following the standard
167
parameterization protocol for the CHARMM22 force field (25). The same procedure was
previously applied for O2-bound heme force-field parameters (10) and details are given in
Supporting Material (Annexe 3).
Systems and simulation setup - Initial coordinates were taken from wild type cyanomet TrHbN
crystallographic structure (PDB 1RTE) (14). Crystallographic water and sulfate ions were
ignored. Hydrogen atoms were added using CHARMM’s HBUILD facility (26). All ionisable
residues were considered in their standard protonation state at pH 7.0 with neutral histidine
protons placed at the ND1 position. The crystal unit cell contained two TrHbN molecules (A and
B chains). Both chains were used individually to start two independent 85 ns MD simulations in
order to increase sampling (trajectories identified hereafter as A-TrHbN and B-TrHbN). The first
5 ns were considered as equilibration time. Complete protocol is available in Supporting
Material (Annexe 3).
Trajectory analysis - The protein N-H bond S2 parameters were calculated using the M2 method
described in Fisette et al. (27). Briefly, method M1 was used to verify convergence of the
backbone amide autocorrelation function (C1(t) (approximating the ensemble using the last 80 ns
of simulations for t < 40 ns). When a function did not converge, S2 was estimated as the average
of the last 500 ps. In M2 method, all structure snapshots from the two trajectories were combined
and randomized. The correlation function decays to its plateau value immediately after C1(0).
The S2 estimate therefore takes into account 160 ns of simulation time. Backbone amide group
accessible surface area (ASA) was calculated using a probe radius of 1.4 Å at every 10 ps.
Backbone amide hydrogen bond occupancy was analyzed with various N-H acceptor distance
cutoffs (2.0, 2.2 and 2.4 Å) and a minimum N-H acceptor angle of 120°.
168
8.5. Results
8.5.1. NMR
Protein expression, labeling, and purification - Using the protocol described in Supplementary
Material (Annexe 3), ~20 mg of highly pure reconstituted TrHbN (r-TrHbN) per liter of M9
medium were obtained for the wild type protein and ~80 mg per liter for the reconstituted Δpre-
A mutant (Δpre-A r-TrHbN). According to LC-MS analysis, incorporation of 13
C and 15
N in our
samples was ≥ 96%. The samples were stable for several weeks at room temperature. Kinetics
parameters for O2 and CO binding and dissociation of r-TrHbN were determined (data not
shown) and found identical to those already published. Resonance Raman spectra for the O2 and
CO r-TrHbN complexes also indicate that the DHP is quite identical to that of TrHbN. Dynamic
light scattering measurements were made at several concentrations to ensure that there was no
aggregation/oligomerization in the NMR sample. The protein was found as a monomer in
solution at the concentration used for NMR. We also noticed that Met1 was cleaved for the wild
type protein but was still present for the Δpre-A mutant, as confirmed by mass spectrometry.
1H,
15N, and
13C resonance assignments for TrHbN cyanomet - As shown in Fig. 8.2, the 2D
15N-HSQC spectrum of r-TrHbN cyanomet is of high quality, with a good dispersion of the N-H
resonances. Backbone resonances assignment was completed for cyanomet r-TrHbN at 97%,
99%, 96%, and 96% respectively, for backbone amides, Cα, Cβ, and carbonyls. Missing amide
assignments are for Leu3, Arg6, Lys9, Gly74 as well as for the 7 proline residues (Pro12, Pro69,
Pro71, Pro76, Pro108, Pro121(H13), and Pro135). Most of the missing amides are located in the
pre-A region of the protein (residues 2 to 9) as they were too weak to be visible in the spectra.
Assignment for the amide group of Gly74 was not possible because of overlapping with other
glycine residues. Missing assignments for Cα are for Gly2 and Ser5. For Cβ, missing assignments
are Ser52(E5), Val107(GH5), and Ser109(H1). Finally, missing assignments for carbonyls are
Gly2, Leu4, Ser5, Arg8, Arg53(E6), and Thr73. For side chains, 75% of the resonances
assignment was completed. Chemical shifts have been deposited in the Biological Magnetic
Resonance Data Bank (BMRB) under accession number 17226.
169
15N spin relaxation data -
15N spin relaxation data were recorded at three magnetic fields (500,
600, and 800 MHz proton Larmor frequencies) in order to better characterize the dynamics of r-
TrHbN in solution. Mean values for 15
N-R1, 15
N-R2 and {1H}-
15N NOE are presented in
Table 8.1 and all experimental values are plotted in Fig. 8.3, A-D. Values obtained are
homogenous and show the same pattern for all the magnetic fields, with smaller R2 for residues
in N- and C- termini and in loops, as expected for these more mobile regions. Raw relaxation
data for each residue at the three fields are available in Table S2 of the Supporting
Material (Annexe 3). 15
N spin relaxation data for r-TrHbN have been deposited in the BMRB
under accession number 17226.
Model-free analysis - It was possible to get high-quality data for 101 out of the 127 non-proline
observable residues at the lowest magnetic field of 500 MHz, overlapping or too broad
resonances being responsible for non-analyzed amides. Only these 101 residues which have data
at the three magnetic fields were used to perform the model-free analysis.
Examination of the inertia tensor of r-TrHbN indicates an asymmetric protein, with relative
moments of 1.00: 0.96: 0.45. Many diffusion tensors were tested, using either the program
relax (28, 29) (local τm, sphere, prolate spheroid, oblate spheroid, and ellipsoid) or Quadric (A.
G. Palmer III, Columbia University) (isotropic, axial, and anisotropic). The best model appeared
to be prolate spheroid with relax and axial with Quadric, which are mostly the same.
Consequently, an axially symmetric (spheroid) tensor was used for the model-free analysis.
Global optimization of the tensor showed that TrHbN tumbles anisotropically in solution with a
D||/D value of 1.45 and a global tumbling time of 10.0 ns, similar to the results obtained for
other globins of the same size and shape (30, 31).
For local motions, the data were fitted to the five following model-free models: (m1) [S2], (m2)
[S2, τe], (m3) [S
2, Rex], (m4) [S
2, τe, Rex], (m5) [S
2f, S
2s, τe], where S
2 (=Sf
2Ss
2) is the square of the
generalized order parameter characterizing the amplitude of internal motions, Sf2 and Ss
2 are the
squares of the order parameters for the internal motions on the fast (ps) and slow (ns) timescales,
respectively, τe is the effective correlation time for internal motions, and Rex is an additional
parameter added to contributions to observed R2 from conformational exchange and pseudo-first-
order processes occurring on the microsecond-to-millisecond timescale (32). Following the final
170
model-free model selection step, 46 residues were fitted with model m1, 23 with model m2, 9
with model m3, 6 with model m4, and 17 residues with model m5. Models m1 and m2 are the
simplest models and were used to fit most of the residues. These models are representative of
residues exhibiting fast pico- to nanoseconds motions for their N-H vectors. Results from the
model-free analysis are presented in Table S3 (Annexe 3).
NMR order parameters, S2 -The S
2 generalized order parameter characterizes the amplitude of
internal picoseconds-nanoseconds timescale motions of N-H bond vectors. S2 values vary from 0
for a completely disordered vector, to 1 for totally restricted vector (33). S2 values obtained for r-
TrHbN are plotted in Fig. 8.3, E, and mapped onto the protein structure in Fig. 8.4, A.
Considering all residues, an average order parameter (S2) of 0.84 was obtained for r-TrHbN. In
particular, we see that helices B, and E are the most rigid of the protein with an average S2 value
of 0.91, which is higher than the average value of 0.88 reported for α-helices by Goodman et al.
(34). Helices F and G appeared to be the most flexible, with average S2 of 0.84 and 0.86,
respectively. Order parameters for other helices are typical.
As expected, a lower degree of motion restriction was observed for loops as well as for both N-
and C-termini, for which a very high degree of mobility is observed with average S2
values of
0.42 and 0.21, respectively. S2 order parameters for r-TrHbN have been deposited in the BMRB
under accession number 17226.
Slow motions - The Rex term in model-free models m3 and m4 accounts for slow μs to ms
motions. Fifteen residues of r-TrHbN were fitted with one of these models, indicating the
presence of chemical exchange occurring in the slow μs to ms timescale in the vicinity of these
residues (Glu30(B7), Tyr33(B10), Gly83, Thr87(G1), His90(G4), Phe91(G5), Val94(G8),
Ala95(G9), Leu98(G12), Ala99(G13), Ala101(G15), Leu102(G16), Ala105(G19), Ile112(H4))
(see Fig. 8.3 F and Fig. 8.4 B). Most of these slow motions are observed for N-H bond vectors of
residues located in helices B and G, and pointing toward the active site of the protein, some of
them located directly in or at the entrance of a tunnel. Active site residues requiring an Rex term
include Tyr33(B10) and Val94(G8) while residues defining tunnel entrances include Phe91(G5)
and Ala95(G9) for the ST tunnel and, Glu30(B7) and Ty33(B10) for the BET tunnel.
171
Two-timescale motions - Seventeen residues were better characterized by using model m5
(Leu7, Glu11, Ile13, Ala24(B1), Ala44, Glu70, Ala75, Gln79, Val80(F7), Arg84, Gly106,
Asp125, Gly129, Glu130, Thr133, Ala134, Val136), indicating the presence of motions
occurring at two different timescales (Sf2 = ps, Ss
2 = ns) for these N-H vectors. All these residues
are located in flexible regions of the protein such as N- and C-termini, loops, or at the beginning
of helices.
NMR amide exchange experiments - Amide protons can exchange using one of two regimes:
EX1 or EX2 (41). In the EX1 regime, exchange rates are pH independent and give kinetics
information on the exchange process, i.e. the exchange rate (kex) is equal to the opening rate for
the local structure protecting the N-H group from solvent access (kop). In the EX2 regime,
thermodynamics information can be extracted from pH dependent exchange rates. The extracted
information provides the following parameters, which correspond to different ways to present the
same information: ΔGHX (the free energy for the opening of the local structure protecting the N-
H group), Kop (the equilibrium constant) and PF (the Protection Factor for the exchange,
Kop = 1/PF). Generally, under non denaturing conditions (i.e. high stability), amide protons
exchange from the EX2 regime. A simple approach for determination of the exchange regime
consists in measuring exchange rates at two pH. If rates from the highest pH are faster, then the
exchange proceeds using the EX2 regime at the lowest pH. As can be seen from Fig. 8.3, J,
amide exchange at pH 7.5 proceeds from the EX2 regime. Indeed, the rates at pH 8.5 are in
average 30±10 times faster than rates at pH 7.5 (while theory would suggest a difference of 10X
between rates from both pH). From these data, ΔGHX, Kop and PF can be extracted to
characterize the exchange process at pH 7.5. Fig. 8.3, K, shows a plot of ΔGHX values according
to the residue number and these values are mapped on the protein structure on Fig. 8.4, C.
Quantitative data is available for only 52 residues, while semi-quantitative data is available for
60 residues (12 too slow, 48 too fast for being quantified). The pre-A region appears as the less
stable portion in TrHbN. Indeed, from the 5 residues that could be characterized in the pre-A
region, neither had a measurable exchange rate, i.e. all exchanged too fast to be characterized.
This means that N-H groups in this region are poorly protected from exchange, with ΔGHX lower
than 5 kcal/mol. This is in agreement with missing resonances and very low S2 values observed
for this part of the protein. Other short helices such as the A, C, F and H’ helices have low ΔGHX.
On the contrary, helices B, E, G and H have ΔGHX of higher value, even including residues for
172
which exchange rates could not be measured accurately due to the limited time allowed for
exchange (~42 days). Exchanging on an intermediate timescale, the H helix has ΔGHX between 7
and 10 kcal/mol. Amide exchange data have been deposited in the BMRB under accession
number 17226.
NMR investigation of the Δpre-A mutant - A recent study concluded that the pre-A region
may play an important function by altering the dynamics of the protein core and thus ligand
diffusion (16). In the latter work, the excision of pre-A region triggered changes in LT dynamics,
especially for Phe62(E15) side-chain, leading to the blockade of the LT and NO access to the
heme-bound oxygen. To validate these conclusions we generated a mutant protein corresponding
to the pre-A mutant described in (16) (lacking residues 1-12) and investigated its structure and
dynamics by NMR spectroscopy. pre-A r-TrHbN was as stable as r-TrHbN and showed
identical kinetic binding properties. Comparison of 15
N-HSQCs from the wild type and the Δpre-
A mutant indicated that changes in the electronic environment are limited to residues
neighboring the mutation site. Analysis of the C sidechain chemical shifts revealed that only
two residues had significant chemical shift change upon pre-A deletion : Asp17 (0.23 ppm) and
His22 (0.34 ppm). Asp17 C is near the deletion and 6.6Å from the terminal NH3+ in the
deletion mutant. On the other hand, His22 is far from pre-A residues in the crystal structure
(nearest group is the charged extremity of Arg6 at 9.2Å). We therefore found little evidence that
the pre-A region was interacting strongly with other parts of the protein. Fig. 8.5 illustrates the
chemical shifts differences (Δδ) between the 1H
15N resonances from r-TrHbN and Δpre-A r-
TrHbN.
Solution structure of the pre-A “helix” - As shown in Fig. 8.3, E, all N-termini residues up to
residue 13 have low order parameters, with steadily decreasing order parameters going toward
the N-termini as typically seen in unstructured extremities of several proteins. The region
includes the so-called pre-A “helix” that was observed in all TrHbN crystal structures. In order to
evaluate the helical character of the pre-A region in solution, we have used the program SSP,
which uses NMR chemical shifts to calculate a single residue-specific secondary structure
propensity score (36). As shown in Fig. 8.3, N, the score obtained for pre-A residues in TrHbN is
around 0, implying an absence of α-helical secondary structure predisposition in solution,
consistent with our NMR spin relaxation and amide exchange data.
173
8.5.2. Molecular dynamics simulation and comparison with NMR results
Stable trajectories were obtained in both molecular dynamics simulations performed. Average
backbone root mean square deviation (RMSD) for residues in α-helices stabilized at ~0.7 Å.
MD order parameters of N-H bond vectors - Both MD trajectories were used to calculate the
generalized order parameter S2 for backbone N-H bonds (sampling from a total of 160 ns).
Comparisons between MD and NMR data are shown in Fig. 8.3, H-I. S2 values, N-H bond
internal autocorrelation function and local motions are available in Annexe 3, Table S4 and
Fig. S1. Individual MD simulations produced very similar S2 datasets. Significant S
2 differences
between these two simulations are observed for the pre-A region and for some residues located
in C-E and E-F loops. For some residues located in loops, the autocorrelation function C1(t) did
not converged during simulations (residues Asp39, Glu70, Gly74). S2 estimates for these
residues would have required more and/or longer MD simulations to converge.
S2 obtained from MD simulations are in very good agreement with those obtained from NMR, as
shown in Fig. 8.3, H-I. The average MD S2 obtained for the four α-helices forming the 2-on-2
fold and enclosing the tunnels (B, E, G and H helices – S2 of 0.89) is the same as from NMR and
reflects very restricted motions in the ps-ns timescale. RMSD between MD and NMR is 0.10
using all residues, 0.16 for loop residues, and 0.06 for residues in α-helices. Similar agreements
were obtained in a recent study on the of E. coli β-lactamase TEM-1(27). The main discrepancy
concerns the pre-A region where MD-derived S2 are much higher than those obtained from
NMR. Other discrepancies concern some residues located within C-E and E-F loops. These latter
discrepancies are explained by the non-convergence of the autocorrelation function for several
residues.
Further agreement of results from NMR and MD concerns residues exhibiting two timescale
motions. Of the seventeen residues fitted with model m5 in the model-free analysis (two-
timescale motions on the ps-ns timescale) nine were observed to have similar motions in MD
simulations. This is shown in MD simulations by N-H vectors exploring more than a single
conformation (see residues Glu11, Ile13, Glu70, Arg84, Gly106, Gly129, Glu130, Thr133, and
Ala134 in Fig. S1(Annexe 3) ).
174
Hydrogen bonds occupancies compared to amide exchange rates - Backbone N-H hydrogen
bond occupancy was calculated for the different simulations and is shown in Fig. 8.3, M. As
expected, occupancy is higher in regions with well formed secondary structure. Particularly,
higher occupancies are found in helices E and G correlated with slower amide exchange rates. As
for S2 parameters, however, discrepancies are found for the pre-A region. Indeed, the pre-A
region remained structured as an α-helix along MD simulations and thus high H-bond
occupancies (Fig. 8.3, M) and low solvent exposure (Fig. 8.3, L) were calculated. This is in
striking contrast with the very fast experimental amide exchange rates.
8.6. Discussion
To this day the structure and dynamics of TrHbN have been studied by several techniques such
as X-ray crystallography, resonance Raman spectroscopy, or MD simulations. The present work
presents the first structure and dynamics study of TrHbN using solution NMR spectroscopy.
NMR data indicate that the 2-on-2 fold may provide sufficient rigidity to host several tunnels.
High S2 parameters derived from model-free analysis and MD simulations show that motions of
backbone amide vectors in TrHbN are very limited on the ps-ns timescale. As we already
proposed high rigidity of the backbone may enable hosting the numerous cavities that form the
gas pathways connecting the DHP to the solvent (10). The high rigidity of the B, E, G and H
helices, which form the characteristic 2-on-2 helical core of the truncated hemoglobin fold, may
prevent the optimization of internal side-chains Van der Waals interactions that would otherwise
result in tighter side-chain packing and the loss of tunnels. At the same time, the free internal
volume of tunnels coupled with thermal fluctuation may allow flexibility of the side-chains
making the tunnels, which is mandatory for gas migration (10, 12, 37-41). This structural feature
could also be a prerequisite in other tunnel-containing proteins. Since most of TrHbN tunnel
residues contain methyl groups (alanine, valine, leucine and isoleucine), NMR characterization
of these side-chain motions using 2H spin relaxation within these methyl groups may represent a
great biophysical interest. For example, if NMR reveals side-chain motions for residues that
appear tightly packed in MD simulations, other substrate/product diffusion routes may be
175
formed. Afterward, new models could be tested by performing biased MD simulations
techniques or by performing extended MD simulations to capture non-frequent motions.
Dynamics in tunnels and in the active site - Rex terms were observed for 13 residues located in
helices B, G, and H (Fig. 8.4, B). Among these we find the distal residue Tyr33(B10), shaping
the BE tunnel, and involved in ligand binding and stabilization (15, 42-43). Since many catalytic
processes occur on this timescale, the presence of such slow motions for this tyrosine is most
likely relevant for the function of the protein.
Fig. 8.4, B, also illustrates that most of the residues having a Rex term are found in helix G which
together with helix H define the ST tunnel, and that all these residues point toward the protein
core and not toward the solvent. Such co-localized slow motions could reflect the presence of a
molecule slowly diffusing in the tunnels of the protein. Another potential explanation for the
presence of these slow motions would be a translational movement of this helix or of the
neighboring H helix in solution. Such a motion, would not contribute to the NMR-derived S2, but
it would modulate the chemical shifts of amides at the interface and, depending on the timescale,
would lead to the observation of Rex terms in the model-free analysis. This kind of motion may
increase significantly internal free volume allowing larger substrates to penetrate the protein
core. Consequently, this motion may also be necessary for bulkier NO3- release. As a
comparison, important structural changes were observed upon binding of cyanide to the ferric
form of the truncated hemoglobin Synechocystis PCC 6833 (Syn-TrHb) (44, 45). In its ferric
form, Syn-TrHb has His46(E10) side chain bound to the heme iron (46), with important residues
implicated in ligand binding pointing toward the solvent (Tyr22(B10) and Gln43(E7)) or being
far above the heme iron (Gln47(E11)) (47). Following displacement of His46(E10) by cyanide,
significant reorganization of the B and E helices occurs, causing Tyr22(B10) and Gln43(E7) to
enter the DHP and formation of a H-bonding network between Tyr22(B10), Gln43(E7),
Gln47(E11) and the bond cyanide (44, 45). Interestingly, no tunnels were found in the 6-
coordinate crystal structure of SynHb, while the LT and EHT are evident in the cyanomet form
(44, 47). These two structural conformations imply important changes in internal side chains
packing. In this view, μs-ms motions in r-TrHbN could have repercussions on the dynamics and
organization of the tunnel, which govern substrate/product diffusion to and out of the DHP.
176
We have attempted to quantify these μs-ms motions observed from spin relaxation using CPMG
relaxation dispersion experiments, without success (data not shown). This absence of dispersion
in the CPMG relaxation dispersion profiles is still consistent with the Rex parameters extracted
from model-free analysis. Indeed, in the model-free analysis scheme we used, the contribution
from μs-ms motions on R2 is assumed to be quadratically dependent on the magnetic field
strength, i.e. in the fast-exchange limit. Of course, the potential contribution from motions in the
slow-exchange limit, which is independent of the magnetic field, is not totally excluded from
these data. However, the flat profiles from CPMG relaxation dispersion experiments confirm that
the μs-ms motions detected from model-free analysis are most probably outside the slow-
exchange limit, i.e. in the fast-exchange limit, probably with kex > 10000 s-1
since CPMG (with
νcpmg up to 1000 Hz) could not quench the exchange.
Pre-A “helix” is not an helix - The main structural divergence between results from NMR and
previous results from X-ray and MD concerns both the rigidity and the presence of a secondary
structure for the pre-A region (residues 2-9). This region forms a somewhat unusual α-helix that
extends away from the globular structure in all X-ray structures of TrHbN and is quite stable in
MD simulations that use X-ray coordinates for an initial structure. NMR data showed no
evidence for such a stable helix, or even helical propensity, in solution. Experimental data
supporting disorder and the lack of secondary structure for the so-called pre-A “helix” are: 1)
Missing or very weak resonances in the NMR spectra, attributed to broadened peaks and/or fast
exchange with the solvent; 2) Very low S2 parameters, reflecting highly disordered N−H vectors;
3) N-H exchanging too fast to be characterized by amide exchange experiments, meaning a very
low protection factor for this region (thus no or low residency H bonds); 4) The propensity for
secondary structure from chemical shifts indicates no helical conformation for this region.
The presence of such an α-helical structure for the pre-A region in the TrHbN X-ray structures
could be favored by the high ionic strength conditions used for crystallization as well as by the
crystal contacts. Indeed, careful observation of the packing of the pre-A region in the crystal
lattice shows contacts with other chains which may favor an helical conformation. Although an
helical conformation could potentially be transiently populated in solution, this would have to be
extremely low since we saw no signs of helical propensity under the physiological conditions
used for the NMR study.
177
Only small localized changes were observed following the removal of the pre-A region; this is in
agreement with CD studies proposing that this region does not contribute to the structural
integrity of the protein (16). The CD data from Lama et al. (16) actually support a disordered
pre-A model. They noted that “the content of random coil decreased when pre-A was deleted
from M. tuberculosis HbN and increased when pre-A region was added to M. smegmatis HbN”.
We believe that this random coil changes in their CD can be attributed to the removal/addition of
a disordered pre-A region. Our pre-A results partially agree with the presence of an interaction
between Arg10 and Glu70 previously detected (35). Our data show that the C chemical shift of
Glu70 does not change upon deletion of the pre-A, hence suggesting that the environment of the
Glu70 sidechain is not affected by the presence or absence of the pre-A region. As mentioned
above, only two C chemical shifts changes were noted upon deletion of the pre-A region, one of
them being His22 (0.34ppm shift). A potential cause for this shift may be transient polar
interactions in the native protein between Glu70 (which is hydrogen bonded to His22 in the
crystal structure) and one or more of the positively charged groups in the disordered pre-A
(Arg6, Arg8 or Arg10), similar to the transient interaction observed by MD between Arg10 and
Glu70 (35).
However, our data disagree with one result from the molecular dynamics simulations done by
Lama et al. (16). In this study, it was shown that the excision of the pre-A region results in
distinct changes in the protein dynamics. They observed that the Phe62(E15) gate is trapped in
the closed conformation in the mutant. From our NMR data, there is no significant change in the
amide and C chemical shifts for Phe62(E15) and nearby residues in the pre-A mutant.
Moreover, we have recorded R2 parameters at 600 MHz for this pre-A mutant and the R2 value
observed for Phe62(E15) is the same as the mean R2 in both proteins. This implies a similar
degree of slow timescale (μs-ms) dynamics in both situations.
178
8.7. Conclusion
This study reports the first experimental characterization of the dynamics of a truncated
hemoglobin. The characterization of the structure and dynamics of ferric Mycobacterium
tuberculosis TrHbN bound to cyanide were done by two complementary techniques, NMR and
MD simulations. This stable cyanomet form provides a good diatomic ligand system model, and
corresponds to the most studied form by X-ray crystallography to date. Although the nature of
the hydrogen bond network with the ligand on the distal side differs slightly with that observed
in the ferrous oxygen-bound structure (14), X-ray crystallography and MD simulations suggest
that the behavior of tunnels and pre-A conformation does not vary significantly between the
oxygen-Fe(II) and cyanide-Fe(III) forms of TrHbN. Consequently, the results presented here can
be extended to the more physiological oxygen-Fe(II) form.
Results obtained from both NMR and MD are in a very good agreement, validating previous
results as well as our protocols. The results emphasize that TrHbN is mainly rigid, especially for
residues forming the 2-on-2 fold showing very limited motions of the N-H vectors in the ps-ns
timescale probed (average S2 for secondary structures of 0.89). Model-free analysis revealed the
presence of unexpected and localized motions in the µs-ms timescale taking place at the DHP
residue Tyr33(B10) and also all along the G-helix. These motions could have important
repercussions on the dynamics of the tunnels and the active site and thus, on ligand diffusion and
kinetics properties. Amide exchange experiments, performed at pH 7.5 and 8.5, also evidenced
the very high stability of TrHbN 2-on-2 fold. While X-ray structures show pre-A as an
α−helix (14-15), our NMR data revealed this N-terminal region to be very disordered and
showed no evidence for the presence of any secondary structure. The novel pre-A conformation
presented here is not in contradiction with a vital role for the pre-A region, as was recently
proposed (16). However, we believe it would be ill-advised to assume an helical conformation
and structural order for residues 2-9 in attempting to interpret the functional role of the pre-A
region. Moreover, we recommend that future MD simulations of TrHbN should not be carried
with an initial helical conformation for the pre-A region; an initial random conformation would
likely be more accurate. Taken together, these findings are of great interest toward our
179
understanding of TrHbN function. This work could also be of interest for other gas-interaction
and tunnel-containing enzymes.
Since most of TrHbN tunnel residues contain methyl groups (alanine, valine, leucine and
isoleucine) it may now be possible to follow 2H spin relaxation within these methyl groups in
order to probe internal side chain flexibility.
This study is thus the first step of a wide analysis of TrHbN dynamics in various forms by NMR
techniques.
8.8. Acknowledgments
The authors thank Prof. Martino Bolognesi and Olivier Fisette for stimulating discussions. This
work was supported by the Natural Sciences and Engineering Research Council of Canada
(NSERC), the Fonds québécois de recherche sur la nature et les technologies (FQRNT), and
PROTEO, the Quebec Network for Research on Protein Function, Structure, and Engineering.
8.9. Supporting information
Additional details, optimized CN-bound heme atomic charges, 15
N spin relaxation data, model-
free analysis results, MD-derived dynamics parameters, amide N-H bound local motions in MD
simulations, ∆pre-A R2 data, ∆pre-A 1H-
15N HSQC overlay, ∆pre-A chemical shift changes. This
material is available free of charge via the Internet at http://pubs.acs.org and partially described
in Annexe 3.
180
8.10. References
1. Brown, G. C., and Cooper, C. E. (1994) Nanomolar concentrations of nitric-oxide reversibly
inhibit synaptosomal respiration by competing with oxygen at cytochrome-oxidase, FEBS
Lett. 356, 295-298.
2. Brunori, M. (2001) Nitric oxide, cytochrome-c oxidase and myoglobin, Trends Biochem.Sci.
26, 21-23.
3. Brunori, M., Giuffre, A., Sarti, P., Stubauer, G., and Wilson, M. T. (1999) Nitric oxide and
cellular respiration, Cell. Mol. Life Sci. 56, 549-557.
4. Cleeter, M. W. J., Cooper, J. M., Darleyusmar, V. M., Moncada, S., and Schapira, A. H. V.
(1994) Reversible inhibition of cytochrome-c oxidase, the terminal enzyme of the
mitochondrial respiratory-chain, by nitric-oxide - Implications for the neurodegenerative
diseases, FEBS Lett. 345, 50-54.
5. Gardner, P. R., Costantino, G., and Salzman, A. L. (1998) Constitutive and adaptive
detoxification of nitric oxide in Escherichia coli - Role of nitric-oxide dioxygenase in the
protection of aconitase, Journal of Biological Chemistry 273, 26528-26533.
6. Gardner, P. R., Costantino, G., Szabo, C., and Salzman, A. L. (1997) Nitric oxide sensitivity
of the aconitases, Journal of Biological Chemistry 272, 25071-25076.
7. Stevanin, T. M., Ioannidis, N., Mills, C. E., Kim, S. O., Hughes, M. N., and Poole, R. K.
(2000) Flavohemoglobin hmp affords inducible protection for Escherichia coli respiration,
catalyzed by cytochromes bo ' or bd, from nitric oxide, Journal of Biological Chemistry 275,
35868-35875.
8. Ouellet, H., Ouellet, Y., Richard, C., Labarre, M., Wittenberg, B., Wittenberg, J., and
Guertin, M. (2002) Truncated hemoglobin HbN protects Mycobacterium bovis from nitric
oxide, Proc. Natl. Acad. Sci. U. S. A. 99, 5902-5907.
9. Via, L. E., Lin, P. L., Ray, S. M., Carrillo, J., Allen, S. S., Eum, S. Y., Taylor, K., Klein, E.,
Manjunatha, U., Gonzales, J., Lee, E. G., Park, S. K., Raleigh, J. A., Cho, S. N., McMurray,
D. N., Flynn, J. L., and Barry, C. E., 3rd. (2008) Tuberculous granulomas are hypoxic in
guinea pigs, rabbits, and nonhuman primates, Infect Immun 76, 2333-2340.
10. Daigle, R., Guertin, M., and Lague, P. (2009) Structural characterization of the tunnels of
Mycobacterium tuberculosis truncated hemoglobin N from molecular dynamics simulations,
Proteins 75, 735-747.
11. Milani, M., Pesce, A., Ouellet, Y., Dewilde, S., Friedman, J., Ascenzi, P., Guertin, M., and
Bolognesi, M. (2004) Heme-ligand tunneling in group I truncated hemoglobins, Journal of
Biological Chemistry 279, 21520-21525.
181
12. Daigle, R., Rousseau, J. A., Guertin, M., and Lague, P. (2009) Theoretical Investigations of
Nitric Oxide Channeling in Mycobacterium tuberculosis Truncated Hemoglobin N, Biophys.
J. 97, 2967-2977.
13. Golden, S. D., Olsen, K. W., and Robert, K. P. (2008) Identification of Ligand Binding
Pathways in Truncated Hemoglobins Using Locally Enhanced Sampling Molecular
Dynamics, Methods in Enzymology 437, 459-475.
14. Milani, M., Ouellet, Y., Ouellet, H., Guertin, M., Boffi, A., Antonini, G., Bocedi, A., Mattu,
M., Bolognesi, M., and Ascenzi, P. (2004) Cyanide binding to truncated hemoglobins: a
crystallographic and kinetic study, Biochemistry 43, 5213-5221.
15. Milani, M., Pesce, A., Ouellet, Y., Ascenzi, P., Guertin, M., and Bolognesi, M. (2001)
Mycobacterium tuberculosis hemoglobin N displays a protein tunnel suited for O2 diffusion
to the heme, EMBO J 20, 3902-3909.
16. Lama, A., Pawaria, S., Bidon-Chanal, A., Anand, A., Gelpi, J. L., Arya, S., Marti, M., Estrin,
D. A., Luque, F. J., and Dikshit, K. L. (2009) Role of Pre-A motif in nitric oxide scavenging
by truncated hemoglobin, HbN, of Mycobacterium tuberculosis, J Biol Chem 284, 14457-
14468.
17. Scott, N. L., and Lecomte, J. T. (2000) Cloning, expression, purification, and preliminary
characterization of a putative hemoglobin from the cyanobacterium Synechocystis sp. PCC
6803, Protein Sci. 9, 587-597.
18. Delaglio, F., Grzesiek, S., Vuister, G. W., Zhu, G., Pfeifer, J., and Bax, A. (1995) NMRPipe:
a multidimensional spectral processing system based on UNIX pipes, J Biomol NMR 6, 277-
293.
19. Johnson, B. A., and Blevins, R. A. (1994) NMRView: A computer program for the
visualization and analysis of NMR data, J Biomol NMR 4, 603-614.
20. Farrow, N. A., Muhandiram, R., Singer, A. U., Pascal, S. M., Kay, C. M., Gish, G., Shoelson,
S. E., Pawson, T., Forman-Kay, J. D., and Kay, L. E. (1994) Backbone dynamics of a free
and phosphopeptide-complexed Src homology 2 domain studied by 15
N NMR relaxation,
Biochemistry 33, 5984-6003.
21. Kay, L. E., Keifer, P., and Saarinen, T. (1992) Pure absorption gradient enhanced
heteronuclear single quantum correlation spectroscopy with improved sensitivity, Journal of
the American Chemical Society 114, 10663-10665.
22. Lipari, G., and Szabo, A. (1982) Model-free approach to the interpretation of nuclear
magnetic resonance relaxation in macromolecules. - Theory and range of validity, Journal of
the American Chemical Society 104, 4546-4559.
182
23. Lipari, G., and Szabo, A. (1982) Model-Free Approach to the Interpretation of Nuclear
Magnetic Resonance Relaxation in Macromolecules. - Analysis of Experimental Results,
Journal of the American Chemical Society 104, 4559-4570.
24. Morin, S., and Gagne, S. M. (2009) NMR dynamics of PSE-4 beta-lactamase: an interplay of
ps-ns order and µs-ms motions in the active site, Biophys J 96, 4681-4691.
25. MacKerell, A. D., Bashford, D., Bellott, M., Dunbrack, R. L., Evanseck, J. D., Field, M. J.,
Fischer, S., Gao, J., Guo, H., Ha, S., Joseph-McCarthy, D., Kuchnir, L., Kuczera, K., Lau, F.
T. K., Mattos, C., Michnick, S., Ngo, T., Nguyen, D. T., Prodhom, B., Reiher, W. E., Roux,
B., Schlenkrich, M., Smith, J. C., Stote, R., Straub, J., Watanabe, M., Wiorkiewicz-Kuczera,
J., Yin, D., and Karplus, M. (1998) All-Atom Empirical Potential for Molecular Modeling
and Dynamics Studies of Proteins, Journal of Physical Chemistry B 102, 3586-3616.
26. Brooks, B. R., Bruccoleri, R. E., Olafson, B. D., States, D. J., Swaminathan, S., and Karplus,
M. (1983) CHARMM: A program for macromolecular energy, minimization, and dynamics
calculations, Journal of Computational Chemistry 4, 187-217.
27. Fisette, O., Morin, S., Savard, P.-Y., Lague, P., and Gagne, S. M. (2010) TEM-1 backbone
dynamics-insights from combined molecular dynamics and nuclear magnetic resonance,
Biophys. J. 98, 637-645.
28. d'Auvergne, E. J., and Gooley, P. R. (2008) Optimisation of NMR dynamic models II. A new
methodology for the dual optimisation of the model-free parameters and the Brownian
rotational diffusion tensor, J Biomol NMR 40, 121-133.
29. d'Auvergne, E. J., and Gooley, P. R. (2008) Optimisation of NMR dynamic models I.
Minimisation algorithms and their performance within the model-free and Brownian
rotational diffusion spaces, J Biomol NMR 40, 107-119.
30. Assfalg, M., Banci, L., Bertini, I., Ciofi-Baffoni, S., and Barker, P. D. (2001) (15)N
backbone dynamics of ferricytochrome b(562): comparison with the reduced protein and the
R98C variant, Biochemistry 40, 12761-12771.
31. Volkman, B. F., Alam, S. L., Satterlee, J. D., and Markley, J. L. (1998) Solution structure
and backbone dynamics of component IV Glycera dibranchiata monomeric hemoglobin-CO,
Biochemistry 37, 10906-10919.
32. Bloom, M., Reeves, L. W., and Wells, E. J. (1965) Spin Echoes and Chemical Exchange, J.
Chem. Phys. 42.
33. Reddy, T., and Rainey, J. K. (2010) Interpretation of biomolecular NMR spin relaxation
parameters, Biochem Cell Biol 88, 131-142.
183
34. Goodman, J. L., Pagel, M. D., and Stone, M. J. (2000) Relationships between protein
structure and dynamics from a database of NMR-derived backbone order parameters, J Mol
Biol 295, 963-978.
35. Bidon-Chanal, A., Marti, M. A., Crespo, A., Milani, M., Orozco, M., Bolognesi, M., Luque,
F. J., and Estrin, D. A. (2006) Ligand-induced dynamical regulation of NO conversion in
Mycobacterium tuberculosis truncated hemoglobin-N., Proteins 64, 457-464.
36. Marsh, J. A., Singh, V. K., Jia, Z., and Forman-Kay, J. D. (2006) Sensitivity of secondary
structure propensities to sequence differences between alpha- and gamma-synuclein:
implications for fibrillation, Protein Sci 15, 2795-2804.
37. Baron, R., Riley, C., Chenprakhon, P., Thotsaporn, K., Winter, R. T., Alfieri, A., Forneris, F.,
van Berkel, W. J., Chaiyen, P., Fraaije, M. W., Mattevi, A., and McCammon, J. A. (2009)
Multiple pathways guide oxygen diffusion into flavoenzyme active sites, Proc Natl Acad Sci
U S A 106, 10603-10608.
38. Chen, L., Lyubimov, A., Brammer, L., Vrielink, A., and Sampson, N. (2008) The Binding
and Release of Oxygen and Hydrogen Peroxide Are Directed by a Hydrophobic Tunnel in
Cholesterol Oxidase., Biochemistry 47, 5368-5377.
39. Leroux, F., Dementin, S., Burlat, B., Cournac, L., Volbeda, A., Champ, S., Martin, L.,
Guigliarelli, B., Bertrand, P., Fontecilla-Camps, J., Rousset, M., and Léger, C. (2008)
Experimental approaches to kinetics of gas diffusion in hydrogenase., Proc Natl Acad Sci U
S A 105, 11188-11193.
40. Saam, J., Ivanov, I., Walther, M., Holzhütter, H.-G., and Kuhn, H. (2007) Molecular
dioxygen enters the active site of 12/15-lipoxygenase via dynamic oxygen access channels.,
Proc Natl Acad Sci U S A 104, 13319-13324.
41. Tomita, A., Sato, T., Ichiyanagi, K., Nozawa, S., Ichikawa, H., Chollet, M., Kawai, F., Park,
S. Y., Tsuduki, T., Yamato, T., Koshihara, S. Y., and Adachi, S. (2009) Visualizing
breathing motion of internal cavities in concert with ligand migration in myoglobin, Proc
Natl Acad Sci U S A 106, 2612-2616.
42. Ouellet, Y., Milani, M., Couture, M., Bolognesi, M., and Guertin, M. (2006) Ligand
interactions in the distal heme pocket of Mycobacterium tuberculosis truncated hemoglobin
N: roles of TyrB10 and GlnE11 residues, Biochemistry 45, 8770-8781.
43. Yeh, S. R., Couture, M., Ouellet, Y., Guertin, M., and Rousseau, D. L. (2000) A cooperative
oxygen binding hemoglobin from Mycobacterium tuberculosis. Stabilization of heme ligands
by a distal tyrosine residue, J Biol Chem 275, 1679-1684.
44. Trent, J. T., Kundu, S., Hoy, J. A., and Hargrove, M. S. (2004) Crystallographic analysis of
synechocystis cyanoglobin reveals the structural changes accompanying ligand binding in a
hexacoordinate hemoglobin., J Mol Biol 341, 1097-1108.
184
45. Vu, B. C., Nothnagel, H. J., Vuletich, D. A., Falzone, C. J., and Lecomte, J. T. (2004)
Cyanide binding to hexacoordinate cyanobacterial hemoglobins: hydrogen-bonding network
and heme pocket rearrangement in ferric H117A Synechocystis hemoglobin, Biochemistry
43, 12622-12633.
46. Falzone, C. J., Christie Vu, B., Scott, N. L., and Lecomte, J. T. (2002) The solution structure
of the recombinant hemoglobin from the cyanobacterium Synechocystis sp. PCC 6803 in its
hemichrome state, J Mol Biol 324, 1015-1029.
47. Hoy, J. A., Kundu, S., Trent, J. T., Ramaswamy, S., and Hargrove, M. S. (2004) The crystal
structure of Synechocystis hemoglobin with a covalent heme linkage., J Biol Chem 279,
16535-16542.
48. Morin, S., and S, M. G. (2009) Simple tests for the validation of multiple field spin relaxation
data, J Biomol NMR 45, 361-372.
185
Table 8.1 Average R1 and R2 relaxation rates (s-1
) and {1H}-
15N NOEs at 500, 600, and 800
MHz.
500 MHz 600 MHz 800 MHz
15N-R1 2.05 ± 0.16 1.22 ± 0.11 0.93 ± 0.12
15N-R2 12.43 ± 2.38 13.36 ± 2.76 Not Used*
{1H}-
15N NOE 0.66 ± 0.37 0.70 ± 0.31 0.77 ± 0.21
Mean value with associated SD for all the data available at three fields (101 residues).
*R2 acquired at 800 MHz were not used in our analysis as they were shown by consistency tests
(48) to be R2 from both 500 and 600 MHz. This was done in order to prevent artefactual
conclusions to be drawn from the data. More details are available in Supporting
Material (Annexe 3).
186
Figure 8.1 Structure of TrHbN displaying the four tunnels: Long tunnel (LT), Short tunnel (ST),
EH tunnel, and BE tunnel.
187
Figure 8.2 (A) Assigned 1H-
15N HSQC spectrum of TrHbN cyanomet, 0.7 mM, pH 7.5, acquired
at 600 MHz, 26.4°C. (B) Zoom of the most crowded region of the spectrum.
188
Figure 8.3 (Legend on next page)
189
Figure 8.3 (A-D) NMR raw relaxation data (R1, R2, R2/R1, NOE) at 500 (black solid circles), 600
(grey solid squares), and 800 (black solid triangles) MHz. (E-G) Model-free parameters (S2, Rex,
and τe) for TrHbN cyanomet. (H-I) Comparision of S2 parameters obtained either from NMR
(white solid squares) or MD simulations (black solid circles). (J-K) NMR amide exchange data:
amide exchanges rates (kex) at pH 7.5 (blue circles) and 8.5 (red squares), and free energy for the
opening of the protecting structure (ΔGHX) at pH 7.5. (L-M) Molecular Dynamics data: Average
backbone ASA and Backbone amide hydrogen bond occupancy calculated with various cutoffs
for the N-H acceptor bond distance. Cutoffs used are 2.0 Å (red), 2.2 Å (green), and 2.4 Å
(blue). (N-P) Secondary structure of TrHbN calculated by NMR (HN, N, CA, CB chemical
shifts used in the program SSP), MD, or taken from the X-ray structure PDB 1S61B (11).
190
Figure 8.4. Mapping of NMR experimental results on the structure of TrHbN. (A) Mapping of
the S2 values. (Figure legend on next page)
191
Figure 8.4 Mapping of NMR experimental results on the structure of TrHbN. (A) Mapping of the
S2 values. (B) Mapping of residues exhibiting slow motions (Rex term, model-free models m3
and m4) (red), two timescale motions (S2
f and S2s, m5) (blue) or fitted with simple models (S
2 or
S2-τe) (white). Gray residues represent residues for which no data were avalaible. (C) Mapping of
the free energy for the opening of the protecting structure (ΔGHX). Residues for which data is
unavailable (N-terminus, Pro, unassigned, ambiguous and overlapped) are colored gray, while
residues with exchange rates too fast (kex > 10-3
s-1
) and too slow (kex < 10-9
s-1
) to be
characterized are colored either blue or red.
192
Figure 8.5 Mapping of the chemical shift differences between the wild type and the Δpre-A
mutant. The cleaved region is shown in green.
193
9.
Chapitre 9
Experimental and Theoretical Investigations Reveal that
Mycobacterium tuberculosis Truncated Hemoglobin N
contains Multiple Diffusion Routes to Sustain Rapid
Gaseous Ligand Entry and Exit.
9.1. Résumé
L’hémoglobine tronquée N de Mycobacterium tuberculosis (TrHbN) catalyse efficacement
l’oxydation du •NO en nitrate selon la constante bimoléculaire k´NOD ≈ 745 × 106 M
-1·s
-1, soit
près de 15 fois plus efficace que la même réaction catalysée par la Mb extraite du myocarde du
cheval. Nous avons tenté d’identifier quels sont les aspects de la structure et/ou de la dynamique
de TrHbN lui conférant une telle réactivité. De récentes simulations de dynamique moléculaire
sur TrHbN sous sa forme oxygénée ont montré que le •NO peut accéder le site actif à travers
trois tunnels hydrophobes nommés LT, ST et EHT. Par contre, il n’existe encore aucune preuve
expérimentale supportant le rôle des différents tunnels chez TrHbN. Dans le présent travail, nous
avons construit des mutants dans lesquels un ou plusieurs tunnels sont obstrués près de la surface
de la protéine par des acides aminés de grande taille. Nous avons mesuré l’activité NOD de ces
mutants. Nos résultats ont montré une baisse maximale de l’activité dans le triple mutant, lequel
ayant les trois routes obstruées, confirmant que chacune d’elle est fonctionnelle pour la diffusion
des ligands. De plus, des mesures cinétiques sur le produit photodissocié de la forme met-•NO
révèlent une phase de recombinaison très rapide (nsec) qui n’est pas observée chez la forme
sauvage et qui est maximale chez le triple mutant. Pour tenter d’expliquer l’activité NOD
résiduelle mesurée dans le triple mutant (43% de celle de wt-TrHbN), des simulations de
dynamique moléculaire ont été réalisées en absence ou en présence de •NO. Ces simulations
révèlent que 1) l’ouverture des tunnels survient à des endroits proches de ceux observés chez wt-
TrHbN; 2) des routes non détectées auparavant se sont formées et que 3) des molécules de •NO
peuvent modifier la dynamique des chaînes latérales de manière à favoriser leur entrée et sortie.
194
Ensemble, nos résultats mettent l’emphase sur le rôle crucial des chaînes latérales et de leur
dynamique dans la diffusion des ligands chez TrHbN.
9.2. Abstract
Oxygenated Mycobacterium tuberculosis truncated hemoglobin N (TrHbN) catalyzes the rapid
oxidation of •NO to innocuous nitrate with a second-order rate constant
k´NOD ≈ 745 × 106 M
-1·s
-1, which is 15-fold faster than the reaction of horse heart Mb. We asked
what aspects of TrHbN structure and/or dynamics give rise to this enhanced activity. Recent
molecular dynamics simulations of TrHbN in the oxygenated form showed that •NO can access
the active site trough three hydrophobic tunnels termed LT, ST and EHT. However, no
experimental evidence has been provided yet to support the role of the different tunnels in
TrHbN. In the present work we constructed mutants in which one or more tunnels were
obstructed with bulky amino acids. We measured the NOD activity of these mutants. Our results
showed a maximal decrease in NOD activity in the triple mutant, with the three tunnels blocked,
confirming that all tunnels constitute a functional route for ligand diffusion. Furthermore, kinetic
measurements of the photoproduct of the •NO derivative of met-TrHbN mutants revealed a ns
geminate binding phase not observed in the wild-type protein, with maximal amplitude in the
triple mutant. To explain the residual extent of NOD reaction measured in the triple mutant (43%
of wt-TrHbN), MD simulations were performed in absence or presence of •NO. Data revealed
that: 1) opening of the tunnels occurred at sites close to those observed in wt-TrHbN; 2)
previously undetected pathways were formed and 3) •NO molecules could alter side-chain
dynamics and so favor their entry/exit. Altogether our results emphasize the crucial role of side-
chains dynamics in ligand diffusion in TrHbN.
195
9.3. Introduction
•NO plays an important role in host defense against microbial pathogens by inhibiting or
inactivating key enzymes such as the terminal respiratory oxidases [1-5] and the iron/sulfur
protein aconitase [6,7].
•NO also combines at near diffusion-limited rate with superoxide
produced by respiring cells to form the highly oxidizing agent peroxynitrite [8, 9]. •NO-
metabolizing reactions are thus required to defend microbial pathogens against •NO poisoning.
The truncated hemoglobin TrHbN from the pathogenic bacterium Mycobacterium tuberculosis
has a potent ability to detoxify •NO to nitrate (nitric oxide dioxygenase (NOD reaction)) and to
protect aerobic respiration from inhibition by •NO in stationary phase cells of M. bovis BCG.
TrHbN catalyses the rapid oxidation of •NO to innocuous nitrate (TrHbN-FeII(O2) + •NO →
TrHbN-FeIII
+ NO3-), with a second-order rate constant k´NOD ≈ 745 µM
-1 s
-1 (23 °C) [10], which
is more than one order of magnitude faster than in horse heart Mb and sperm whale Mb [10,11]
and close to that of a diffusion-limited reaction [12]. In this context, the aspects of the structure
and/or dynamics giving rise to this enhanced reactivity become a critical issue. A first step is to
expose the molecular mechanisms controlling ligand/substrate access to the DHP.
The first indications came from crystallographic studies of TrHbN which revealed the presence
of two hydrophobic tunnels, termed the Short (ST) and the Long (LT) tunnels, connecting the
DHP to distinct protein surface sites [13,14] (Fig. 9.1). These tunnels were proposed to constitute
gas diffusion pathways. In support, saturation of TrHbNFeIII
(CN-) crystals with xenon led to the
identification of five xenon binding sites (Xe sites) along these pathways (PDB 1S56) [15]. Two
binding sites are located along the LT (Xe1, Xe5), one at the ST entrance (Xe3), one where LT
and ST are merging (Xe2) and finally one site (Xe4) located outside the protein core at 5.4 Å of
Xe3. Of interest, Xe2 is the only site communicating with the DHP.
Afterwards, MD simulations with the oxygenated and deoxygenated form of TrHbN showed that
tunnels are not permanently open nor static features, but rather result from the dynamical
reshaping of hydrophobic cavities that temporarily interconnect due to side-chain flexibility [16].
In addition, two other tunnels were observed; the EH (EHT) and BE (BET) tunnels.
196
More recently, different simulation strategies have been employed to map the complete network
and energy profile of gas migration inside TrHbN. Mishra and Meuwly performed 24×2-ns
simulations of TrHbN containing one •NO molecule placed in each of the Xe sites as well as
inside another cavity located on the proximal side of the heme [17]. In contrast, Daigle et al.
performed 10×20-ns simulations of TrHbN(FeIIO2) including 10 •NO molecules starting in the
bulk solvent [18]. The latter study revealed that •NO interacts with TrHbN at specific surface
sites at tunnel entrances, composed of hydrophobic residues. Once inside the protein, •NO
diffuses rapidly from one cavity to another. Of interest, most of these cavities correspond to Xe
sites. The trajectories also indicated that •NO alters the dynamics of Ile119(H11) residue,
favoring the adoption of rotamers promoting ST opening. Similarly, Mishra and Meuwly
reported •NO diffusion through the ST, LT and EHT [17]. They also identified a new route
located between G and H helices, allowing communications with various cavities and the
solvent. This route is hereafter referred as the GH tunnel (GHT) (Fig. 9.1).
Altogether, these observations suggest that TrHbN tunnels have been specifically tailored to
afford efficient gas capture from solvent as well as to provide direct and efficient diffusion of
gases to the DHP. As a consequence, the bound O2 may remain optimally oriented and stabilized
by the active site residues Tyr(B10) and Gln(E11) for reaction with •NO [16].
Apolar tunnels or cavities are also observed in several other structures of proteins that bind the
gaseous molecules O2, •NO or H2 or catalyze reactions involving these gases [19-28]. In some
cases, these tunnels have also been saturated with xenon to demonstrate that a gas can diffuse
through a specific tunnel or multiple tunnels.
To this day, few studies have combined computational and experimental approaches to study the
functionality of channels in proteins. In enzymes where a single specific channel is observed,
mutagenesis data support a functional role [22,23, 29-33]. However, in proteins with multiple
predicted channels the conclusions differ depending on the enzyme investigated. Notably, in
12/15-lipoygenase only one path out of three predicted by implicit ligand sampling (ILS)
calculations was found to be effective in O2 delivery to the active site, the other two being
occupied by the substrate linoleic acid [22]. In copper-containing amine oxidase (COA) two
possible major pathways have been identified by ILS calculation [21]. These two paths merge
197
near the active site. Mutants intended to block individual routes for O2 in COA, resulted in little
perturbation of the kcat/ km ratios. These results were taken as evidence of the existence of other
multiple dynamic pathways [21]. Several channels have been observed in Cytochrome c oxidase
(CcO). One is hydrophobic and was predicted to serve for ligand diffusion. The other ones are
hydrophilic and were proposed to serve for water diffusion and proton transfer. In contrast to
COA a single mutation gly→val intended to block the hydrophobic tunnel slowed O2 and CO
binding by several orders of magnitude [23]. To explain this effect, the authors postulated that
CcO structure should be highly rigid near to mutation site, preventing formation of alternative
routes. Furthermore, this work demonstrated that only one major gas diffusion route exits in
CcO, the hydrophilic routes being obstructed by water molecules.
In the present work we investigated the NOD reaction catalyzed by TrHbN mutants with the LT
(Ala24(B1)Leu), ST (Ala95(G9)Ile) or EHT (Ala65(E18)Ile) entrance obstructed. Kinetic data
indicated that each tunnel can deliver •NO to the active site. Attempts to completely block the
access to the DHP as in the triple mutant ST/LT/EHT, resulted in a 3-fold reduction of NOD
reaction rate. In agreement, kinetic measurements on the photoproduct of the •NO derivative of
met-TrHbN mutants revealed a geminate binding phase not observed in the wild-type protein,
that was greatest in the triple mutant.
To understand residual NOD activity in the triple mutant, theoretical investigations were
performed. MD simulations revealed that 1) LT, ST and EHT were partially blocked due to side-
chain flexibility; 2) other pathways were formed and 3) •NO could modify side-chains dynamics
so as to favor tunnels opening. Our results emphasize the importance of the flexibility of side
chain in ligand diffusion.
9.4. Experimental procedures
Design of the mutations – Mutations were performed to close the entrance of the ST, LT or EHT
tunnels. Substitutions were designed so as to preserve the hydrophobic character and the
topology of the entrances, and to minimize changes in the dynamics of tunnels and of the DHP.
198
For LT, the entrance is mainly defined by backbone from the A-B and G-H loops. The only
available residue for mutagenesis is Ala24(B1), which was replaced by leucine. Entrances of ST
and EHT share common characteristics. They are found between two helices and are shaped by
side-chains from four hydrophobic residues. For the ST, only Ala95(G9) was found correctly
oriented for efficient blocking while for the EHT, only Ala65(E18) was correctly oriented. For
the ST and EHT, the targeted residue was replaced by an isoleucine. According to the crystal
structure and preliminary MD simulations, these mutations were found to optimally fill the
tunnel space and to avoid clashes with other residues.
Mutagenesis, expression and purification – Amino acid substitutions were carried out using the
QuickChange Site-Directed Mutagenesis kit (Stratagene) following the recommended protocol. Details on
mutagenesis are provided in Supporting Material (Annexe 4). The expression and purification of the
recombinant proteins were performed in accordance with the previously published method [34].
NOD reaction – NOD reactions were measured by stopped-flow spectrophotometry under single
turnover conditions as previously described [10]. Complete protocol is available in Supporting
Material (Annexe 4). The results shown in figures 9.2, 9.3, S1 and S2 (Annexe 4) are
representative of at least two experiments.
Flash-photolysis experiments – Laser flash-photolysis studies of the ferric NO complexes of the
different proteins were carried out as previously described [34]. An average of at least ten kinetic
traces from at least two separate experiments were averaged and analyzed with the instrument
manufacturer software (Applied Photolysis, U.K.) to obtain the rate constants. The fraction of
geminate rebinding was calculated as described in [35]. Plots showing absorbance changes
following •NO photolysis were obtained using the KaleidaGraph software (Synergy Software,
USA).
MD Simulations - The structure and dynamics of the ST/LT/EHT mutant, under the FeIIO2 form,
was studied by performing a 30 ns MD simulation. Simulations were performed using
CHARMM [36]. Simulations were performed as described in [16]. A complete description of the
simulation protocol is given as Supporting Material (Annexe 4).
System setup - The coordinates of the mutant were built from an equilibrated MD frame of wild-
type oxygenated TrHbN. Missing coordinates were built using the internal coordinates definition
199
of CHARMM. The first 5 ns were considered as the equilibration phase giving 25 ns in
production mode. The analysis of this simulation was performed in comparisons with two 30 ns
MD simulations of TrHbN presented earlier [16].
Evaluation of tunnel entrance openings – The method used to evaluate the opening of the
tunnel entrances is given as Supporting Material (Annexe 4).
Locally Enhanced Sampling – The locally enhanced sampling method (LES) [37] was
employed in this work to find out the more likely NO diffusion pathways in TrHbN and the triple
mutant. At the same time, these simulations allow to verify if •NO themselves have local impacts
on protein dynamics. This simulation technique allows replication of a given part of the system
to improve sampling. In this work, a •NO molecule was replicated. Each replicate is invisible to
each other but all of them interact with the rest of the system. The latter interactions are scaled
by a factor 1/N, where N is the number of replicates used. This factor, easing barrier crossing,
coupled with the high number of replicates favor the sampling. Ten 10-ns simulations, each
including ten •NO replicates, were run for both TrHbN and the triple mutant. In these
simulations, •NO molecules started in the DHP. Each system was built using snapshots from MD
simulations at equilibrium of the TrHbN or the triple mutant. The number of water molecule 5 Å
around the center of mass of each •NO was used as a probe to detect entry and exit events along
the trajectories. Each event was then studied visually using PyMOL [38].
Implicit ligand sampling – The •NO potential of mean force (PMF) inside TrHbN and the triple
mutant was determined using the implicit ligand sampling (ILS) method [39]. Details about
ligand parameters are given in [18]. ILS methods tends to overestimate PMF levels as they
increase, a tendency than can be counterbalanced with a higher sampling (see equation 12 from
ref [39]). For this reason, high energy barrier (PMF levels > 5 kcal/mol) could not be evaluated
precisely. PMF levels were evaluated using a sampling of all 25 000 MD frames. All PMF plots
are available in Supporting Material (Annexe 4, Fig. S5).
200
9.5. Results
9.5.1. NOD reaction of TrHbN.
(a) Kinetics of the reaction and comparison with reaction of Myoglobin and Leghemoglobin.
No intermediate was detected when TrHbNFeII(O2) was reacted with equimolar •NO at 23ºC, pH
7.5, the oxy complex being converted to aquomet TrHbNFeIII
(OH2) during the mixing time.
Similar results have been reported when HbAFeII(O2), sperm whale MbFe
II(O2) or plant
leghemoglobin LbFeII(O2) are reacted with equimolar •NO at 23 ºC, pH 7.5 [40, 41]. In contrast,
an intermediate species with UV-Vis spectral properties similar to that for a ferric high-spin
species could be detected when HbAFeII(O2) or MbFe
II(O2) were reacted under alkaline
conditions (pH 9.5). Fig. S1a (Annexe 4)shows the optical changes using our data obtained with
horse heart MbFeII(O2) (5 M) reacted with 5 M •NO at 5 ºC, pH 9.5, while Fig. S1b
(Annexe 4) depicts the first spectrum (417, 544 and 580 nm) recorded after mixing (1.3 ms).
This spectrum has maxima that are very close to those of MbFeII(O2) under equilibrium
conditions (418.6 , 544 and 581 nm) indicating that only a small fraction of the protein had
reacted during mixing time. Singular value decomposition (SVD) and global analysis allowed
fitting of the kinetic data to the model ABC. (Fig. S1c (Annexe 4), Table 9.1) UV-Vis
spectrum for each species is shown in Fig S1d. Species A, corresponding to MbFeII(O2), decays
rapidly (145 ± 3.6 s-1
) to an intermediate species B showing maxima at 411.9, 502, 540, 580 and
634 nm. This spectrum is similar in the visible region to that reported for HbA [40] and indicates
a ferric species with a pronounced LS character distinctly different from that of ferric Mb at pH
7.5 under equilibrium conditions. The ferric HS intermediate decays to the FeIII
(OH-)-form
(species C) at a rate of 27.3 ± 0.54 s-1
. Recent resonance Raman analysis of rapid freeze
quenched samples of the reaction of MbFeII(O2) + •NO at pH 9.5 (3 °C) identified the HS-
intermediate as a ferric nitrato complex (FeIII
(ONOO-) [42]. It is worth mentioning that the
optical spectrum of the nitrato-intermediate in Mb is different from that observed under
equilibrium conditions with a large excess of nitrate at pH 7.5 and likely represents a transient
FeIII
(ONOO-) complex. In contrast, the reaction of oxy plant leghemoglobin with •NO yields the
201
FeIII
(OH-)-form without the detection of an intermediate even under alkaline conditions (pH
9.5) [41].
We also examined the NOD reaction in TrHbN under alkaline conditions. Fig. 9.2a depicts the
evolution of the optical spectra acquired during the first 250 ms after mixing TrHbNFeII(O2) with
equimolar •NO at 5 ºC and pH 9.5. In contrast to Mb, the first spectrum obtained 1.3 ms after
mixing bears the signature of a HS species with peaks at 630 and 500 nm (Fig. 9.2b) indicating
that most of the oxy complex has reacted during the mixing time. SVD and global analysis
indicated that three optical species were necessary to fit the kinetic data (ABC) where
species A is TrHbNFeII(O2) (Fig. 9.3a and 9.3b; Table 9.1). Accordingly, TrHbNFe
II(O2)
decays very rapidly (1912 ± 54.2 s-1
) to a ferric HS intermediate (species B) showing maxima at
406, 503, 533 (sh), 570 (sh) and 635 nm. The associated rate is 14.4 fold faster than that
measured for horse heart Mb and is close to the value (16.2-fold) calculated previously from the
overall rate constants measured for these two proteins under pseudo first-order at pH 7.5 and 23
°C [10]. The HS intermediate decays to the FeIII
(OH-)-form expected at this pH (species C) (411,
543, 576 and 607 (sh)) at a rate of 22.72 ± 0.76 s-1
(Fig. 9.4 and Table 9.1). The optical spectrum
of the HS intermediate is very similar to that of TrHbNFeIII
(OH2) or TrHbNFeIII
(ONOO-)
complexes at pH 7.5 under equilibrium conditions (406, 502, 542 (sh), 581 (sh) and 632 nm), the
latter’s being almost identical. We propose that the observed HS species at pH 9.5 may be either
the TrHbNFeIII
(ONOO-) as in Mb or TrHbNFe
III(OH2) complex. In agreement, theoretical
calculations by Mishra and Meuwly [43] predicted a reaction time too fast to be measured by
stopped-flow experiments. However, additional investigations are required to determine whether
the intermediate at pH 9.5 is the nitrato or the aquo form.
(b) The ST, EHT and LT all deliver •NO to the heme bound O2 in the NOD reaction. To
investigate the role of the tunnels in the NOD reaction TrHbN, mutants with the LT, ST and
EHT entrance obstructed were produced (see experimental procedures). UV-Vis optical spectra
and resonance Raman spectra of the different mutants were identical to those of the TrHbN,
which indicated that blocking the different entrances did not perturb the heme bound O2
complexes (unpublished results). Reactions took place upon turnover of one stoichiometric
equivalent of •NO under alkaline conditions at 5 ºC as for TrHbN.
202
Three optical species were found necessary to fit kinetic data of all TrHbN mutants with species
A being assigned to their respective oxy forms (Fig. 9.3 a, c and e, only WT, ST/LT and
ST/LT/EHT spectra and kinetic traces are depicted for the sake of clarity). In all cases, the
optical spectrum of species B was nearly identical to the intermediate in TrHbN indicating that
mutations did not perturb the reaction. As shown in Table 9.1, the rates associated with the
decay of the oxygenated complexes (k1) indicated that •NO access to the DHP was impeded in
all mutants and that the extent of inhibition increased as more tunnels were blocked. In
agreement, the spectrum at 1.3 ms in the ST/LT/EHT mutant had a significant LS character (409,
544 and 582 nm) relative to that of TrHbN (Fig. S2), indicating a mixture of TrHbNFeII(O2)
(416, 545 and 582 nm) and the HS intermediate. The remaining activity measured in the triple
mutant is noteworthy and suggests that tunnels are either partially blocked or that other pathways
have been used to access the DHP. The lower k2 values in LT mutants (Table 9.1), indicate that
LT could play a role in the exit of intermediate (H2O or NO3-) or an entryway for the hydroxyl
anion.
9.5.2. Mutants with obstructed tunnel entrance(s) show ns geminate rebinding
of the •NO.
We recently used flash photolysis of ferric TrHbN bound with •NO to study the kinetics of water
and •NO binding to the heme iron in TrHbN [34]. Photodissociation of the FeIII
(•NO) complex
leaves the heme distal site in a ferric dehydrated state 5c (FeIII
) [43]. After •NO escape, a water
molecule enters the DHP and binds very rapidly (≤ 10 ns) to the heme iron forming the 6c HS
aquomet state FeIII
(OH2). Subsequently, on a much longer time scale, a •NO coming from the
solvent displaces the bound water molecule and combines with the iron atom to form the
FeIII
(•NO) species. Fig. 9.4 shows the normalized kinetic traces obtained for TrHbN, ST, LT/ST
and ST/LT/EHT mutants when the reaction is monitored at 392 nm (23 °C) the wavelength
corresponding to the isosbestic point of the optical spectra of the 5c (FeIII
) and FeIII
(OH2). The
increase in absorbance corresponds to the formation of the 5c (FeIII
) species. In TrHbN, this
initial kinetic phase is followed by a plateau that is attributed to the long lived FeIII
(OH2) species
(the formation of the FeIII
(OH2) species cannot be measured at this wavelength). The bound
203
water is eventually displaced by •NO coming from the bulk solvent leading to a decrease in
absorbance (not shown; (see ref [34]). In contrast, all mutants, except the LT, showed an
additional kinetic phase (very rapid decrease in absorbance (≤ 10 ns)), which represents geminate
rebinding of •NO. The fraction of geminate recombination, Fgem increased markedly in going
from ST (0.43), ST/LT (0.49) to the ST/LT/EHT (0.75) mutant. The Fgem for TrHbN and LT
mutant could not be measured indicating that the rate of ligand escape must be much larger than
the rate of internal bond formation to the 5c (FeIII
). Similar observations were made when CO
recombination was measured subsequent to photodissociation of TrHbNFeII(CO) [34].
Altogether kinetic measurements on the photoproduct of the •NO derivative of met-TrHbN
mutants and on their NOD activity (Table 9.1) indicated that the ST, LT and EHT are routes for
gas entry and exit. Both also indicated that some route(s) for •NO diffusion still exist in the triple
mutant.
9.5.3. MD simulations emphasize the importance of side-chain flexibility on
ligand diffusion
The extent of inhibition of the NOD reaction measured in the triple mutant suggested that
obstruction of the tunnel entrances was either incomplete or that other pathways may have been
used to access DHP. To verify these hypotheses, theoretical calculations were performed on the
triple mutant. Two approaches were used. In the first approach, a 30-ns MD simulation of the
mutant in the FeII(O2) form was carried out. This simulation allowed us to measure the impacts
of the mutations on the conformation and dynamics of the tunnels and the DHP. This trajectory
also served to calculate the potential of mean force (PMF) for •NO diffusion inside the mutant
using the implicit ligand sampling method [39]. In the second approach, •NO diffusion inside the
mutant and TrHbN was investigated from 10×10-ns simulations using the locally enhanced
sampling method [37]. The latter method allowed to determine the more likely pathways used by
•NO to exit out of the protein matrix.
204
(I) Equilibrium MD simulations
(a) Effects of the mutations on the opening of the tunnel entrances - All mutated side chains
were found to adopt various rotamers along the trajectory (Table S1). Plots showing side-chain
dihedral fluctuations are available in Supporting Material (Annexe 4, Fig. S3). However, even
with this flexibility, tunnel-solvent communications were dramatically reduced for the triple
mutant compare to TrHbN (Table 9.2). For instance, no opening of the ST was observed.
Accordingly, PMF calculations revealed a high energy barrier at the ST entrance compare to
TrHbN (Fig. 9.5b). For the EHT, one opening event was detected, which was promoted by the
simultaneous displacement of the side-chain of Ile65(H18), Leu118(H10) and Val122(H14) (Fig.
9.6b). Because of this side-chain flexibility, PMF calculations revealed a weak energy barrier of
+4.6 kcal/mol +0.3/-2.4 kcal/mol. (Fig. 9.5c). Communications between LT and solvent were
more frequent (29 isolated MD frames). These opening events were caused by two distinct
movements of the protein. In the first movement, Leu24(B1) adopted rotamers mm and mt
(Table S1, Fig. S3), which caused Leu24(B1) to flip into the solvent resulting in the opening of
the LT entrance Fig. 9.6a). The second movement opening the LT entrance corresponds to the
displacement of the N-terminal end of the B-helix toward the solvent. This motion, modest
regarding Cα position (amplitude of about 2 Å),displaces Leu24(B1) side chain toward the
solvent sufficiently to open LT. Because of these open conformations, PMF calculations revealed
a small increase in PMF levels (up to +2.2 kcal/mol ±0.6 kcal/mol) near the surface. Limiting
PMF calculations to the “closed conformations”, which account for more than 92% of the time,
revealed that the mutation efficiently blocks LT in these circumstances (Fig. 9.5a, red curve).
(b) Impacts of mutations on residue forming tunnels and DHP – Dynamics of all tunnel
residues were studied and results are given in Supporting Material figures S3 and S4 (Annexe 4)
show plots of side chain dihedrals over time and give rotamer populations. Table S2 (Annexe 4)
summarizes interaction between all residues shaping the tunnels. Among these residues, six
showed a modified behavior in the mutant (side chain dynamics or rotamer populations)
(Ile15(A11), Ile19(A15), Ile25(B2), Phe62(E15), Val118(H10) and Ile119(H11)) and two
showed new rotamers (Ile15(A11) and Ile119(H11)). Only changes in behavior of residues
Phe62(E15) and Ile119(H11) resulted in a modification of tunnel dynamics.
205
Phe62(E15) - Previous theoretical investigations of TrHbN emphasized the importance of
Phe62(E15) on ligand diffusion in the LT and EHT [16, 18, 44, 45]. In the mutant, the change in
dynamics of Phe62(E15) is characterized by the more frequent t80 rotamer over rotamers m30
and m-85 (Table S1, Fig. S4 l). In TrHbN, this preference is inverted. This is due to changes in
Ile25(B2) dynamics, the latter residue being located between Leu24(B1) and Phe62(E15). The
main consequence of this change is a more frequent communication between Xe5↔Xe2 and
EHc↔Xe2 cavities. On the other hand, communications between Xe1 and Xe5 communications
are less frequent (Fig. 9.1, purple arrow). No other diffusion route was created by this
modification.
Ile119(H11) – Part of the ST and EHT are defined by Ile119(H11). Changes in dynamics and
conformations of Ile119(H11) side chain were characterized by the adoption of rotamers tt and tp
(5.6%), which are mostly unpopulated (< 0.1%) in TrHbNFeII(O2) simulations (Table S1,
Fig. S4w). These rotamers favor the EHc ↔ GHc communication (part of GHT tunnel)
(Fig. 9.1)
(c) Formation of additional diffusion pathways - In addition to ST, LT and EHT, two additional
diffusion pathways were observed in the triple mutant: the GHT and a new path hereafter termed
EH2 tunnel (EH2T). GHT extends from the EHc to an apolar cavity (GHc) located between G
and H helices (Fig. 9.1). Residues Ala99(G13), Ile112(H4) and Leu116(H8) separate GHc from
the solvent. Residues Leu98(G12), Leu102(G16), Ile115(H7) and Ile119(H11) separate GHc
from the protein core. For TrHbN as well as for the mutant, GHc is occasionally open to the
solvent (Table 9.2). Solvent exposure is promoted by the flexible Leu116(H8) side chain
(Fig. 9.6c). In TrHbN, PMF calculations revealed very high energy barriers between GHc and
the neighbouring cavities (Xe1, Xe3 and EHc) indicating that the communication with other
tunnels is limited (Fig. 9.5). As previously mentioned, energy barrier separating GHc and EHc is
dramatically lowered in the triple mutant (Fig. 9.5).
The second diffusion route, the EH2T, also originates from the EHc and passes through a cavity
located on the proximal side of the heme. Tunnel EH2T has its surface entry located between the
E and H helices and is defined by side chain from residues Phe61(E14), Met77(F4) and
Leu122(H14). Evaluation of the PMF levels along the EH2T revealed that this route is the less
206
favorable with higher energy barriers, especially between the heme and the solvent. However,
the heights of these barriers are lowered in the triple mutant (Fig. 9.5e).
(d) Impacts of mutations on the DHP – In agreement with UV-Vis optical and resonance
Raman spectroscopy analysis of the FeIIO2 complexes of the triple mutant and TrHbN, the
conformations and dynamics of the residues shaping the DHP were found unchanged relative to
TrHbN along the mutant trajectory (Fig. S4 f to j).
(II) Locally enhanced sampling
(a) ST, LT and EHT as the main diffusion routes in TrHbN - For all TrHbN simulations, all
•NO molecules rapidly migrated out of the protein matrix, with more than 80% of the •NO
molecules having left within the first 2 ns (Fig. S6, green). Trajectories of •NO diffusion inside
TrHbN are shown in Fig. S7. •NO molecules exited mainly by the ST > LT > EHT (Table 9.3).
Also, five •NO exited by GHT. In the latter case •NO reached GHc from the ST through a
limited opening between Leu98(G12), Leu116(H8) and Ile119(H11). These events were not
expected given the high energy barrier between ST and GHc. The LES method, lowering energy
barrier, may have favored these events. However, upon •NO passage from ST to GHc,
Leu116(H8) was displaced causing the enlargement of the passage indicating that •NO may have
favored this displacement.
Several entries inside the protein matrix were also observed (Fig. S6, blue). Interestingly, a
single entry event by the BET was observed (Fig. 9.1). However, the later molecule returned by
the same route after 80 ps. These results agreed well with our previous work, which predicted the
ST, LT and EHT as the main diffusion routes [18]. In the latter work, simulations showed a
similar tunnel usage for •NO entry and exit (Occurrences from a total of 200 ns simulation time:
Entries : ST (20) > LT (13) > EHT (9), Exits : ST (13) > LT (7) > EHT (3) [18].
(b) Triple mutant partial blockade of the tunnels, other diffusion routes and the influence of
•NO – While more than 80% of the •NO molecules had reached the solvent within the first 2 ns
in TrHbN, only 47% exited the mutant within 10 ns indicating that although significantly
blocked the tunnels still allowed entry and exit of •NO (Table 9.3, Fig. S6 and S7b). As shown
in Table 9.3, the LT (15×), GHT (15x) and EHT (12×) were the most used routes. The ST was
207
used only three times. Exits by ST were not expected giving the very high energy barrier
calculated at the ST entrance (Fig. 9.5) and the absence of open conformation in the equilibrium
MD simulation (Table 9.2). However, detailed analysis of LES simulations (100 000 frames)
showed twelve MD isolated frames with an open ST (Table 9.2). These openings occurred
following the simultaneous displacement of the side chains defining ST entrance and without
these adopting non-previously observed rotamers (Fig. 9.6, d). Remarkably, eleven opening
events took place simultaneously with either an •NO exit or happened while a •NO was in
contact with ST surface residues (Table 9.3) indicating that the presence of •NO may impact
tunnel opening. The more frequent usage of LT and EHT was consistent with PMF calculations,
which had revealed lower energy barriers at the entrance relatively to ST (Fig. 9.5). For the EHT,
•NO diffusion was constrained by a narrow passage between Phe61(E14) and Leu122(H14). The
side-chain flexibility of Ile65(E18) and Leu122(H14) contributed to these exits. In the case of the
LT, transient displacements of Leu24(B1) side chain allowed •NO diffusion as in TrHbN. This
open conformation was also observed in the simulation in absence of •NO molecule (rotamers
mm and mt, Fig. 9.6, a and Table 9.2). As for ST, opening events at LT or EHT entrances were
more frequent in LES simulations than in MD simulations highlighting the impact of ligand
molecules on side-chain dynamics. A high percentage of these opening events were observed
while at least one •NO was near the mutated side chain (Table 9.2).
As mentioned before, frequent exits occurred via GHT in the triple mutant (Table 9.3). In all
cases •NO transited through the GHc before leaving the protein. In eleven events out of fifteen
•NO came from the EHc, through a passage enlarged by the displacement of Ile119(H11) side
chain (rotamers tt and tp). In the four other cases, •NO reached GHc from the Xe1 cavity through
a path opened by a transient displacement of Leu102(G16) (rotamer mt→tp). This motion of
Leu102(G16) is absent in equilibrium simulations without •NO (wild-type and mutant)
suggesting that •NO triggered the displacement of this residue. Solvent-GHc communications
were much more frequent in LES simulations (wt and mutant) than in equilibrium MD
simulations (Table 9.2) and were dependent on the conformation of Leu116(H8) side chain,
which is enhanced upon adoption of rotamers tt or tp (Fig. 9.6). In agreement, when a •NO is
docked in GHc, these rotamers account for 64.7% of the time compare to 5.6% in absence of
•NO.
208
9.6. Conclusions
Prior to this work, i.e. about 10 years following trHbN discovery and the elucidation of its
structure, there was no experimental proof demonstrating the functional role of trHbN tunnels. In
the other hand, many theoretical works were conducted by several teams around the world and
all of them share a common major conclusion: ligands diffuse through the tunnels. In the present
work, the modest effects of the mutations on geminate recombination kinetics as well as NOD
reactions are challenging our precedent theoretical understanding. However, the new
experimental data do not lead us to the conclusion that trHbN tunnels do no support ligand
diffusion. Intead, they surely told us that there is still much to discover and they cleary warns
that trHbN is a complexier protein than expected. To support this view, several hypotheses are
proposed to reconcile experiments in the discussion section of this thesis.
209
9.7. References
1. Brunori, M., Nitric oxide, cytochrome-c oxidase and myoglobin. Trends in Biochemical
Sciences, 2001. 26(1): p. 21-23.
2. Brunori, M., et al., Nitric oxide and cellular respiration. Cell Mol Life Sci, 1999. 56(7-8):
p. 549-57.
3. Stevanin, T.M., et al., Flavohemoglobin Hmp affords inducible protection for Escherichia
coli respiration, catalyzed by cytochromes bo' or bd, from nitric oxide. J Biol Chem,
2000. 275(46): p. 35868-75.
4. Cleeter, M.W., et al., Reversible inhibition of cytochrome c oxidase, the terminal enzyme
of the mitochondrial respiratory chain, by nitric oxide. Implications for neurodegenerative
diseases. FEBS Lett, 1994. 345(1): p. 50-4.
5. Brown, G.C. and C.E. Cooper, Nanomolar concentrations of nitric oxide reversibly
inhibit synaptosomal respiration by competing with oxygen at cytochrome oxidase. FEBS
Lett, 1994. 356(2-3): p. 295-8.
6. Gardner, P.R., G. Costantino, and A.L. Salzman, Constitutive and Adaptive
Detoxification of Nitric Oxide in Escherichia coli. Role of nitric-oxide dioxygenase in
the protection of actonitase. J. Biol. Chem., 1998. 273(41): p. 26528-26533.
7. Gardner, P.R., et al., Nitric Oxide Sensitivity of the Aconitases. J. Biol. Chem., 1997.
272(40): p. 25071-25076.
8. Kissner, R., et al., Formation and Properties of Peroxynitrite as Studied by Laser Flash
Photolysis, High-Pressure Stopped-Flow Technique, and Pulse Radiolysis. Chem. Res.
Toxicol., 1997. 10(11): p. 1285-1292.
9. Pfeiffer, S., et al., Metabolic Fate of Peroxynitrite in Aqueous Solution. Reaction with
nitric oxide and pH-dependent decomposition to nitrite and oxygen in a 2:1 stoichimetry.
J. Biol. Chem., 1997. 272(6): p. 3465-3470.
10. Ouellet, H., et al., Truncated hemoglobin HbN protects Mycobacterium bovis from nitric
oxide. Proc Natl Acad Sci U S A, 2002. 99(9): p. 5902-7.
11. Scott, E.E., Q.H. Gibson, and J.S. Olson, Mapping the pathways for O2 entry into and exit
from myoglobin. Journal of Biological Chemistry, 2001. 276(7): p. 5177-5188.
12. Huie, R.E. and S. Padmaja, The Reaction of NO with Superoxide. Free Radical Research
Communications, 1993. 18(4): p. 195-199.
13. Milani, M., et al., Mycobacterium tuberculosis hemoglobin N displays a protein tunnel
suited for O2 diffusion to the heme. EMBO J, 2001. 20(15): p. 3902-9.
210
14. Milani, M., et al., Cyanide binding to truncated hemoglobins: a crystallographic and
kinetic study. Biochemistry, 2004. 43(18): p. 5213-21.
15. Milani, M., et al., Heme-ligand tunneling in group I truncated hemoglobins. J Biol Chem,
2004. 279(20): p. 21520-5.
16. Daigle, R., M. Guertin, and P. Lague, Structural characterization of the tunnels of
Mycobacterium tuberculosis truncated hemoglobin N from molecular dynamics
simulations. Proteins-Structure Function and Bioinformatics, 2009. 75(3): p. 735-747.
17. Mishra, S. and M. Meuwly, Nitric oxide dynamics in truncated hemoglobin: docking
sites, migration pathways, and vibrational spectroscopy from molecular dynamics
simulations. Biophys J, 2009. 96(6): p. 2105-2018.
18. Daigle, R., et al., Theoretical Investigations of Nitric Oxide Channeling in
Mycobacterium tuberculosis Truncated Hemoglobin N. Biophysical Journal, 2009.
97(11): p. 2967-2977.
19. Baron, R., et al., Multiple pathways guide oxygen diffusion into flavoenzyme active sites.
Proceedings of the National Academy of Sciences of the United States of America, 2009.
106(26): p. 10603-10608.
20. Montet, Y., et al., Gas access to the active site of Ni-Fe hydrogenases probed by X-ray
crystallography and molecular dynamics. Nat Struct Biol, 1997. 4(7): p. 523-526.
21. Johnson, B.J., et al., Exploring molecular oxygen pathways in Hansenula polymorpha
copper-containing amine oxidase. J Biol Chem, 2007. 282(24): p. 17767-17776.
22. Saam, J., et al., Molecular dioxygen enters the active site of 12/15-lipoxygenase via
dynamic oxygen access channels. Proc Natl Acad Sci U S A, 2007. 104(33): p. 13319-
13324.
23. Salomonsson, L., et al., A single-amino-acid lid renders a gas-tight compartment within a
membrane-bound transporter. Proceedings of the National Academy of Sciences of the
United States of America, 2004. 101(32): p. 11617-11621.
24. Igarashi, R.Y. and L.C. Seefeldt, Nitrogen fixation: the mechanism of the Mo-dependent
nitrogenase. Crit Rev Biochem Mol Biol, 2003. 38(4): p. 351-384.
25. Volbeda, A. and J.C. Fontecilla-Camps, Crystallographic evidence for a CO/CO2 tunnel
gating mechanism in the bifunctional carbon monoxide dehydrogenase/acetyl coenzyme
A synthase from Moorella thermoacetica. J Biol Inorg Chem, 2004. 9(5): p. 525-532.
26. Pesce, A., et al., The 109 residue nerve tissue minihemoglobin from Cerebratulus lacteus
highlights striking structural plasticity of the alpha-helical globin fold. Structure, 2002.
10(5): p. 725-735.
211
27. Hiromoto, T., et al., Crystal structure of 3-hydroxybenzoate hydroxylase from
Comamonas testosteroni has a large tunnel for substrate and oxygen access to the active
site. J Mol Biol, 2006. 364(5): p. 878-896.
28. Pesce, A., et al., Reversible hexa- to penta-coordination of the heme Fe atom modulates
ligand binding properties of neuroglobin and cytoglobin. IUBMB Life, 2004. 56(11-12):
p. 657-664.
29. Chen, L., et al., The Binding and Release of Oxygen and Hydrogen Peroxide Are
Directed by a Hydrophobic Tunnel in Cholesterol Oxidase. Biochemistry, 2008. 47(19):
p. 5368-5377.
30. Tan, X.S., et al., The tunnel of acetyl-coenzyme a synthase/carbon monoxide
dehydrogenase regulates delivery of CO to the active site. Journal of the American
Chemical Society, 2005. 127(16): p. 5833-5839.
31. Tan, X., et al., Function of the tunnel in acetylcoenzyme A synthase/carbon monoxide
dehydrogenase. J Biol Inorg Chem, 2006. 11(3): p. 371-378.
32. Riistama, S., et al., Channelling of dioxygen into the respiratory enzyme. Biochim
Biophys Acta, 1996. 1275(1-2): p. 1-4.
33. Riistama, S., et al., Binding of O2 and its reduction are both retarded by replacement of
valine 279 by isoleucine in cytochrome c oxidase from Paracoccus denitrificans.
Biochemistry, 2000. 39(21): p. 6365-6372.
34. Ouellet, Y.H., et al., Ligand binding to truncated hemoglobin N from Mycobacterium
tuberculosis is strongly modulated by the interplay between the distal heme pocket
residues and internal water. J Biol Chem, 2008. 283(40): p. 27270-8.
35. Salter, M.D., et al., The apolar channel in cerebratulus lacteus hemoglobin is the route for
O2 entry and exit. J Biol Chem, 2008. 283(51): p. 35689-35702.
36. Brooks, B.R., et al., CHARMM: A program for macromolecular energy, minimization,
and dynamics calculations. Journal of Computational Chemistry, 1983. 4(2): p. 187-217.
37. Elber, R. and M. Karplus, Enhanced sampling in molecular-dynamics - Use of the time-
dependent Hartree approximation for a simulation of carbon-monoxide diffusion through
myoglobin. Journal of the American Chemical Society, 1990. 112(25): p. 9161-9175.
38. DeLano, W.L., The PyMOL Molecular Graphics System. 2002.
39. Cohen, J., et al., Imaging the migration pathways for O2, CO, NO, and Xe inside
myoglobin. Biophys J, 2006. 91(5): p. 1844-57.
40. Eich, R.F., et al., Mechanism of NO-induced oxidation of myoglobin and hemoglobin.
Biochemistry, 1996. 35(22): p. 6976-6983.
212
41. Herold, S. and A. Puppo, Oxyleghemoglobin scavenges nitrogen monoxide and
peroxynitrite: a possible role in functioning nodules? Journal of Biological Inorganic
Chemistry, 2005. 10(8): p. 935-945.
42. Yukl, E.T., S. de Vries, and P. Moenne-Loccoz, The Millisecond Intermediate in the
Reaction of Nitric Oxide with Oxymyoglobin is an Iron(III)-Nitrato Complex, Not a
Peroxynitrite. Journal of the American Chemical Society, 2009. 131(21): p. 7234-7235.
43. Mishra, S. and M. Meuwly, Atomistic Simulation of NO Dioxygenation in Group I
Truncated Hemoglobin. Journal of the American Chemical Society, 2010. 132(9): p.
2968-2982.
44. Crespo, A., et al., Theoretical study of the truncated hemoglobin HbN: exploring the
molecular basis of the NO detoxification mechanism. J Am Chem Soc, 2005. 127(12): p.
4433-44.
45. Bidon-Chanal, A., et al., Ligand-induced dynamical regulation of NO conversion in
Mycobacterium tuberculosis truncated hemoglobin-N. Proteins, 2006. 64(2): p. 457-64.
213
9.8. Footnotes
We are grateful to Dr. Beatrice A. Wittenberg and Dr. Jonathan B. Wittenberg from the Albert
Einstein College of Medicine (NY, USA) for insightful discussions. This work was supported by
the National Sciences and Engineering Research Council (NSERC) grant 46306-01 and the
Fonds Québécois de la Recherche sur la Nature et les Technologies (FQRNT) grant 104897 to
Dr. Michel Guertin. Patrick Lagüe is supported by the Canadian Foundation for Innovation (CFI)
grant 12428 and the Fonds Québécois de la Recherche sur la Nature et les Technologies
(FQRNT) grant 104897.
The abbreviations used are: BCG, bacillus Calmette-Guérin; DHP, distal heme pocket, Hb,
hemoglobin; HS, high spin; LS, low spin; ILS, implicit ligand sampling; LES, locally enhanced
sampling; Mb, myoglobin; TrHb, truncated hemoglobin; TrHbN, Mycobacterium tuberculosis
truncated hemoglobin N; ST. short tunnel; LT, long tunnel; EHT, EH tunnel, BET, BE tunnel,
GHT, GH tunnel; MD, molecular dynamics; QM-MM, quantum mechanics-molecular
mechanics.
214
Table 9.1 Kinetics constants for the NOD reactions of TrHbN and its tunnel mutants.
Protein
A → B B → C
k1 k2
s-1
± s-1
±
TrHbN 1902 54 22.7 0.2
LT 1751 55 15.2 0.1
ST 1383 25 19.0 0.1
LT/ST 1034 20 12.5 0.1
LT/ST/EHT 814 56 13.7 0.3
Horse heart Mb 145 4 27.3 0.5
215
Table 9.2 Number of MD snapshots showing a tunnel open at its entrance from simulations
of TrHbN and the triple mutant.
Tunnel
Opening Events †
wt-TrHbN Wt-TrHbN + •NO Triple mutant Triple mutant +
•NO†
LT 34116 21719 (29%) 29 811 (65%)
ST 1452 1276 (74%) 0 12 (92%)
EHT 2550 1485 (48%) 1 177 (96%)
GHT 30 422 (32%) 8 1678 (41%)
† Based on a 100 ns sampling for the sake of comparisons. Numbers for snapshots without
•NO are doubled for wt-TrHbN and quadrupled for the mutant
216
Table 9.3 Exit and entry events observed in LES simulations of the wild type and triple
mutant.
Tunnel
Wild type Triple mutant
Exit Entry Exit Entry
ST 68 29 3 0
LT 67 26 15 4
EHT 22 7 12 1
BET 1 1 0 0
GHT 5 2 15 0
EH2T 0 0 2 0
217
Figure 9.1 TrHbN tunnel system. Xenon binding sites and cavities are identified by pale
yellow spheres. Communications between solvent and tunnels are identified by cyan
arrows. Helices are identified by corresponding letters. Cavity communications forming
along each tunnels are summarized below the picture. The picture was produced using
PyMOL (38)
218
Figure 9.2 Reaction of TrHbNFeII(O2) (5 µM) with one equivalent of •NO at 5 ºC, pH 9.5.
(a) Evolution of the optical spectra acquired during the first 250 ms and collected on time
scales ranging from 1.3 ms (red line) to 250 ms (blue line) with an integration time of 2.5
ms. Abs, absorbance units. (b) UV-V spectrum of first spectrum obtained 1.3 ms after
mixing bearing the signature of a HS species with peaks at 500 and 630 nm.
219
Figure 9.3 Reaction of the FeII(O2) form (5 µM) of TrHbN (a, b) and tunnel mutants LT/ST
(c, d) and LT/ST/EHT (e, f) with one equivalent of •NO at 5 ºC, pH 9.5. (a, c and e), optical
spectra of the species obtained by singular value decomposition and global analysis of the
rapid scan data from (a): Species A (oxygenated form, red), species B (intermediate
species, black) and species C (hydroxyl form, blue). Abs: absorbance. (b, d and f), the
reaction of oxidation of the different proteins by •NO was well described using a double
exponential function (ABC). The kinetics at 433 nm (black) and the fit (red) are
shown. Note the appearance of peaks at 500 and 630 nm for c and e panels.
220
Figure 9.4 Kinetic traces illustrating the absorbance changes after photo-dissociation of (a)
TrHbNFeIII
(•NO), (b) ST-FeIII
(•NO), (c) LT/ST-FeIII
(•NO), and (d) LT/ST/EHT-FeIII
(•NO)
at 23 °C. The reaction was monitored at 392 nm, this wavelength corresponds to the
isosbestic point of the optical spectra of the 5c (FeIII
) and FeIII
(OH2) species of the different
proteins. The rapid decrease in absorbance observed in the mutants corresponds to
geminate •NO rebinding.
221
Figure 9.5 PMF profiles for •NO diffusion in the different tunnels for the TrHbN (blue) and
mutant (black). Shaded gray zones correspond to tunnel region filled by the mutations.
PMF profiles were calculated for tunnels LT (a), ST (b), EHT (c), GHT (d) and EH2 (e).
For LT (a), profile in red was calculated for the mutant without Ala24(B1) mm and mt
rotamers. For tunnel passing by GHc (d), profile in red was calculated mutant without
Ile119(H11) rotamers tt and tp. To highlight Xe1, Xe2, Xe5 cavities along LT, PMF was
calculated depending on Phe62(E15) conformations (rotamers t80 or m30/m-85) and only
rotamer t80 is shown here for picture clarity. PMF profiles calculated with m-85 and m30
rotamers are available in Supporting Material. Errorbars, depending on calculated PMF
levels, are not shown for picture clarity (see method).
222
Figure 9.6 Typical closed (left) and open (right) tunnels at the surface observed for the
triple mutant protein. The mutated residues are colored in green. (a) LT : Opening coupled
with displacement of Leu24(B1) (green). (b) EHT : Opening coupled with displacement of
Ile65(E18) (yellow), Val118(H10) and Leu122(H14) (c) GHc : Opening coupled with
displacement of Leu116(H8) (yellow). (d) ST : Opening coupled with displacement of all
surface residues and observed while a •NO was nearby.
223
10.
Chapitre 10
Discussion
Les travaux concernant la présente thèse de doctorat visaient à étudier la structure et la
dynamique de TrHbN à l’aide d’outils bio-informatiques. Ces travaux ont permis d’étudier
plusieurs aspects de TrHbN, notamment la structure et la dynamique du site actif, du
squelette et des tunnels de l’enzyme. Également, le rôle des tunnels dans la diffusion des
substrats gazeux a été étudié. Ces travaux théoriques ont bénéficié d’un appui expérimental
grâce à des travaux en spectroscopie RMN en solution et à l’étude cinétique de mutants.
Les principales avancées scientifiques réalisées au cours de cette thèse sont discutées dans
les pagraphes qui suivent.
10.1. Structure et dynamique de la poche distale de l’hème
Le site distal de TrHbN est formé par la chaîne latérale de quelques résidus, soient la
Phe32(B9), la Tyr33(B10), la Phe46(CD1), la Gln58(E11) et la Val94(G8). Les résidus en
position 33 et 58 sont polaires et suffisamment près du fer pour former des interactions
avec le ligand (Chapitres 5 et 6). En absence de l’O2 lié au fer, les résidus distaux
Try33(B10) et Gln58(E11) jouent un rôle dans le maintien et le positionnement d’une
molécule d’eau au site actif de la forme deoxy-TrHbN (Chapitre 5). Cette molécule d’eau
se positionne alors près du fer limitant l’accès des ligands à la poche distale de l’hème.
En présence de cette molécule d’eau, le positionnement des résidus distaux et la dynamique
des tunnels de deoxy-TrHbN sont comparables à ceux de la forme oxygénée. Sans
molécule d’eau, le positionnement de la Gln58(E11) et la dynamique de la Phe62(E15)
diffèrent (Chapitre 5). Lorsque la Tyr33(B10) et Gln58(E11) sont remplacés par des résidus
apolaires, il a été démontré que la molécule d’eau est instable et celle-ci s’éloigne et/ou
quitte vers le solvant. En accord, les constantes bimoléculaires d’association de l’O2 et CO
pour les mutants apolaires sont largement augmentées, en particulier lorsque la Tyr33(B10)
224
est substituée; la constante d’association de l’O2 au fer dépassant même la constante
bimoléculaire de la réaction NOD (Chapitre 5). La présence de cette molécule d’eau permet
donc d’expliquer pourquoi la constante bimoléculaire de la réaction NOD catalysée par
TrHbN est 15x plus élevée que la fixation de l’oxygène moléculaire à deoxy-TrHbN.
Il demeure encore certaines interrogations quant à cette molécule d’eau. D’où vient-elle?
Entre-t-elle via un des tunnels apolaires ou emprunte-t-elle une route différente? Est-elle
déjà présente dans la structure de TrHbN? Les simulations de DM menées sur la forme
deoxy n’ont pas montré d’entrée de molécule d’eau. De plus, la structure tridimensionnelle
de la forme deoxy est encore inconnue. Il n’est pas impossible qu’un changement structural
survienne lors de la formation de deoxy-TrHbN. En appui, la spectroscopie de résonance
Raman menée sur la forme deoxy du double mutant Tyr33(B10)Phe/Gln58(E11)Val a
révélé la présence d’un mélange 5C et 6C au lieu d’une seule forme 5C, le 6e ligand étant
de nature endogène [175]. L’absence de chaîne latérale pouvant se lier au fer dans la
proximité immédiate du fer suggère un réarrangement plutôt important de la structure de
TrHbN. Comme hypothèse, il est possible que ce réarrangement, du moins une certaine
partie, survienne également pour la forme sauvage de l’enzyme après la dissociation du
ligand. Cependant, chez TrHbN ce changement favoriserait l’entrée d’une molécule d’eau
et sa diffusion vers le site distal, celle-ci étant attirée puis maintenue par les résidus polaires
Tyr33(B10) et Gln58(E11). Une fois stabilisée près du fer, cette molécule d’eau jouerait un
rôle structural en favorisant le maintien d’une poche distale dans une configuration proche
de celle de la forme oxygénée, propice à l’arrivée d’un substrat gazeux apolaire arrivant via
un tunnel apolaire. Cette hypothèse pourrait éventuellement être testée à l’aide de
simulations de DM. Avec l’avènement de nouveaux supercalculateurs, il serait possible de
produire des trajectoires de dynamique moléculaire (>1 µs) possiblement suffisamment
longues pour observer ces mouvements.
225
10.2. Structure et dynamique des tunnels de TrHbN
Le site distal de TrHbN est relié à la surface de l’enzyme via un réseau de tunnels
hydrophobes contenu dans la matrice protéique. Jusqu’à quatre tunnels distincts ont été
observés au cours des simulations (Chapitre 6), soit deux de plus que ceux observé dans la
structure cristalline [174]. Cette caractéristique structurale distingue TrHbN des TrHbs des
groupes II et III qui possèdent une cavité distale très compacte et des cavités apolaires
isolées et de volumes plus modestes. La communication entre le site distal et les tunnels est
grandement due à la taille du résidu en position G8 qui est occupée par une valine chez
TrHbN alors qu’on y retrouve un tryptophane chez les TrHbs des groupes II et III.
Les simulations de DM ont révélé que les tunnels prenant place au sein de la structure de
TrHbN sont très dynamiques. En effet, il peut s’y former différents tunnels lors de la fusion
momentanée de différentes cavités hydrophobes (Chapitre 6). Cette caractéristique de la
structure de TrHbN est sans doute un facteur clef permettant à cette enzyme de catalyser la
réaction NOD à une vitesse s’approchant des réactions limitées que par la diffusion des
molécules.
Il est intéressant de rappeler que les tunnels sont contenus au centre de quatre hélices alpha
rigides (Chapitres 6 et 8). Au Chapitre 6, il a été proposé que cette rigidité permette le
maintien du volume vide interne. Ces dernières observations s’opposent à une autre théorie
générale chez les enzymes où une réduction de la mobilité conformationelle est associée à
une réduction de l’activité [176, 177]. Par contre, de récentes études d’évolution dirigée ont
démontré que rigidité et activité peuvent être découplées [178, 179]. TrHbN, étant à la fois
rigide et un catalyseur très efficace, représente donc un cas particulier. L’espace vide
interne et la mobilité des chaînes latérales semblent alors la clef pour garantir une haute
activité. Cette rigidité joue possiblement un rôle dans un contexte physiologique en
permettant la diffusion des ligands interne plus indépendante des conditions physico-
chimiques pouvant subsister dans l’environnement intracellulaire. Enfin, les mouvements
lents (µs-ms) localisés le long des hélices B et G et révélés par spectroscopie RMN en
solution peuvent avoir des répercussions non négligeables sur le volume vide interne et son
organisation dans l’espace.
226
10.3. Rôle des tunnels dans la diffusion des substrats entre le
solvant et le site actif
Comme mentionné précédemment, de nombreuses simulations de DM ont mené à
différents postulats quant aux mécanismes de la diffusion des ligands à l’intérieur de
TrHbN [170, 171, 180-183]. Ces derniers ont en particulier identifié les tunnels Court et
Long comme les routes de diffusion privilégiées. En support, les structures de TrHbN
obtenues à partir de cristaux placés sous haute pression de xénon ont montré des atomes de
xénon localisés le long de ces deux routes [184].
Avant les travaux menés en laboratoire et présentés au Chapitre 9, cette observation était le
seul support expérimental suggérant un rôle pour les tunnels de TrHbN. Dans les travaux
présentés dans ce chapitre, nous avons tenté de confirmer expérimentalement l’existence de
plusieurs routes fonctionnelles pour la diffusion des ligands à l’intérieur de TrHbN. Pour ce
faire, nous avons construit des mutants ayant les tunnels Court, Long et EHT bloqués
individuellement ou en combinaison et tenté ensuite de mettre en évidence leur importance
pour l’accès du •NO vers le site actif de TrHbN. Tous les mutants ont démontré une
réaction NOD ralentie indiquant que ceux-ci constituent des routes pour la diffusion du
•NO (Table 9.1, Fig. 9.3). Cette conclusion a été renforcée par des expériences de
photolyse avec la forme ferrique-•NO (Fig. 9.4).
Pendant la rédaction de cette thèse, d’autres travaux sur TrHbN et le triple mutant des
tunnels étaient réalisés en collaboration dans un laboratoire étranger, celui du Dr. Marten
Vos. Ce chercheur de calibre international a développé une expertise technique permettant
l’étude de la recombinaison géminée dans l’échelle de temps de la picoseconde [185].
Étonnamment, des essais menés sur la forme ferrique-•NO de TrHbN ont montré des tracés
de recombinaison identiques pour le mutant et la protéine sauvage. De plus, des essais
menés sur la forme CO n’ont pas révélé de recombinaison géminée 4 ns après la photolyse,
un résultat cohérent avec la sortie facile du ligand à l’extérieur des deux protéines. La
situation opposée a été obtenue pour la protéine mt-TrHbO laquelle n’a aucun tunnel
227
apparent et une poche distale beaucoup plus compacte que celle de TrHbN. Ces derniers
résultats viennent mêler les cartes quant au rôle des tunnels de TrHbN. Viennent-ils
invalider les modèles précédemment proposés sur le rôle et le fonctionnement des tunnels
de TrHbN? Pour tenter de répondre à cette question, les prochains paragraphes mettront en
perspectives l’ensemble des travaux théoriques et expérimentaux menés sur TrHbN.
Les mutations créées dans le but de bloquer les tunnels de TrHbN (Chapitre 9) n’ont pas eu
d’impacts dramatiques tels que ceux observés chez la mini-Hb du nématode Cerebratulus
lacteus [186]. Par surcroît, comme mentionné précédemment, les résultats obtenus par le
laboratoire du Dr. Marten Vos montrent que les mutations n’ont aucun impact sur les
cinétiques de recombinaison. Ensemble, ces résultats expérimentaux contrastent avec ceux
obtenus via les simulations de DM qui prédisent un rôle fonctionnel des tunnels dans la
diffusion des ligands (Chapitres 7, 9). En se basant sur les travaux de DM, les mutations
auraient dû avoir causé des effets significatifs in vitro. D’un autre côté, les simulations de
DM présentées dans cette thèse contiennent également plusieurs observations pouvant
réconcilier les résultats expérimentaux et théoriques. Au Chapitre 9, les simulations ont
montré :
que les ligands peuvent entrer/sortir près de l’entrée obstruée malgré
l’augmentation de l’encombrement stérique.
d’autres routes de diffusion, non observées dans la protéine sauvage. Ces
dernières sont vraisemblablement la conséquence des mutations elles-mêmes
sur la structure et la dynamique de la protéine.
Que l’espace vide considérablement important qui est contenu dans la
structure de TrHbN est favorable à la réorganisation des chaînes latérales.
Que les interactions protéine:ligand engendrent le déplacement de chaînes
latérales spécifiques menant à la formation de route de diffusion non
observée dans les simulations sans ligand.
Toutes ces observations montrent clairement que l’espace vide interne de TrHbN est
hautement dynamique. Par conséquent, cette caractéristique de la structure de TrHbN
228
pourrait expliquer pourquoi ses tunnels sont très difficiles à étudier et à mettre en évidence
par le biais de mutations. Pour ces raisons, au lieu d’invalider les précédents modèles
proposés sur le fonctionnement et le rôle des tunnels de TrHbN, les toutes dernières
données expérimentales précisent notre compréhension. Celles-ci soulèvent également de
nouvelles questions et ouvrent d’autres avenues de recherches. Il est clair que TrHbN est
une protéine plus complexe qu’anticipé et que notre compréhension est encore partielle.
En plus des observations énumérées précédemment, d’autres explications peuvent aider à
réconcilier les données théoriques et expérimentales. D’abord, il n’est pas exclu que
d’autres conformations structurales de TrHbN existent en solution. Si tel est le cas,
l’organisation des tunnels et donc la diffusion des ligands peuvent différer de ce que
proposent les modèles actuels. Pour supporter cette hypothèse, les travaux de spectroscopie
RMN en solution menés sur TrHbN sous sa forme cyanomet (Chapitre 8) ont révélé que la
pre-A est désordonnée contrairement à l’hélice alpha observée dans la structure cristalline
et maintenue lors des simulations de DM. De plus, ces travaux ont révélé l’existence de
mouvements lents se produisant sur l’échelle de temps µs-ms pour plusieurs résidus situés
le long des hélices B et G. Parmi les résidus concernés, il y a la Tyr33(B10), résidu clef
étant donné sa chaîne latérale formant une partie de la poche distale de l’hème et
interagissant avec le ligand lié au fer. En même temps, les atomes de la chaîne principale de
ce résidu délimitent en partie l’ouverture du tunnel BET présenté au Chapitre 6. Ce tunnel
n’a pas été ciblé par les mutations puisque ce tunnel est beaucoup plus étroit près de la
surface de la protéine par rapport aux trois autres ciblés (Chapitre 6). Des mouvements des
hélices B et G pourraient avoir des effets significatifs sur l’ouverture du tunnel BET et/ou
permettre la formation d’autres routes de diffusion.
Enfin, il est possible que les mutations créées pour bloquer les tunnels aient causé des effets
significatifs sur la structure de TrHbN causant la formation de nouvelles routes de
diffusion. De telles modifications n’auraient pas pu être observées au cours des simulations
de DM puisque celles-ci impliquent des mouvements de grande amplitude s’effectuant sur
des échelles de temps encore non accessibles aux simulations de DM.
229
10.4. Perspective de recherche sur les relations structure-
fonction des tunnels de TrHbN
Différents travaux pourraient être réalisés pour pousser notre compréhension de TrHbN, en
particulier sur le rôle des tunnels dans la diffusion des substrats. Les prochains paragraphes
en proposent quelques-uns.
D’abord, déterminer la structure 3D du triple mutant des tunnels permettrait de révéler leurs
impacts sur la configuration des cavités et des tunnels de TrHbN. Si des différences sont
observées, les nouvelles coordonnées pourraient servir à initier de nouveaux calculs de DM
et/ou à mener de nouveaux travaux en laboratoire (par exemple tester de nouvelles
mutations).
Étudier TrHbN et le triple mutant des tunnels en utilisant la spectroscopie de Laue résolue
en temps réel pourrait mettre en évidence expérimentalement la ou les routes de diffusion
utilisée(s) ainsi que les fluctuations structurales s’effectuant au cours de la diffusion du
ligand photodissocié. En complément, ces travaux pourraient fournir une description
structurale des mouvements lents observés le long des hélices B et G et mis en évidence par
la spectroscopie RMN en solution (Chapitre 8).
Étudier la dynamique des chaînes latérales de TrHbN et le triple mutant par spectroscopie
RMN en solution pourrait mettre en évidence des mouvements non observés au cours des
simulations de DM. Ces derniers pourraient avoir un impact significatif sur la diffusion des
ligands. Si de tels mouvements étaient identifiés, ceux-ci pourraient être par la suite
modélisés pour évaluer leurs impacts sur l’organisation de l’espace interne vide et sur la
dynamique des autres résidus.
10.5. Routes de diffusions multiples et pertinence fonctionnelle
L’ensemble des travaux présentés lors de cette thèse démontre clairement que la structure
de TrHbN permet la diffusion rapide des ligands vers son site actif. Cette propriété pourrait
230
être garantie par l’espace interne vide considérablement grand lequel est connecté à la
surface de la protéine en plusieurs endroits. La pertinence fonctionnelle à maintenir de
nombreuses voies de diffusion chez une protéine présente un intérêt fondamental certain.
D’abord, la présence de plusieurs routes apolaires chez TrHbN pourrait augmenter la
chance de capter une molécule de •NO ou d’O2 et ainsi contribuer à une haute efficacité de
catalyse de la réaction NOD sous une faible tension d’O2 (~1-3 µM) [187], telle que celle
prévalant durant l’infection de Mtb [188]. Le calcul d’affinité des tunnels pour le •NO
présenté au Chapitre 7 a prédit une faible occupation de ce ligand dans les tunnels (Kd = 6.2
mM) [171]. Dans des conditions physiologiques où la concentration du •NO est ~0.1-1.0
µM, une molécule de TrHbN à toutes les ~62000 à 6200 devrait contenir une molécule de
•NO. Pour maintenir une vitesse de réaction de 745 s-1
, la formation du produit de la
réaction de ne devrait pas pouvoir durer plus de 0.2 µs. En accord, des travaux théoriques
menés par Mishra et Meuwly suggèrent que la réaction entre TrHbNFeII(O2) et le •NO
s’effectue sur quelques dizaines de picosecondes incluant (i) la liaison du •NO à
TrHbNFeII(O2), (ii) le réarrangement de l’intermédiaire peroxynitrite (Fe
III(OONO
-)) et
finalement (iii) la dissociation du complexe nitrato-TrHbN [180]. Ainsi, la réaction NOD
ne serait limitée que par la diffusion du •NO du solvant vers le site actif comme le suggère
la constante bimoléculaire k´NOD ≈ 745 µM-1
s-1
(23 °C) [189]. Dans ce contexte, les
tunnels hydrophobes de TrHbN garantiraient un accès rapide du •NO vers le site actif.
10.6. Comparaisons de TrHbN avec d’autres protéines liant des
gaz et perspectives
À notre connaissance, étant donné les données cinétiques du triple mutant des tunnels
(Chapitre 9), TrHbN pourrait représenter la première protéine confirmée possédant
plusieurs routes fonctionnelles. De nombreux travaux théoriques ont suggéré l’existence de
routes de diffusion multiple chez d’autres protéines dont la COA [93], la flavoenzyme
oxydase et la mono-oxygénase [190] et la Mb [88-90]. Chez la Mb, l’étude de plusieurs
mutants a suggéré que ceux-ci ne sont pas fonctionnels ou négligeables [191]. Au contraire,
231
l’ensemble des travaux expérimentaux pointe vers une route majeure contrôlée par
l’His(E7) [191]. De manière similaire, plusieurs routes de diffusion à l’intérieur de la mini-
Hb de Cerebratulus lacteus (CerHb) ont été observées par échantillonnage amélioré de
ligands [192], mais une seule a été confirmée expérimentalement [186]. Il est intéressant de
noter que comme TrHbN, la structure de CerHb contient un volume interne vide très
significatif. Des mutations créées dans le but de bloquer un seul tunnel correspondant au
tunnel EHT de TrHbN ont causé des effets très importants [186]. Par surcroît, les mutations
créées pour bloquer ce tunnel ont été réalisées sur le résidu en position E18, soit la même
position topologique que celle ciblée avec TrHbN (Chapitre 9).
Une étude théorique comparative de la structure et de la dynamique de TrHbN avec celles
de CerHb devrait révéler d’importantes différences entre les deux protéines. Comme
hypothèse, il serait possible d’envisager que la structure de CerHb, en particulier les
chaînes latérales internes formant le cœur de sa structure, soit plus rigide que TrHBN. Ceci
limiterait la réorganisation du volume interne vide de CerHb empêchant donc la formation
de routes alternatives. De plus, l’impact des ligands eux-mêmes sur ces mêmes chaînes
latérales, c.-à-d. leur conformation et leur dynamique, serait également davantage restreint.
Une explication similaire a été proposée pour le cytochrome c oxydase chez laquelle une
seule mutation a causé un blocage dramatique de la diffusion des ligands [129].
Il est également d’intérêt de comparer la dynamique des tunnels de TrHbN à celle d’autres
TrHbs du groupe I dans le contexte des travaux de Cohen et al [89]. Ces derniers travaux
théoriques ont conclu que différentes globines, malgré leur repliement structural similaire,
présentent différents patrons de routes de diffusion. Ainsi, comparer la dynamique des
tunnels de TrHbN à celle d'autres TrHbs du groupe I, lesquelles présentent toutes un
volume vide interne important [78, 184, 193], suscite un fort intérêt. Ce type d’étude
pourrait permettre de mieux comprendre les déterminants structuraux affectant la diffusion
des ligands à l’intérieur de cette famille de protéines et des protéines en général. La
flexibilité des chaînes latérale délimitant l’espace interne vide tout comme la rigidité du
squelette pourraient s’avérer des caractéristiques évolutives de la famille de TrHbs du
groupe I.
232
Les travaux de Cohen [89] tout comme les nôtres suggèrent que plusieurs routes
alternatives peuvent être contenues dans une structure tertiaire générale donnée. Cependant,
certaines routes sont privilégiées dues à l’emboîtement des chaînes latérales, leur degré de
liberté et l’impact des ligands sur celles-ci. L’impact des ligands sur la dynamique de la
protéine est également un facteur important chez TrHbN (Chapitres 7 et 9), une observation
également soulevée pour la Mb par Tomita et al [194]. Ces derniers, en illuminant
continuellement des cristaux de CO-Mb sous des températures cryogéniques ont observé
que la migration des molécules de CO à l’intérieur de sites Xe cause l’expansion du volume
des cavités laquelle cause la formation de passage entre les cavités et la diffusion du CO.
Tout comme le mouvement des chaînes latérales, la mobilité de la chaîne principale peut
être un facteur important. Enfin, la surface hydrophobe invaginée en forme d’entonnoir
favorise la capture et l’entrée de ligands apolaires est notée pour le tunnel Court
(Chapitre 7) [171]. Un arrangement structural similaire a également été noté chez la 12/15-
lipoxygénase et ce dernier présente, comme l’entrée du tunnel Court de TrHbN, une plus
haute affinité pour les ligands apolaires que celle du solvant [96].
10.7. Localisation de TrHbN au niveau des membranes –
nouvelles perpectives de recherche
Il existe un certain nombre d’observations qui suggèrent que TrHbN puisse être localisée
près ou à l’intérieur les membranes. D’abord, l’extraction de TrHbN après sa surexpression
dans E. coli a révélé qu’environ 15 à 20% des molécules de TrHbN étaient associées aux
membranes (résultats non publiés). Également, il a été démontré que TrHbN interagit avec
l’ADN, en particulier via la région pre-A. En effet, des expériences de retardement de
migrations sur gel ont montré que TrHbN cause un retard dans la migration d’un plasmide.
À l’opposé, la protéine mutante TrHbN_Δpre-A ne cause pas ce retardement (résultats non
publiés). De plus, la spectroscopie de résonance RMN a montré des modifications dans le
déplacement chimique de résidus de la pre-A lorsque TrHbN est incubée en présence
d’ADN. La présence de quatre résidus chargés positivement dans la pre-A (trois arginines
et une lysine) pourrait jouer un rôle dans ces interactions par le biais d’interactions ioniques
avec des groupements phosphate de l’ADN, lesquels sont chargés de négativement.
233
Indirectement, ces observations suggèrent que des interactions semblables pourraient
également se former avec la tête de phospholipides chargés négativement. En support, de
récents travaux de pression maximale d’insertion en monocouche avec TrHbN menés au
laboratoire du Pr. Christan Salesse ont montré que TrHbN interagit avec les lipides
anioniques cardiolipine et phosphatidylinositol et, dans une moindre mesure, avec les
lipides zwitterioniques phosphatidylcholine et phophatidyléthanolamine (résultats non
publiés).
Afin d’étudier les interactions entre TrHbN et les membranes, des travaux théoriques ont
été menés par Julie-Anne Rousseau, étudiante à la maîtrise au laboratoire du Pr. Patrick
Lagüe. D'abord, des calculs d’hydrophathie menés avec l’outil MPEx [195] sur la structure
primaire de TrHbN prédisent que deux segments (résidus 32 à 50 et 85 à 103), formant
ensemble une vaste zone de la surface de TrHbN, sont membranaires. Différentes
trajectoires de TrHbN en présence d’une membrane explicite a permis d’étudier différents
degrés d’enfoncement de TrHbN à l’intérieur des membranes, les intéractions TrHbN :
phospholides et l’impact de la membrane sur la dynamique de TrHbN et ses tunnels. Ces
simulations ont permis de montrer, entre autres, que les phospholipides peuvent se placer à
l’intérieur des tunnels ce qui pourrait contribuer à l’encrage de TrHbN aux membranes. La
rédaction d’un mémoire de maîtrise décrivant ces travaux est en cours. D’autres travaux,
actuellement menés par une étudiante à la maîtrise au laboratoire du Pr. Michèle Auger,
visent à étudier par spectroscopie RMN solide les interactions entre les membranes et
TrHbN ainsi que le mutant TrHbN_Δpre-A. En accord avec les précédentes observations,
ces derniers travaux ont montré que TrHbN interagit avec les membranes et que la pre-A
joue un rôle important dans ces interactions (résultats non publiés).
La surface de TrHbN présente plusieurs régions apolaires. En particulier, on retrouve une
vaste région englobant l’entrée du tunnel court. En plus de l’implication de la pre-A, ces
surfaces hydrophobes pourraient contribuer à l’insertion membranaire. L’insertion de
TrHbN dans les membranes pourrait présenter certains avantages. En effet, les substrats
apolaires sont plus solubles dans les membranes que dans des solvants aqueux [196]. De ce
fait, TrHbN pourrait, via ses tunnels, puiser plus efficacement ses substrats dans les
membranes. Également, d’autres protéines membranaires dont certaines hémoglobines se
234
trouvent associées aux membranes tel que la cytochrome c oxydase [197]. La présence de
TrHbN pourrait permettre de jouer certains rôles en éliminant le •NO et empêchant
l’inhibition de certaines globines, en particulier certaines globines de la chaîne respiratoire.
10.8. Conclusion
Les travaux présentés dans cette thèse de doctorat visaient à étudier la structure et la
dynamique de TrHbN à l’aide de méthodes théoriques. En particulier, le rôle des tunnels de
TrHbN a fait l’objet d’une attention très pointue. Ces travaux ont permis de mettre en
évidence plusieurs éléments clefs de la dynamique de TrHbN et de ses tunnels. Ces
éléments renferment i) la présence de tunnels dynamiques grâce à la flexibilité des chaînes
latérales, ii) des routes de diffusions additionnelles à celles observées dans la structure
cristalline, iii) un squelette rigide, iv) l’affinité accrue des tunnels par rapport au solvant
pour les substrats gazeux et v) le tunnel Court est prédit comme la route de diffusion la plus
favorable. De plus, ces travaux théoriques ont permis démontrer que les substrats diffusent
à travers ces tunnels, de cavité en cavité, pour atteindre le site actif de TrHbN. Ces travaux
ont bénéficié d’un support expérimental important par l’étude de TrHbN et plusieurs
mutants caractérisés en cinétique, en spectroscopie de résonance Raman et en spectroscopie
RMN en solution. Avant les travaux présentés dans cette thèse, soit près de 10 ans après la
découverte et l’élucidation de la structure de TrHbN, il n’y avait aucune preuve
expérimentale démontrant le rôle fonctionnel des tunnels de TrHbN. L’ensemble des
travaux réalisés a permis plusieurs avancées scientifiques, mais a également soulevé de
nouvelles questions. Parmi ces interrogations, notons l’effet modeste inattendu des
mutations créées dans le but de bloquer les tunnels ainsi que la découverte des mouvements
lents (µs-ms) le long des hélices B et G mis en évidence par la spectroscopie RMN en
solution.
235
Bibliographie
1. World Health Orgnization report 2009, Global tuberculosis control. Epidemiology,
Strategy, Financing: Geneva.
2. Dye, C., Global epidemiology of tuberculosis. Lancet, 2006. 367(9514): p. 938-940.
3. Raviglione, M.C., The TB epidemic from 1992 to 2002. Tuberculosis, 2003. 83(1-
3): p. 4-14.
4. Zignol, M., et al., Global incidence of multidrug-resistant tuberculosis. Journal of
Infectious Diseases, 2006. 194(4): p. 479-485.
5. Russell, D.G., Who puts the tubercle in tuberculosis? Nat Rev Microbiol, 2007.
5(1): p. 39-47.
6. Deretic, V., et al., Mycobacterium tuberculosis inhibition of phagolysosome
biogenesis and autophagy as a host defence mechanism. Cellular Microbiology,
2006. 8(5): p. 719-727.
7. Russell, D.G., Mycobacterium tuberculosis: Here today, and here tomorrow. Nature
Reviews Molecular Cell Biology, 2001. 2(8): p. 569-577.
8. Russell, D.G., et al., Mycobacterium tuberculosis and the Four-Minute Phagosome
- By arresting the maturation of phagosomes, M-tuberculosis avoids being delivered
to lysosomes. Asm News, 2005. 71(10): p. 459-463.
9. Ulrichs, T. and S.H.E. Kaufmann, New insights into the function of granulomas in
human tuberculosis. Journal of Pathology, 2006. 208(2): p. 261-269.
10. Flynn, J.L. and J. Chan, What's good for the host is good for the bug. Trends in
Microbiology, 2005. 13(3): p. 98-102.
11. Algood, H.M.S., P.L. Lin, and J.L. Flynn, Tumor necrosis factor and chemokine
interactions in the formation and maintenance of granulomas in tuberculosis.
Clinical Infectious Diseases, 2005. 41: p. S189-S193.
12. Tsai, M.C., et al., Characterization of the tuberculous granuloma in murine and
human lungs: cellular composition and relative tissue oxygen tension. Cellular
Microbiology, 2006. 8(2): p. 218-232.
13. Akaki, T., et al., Effector molecules in expression of the antimicrobial activity of
macrophages against Mycobacterium avium complex: roles of reactive nitrogen
intermediates, reactive oxygen intermediates, and free fatty acids. Journal of
Leukocyte Biology, 1997. 62(6): p. 795-804.
14. Adams, L.B., et al., Comparison of the roles of reactive oxygen and nitrogen
intermediates in the host response to Mycobacterium tuberculosis using transgenic
mice. Tubercle and Lung Disease, 1997. 78(5-6): p. 237-246.
15. Rich, E.A., et al., Mycobacterium tuberculosis (MTB)-stimulated production of
nitric oxide by human alveolar macrophages and relationship of nitric oxide
production to growth inhibition of MTB. Tubercle and Lung Disease, 1997. 78(5-6):
p. 247-255.
16. Stewart, G.R., B.D. Robertson, and D.B. Young, Tuberculosis: A problem with
persistence. Nature Reviews Microbiology, 2003. 1(2): p. 97-105.
17. Samuni, U., et al., Ligand recombination and a hierarchy of solvent slaved
dynamics: The origin of kinetic phases in hemeproteins. Gene, 2007.
236
18. Gardner, P.R., et al., Nitric oxide sensitivity of the aconitases. Journal of Biological
Chemistry, 1997. 272(40): p. 25071-25076.
19. Stevanin, T.M., et al., Flavohemoglobin hmp affords inducible protection for
Escherichia coli respiration, catalyzed by cytochromes bo ' or bd, from nitric oxide.
Journal of Biological Chemistry, 2000. 275(46): p. 35868-35875.
20. Dedon, P.C. and S.R. Tannenbaum, Reactive nitrogen species in the chemical
biology of inflammation. Archives of Biochemistry and Biophysics, 2004. 423(1): p.
12-22.
21. Patel, R.P., et al., Biological aspects of reactive nitrogen species. Biochimica Et
Biophysica Acta-Bioenergetics, 1999. 1411(2-3): p. 385-400.
22. Ouellet, H., et al., Truncated hemoglobin HbN protects Mycobacterium bovis from
nitric oxide. Proc Natl Acad Sci U S A, 2002. 99(9): p. 5902-7.
23. Perutz, M.F., Regulation of Oxygen-Affinity of Hemoglobin - Influence of Structure
of the Globin on the Heme Iron. Annual Review of Biochemistry, 1979. 48: p. 327-
386.
24. Gardner, P.R., Nitric oxide dioxygenase function and mechanism of
flavohemoglobin, hemoglobin, myoglobin and their associated reductases. Journal
of Inorganic Biochemistry, 2005. 99(1): p. 247-266.
25. Tsai, A., How does NO activate hemeproteins? FEBS Lett, 1994. 341(2-3): p. 141-
5.
26. Doyle MP, H.J., Oxidation Of Nitrogen-Oxides By Bound Dioxygen In
Hemoproteins. Journal of Inoganic Biochemistry, 1981. 14(4): p. 351-358.
27. DeLano, W.L., The PyMOL Molecular Graphics System. 2002.
28. Vinogradov, S.N., et al., Three globin lineages belonging to two structural classes
in genomes from the three kingdoms of life. Proceedings of the National Academy
of Sciences of the United States of America, 2005. 102(32): p. 11385-11389.
29. Wittenberg, J.B., et al., Truncated hemoglobins: a new family of hemoglobins
widely distributed in bacteria, unicellular eukaryotes, and plants. J Biol Chem,
2002. 277(2): p. 871-4.
30. Vuletich, D.A. and J.T.J. Lecomte, A phylogenetic and structural analysis of
truncated hemoglobins. J Mol Evol, 2006. 62(2): p. 196-210.
31. Lecomte, J.T.J., D.A. Vuletich, and A.M. Lesk, Structural divergence and distant
relationships in proteins: evolution of the globins. Curr Opin Struct Biol, 2005.
15(3): p. 290-301.
32. Vinogradov, S.N. and L. Moens, Diversity of globin function: enzymatic, transport,
storage, and sensing. J Biol Chem, 2008. 283(14): p. 8773-8777.
33. Singel, D.J. and J.S. Stamler, Blood traffic control. Nature, 2004. 430(6997): p. 297.
34. Cossins, A. and M. Berenbrink, Physiology - Myoglobin's new clothes. Nature,
2008. 454(7203): p. 416-417.
35. Lundberg, J.O., E. Weitzberg, and M.T. Gladwin, The nitrate-nitrite-nitric oxide
pathway in physiology and therapeutics. Nature Reviews Drug Discovery, 2008.
7(2): p. 156-167.
36. Pesce, A., et al., A novel two-over-two alpha-helical sandwich fold is characteristic
of the truncated hemoglobin family. EMBO J, 2000. 19(11): p. 2424-34.
37. Hofacker, I. and K. Schulten, Oxygen and proton pathways in cytochrome c
oxidase. Proteins, 1998. 30(1): p. 100-107.
237
38. Milani, M., et al., Mycobacterium tuberculosis hemoglobin N displays a protein
tunnel suited for O2 diffusion to the heme. EMBO J, 2001. 20(15): p. 3902-9.
39. Pesce, A., et al., The 109 residue nerve tissue minihemoglobin from Cerebratulus
lacteus highlights striking structural plasticity of the alpha-helical globin fold.
Structure, 2002. 10(5): p. 725-735.
40. Nardini, M., et al., Archaeal protoglobin structure indicates new ligand diffusion
paths and modulation of haem-reactivity. Embo Reports, 2008. 9(2): p. 157-163.
41. Vallone, B., et al., The structure of murine neuroglobin: Novel pathways for ligand
migration and binding. Proteins, 2004. 56(1): p. 85-92.
42. Monod, J., J. Wyman, and J.P. Changeux, On nature of allosteric transitions - A
plausible model. Journal of Molecular Biology, 1965. 12(1): p. 88-&.
43. Huie, R.E. and S. Padmaja, The Reaction of NO with Superoxide. Free Radical
Research Communications, 1993. 18(4): p. 195-199.
44. Pryor, W.A. and G.L. Squadrito, The Chemistry of Peroxynitrite - A Product from
The Reaction of Nitric-Oxide with Superoxide. American Journal of Physiology-
Lung Cellular and Molecular Physiology, 1995. 268(5): p. L699-L722.
45. Tsai, J.H.M., et al., Role of conformation of peroxinitrite anion (ONOO-) in its
stability and toxicity. Journal of the American Chemical Society, 1994. 116(9): p.
4115-4116.
46. Miranda, K.M., M.G. Espey, and D.A. Wink, A discussion of the chemistry of
oxidative and nitrosative stress in cytotoxicity. Journal of Inorganic Biochemistry,
2000. 79(1-4): p. 237-240.
47. Pacher, P., J.S. Beckman, and L. Liaudet, Nitric Oxide and Peroxynitrite in Health
and Disease. Physiological Reviews, 2007. 87(1): p. 315-424.
48. Beckman, J.S., Oxidative damage and tyrosine nitration from peroxynitrite.
Chemical Research in Toxicology, 1996. 9(5): p. 836-844.
49. Mishra, S. and M. Meuwly, Atomistic Simulation of NO Dioxygenation in Group I
Truncated Hemoglobin. Journal of the American Chemical Society, 2010.
50. Gardner, P.R., et al., Nitric-oxide dioxygenase activity and function of
flavohemoglobins - Sensitivity to nitric oxide and carbon monoxide inhibition.
Journal of Biological Chemistry, 2000. 275(41): p. 31581-31587.
51. Frey, A.D., et al., Bacterial hemoglobins and flavohemoglobins for alleviation of
nitrosative stress in Escherichia coli. Applied and Environmental Microbiology,
2002. 68(10): p. 4835-4840.
52. Ouellet, H., et al., Reactions of Mycobacterium tuberculosis truncated hemoglobin
O with ligands reveal a novel ligand-inclusive hydrogen bond network.
Biochemistry, 2003. 42(19): p. 5764-74.
53. Minning, D.M., et al., Ascaris haemoglobin is a nitric oxide-activated deoxygenase.
Nature, 1999. 401(6752): p. 497-502.
54. Eich, R.F., et al., Mechanism of NO-induced oxidation of myoglobin and
hemoglobin. Biochemistry, 1996. 35(22): p. 6976-6983.
55. Takano, T., Structure of Myoglobin Refined at 2.0 A Resolution: I. Crystallographic
Refinement of Metmyoglobin from Sperm Whale. Journal of Molecular Biology,
1977. 110(3): p. 537-568.
56. Ouellet, Y., et al., Ligand interactions in the distal heme pocket of Mycobacterium
tuberculosis truncated hemoglobin N: roles of TyrB10 and GlnE11 residues.
Biochemistry, 2006. 45(29): p. 8770-81.
238
57. Pesce, A., et al., Thr-E11 regulates O2 affinity in Cerebratulus lacteus mini-
hemoglobin. J Biol Chem, 2004. 279(32): p. 33662-72.
58. Gibson, Q.H. and M.H. Smith, Rates of Reaction of Ascaris Haemoglobins with
Ligands. Proceedings of the Royal Society of London Series B-Biological Sciences,
1965. 163(991): p. 206-&.
59. Salter, M.D., et al., The apolar channel in cerebratulus lacteus hemoglobin is the
route for O2 entry and exit. J Biol Chem, 2008.
60. Das, T.K., et al., Ligand binding in the ferric and ferrous states of Paramecium
hemoglobin. Biochemistry, 2000. 39(46): p. 14330-14340.
61. Lu, C., et al., Structural and functional properties of a truncated hemoglobin from a
food-borne pathogen Campylobacter jejuni. J Biol Chem, 2007. 282(18): p. 13627-
13636.
62. Trent, J.T., et al., Crystallographic analysis of synechocystis cyanoglobin reveals
the structural changes accompanying ligand binding in a hexacoordinate
hemoglobin. J Mol Biol, 2004. 341(4): p. 1097-108.
63. Hamdane, D., et al., The Redox State of the Cell Regulates the Ligand Binding
Affinity of Human Neuroglobin and Cytoglobin. Journal of Biological Chemistry,
2003. 278(51): p. 51713-51721.
64. Perutz, M.F., Mechanisms Regulating the Reactions of Human Hemoglobin with
Oxygen and Carbon-Monoxide. Annual Review of Physiology, 1990. 52: p. 1-25.
65. Quillin, M.L., et al., Structural and Function-Effets of Apolar Mutations of the
Distal Valine in Myoglobin. Journal of Molecular Biology, 1995. 245(4): p. 416-
436.
66. Kendrew, J.C., et al., A Three-Dimensional Model of the Myoglobin Molecule
Obtained by X-Ray Analysis. Nature, 1958. 181(4610): p. 662-666.
67. Perutz, M.F., et al., Structure of Haemoglobin: A Three-Dimensional Fourier
Synthesis at 5.5-[angst]. Resolution, Obtained by X-Ray Analysis. Nature, 1960.
185(4711): p. 416-422.
68. Milani, M., et al., Cyanide binding to truncated hemoglobins: a crystallographic
and kinetic study. Biochemistry, 2004. 43(18): p. 5213-21.
69. Milani, M., et al., Heme-ligand tunneling in group I truncated hemoglobins. J Biol
Chem, 2004. 279(20): p. 21520-5.
70. Falzone, C.J., et al., The solution structure of the recombinant hemoglobin from the
cyanobacterium Synechocystis sp. PCC 6803 in its hemichrome state. J Mol Biol,
2002. 324(5): p. 1015-29.
71. Hoy, J.A., et al., The crystal structure of Synechocystis hemoglobin with a covalent
heme linkage. J Biol Chem, 2004. 279(16): p. 16535-42.
72. Milani, M., et al., A TyrCD1/TrpG8 hydrogen bond network and a TyrB10TyrCD1
covalent link shape the heme distal site of Mycobacterium tuberculosis hemoglobin
O. Proc Natl Acad Sci U S A, 2003. 100(10): p. 5766-5771.
73. Giangiacomo, L., et al., The truncated oxygen-avid hemoglobin from Bacillus
subtilis: X-ray structure and ligand binding properties. J Biol Chem, 2005. 280(10):
p. 9192-202.
74. Ilari, A., et al., Crystal structure and ligand binding properties of the truncated
hemoglobin from Geobacillus stearothermophilus. Arch Biochem Biophys, 2007.
457(1): p. 85-94.
239
75. Bonamore, A., et al., A novel thermostable hemoglobin from the actinobacterium
Thermobifida fusca. FEBS J, 2005. 272(16): p. 4189-201.
76. Pesce, A., et al., Structural characterization of a group II 2/2 hemoglobin from the
plant pathogen Agrobacterium tumefaciens. Biochimica et Biophysica Acta (BBA)
- Proteins & Proteomics. 1814(6): p. 810-816.
77. Nardini, M., et al., Structural determinants in the group III truncated hemoglobin
from campylobacter jejuni. J Biol Chem, 2006.
78. Nardini, M., et al., Protein fold and structure in the truncated (2/2) globin family.
Gene, 2007. 398(1-2): p. 2-11.
79. Richards, F.M., Interpretation of protein structures - Toal volume, group, volume
distributions and packing density. Journal of Molecular Biology, 1974. 82(1): p. 1-
14.
80. McCammon, J.A., B.R. Gelin, and M. Karplus, Dynamics of Folded Proteins.
Nature, 1977. 267(5612): p. 585-590.
81. Srajer, V., et al., Photolysis of the carbon monoxide complex of myoglobin:
Nanosecond time-resolved crystallography. Science, 1996. 274(5293): p. 1726-
1729.
82. Srajer, V. and W.E. Royer, Time-resolved x-ray crystallography of heme proteins.
Methods Enzymol, 2008. 437: p. 379-395.
83. Bourgeois, D., et al., Extended subnanosecond structural dynamics of myoglobin
revealed by Laue crystallography. Proc Natl Acad Sci U S A, 2006. 103(13): p.
4924-4929.
84. Carlson, M.L., R.M. Regan, and Q.H. Gibson, Distal cavity fluctuations in
myoglobin: Protein motion and ligand diffusion. Biochemistry, 1996. 35(4): p.
1125-1136.
85. Bossa, C., et al., Extended molecular dynamics simulation of the carbon monoxide
migration in sperm whale myoglobin. Biophysical Journal, 2004. 86(6): p. 3855-
3862.
86. Tilton, R.F., et al., Protein-ligand dynamics : A 96 picosecond simulation of a
myoglobin-xenon complex. Journal of Molecular Biology, 1988. 199(1): p. 195-211.
87. Kuczera, K., J. Kuriyan, and M. Karplus, Temperature dependence of the structure
and dynamics of myoglobin. A simulation approach. J Mol Biol, 1990. 213(2): p.
351-373.
88. Elber, R. and M. Karplus, Enhanced sampling in molecular-dynamics - Use of the
time-dependent Hartree approximation for a simulation of carbon-monoxide
diffusion through myoglobin. Journal of the American Chemical Society, 1990.
112(25): p. 9161-9175.
89. Cohen, J., et al., Imaging the migration pathways for O2, CO, NO, and Xe inside
myoglobin. Biophys J, 2006. 91(5): p. 1844-57.
90. Ruscio, J.Z., et al., Atomic level computational identification of ligand migration
pathways between solvent and binding site in myoglobin. Proceedings of the
National Academy of Sciences, 2008. 105(27): p. 9204-9209.
91. Amara, P., et al., Ligand diffusion in the catalase from Proteus mirabilis: a
molecular dynamics study. Protein Sci, 2001. 10(10): p. 1927-35.
92. Anselmi, M., et al., Molecular dynamics simulation of deoxy and carboxy murine
neuroglobin in water. Biophys J, 2007. 93(2): p. 434-441.
240
93. Johnson, B.J., et al., Exploring molecular oxygen pathways in Hansenula
polymorpha copper-containing amine oxidase. J Biol Chem, 2007. 282(24): p.
17767-17776.
94. Cohen, J., et al., Finding gas diffusion pathways in proteins: application to O2 and
H2 transport in CpI [FeFe]-hydrogenase and the role of packing defects. Structure,
2005. 13(9): p. 1321-1329.
95. Furse, K.E., et al., Molecular dynamics simulations of arachidonic acid-derived
pentadienyl radical intermediate complexes with COX-1 and COX-2: insights into
oxygenation regio- and stereoselectivity. Biochemistry, 2006. 45(10): p. 3206-3218.
96. Saam, J., et al., Molecular dioxygen enters the active site of 12/15-lipoxygenase via
dynamic oxygen access channels. Proc Natl Acad Sci U S A, 2007. 104(33): p.
13319-13324.
97. Vojtechovsky, J., et al., Crystal structures of myoglobin-ligand complexes at near-
atomic resolution. Biophysical Journal, 1999. 77(4): p. 2153-2174.
98. Miles, E.W., S. Rhee, and D.R. Davies, The molecular basis of substrate
channeling. Journal of Biological Chemistry, 1999. 274(18): p. 12193-12196.
99. Raushel, F.M., J.B. Thoden, and H.M. Holden, Enzymes with molecular tunnels.
Accounts of Chemical Research, 2003. 36(7): p. 539-548.
100. Hyde, C.C., et al., 3-Dimensional structure of the tryptophan synthase alpha-2-
beta-2-multienzyme complex from salmonella-typhimurium. Journal of Biological
Chemistry, 1988. 263(33): p. 17857-17871.
101. Darnault, C., et al., Ni-Zn-[Fe-4-S-4] and Ni-Ni-[Fe-4-S-4] clusters in closed and
open subunits of acetyl-CoA synthase/carbon monoxide dehydrogenase. Nature
Structural Biology, 2003. 10(4): p. 271-279.
102. Thoden, J.B., et al., Structure of Carbamoyl Phosphate Synthetase: A Journey of 96
A from Substrate to Product†,‡. Biochemistry, 1997. 36(21): p. 6305-6316.
103. Muchmore, C.R.A., et al., Crystal structure of glutamine
phosphoribosylpyrophosphate amidotransferase from Escherichia coli. Protein
Science, 1998. 7(1): p. 39-51.
104. Larsen, T.M., et al., Three-Dimensional Structure of Escherichia coli Asparagine
Synthetase B: A Short Journey from Substrate to Product†,‡. Biochemistry,
1999. 38(49): p. 16146-16157.
105. Binda, C., et al., Cross-talk and ammonia channeling between active centers in the
unexpected domain arrangement of glutamate synthase. Structure, 2000. 8(12): p.
1299-1308.
106. Chaudhuri, B.N., et al., Crystal structure of imidazole glycerol phosphate synthase:
A tunnel through a (beta/alpha)(8) barrel joins two active sites. Structure, 2001.
9(10): p. 987-997.
107. Teplyakov, A., et al., Channeling of ammonia in glucosamine-6-phosphate
synthase. Journal of Molecular Biology, 2001. 313(5): p. 1093-1102.
108. Li, R.B., J.P. Klinman, and F.S. Mathews, Copper amine oxidase from Hansenula
polymorpha: the crystal structure determined at 2.4 angstrom resolution reveals the
active conformation. Structure, 1998. 6(3): p. 293-307.
109. Fontecilla-Camps, J.C., et al., Structure/function relationships of [NiFe]- and
[FeFe]-hydrogenases. Chemical Reviews, 2007. 107(10): p. 4273-4303.
110. Boyington, J.C., B.J. Gaffney, and L.M. Amzel, The three-dimensional structure of
an arachidonic acid 15-lipoxygenase. Science, 1993. 260(5113): p. 1482-1486.
241
111. Furse, K.E., et al., Molecular dynamics simulations of arachidonic acid complexes
with COX-1 and COX-2: insights into equilibrium behavior. Biochemistry, 2006.
45(10): p. 3189-3205.
112. Minor, W., et al., Crystal structure of soybean lipoxygenase L-l at 1.4 angstrom
resolution. Biochemistry, 1996. 35(33): p. 10687-10701.
113. Lario, P.I., N. Sampson, and A. Vrielink, Sub-atomic resolution crystal structure of
cholesterol oxidase: What atomic resolution crystallography reveals about enzyme
mechanism and the role of the FAD cofactor in redox activity. Journal of Molecular
Biology, 2003. 326(5): p. 1635-1650.
114. Coulombe, R., et al., Oxygen access to the active site of cholesterol oxidase through
a narrow channel is gated by an Arg-Glu pair. J Biol Chem, 2001. 276(32): p.
30435-30441.
115. Petrek, M., et al., CAVER: a new tool to explore routes from protein clefts, pockets
and cavities. BMC Bioinformatics, 2006. 7: p. 316.
116. Pesce, A., et al., Crystallization and preliminary X-ray analysis of neural
haemoglobin from the nemertean worm Cerebratulus lacteus. Acta
Crystallographica Section D-Biological Crystallography, 2001. 57: p. 1897-1899.
117. Couture, M., et al., A cooperative oxygen-binding hemoglobin from Mycobacterium
tuberculosis. Proc Natl Acad Sci U S A, 1999. 96(20): p. 11223-8.
118. Thorsteinsson, M.V., et al., A cyanobacterial hemoglobin with unusual ligand
binding kinetics and stability properties. Biochemistry, 1999. 38(7): p. 2117-2126.
119. Brunori, M., et al., The role of cavities in protein dynamics: crystal structure of a
photolytic intermediate of a mutant myoglobin. Proc Natl Acad Sci U S A, 2000.
97(5): p. 2058-2063.
120. Lakowicz, J.R. and G. Weber, Quenching of protein fluorescence by oxygen.
Detection of structural fluctuations in proteins on nanosecond time scale.
Biochemistry, 1973. 12(21): p. 4171-4179.
121. Perutz, M.F. and F.S. Mathews, An X-ray study of azide methaemoglobin. Journal of
Molecular Biology, 1966. 21(1): p. 199-202.
122. Tilton, R.F., I.D. Kuntz, and G.A. Petsko, Cavities in proteins: structure of a
metmyoglobin-xenon complex solved to 1.9 A. Biochemistry, 1984. 23(13): p. 2849-
2857.
123. Scott, E.E., Q.H. Gibson, and J.S. Olson, Mapping the pathways for O-2 entry into
and exit from myoglobin. Journal of Biological Chemistry, 2001. 276(7): p. 5177-
5188.
124. Olson, J.S., J. Soman, and G.N. Phillips, Ligand pathways in myoglobin: a review
of Trp cavity mutations. IUBMB Life, 2007. 59(8-9): p. 552-562.
125. Leroux, F., et al., Experimental approaches to kinetics of gas diffusion in
hydrogenase. Proc Natl Acad Sci U S A, 2008.
126. Gibson, Q.H., Hemoproteins, Ligands, and Quanta. Journal of Biological
Chemistry, 1989. 264(34): p. 20155-20158.
127. Tan, X.S., et al., The tunnel of acetyl-coenzyme a synthase/carbon monoxide
dehydrogenase regulates delivery of CO to the active site. Journal of the American
Chemical Society, 2005. 127(16): p. 5833-5839.
128. Chen, L., et al., The Binding and Release of Oxygen and Hydrogen Peroxide Are
Directed by a Hydrophobic Tunnel in Cholesterol Oxidase. Biochemistry, 2008.
47(19): p. 5368-5377.
242
129. Salomonsson, L., et al., A single-amino-acid lid renders a gas-tight compartment
within a membrane-bound transporter. Proceedings of the National Academy of
Sciences of the United States of America, 2004. 101(32): p. 11617-11621.
130. Tan, X., et al., Function of the tunnel in acetylcoenzyme A synthase/carbon
monoxide dehydrogenase. Journal Biological Inorganic Chemistry, 2006. 11(3): p.
371-378.
131. Riistama, S., et al., Channelling of dioxygen into the respiratory enzyme. Biochimia
Biophysica Acta, 1996. 1275(1-2): p. 1-4.
132. Riistama, S., et al., Binding of O2 and its reduction are both retarded by
replacement of valine 279 by isoleucine in cytochrome c oxidase from Paracoccus
denitrificans. Biochemistry, 2000. 39(21): p. 6365-6372.
133. Schlichting, I., et al., Crystal-structure of photolyzed carbonmonoxy-myoglobin.
Nature, 1994. 371(6500): p. 808-812.
134. Schlichting, I. and K. Chu, Trapping intermediates in the crystal: ligand binding to
myoglobin. Current Opinion in Structural Biology, 2000. 10(6): p. 744-752.
135. Ostermann, A., et al., Ligand binding and conformational motions in myoglobin.
Nature, 2000. 404(6774): p. 205-208.
136. Srajer, V., et al., Protein conformational relaxation and ligand migration in
myoglobin: A nanosecond to millisecond molecular movie from time-resolved Laue
X-ray diffraction. Biochemistry, 2001. 40(46): p. 13802-13815.
137. Palmer, A.G., NMR characterization of the dynamics of biomacromolecules.
Chemical Reviews, 2004. 104(8): p. 3623-3640.
138. Case, D.A. and M. Karplus, Dynamics of Ligand-Binding ti Heme-Proteins. Journal
of Molecular Biology, 1979. 132(3): p. 343-368.
139. Karplus, M. and J.A. McCammon, Molecular dynamics simulations of
biomolecules. Nature Structural Biology, 2002. 9(9): p. 646-652.
140. Alder, B.J. and T.E. Wainwright, Phase transition for a hard sphere system. Journal
of Chemical Physics, 1957. 27(5): p. 1208-1209.
141. Alder, B.J. and T.E. Wainwright, Studies in molecular dynamics .I. General
method. Journal of Chemical Physics, 1959. 31(2): p. 459-466.
142. Rahman, A., Correlations in the Motion of Atoms in Liquid Argon. Physical
Review, 1964. 136(2A): p. A405.
143. Stilling.Fh and A. Rahman, Improved simulation of liquid water by molecular
dynamics. Journal of Chemical Physics, 1974. 60(4): p. 1545-1557.
144. Deisenhofer, J. and W. Steigemann, Crystallographic Refinement of Structure of
Bovine Pancreatic Trypsin-Inhibithor at 1.5 A Resolution. Acta Crystallographica
Section B-Structural Science, 1975. B 31(JAN15): p. 238-250.
145. Brooks, B. and M. Karplus, Normal-Modes for Specific Motions of Macromolecules
- Application to the Hinge-Bending Mode of Lysozyme. Proceedings of the National
Academy of Sciences of the United States of America, 1985. 82(15): p. 4995-4999.
146. Colonna-Cesari, F., et al., Interdomain Motion in Liver Alcohol-Dehydrogenase -
Structural and Energetic Analysis of the Hinge Bending Mode. Journal of
Biological Chemistry, 1986. 261(32): p. 5273-5280.
147. Levy, R.M., M. Karplus, and P.G. Wolynes, NMR Relaxation Parameters in
Molecules With Internal Motion - Exact Langevin Trajectory Results Compared
With Simplified Relaxation Models. Journal of the American Chemical Society,
1981. 103(20): p. 5998-6011.
243
148. Olejniczak, E.T., et al., Motional Averaging of Proton Nuclear Overhauser Effects
in Proteins - Predictions from a Molecular-Dynamics Simulations of Lysozyme.
Journal of the American Chemical Society, 1984. 106(7): p. 1923-1930.
149. Brunger, A.T., C.L. Brooks, and M. Karplus, Active-Site Dynamics of Ribonuclease.
Proceedings of the National Academy of Sciences of the United States of America,
1985. 82(24): p. 8458-8462.
150. Nadler, W., et al., Molecular and Stochastic Dynamics of Proteins. Proceedings of
the National Academy of Sciences of the United States of America, 1987. 84(22): p.
7933-7937.
151. Frauenfelder, H., et al., Thermal-Expansion of a Protein. Biochemistry, 1987.
26(1): p. 254-261.
152. Schlick, T., Molecular Modeling and Simulation. 2002: Springer.
153. Kettering, C.F., L.W. Shutts, and D.H. Andrews, A representation of the dynamic
properties of molecules by mechanical models. Physical Review, 1930. 36(3): p.
0531-0543.
154. Born, M. and R. Oppenheimer, Zur Quantentheorie der Molekeln. Annalen der
Physik, 1927. 389(20): p. 457-484.
155. MacKerell, A.D., et al., All-Atom Empirical Potential for Molecular Modeling and
Dynamics Studies of Proteins. Journal of Physical Chemistry B, 1998. 102(18): p.
3586-3616.
156. Brooks, B.R., et al., CHARMM: A program for macromolecular energy,
minimization, and dynamics calculations. Journal of Computational Chemistry,
1983. 4(2): p. 187-217.
157. Lovell, S.C., et al., The penultimate rotamer library. Proteins, 2000. 40(3): p. 389-
408.
158. Steinbach, P.J. and B.R. Brooks, New spherica-cutoff methods for long-range forces
in macromolecular simulation. Journal of Computational Chemistry, 1994. 15(7): p.
667-683.
159. Koehl, P., Electrostatics calculations: latest methodological advances. Current
Opinion in Structural Biology, 2006. 16(2): p. 142-151.
160. Darden, T., D. York, and L. Pedersen, Particle mesh Ewald: An N·log(N) method
for Ewald sums in large systems. The Journal of Chemical Physics, 1993. 98(12): p.
10089-10092.
161. Sagui, C. and T.A. Darden, Molecular dynamics simulations of biomolecules: Long-
range electrostatic effects. Annual Review of Biophysics and Biomolecular
Structure, 1999. 28: p. 155-179.
162. Ryckaert, J.-P., G. Ciccotti, and H.J.C. Berendsen, Numerical integration of the
cartesian equations of motion of a system with constraints: molecular dynamics of
n-alkanes. Journal of Computational Physics, 1977. 23(3): p. 327-341.
163. Verlet, L., Computer experiments on Classical Fluids .I. Thermodynamical
Properties of Lennard-Jones Molecules. Physical Review, 1967. 159(1): p. 98-&.
164. Petrek, M., et al., MOLE: a Voronoi diagram-based explorer of molecular channels,
pores, and tunnels. Structure, 2007. 15(11): p. 1357-1363.
165. Smart, O.S., et al., HOLE: A program for the analysis of the pore dimensions of ion
channel structural models. Journal of Molecular Graphics & Modelling, 1996.
14(6): p. 354-&.
244
166. Dijkstra, E.W., A note on two problems in connexion with graphs. Numerische
Mathematik, 1959. 1(1): p. 269-271.
167. Kleywegt, G.J. and T.A. Jones, Detection, delineation, measurement and display of
cavities in macromolecular structures. Acta Crystallogr D Biol Crystallogr, 1994.
50(Pt 2): p. 178-85.
168. Humphrey, W., A. Dalke, and K. Schulten, VMD: Visual molecular dynamics.
Journal of Molecular Graphics, 1996. 14(1): p. 33-&.
169. Anselmi, M., A. Di Nola, and A. Amadei, The Kinetics of Ligand Migration in
Crystallized Myoglobin as Revealed by Molecular Dynamics Simulations. Biophys.
J., 2008. 94(11): p. 4277-4281.
170. Daigle, R., M. Guertin, and P. Lague, Structural characterization of the tunnels of
Mycobacterium tuberculosis truncated hemoglobin N from molecular dynamics
simulations. Proteins-Structure Function and Bioinformatics, 2009. 75(3): p. 735-
747.
171. Daigle, R., et al., Theoretical Investigations of Nitric Oxide Channeling in
Mycobacterium tuberculosis Truncated Hemoglobin N. Biophysical Journal, 2009.
97(11): p. 2967-2977.
172. Golden, S.D., K.W. Olsen, and K.P. Robert, Identification of Ligand-Binding
Pathways in Truncated Hemoglobins Using Locally Enhanced Sampling Molecular
Dynamics, in Methods in Enzymology. 2008, Academic Press. p. 459-475.
173. Milani, M., et al., Cyanide binding to truncated hemoglobins: a crystallographic
and kinetic study. Biochemistry, 2004. 43(18): p. 5213-21.
174. Milani, M., et al., Mycobacterium tuberculosis hemoglobin N displays a protein
tunnel suited for O2 diffusion to the heme. EMBO Journal, 2001. 20(15): p. 3902-9.
175. Ouellet, Y., et al., Ligand interactions in the distal heme pocket of Mycobacterium
tuberculosis truncated hemoglobin N: roles of TyrB10 and GlnE11 residues.
Biochemistry, 2006. 45(29): p. 8770-81.
176. Cowan, D.A., Thermophilic proteins: Stability and function in aqueous and organic
solvents. Comparative Biochemistry and Physiology a-Molecular & Integrative
Physiology, 1997. 118(3): p. 429-438.
177. Liang, X.Y., et al., Apparent Tradeoff of Higher Activity in MMP-12 for Enhanced
Stability and Flexibility in MMP-3. Biophysical Journal, 2010. 99(1): p. 273-283.
178. Walters, J., et al., Thermodynamic, enzymatic and structural effects of removing a
salt bridge at the base of loop 4 in (pro)caspase-3. Archives of Biochemistry and
Biophysics, 2011. 508(1): p. 31-38.
179. Tian, J., et al., Enhanced thermostability of methyl parathion hydrolase from
Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation.
FEBS Journal, 2010. 277(23): p. 4901-4908.
180. Mishra, S. and M. Meuwly, Nitric oxide dynamics in truncated hemoglobin:
docking sites, migration pathways, and vibrational spectroscopy from molecular
dynamics simulations. Biophysical Journal, 2009. 96(6): p. 2105-2018.
181. Bidon-Chanal, A., et al., Ligand-induced dynamical regulation of NO conversion in
Mycobacterium tuberculosis truncated hemoglobin-N. Proteins, 2006. 64(2): p. 457-
64.
182. Crespo, A., et al., Theoretical study of the truncated hemoglobin HbN: exploring the
molecular basis of the NO detoxification mechanism. Journal American Chemistry
Society, 2005. 127(12): p. 4433-44.
245
183. Mishra, S. and M. Meuwly, Atomistic Simulation of NO Dioxygenation in Group I
Truncated Hemoglobin. Journal of the American Chemical Society, 2010. 132(9): p.
2968-2982.
184. Milani, M., et al., Heme-ligand tunneling in group I truncated hemoglobins. J Biol
Chem, 2004. 279(20): p. 21520-5.
185. Vos, M.H., Ultrafast dynamics of ligands within heme proteins. Biochimica Et
Biophysica Acta-Bioenergetics, 2008. 1777(1): p. 15-31.
186. Salter, M.D., et al., The apolar channel in cerebratulus lacteus hemoglobin is the
route for O2 entry and exit. Journal Biological Chemistry, 2008. 283(51): p. 35689-
35702.
187. Via, L.E., et al., Tuberculous granulomas are hypoxic in guinea pigs, rabbits, and
nonhuman primates. Infection and Immunity, 2008. 76(6): p. 2333-2340.
188. Shi, L., et al., Transcriptional characterization of the antioxidant response of
Mycobacterium tuberculosis in vivo and during adaptation to hypoxia in vitro.
Tuberculosis, 2008. 88(1): p. 1-6.
189. Ouellet, H., et al., Truncated hemoglobin HbN protects Mycobacterium bovis from
nitric oxide. Proceedings of the National Academy of Sciences of the United States
of America, 2002. 99(9): p. 5902-7.
190. Baron, R., et al., Multiple pathways guide oxygen diffusion into flavoenzyme active
sites. Proceedings of the National Academy of Sciences of the United States of
America, 2009. 106(26): p. 10603-10608.
191. Scott, E.E., Q.H. Gibson, and J.S. Olson, Mapping the pathways for O2 entry into
and exit from myoglobin. Journal of Biological Chemistry, 2001. 276(7): p. 5177-
5188.
192. Orlowski, S. and W. Nowak, Oxygen diffusion in minihemoglobin from
Cerebratulus lacteus: a locally enhanced sampling study. Theoretical Chemistry
Accounts, 2007. 117(2): p. 253-258.
193. Pesce, A., et al., Protein structure in the truncated (2/2) hemoglobin family.
IUBMB Life, 2007. 59(8-9): p. 535-541.
194. Tomita, A., et al., Visualizing breathing motion of internal cavities in concert with
ligand migration in myoglobin. Proceedings of the National Academy of Sciences
of the United States of America, 2009. 106(8): p. 2612-2616.
195. Snider, C., et al., MPEx: A tool for exploring membrane proteins. Protein Science,
2009. 18(12): p. 2624-2628.
196. Wang, Y., et al., Exploring gas permeability of cellular membranes and membrane
channels with molecular dynamics. J Struct Biol, 2007. 157(3): p. 534-544.
197. Sinibaldi, F., et al., Extended cardiolipin anchorage to cytochrome c: a model for
protein-mitochondrial membrane binding. Journal of Biological Inorganic
Chemistry. 15(5): p. 689-700.
246
Annexe 1
Matériel supplémentaire du chapitre 6
Figure S1. CHARMM atom types for the iron-porphyrin ring used in the force field
parameters optimization. The heme-bound oxygen molecule, which uses the OM atom type
for both oxygen atoms, is omitted for clarity. The parameters in Table S1 and Table S2 are
given in terms of atom types defined here.
247
Figure S2. Various Gln58(E11) rotamers from typical MD frames for oxy-TrHbN (top) and
deoxyTrHbN (bottom). The (a) tp-100º, (b) mm100º, (c) mt-30º and the (d) tt0º rotamers
are shown. The heme, Phe62(E15), Gln58(E11), Tyr33(B10) and the proximal histidine
His81(F8) are represented with balls and sticks. Hydrogen bonds are represented by dashed
lines with their corresponding length. Pictures were generated using PyMOL (41).
248
Figure S3. Stereo view of the active site configurations observed from typical MD frames
for oxy-TrHbN (top) and deoxy-TrHbN (bottom). The heme, Phe62(E15), Gln58(E11),
Tyr33(B10) and the proximal histidine His81(F8) are represented with balls and sticks.
Hydrogen bonds are represented by dashed lines. Additionnal pictures from different
Gln58(E11) rotamers are available in the supplemental figure S2. Pictures were generated
using PyMOL (41).
249
Table S1. Atomic charges according to the CHARMM atom type
CHARMM atom type CHARMM22 Optimized charges Cytochrome c*
FE 0.24 1.42 1.20
NPH -0.18 -0.65 -0.76
CPA 0.12 0.42 0.32
CPB -0.06 -0.12 0.07
CPM -0.10 -0.27 -0.28
OM (proximal) 0.02 -0.18 -
OM (distal) -0.02 -0.32 -
* Reduced heme with methionine as bound substrate, see Chapter 6, reference #12.
Table S2. Optimized and CHARMM22 OM-OM-FE angle parameter.
Angle (º) Force constant
Optimized 122.22 13.18
CHARMM22 180.00 0.00
250
Annexe 2
Matériel supplémentaire du chapitre 7
Simulation details
MD simulation were performed using CHARMM (2) with the CHARMM22 all-atom
potential energy parameter set (3) with phi, psi cross term map correction CMAP (4), and
modified TIP3P waters (5). Optimized oxygenated heme atomic charges and Fe-O-O angle
parameters were used (1). A 3-point model was used for free •NO molecule and the force
field parameters were derived from ref. (6). This model takes into account the dipole of the
molecule, and accurately reproduces solvation energy (More details on •NO and water
force fields are given in the next section). Electrostatic interactions were calculated via the
Particle Mesh Ewald method (7), using a sixth-order spline interpolation for
complementary function, with κ=0.34 Å-1
, and a fast-Fourier grid density of ≈1 Å-1
. Cutoffs
for the real space portion of the Particle Mesh Ewald calculation and the truncation of the
Lennard-Jones interactions were 10 Å, with the latter smoothed via a shifting function over
the range of 8 Å to 10 Å. The SHAKE algorithm (8) was used to constrain all covalent
bonds involving hydrogen atoms. All simulations employed the leapfrog algorithm and an
integration step of 1 femtosecond. Coordinates were saved every picosecond (ps) for
analysis. Nonbond and image lists were updated heuristically. All simulations were
performed at constant pressure and temperature (NPT ensemble) using Hoover algorithm
for temperature control (9). The mass of the thermal piston was 20,000 kcal•mol-1
•ps2 and
the mass of the pressure piston equaled 1000 amu. All simulations were carried out at 298
K and 1 atm. The net translation and rotation of the systems were removed every 10,000
steps.
251
Ligand binding affinities
The binding affinities of the ligands were estimated from the PMF maps obtained from the
ILS calculations as follows. The equilibrium constant Kb of the binding reaction L+P ⇌ LP
is defined as Kb = [LP]/([L][P]), where [L], [P] and [LP] are the equilibrium concentrations
of the unbound ligand, unbound protein, and bound complex, respectively. The standard
binding free energy is defined from the equilibrium constant by ΔGbº= -kBT ln (CºKb),
where kB is the Boltzmann constant, T the temperature, and Cº is a standard concentration.
Here, the equilibrium association constants were calculated using the PMFs grid
maps obtained from ILS calculations. The relation between the equilibrium constant and
the PMF is given by (10, 11):
∫ [ ( ) ( )]
where r represents the positions of the grid maps, β=1/kBT, w the PMF between the ligand
and the protein, and r' is a reference position far away in the bulk. In our calculations, w(r')
was calculated as the average PMF of the ligand in a water box. The sums were executed
using Simpson's rule. Errors on affinities were estimated from 5 different ILS maps. Local
binding affinities were calculated at the protein surface and inside the tunnels by integrating
over selected grids points. For the surface binding affinity, a 4.5 Å layer of solvent was
considered.
Unless otherwise noted in the main text, all affinity numbers given in this study refer to
Kd=1/Kb.
252
Table S1: Force field parameters for nitric oxide molecule
Molecules Electrostatic Van der Waals
•NO three points model qN = -0.250e
qO = -0.345e
qcom = 0.595e
εN = 0.20 kcal/mol
εO = 0.16 kcal/mol
rN = 2.00 Å
rO = 2.05 Å
The •NO solvation free energies was determined by free energy perturbation molecular
dynamics (FEP-MD) (12). Simulations details are given in the preceding section. The
simulated system consists of cubic box composed of 500 water molecules and one •NO
molecule. Parameters for •NO are given in table S1. 8 FEP-MD simulations were
performed; 4 for both forward and reverse reactions (where NO disappears and appears,
respectively). These calculations returned •NO solvation free energies of 1.6±0.2 kcal/mol,
in agreement with the experimentally measured free energy of 1.53 kcal/mol at 298.15 K
and 1 ATM (13).
Table S2 : •NO and O2 parameters used for implicit ligand sampling and resulting solvation
free energies
Ligands Van der Waals Bond length
(Å)
NO solvation energies
•NO εN = -0.20 rmin/2 = 1.85 Å
εO = -0.12 rmin/2 = 1.70 Å
1.15 1.37±0.03
O2 εO = -0.12 rmin/2 = 1.70 Å 1.21*
1.91±0.03
* In the original paper of Cohen et al. presenting ILS method (14), the O2 bond length
parameter suggested is 1.12 Å. Using this setting, we were unable to reproduce published
value of 1.97 kcal/mol. We contacted Klaus Schulten group (developers of the ILS method)
about this discrepancy and after few communications, they suggested us to use a bond
length of 1.21 Å. This length is close to the experimental value of 1.208 Å published in the
CRC Handbook of Chemistry (pages 9-82 and 9-98) and allows to obtain O2 solvations
energy close to the expected value. The small differences arise from simulation conditions,
like to the use (or not) of rattle to constrain covalent bonds involving hydrogen.
253
Figure S1. Gradient of affinity for nitric oxide calculated as function of the position at the
surface of wild type TrHbN (top) and polar entrance mutant (bottom). Location of the
surface entrances are indicated by magenta arrows. NO affinity was estimated using the
PMF maps obtained from the ILS calculations (see methods section). First, about 5100
coordinates were selected from ILS grid maps. These points surround the entire protein
surface at a distance of about 2.25 Å. For each point, affinity is calculated by integrating
over all PMF grid points located closer than 2.25 Å (spheres of ~48 Å3). Each point is
colored according to the calculated affinity.
254
Three addition molecular movies built from MD simulations snapshots are accessible at the
following internet link:
http://www.cell.com/biophysj/supplemental/S0006-3495(09)01450-7
Movie 1: xe1_ehc_xe2.wmv
Animation presenting a •NO molecule diffusing from LT entrance to Xe2 via EHc.
(LT entrance → Xe1 → EHc → Xe2).
Movie 2 : NO_entering_ST.wmv
Animation presenting a •NO molecule diffusing from the ST entrance to Xe2.
Ile119(H11) side chain is shown with sticks.
Movie 3 : NO_entering_EHT.wmv
Animation presenting a •NO molecule entering EHT and reaching EHc.
255
References
1. Daigle, R., M. Guertin, and P. Lagüe. 2009. Structural characterization of the
tunnels of Mycobacterium tuberculosis truncated hemoglobin N from molecular
dynamics simulations. Proteins-Structure Function and Bioinformatics 75:735-747.
2. Brooks, B. R., R. E. Bruccoleri, B. D. Olafson, D. J. States, S. Swaminathan, and M.
Karplus. 1983. CHARMM: A program for macromolecular energy, minimization,
and dynamics calculations. Journal of Computational Chemistry 4:187-217.
3. MacKerell, A. D., D. Bashford, M. Bellott, R. L. Dunbrack, J. D. Evanseck, M. J.
Field, S. Fischer, J. Gao, H. Guo, S. Ha, D. Joseph-McCarthy, L. Kuchnir, K.
Kuczera, F. T. K. Lau, C. Mattos, S. Michnick, T. Ngo, D. T. Nguyen, B. Prodhom,
W. E. Reiher, B. Roux, M. Schlenkrich, J. C. Smith, R. Stote, J. Straub, M.
Watanabe, J. Wiorkiewicz-Kuczera, D. Yin, and M. Karplus. 1998. All-Atom
Empirical Potential for Molecular Modeling and Dynamics Studies of Proteins.
Journal of Physical Chemistry B 102:3586-3616.
4. Mackerell, A. D., M. Feig, and C. L. Brooks. 2004. Extending the treatment of
backbone energetics in protein force fields: limitations of gas-phase quantum
mechanics in reproducing protein conformational distributions in molecular
dynamics simulations. J Comput Chem 25:1400-1415.
5. Price, D. J., and C. L. B. III. 2004. A modified TIP3P water potential for simulation
with Ewald summation. The Journal of Chemical Physics 121:10096-10103.
6. Meuwly, M., O. M. Becker, R. Stote, and M. Karplus. 2002. NO rebinding to
myoglobin: a reactive molecular dynamics study. Biophys Chem 98:183-207.
7. Darden, T., D. York, and L. Pedersen. 1993. Particle mesh Ewald: An N·log(N)
method for Ewald sums in large systems. The Journal of Chemical Physics
98:10089-10092.
8. Ryckaert, J.-P., G. Ciccotti, and H. J. C. Berendsen. 1977. Numerical integration of
the cartesian equations of motion of a system with constraints: molecular dynamics
of n-alkanes. Journal of Computational Physics 23:327-341.
9. Feller, S. E., Y. Zhang, R. W. Pastor, and B. R. Brooks. 1995. Constant pressure
molecular dynamics simulation: The Langevin piston method. The Journal of
Chemical Physics 103:4613-4621.
10. Chandler, D., and L. R. Pratt. 1976. Statistical mechanics of chemical equilibria and
intramolecular structures of nonrigid molecules in condensed phases. The Journal of
Chemical Physics 65:2925-2940.
11. Simonson, B. R. a. T. 1999. Implicit solvent models. Biophys Chem 78:1-20.
256
12. Kollman, P. 1993. Free-Energy Calculations - Applications to chemical and
biochemical phenomena. Chemical Reviews 93:2395-2417.
13. Scharlin, P., R. Battino, E. Silla, I. Tunon, and J. L. Pascual-Ahuir. 1998. Solubility
of gases in water: Correlation between solubility and the number of water molecules
in the first solvation shell. Blackwell Science Ltd. 1895-1904.
14. Cohen, J., A. Arkhipov, R. Braun, and K. Schulten. 2006. Imaging the migration
pathways for O2, CO, NO, and Xe inside myoglobin. Biophys J 91:1844-1857.
257
Annexe 3
Matériel supplémentaire du chapitre 8
Methods
NMR
Protein expression, labeling, and purification - Construction of pET3a plasmid
containing the glbN gene lacking the pre-A helix. We used the PCR to amplify the coding
region lacking residues 1 to 12 from the pET3a plasmid containing the glbN gene (1). The
DNA primers used were 5'-GACCCATATGATCAGCATCTACGACAAGATCGG-3'
(upper primer) and 5'-GATGGATCCTCAGACTGGTGCCGTGGTG-3' (lower primer).
Protein expression and labeling. E. coli BL21(DE3) cells were transformed with pET3a
plasmid containing glbN (1) or ΔpreA-glbN gene. Transformed cells were spread on LB
agar plates containing 200 μg/ml ampicilin (Roche Diagnostic) and grown overnight at 37
°C. Ten colonies were used to inoculate 125 ml LB medium supplemented with 200 μg/ml
ampicillin. The culture was incubated at 37°C until OD600 nm reached 0.5-0.6. Ten milliliters
of the preculture was used to inoculate 1L of M9 medium (48 mM Na2HPO4, 22 mM
KH2PO4, 8,5 mM NaCl, 18,7 mM NH4Cl 20 mM glucose, 2 mM MgSO4, 2 μM FeCl3, 100
μM CaCl2, 50 μM ZnSO4, 7.8 μM Thiamin-HCl, BME vitamin solution (Sigma Aldrich)
diluted 1/2000 and 200 μg/ml ampicillin) in a 3L Vessel (BioFlo 110 fermentor, New
Brunswick Scientific CO., Edison, NJ). Cells were grown at 37 °C with agitation.
Dissolved oxygen was maintained at 30 % and pH was maintained between 7.2 and 7.5.
When OD600 nm reached 0.9, cells were induced with 0.5 mM IPTG for 16-18h at 25 °C
with same conditions for dissolved oxygen and pH 15
NH4Cl (Cambridge isotope laboratory,
Andover, MA) was added to obtain 15
N-labeled protein. For 13
C15
N labeled protein, (13
C)-
Glucose (Cambridge isotope laboratory, Andover, MA) was used.
Purification of apo-TrHbN. Cell suspension was centrifuged 15 min at 5,000 x g, 4 °C. Cell
pellets were suspended in lysis buffer (50 mM Tris, 1 mM PMSF, pH 7.5) supplemented
with DNase I (1 μg/g wet cell) (Roche Diagnostic) and broken by passing them twice
through a French pressure cell operated at 20, 000 psi. The cell lysate was centrifuged 15
258
min at 4 °C at 16,000 x g. The supernatant was discarded and the pellet was washed twice
with 60 ml wash buffer (5mM Tris, 50 μM EDTA, 1mM PMSF and 0.5% triton X-100) at 4
°C and centrifuged 15 min at 4 °C at 16,000 x g. Inclusion bodies containing apo-TrHbN
were solubilized at room temperature with 40 mL urea solution (8 M deionized urea, 50
mM Tris, 50 μM EDTA, pH 7.5) by gentle shaking until solution was clear and centrifuged
at 31,000 x g, 15 min at room temperature. Supernatant was dialyzed overnight at 4 °C
against reconstitution buffer (50 mM tris, 50 μM EDTA, pH 7,5) (6−8 kDa molecular mass
cutoff membranes from Spectrapor). ApoTrHbN solution was centrifuged at 31,000 x g for
10 min at 4 °C before reconstitution.
Reconstitution of holo-TrHbN. Reconstitution was performed as described in
reference (2). Protein and hemin were stirred gently for 30 min in the dark for complete
reconstitution of holo-TrHbN. Hemin excess was removed by fractionation with
ammonium sulfate (40-80%). The precipitate was centrifuged at 10,000 x g for 20 min at 4
°C and resuspended in small amount of 50 mM tris, 50 μM EDTA and 300 mM NaCl
buffer and dialyzed over night against the same buffer at 4 °C. The protein mixture was
loaded onto a Hiload 26/60 Superdex 75 gel-filtration column (GE Healthcare) equilibrated
with the same buffer and monitored with AKTA FPLC (GE Healthcare) at 4 °C. Fraction
with a 412 nm/218 nm ratio between 5 and 7 were pooled and concentrated by ammonium
sulfate precipitation (75% saturation). After centrifugation (10,000 x g, 20 min, 4 °C) the
precipitate was dissolved in 20mM KH2PO4, 50 μM EDTA, pH 7.5 and dialyzed overnight
against same buffer. Purified protein was concentrated with centricon Ultracel YM-
10 (Amicon) and heme concentration was determined by pyridine-hemochrome method (3).
15N NMR relaxation experiments - Relaxation delays for R1 were 10.9, 21.8 (x2), 43.6,
87.2 (x2), 174.4, 348.9 (x2), 697.7 (x2), 11395.4, and 1994.5 ms. For R2, relaxation delays
were 10, 30 (x2), 50, 70 (x2), 90 (x2), 130 (x2), 170, 210, and 250 ms. For both R1 and R2
experiments, eight transients were recorded per FID with a recycle delay of 2s and these
experiments were recorded in an interleaved manner in order to avoid effect of field or
sample variation as a function of time (4). For {1H}-
15N NOE measurements at 500 and
600 MHz, spectra were recorded with and without 1H saturation, with 44 transients. A
saturation time of 4s was used and recycle delays were of 5s for experiments with and
259
without saturation (4s of saturation + 1s of blank delay, or 5s of blank delay, respectively).
For the NOE experiments recorded at 800 MHz, we had to set the saturation time to 10s in
order to obtain reliable values. Indeed, longer delays are sometimes needed at higher
magnetic field because the cross-correlation between 1H-
15N dipole and
15N chemical shift
anisotropy becomes significant for small proteins (5). R1 and R2 rates were extracted with
the program relax (6, 7) and errors were initially estimated from 500 Monte Carlo
simulations according to experiments acquired in duplicata. Errors were doubled in order to
avoid over fitting during model-free analysis. NOE values were obtained from the ratio of
the intensities of peaks from experiments recorded with and without proton saturation and
errors were derived from the noise. To verify integrity of the sample during the time needed
for acquisition of the three relaxation parameters (R1, R2, and NOE), R2 data were
recorded both at the beginning and at the end of acquisition at each magnetic field. As R2
values are very sensitive to changes in the homogeneity of the sample, we assumed that our
samples were stable when R2 values were not significantly different. This was as in Morin
and Gagné (8).
Model-free analysis - The model-free analysis (9, 10) was performed using an axially
symmetric diffusion tensor with the program MODELFREE 4.20 (A.G. Palmer III,
Columbia University, New York, NY). Validation tests were performed with our multiple
field data (11) and it appeared that the R2 values recorded at 800 MHz were slightly
inconsistent with other datasets, so we chose not to use these. Only residues with data
available at the three magnetic fields were used in this analysis, in order to avoid under- or
overfitting (8). An initial estimate of the diffusion tensor was obtained by using the inertia
and diffusion tensors package from A.G. Palmer lab (pdbinertia 1.11, R2R1_diffusion 1.11,
and Quadric 1.13), with the structure PDB 1S61 chain B. This chain was used because it
contains all the C-terminus residues, which is not the case for chain A, where the structure
does not contain residues 130-136. For this estimation, only residues located in secondary
structures were used and residues with NOE values ≤ 0.65 were removed as well as
residues with high values of R2 (unless their R1 values were low) (12). For the selection of
model-free models, data were best fit to the five models and 8 iterations of model selection
were performed in order to obtain stable diffusion tensor parameters. After 3 iterations of
global optimization of the tensor, all residues were included and a final run was performed
260
with fixed diffusion tensor parameters. A 1.02 Å 1H-
15N bond length and a -172 ppm 15N
chemical shift anisotropy were assumed.
Amide exchange experiments - NMR spectra were recorded at the following delays
following solubilization of lyophilized protein in D2O: 40; 50; 60; 70; 80; 100; 110; 120;
130; 140; 150; 164; 184; 243; 262; 282; 302; 322; 341; 371; 410; 449; 489; 528; 567; 617;
646; 686; 725; 764; 803; 843; 882; 1138; 1257; 1398; 1467; 1844; 2818; 3120; 6073;
11,385; 27,322; 37,515; and 60,478 min. At pH 8.5, 42 spectra were recorded at these
delays: 39; 48; 58; 68; 78; 88; 98; 108; 118; 128; 162; 182; 202; 221; 241; 280; 300; 320;
340; 369; 408; 448; 487; 526; 566; 605; 644; 684; 723; 762; 802; 841; 880; 1210; 1348;
1496; 2633; 6138; 6959; 8710; 12,716; and 18,773 min. At the beginning, spectra with a
low number of transients were recorded; as time passed, a higher number of transients were
recorded to ensure a higher S/N. Thus, depending on when the spectra were recorded, 2, 4,
or 8 transients were used for NMR data averaging. Amide exchange rates were extracted
from the peak intensities using the following equation:
It = I0 exp(-kex • t) + I∞,
where I is the intensity at time 0, t or infinity (offset, accounting for residual 1H in
solution), and kex is the exchange rate. Fits were performed using the program CURVEFIT
(A. G. Palmer, Columbia University, New York, NY) and errors were estimated from either
500 Monte Carlo simulations or the Jackknife approach, using the method which yielded
the highest errors in all cases. To avoid inclusion of noise into the fit of fast exchanged NH
groups, datasets were manually trimmed in order to include approximately five data points
when exchange was completed (i.e. when amplitude yielded a plateau of value ~I∞). From
the kex values at pH 7.5, ΔGHX (the free energy for the opening of the structure protecting
the NH group from exchange), Kop (the opening rate for exposure of the NH group) and SF
(the slowing factor for the NH group exchange) were calculated within Excel using a
spreadsheet from S. W. Englander (University of Pennsylvania, Philadelphia, PA), and kc
values (intrinsic rates of exchange for the free amino acids in solution) were from (13, 14).
261
Molecular dynamics simulations
Force field optimization of the cyanide-bound heme atomic charges and Fe-C-N angle
parameter - CHARMM22 lacks parameters for the cyanide-bound heme. In this work, to
simulate CN-bound TrHbN, the atomic charges of heme prosthetic group as well as the
cyanide and the Fe-C-N angle parameter were optimized following the standard
parametrization protocol for the CHARMM22 force field (15). Ab initio quantum
mechanical (QM) calculations were performed using the program Gaussian 03 (16). The
B3LYP/6-31G* level of theory was used for the initial geometry optimization and
subsequent single point calculations. This level of theory was applied successfully to the
parametrization of the CHARMM force field of iron–porphyrin systems (17, 18). The
atoms included for this procedure are those of the central iron–porphyrin ring and those of
the linking molecules CN- and imidazole. The heme side groups were omitted. Initial atom
coordinates were taken from the oxygenated TrHbN crystal structure (PDB accession code
1RTE (A chain)). The atomic charges were obtained from the optimized geometry
Mulliken charges, adjusted consistently with the electrostatic fitting procedure of the
parametrization protocol (15). The potential energy of interaction between the CN ligand
and a water molecule was calculated from the difference in QM energies of a gas-phase
system-water complex and the isolated molecules. For this calculation, the single point
calculations were performed while keeping the intramolecular geometry of each molecule
kept fixed.
The optimum Fe-C-N angle was determined at 180° while a zero force constant was found
through optimization procedure. The heme atom repulsion on cyanide N atom suffices to
favor a linear Fe-C-N angle. In wild type TrHbN, Fe-C-N angle is slightly bent, varying
from 165° to 171° (PDB accession 1RTE and 1S61). In agreement, using this set of
parameters, an equilibrium angle of 166.9° (standard error below 0.1° and standard
deviation of ±6.8°) was obtained in the MD simulations presented here.
Systems and simulation setup - Initial coordinates were taken from wild type cyanomet
TrHbN crystallographic structure (PDB 1RTE) (19). Crystallographic water and sulfate
262
ions were ignored. Hydrogen atoms were added using CHARMM’s HBUILD facility (20).
All ionisable residues were considered in their standard protonation state at pH 7.0 with
neutral histidine protons placed at the ND1 position. The crystal unit cell contained two
TrHbN molecules (A and B chains). Both chains were used individually to start two
independent MD simulations in order to increase sampling (trajectories identified hereafter
as A-TrHbN and B-TrHbN). For each chain, the missing C-terminal end (8 residues) was
built using internal coordinates definition of CHARMM. The C-terminal end was optimally
positioned by performing 3 ns Langevin dynamics using CHARMM with a 1 fs time step
and a friction coefficient FBETA of 5 ps-1 while keeping constrained all coordinates from
the crystal structure. The converged structures were immersed in a cubic box containing
preequilibrated TIP3P waters. This water box had a volume of ~ 4.4×105 Å3 (box edge of
76 Å) and contained 15,137 water molecules. Five sodium ions were added to neutralize
the charges of the system. Water molecules within 2.8 Å of any protein atom were deleted,
the resulting system contained 44,672 and 44,648 atoms for A-TrHbN and B-TrHbN,
respectively. The energy of the systems was minimized with 5,000 conjugate gradient steps
while keeping fixed all protein atoms at their crystallographic position. Two independent
85 ns trajectories of these systems were produced. In the equilibrium phase, all protein
atoms were fixed at their crystallographic position during the first 500 ps. In the following
500 ps, only the protein backbone was constrained. After the first nanosecond (ns), all
atoms were unconstrained. The first 5 ns were not considered for analyses giving a total of
160 ns simulation time in production mode.
MD simulations were performed using NAMD 2.6 software (21)¸with the CHARMM22
all-atom potential energy parameter set (15) with φ, ψ cross term map correction (CMAP)
(22) and modified TIP3P waters (23). Electrostatic interactions were calculated via the
Particle Mesh Ewald method (24) using a sixth-order spline interpolation for
complementary function and a grid spacing of 1.0 Å. Water molecules were kept rigid
using the SETTLE algorithm (25). For non-water molecules, covalent bonds involving
hydrogen atoms were kept at their equilibrium length using the SHAKE algorithm (26).
The Lennard-Jones interactions were smoothed over the distance range of 8 Å to 10 Å.
Long range electrostatics were computed every two steps. The non-bonded pair list was
updated every 10 steps. Simulations were performed at constant pressure and temperature
263
(NPT ensemble) at 298.15 K and 1 ATM and an integration timestep of 1 fs. Temperature
was controlled using a Lanvegin dynamics and the pressure using the Langevin piston
method. The damping coefficient was set to 1 ps-1, the Langevin piston period was set 100
fs and the Langevin piston decay to 50 fs. Coordinates were saved every ps for analysis.
264
Table S1. Optimized CN-bound heme atomic charges
CHARMM atom type Optimized charges
(E)
FE +1.29
NPH -0.72
CPA +0.36
CPB -0.04
CPM -0.23
C1 -0.10
N1 -0.51
265
Table S2: 15
N spin relaxation data
Residues 500 MHz 600 MHz 800 MHz
# AA R1 (s-1) δR1 (-1) R2 (-1) δR2 (-1) NOE δNOE R1 (s
-1) δR1 (-1) R2 (-1) δR2 (-1) NOE δNOE R1 (s-1) δR1 (-1) NOE δNOE
1 M
2 G
3 L
4 L
5 S
6 R
7 L 1.962 0.095 5.719 0.188 -0.122 0.037 1.474 0.043 5.632 0.158 0.022 0.028 1.522 0.148 0.315 0.023
8 R
9 K
10 R
11 E 1.866 0.053 7.082 0.121 0.182 0.028 1.387 0.025 6.753 0.102 0.244 0.020 1.188 0.065 0.365 0.016
12 P
13 I 1.648 0.023 7.708 0.062 0.318 0.019 1.308 0.016 8.180 0.070 0.350 0.016 1.086 0.034 0.471 0.012
14 S 1.689 0.035 11.388 0.138 0.530 0.028 1.346 0.024 12.576 0.190 0.540 0.021 1.025 0.057 0.619 0.020
15 I 1.844 0.046 12.462 0.183 0.797 0.031 1.370 0.029 13.221 0.256 0.810 0.025 1.005 0.063 0.811 0.021
16 Y 1.767 0.040 12.654 0.173 0.817 0.030 1.286 0.025 13.008 0.193 0.793 0.022 0.972 0.052 0.813 0.019
17 D 1.723 0.030 12.348 0.132 0.805 0.021 1.343 0.020 13.684 0.179 0.748 0.019 0.975 0.039 0.844 0.016
18 K
19 I 1.672 0.032 12.332 0.143 0.801 0.026 1.251 0.021 12.924 0.160 0.696 0.020 0.928 0.041 0.850 0.017
20 G 1.680 0.028 12.012 0.112 0.787 0.020 1.249 0.014 13.395 0.139 0.757 0.016 0.964 0.037 0.809 0.014
21 G 1.705 0.025 11.416 0.102 0.727 0.018 1.342 0.016 12.351 0.122 0.784 0.016 1.033 0.036 0.836 0.015
22 H 1.741 0.032 13.476 0.149 0.750 0.022 1.324 0.020 13.882 0.186 0.748 0.019 0.962 0.045 0.870 0.018
23 E 1.537 0.022 14.057 0.113 0.687 0.017 1.163 0.012 15.397 0.177 0.789 0.014 0.941 0.034 0.771 0.013
24 A 1.540 0.015 12.369 0.072 0.757 0.014 1.203 0.010 13.553 0.094 0.744 0.012 0.886 0.021 0.789 0.010
25 I 1.571 0.023 13.254 0.132 0.747 0.022 1.178 0.016 14.674 0.188 0.755 0.018 0.818 0.036 0.792 0.016
26 E 1.499 0.025 14.563 0.154 0.716 0.024 1.194 0.019 16.169 0.234 0.778 0.021 0.818 0.051 0.811 0.020
27 V
28 V 1.534 0.020 12.736 0.119 0.772 0.020 1.199 0.015 14.108 0.154 0.764 0.018 0.890 0.033 0.823 0.015
29 V
30 E 1.468 0.019 15.043 0.127 0.705 0.018 1.095 0.012 16.205 0.162 0.815 0.015 0.822 0.028 0.904 0.014
31 D 1.485 0.021 14.534 0.133 0.756 0.020 1.137 0.014 15.876 0.183 0.807 0.016 0.862 0.029 0.832 0.013
32 F 1.542 0.023 13.628 0.124 0.785 0.018 1.226 0.015 15.113 0.175 0.786 0.017 0.856 0.027 0.841 0.013
33 Y 1.560 0.026 14.136 0.137 0.730 0.021 1.178 0.015 15.742 0.189 0.777 0.017 0.859 0.033 0.865 0.015
34 V 1.433 0.020 14.412 0.128 0.789 0.019 1.078 0.013 15.444 0.140 0.811 0.015 0.813 0.028 0.809 0.012
35 R 1.524 0.027 14.009 0.161 0.788 0.023 1.135 0.018 15.321 0.219 0.787 0.018 0.885 0.042 0.817 0.016
(Table continued on next page)
Table S2: 15
N spin relaxation data
266
Residues 500 MHz 600 MHz 800 MHz
# AA R1 (s-1) δR1 (-1) R2 (-1) δR2 (-1) NOE δNOE R1 (s
-1) δR1 (-1) R2 (-1) δR2 (-1) NOE δNOE R1 (s-1) δR1 (-1) NOE δNOE
36 V 1.523 0.024 13.910 0.152 0.759 0.021 1.155 0.015 14.581 0.179 0.777 0.017 0.824 0.035 0.806 0.015
37 L 1.521 0.023 14.830 0.150 0.775 0.021 1.172 0.016 16.246 0.188 0.755 0.016 0.823 0.035 0.867 0.016
38 A 1.494 0.021 14.255 0.119 0.767 0.017 1.128 0.012 15.632 0.165 0.793 0.014 0.834 0.028 0.880 0.013
39 D 1.682 0.023 11.602 0.085 0.783 0.016 1.258 0.013 12.348 0.103 0.793 0.013 0.940 0.026 0.841 0.011
40 D 1.792 0.027 12.014 0.102 0.680 0.017 1.295 0.015 12.790 0.121 0.792 0.013 1.035 0.037 0.793 0.012
41 Q 1.545 0.021 13.671 0.099 0.721 0.016 1.147 0.012 14.468 0.128 0.794 0.012 0.862 0.027 0.803 0.011
42 L 1.639 0.028 12.181 0.144 0.695 0.021 1.261 0.018 12.953 0.151 0.763 0.018 0.907 0.037 0.796 0.014
43 S 1.746 0.022 11.757 0.078 0.764 0.016 1.230 0.014 12.436 0.102 0.735 0.012 0.974 0.027 0.816 0.011
44 A 1.943 0.027 12.115 0.092 0.758 0.015 1.442 0.014 12.894 0.097 0.753 0.012 1.095 0.035 0.802 0.011
45 F 1.718 0.022 11.935 0.095 0.797 0.017 1.310 0.013 12.742 0.097 0.809 0.013 0.957 0.029 0.866 0.012
46 F 1.753 0.033 11.953 0.123 0.775 0.022 1.288 0.019 12.607 0.154 0.757 0.018 0.942 0.037 0.848 0.016
47 S 1.669 0.017 12.302 0.064 0.775 0.012 1.253 0.009 13.193 0.071 0.771 0.009 0.932 0.018 0.825 0.008
48 G
49 T 1.759 0.024 11.419 0.086 0.760 0.016 1.284 0.012 12.009 0.089 0.784 0.012 0.972 0.025 0.810 0.010
50 N
51 M 1.997 0.102 13.653 0.390 0.791 0.042 1.298 0.040 14.625 0.503 0.785 0.030 0.934 0.101 0.822 0.026
52 S 1.758 0.085 13.490 0.327 0.673 0.035 1.231 0.033 15.050 0.389 0.791 0.027 0.883 0.082 0.817 0.024
53 R 1.620 0.027 13.988 0.139 0.789 0.021 1.166 0.014 14.387 0.151 0.768 0.016 0.904 0.035 0.792 0.014
54 L
55 K 1.659 0.031 12.742 0.139 0.720 0.023 1.271 0.018 13.776 0.169 0.749 0.018 0.911 0.038 0.801 0.016
56 G 1.549 0.025 13.217 0.135 0.779 0.022 1.182 0.016 14.638 0.169 0.775 0.018 0.846 0.033 0.832 0.015
57 K
58 Q 1.673 0.025 12.301 0.121 0.797 0.021 1.338 0.018 13.079 0.149 0.782 0.017 0.977 0.043 0.876 0.016
59 V 1.581 0.025 12.686 0.136 0.757 0.022 1.229 0.016 13.848 0.159 0.799 0.017 0.910 0.037 0.780 0.015
60 E 1.610 0.022 13.395 0.123 0.741 0.019 1.151 0.013 14.581 0.137 0.795 0.015 0.895 0.029 0.824 0.013
61 F 1.657 0.024 13.129 0.126 0.717 0.021 1.267 0.015 14.161 0.163 0.776 0.015 0.913 0.034 0.881 0.015
62 F 1.720 0.028 12.763 0.134 0.720 0.020 1.314 0.017 13.881 0.176 0.763 0.016 0.977 0.037 0.869 0.016
63 A 1.651 0.019 13.244 0.108 0.754 0.016 1.243 0.012 14.303 0.126 0.774 0.013 0.920 0.030 0.800 0.013
64 A 1.553 0.018 13.512 0.103 0.723 0.017 1.193 0.011 14.608 0.120 0.729 0.013 0.885 0.026 0.831 0.013
65 A
66 L 1.666 0.026 11.819 0.114 0.783 0.023 1.263 0.019 12.536 0.151 0.791 0.019 0.930 0.035 0.815 0.015
67 G 1.520 0.025 14.286 0.142 0.796 0.022 1.142 0.017 15.914 0.192 0.777 0.018 0.861 0.036 0.822 0.016
68 G 1.496 0.027 14.130 0.152 0.720 0.023 1.188 0.017 14.973 0.187 0.785 0.018 0.855 0.037 0.832 0.015
69 P
70 E 1.688 0.025 10.935 0.088 0.706 0.020 1.323 0.017 10.992 0.122 0.747 0.018 0.959 0.038 0.765 0.014
(Table continued on next page)
Table S2: 15
N spin relaxation data
267
Residues 500 MHz 600 MHz 800 MHz
# AA R1 (s-1) δR1 (-1) R2 (-1) δR2 (-1) NOE δNOE R1 (s
-1) δR1 (-1) R2 (-1) δR2 (-1) NOE δNOE R1 (s-1) δR1 (-1) NOE δNOE
71 P
72 Y 1.529 0.023 10.609 0.083 0.687 0.019 1.179 0.014 11.343 0.105 0.684 0.014 0.893 0.028 0.725 0.012
73 T 1.862 0.053 12.031 0.198 0.686 0.029 1.343 0.027 12.621 0.232 0.795 0.023 1.071 0.080 0.750 0.020
74 G
75 A 1.747 0.026 11.244 0.105 0.727 0.020 1.306 0.017 12.020 0.127 0.710 0.016 1.034 0.046 0.759 0.015
76 P
77 M 1.616 0.045 14.465 0.241 0.795 0.034 1.306 0.027 15.628 0.337 0.801 0.026 0.980 0.064 0.865 0.022
78 K 1.625 0.044 13.845 0.217 0.808 0.027 1.286 0.028 14.130 0.259 0.765 0.024 0.901 0.066 0.790 0.022
79 Q 1.391 0.016 11.652 0.085 0.590 0.016 1.083 0.011 12.467 0.102 0.632 0.013 0.857 0.024 0.669 0.012
80 V 1.474 0.022 13.925 0.136 0.597 0.020 1.159 0.015 15.360 0.168 0.712 0.016 0.858 0.035 0.773 0.017
81 H 1.670 0.042 12.280 0.217 0.618 0.031 1.286 0.033 12.946 0.333 0.755 0.033 0.993 0.121 0.756 0.040
82 Q 1.559 0.017 12.073 0.084 0.726 0.016 1.164 0.011 12.966 0.106 0.754 0.013 0.904 0.026 0.770 0.012
83 G 1.506 0.025 12.933 0.122 0.723 0.021 1.131 0.014 13.350 0.151 0.721 0.017 0.881 0.031 0.776 0.015
84 R 1.928 0.048 11.901 0.160 0.778 0.025 1.424 0.023 12.767 0.188 0.776 0.019 1.063 0.055 0.858 0.018
85 G 1.717 0.026 11.232 0.105 0.778 0.019 1.342 0.017 11.866 0.125 0.810 0.017 0.977 0.035 0.830 0.013
86 I 1.670 0.039 11.584 0.168 0.762 0.029 1.262 0.026 12.166 0.201 0.761 0.026 0.974 0.064 0.851 0.023
87 T 1.547 0.024 13.303 0.111 0.786 0.018 1.129 0.013 14.167 0.123 0.750 0.013 0.862 0.026 0.828 0.011
88 M
89 H
90 H 1.595 0.028 13.901 0.141 0.745 0.021 1.141 0.017 14.949 0.161 0.806 0.017 0.868 0.036 0.822 0.015
91 F 1.506 0.018 14.115 0.105 0.767 0.016 1.104 0.012 15.139 0.119 0.786 0.013 0.824 0.023 0.851 0.011
92 S 1.569 0.025 13.958 0.142 0.760 0.019 1.100 0.016 14.837 0.157 0.803 0.016 0.853 0.036 0.884 0.014
93 L 1.565 0.026 13.040 0.131 0.744 0.019 1.210 0.016 14.413 0.173 0.830 0.016 0.784 0.033 0.822 0.014
94 V 1.544 0.019 14.040 0.113 0.746 0.017 1.169 0.013 15.170 0.124 0.782 0.014 0.863 0.024 0.785 0.012
95 A 1.484 0.021 14.327 0.144 0.779 0.020 1.161 0.013 16.343 0.180 0.821 0.015 0.837 0.028 0.856 0.014
96 G 1.534 0.019 13.473 0.110 0.820 0.017 1.107 0.012 14.868 0.130 0.758 0.013 0.862 0.025 0.843 0.011
97 H 1.611 0.023 12.938 0.108 0.714 0.019 1.202 0.015 14.659 0.161 0.784 0.017 0.869 0.033 0.844 0.014
98 L 1.493 0.016 13.836 0.091 0.717 0.014 1.096 0.010 14.731 0.099 0.754 0.011 0.854 0.020 0.820 0.010
99 A 1.489 0.019 14.801 0.155 0.738 0.017 1.164 0.011 15.711 0.140 0.774 0.012 0.841 0.027 0.880 0.013
100 D 1.612 0.020 13.710 0.106 0.763 0.017 1.224 0.012 15.016 0.145 0.779 0.013 0.923 0.029 0.831 0.012
101 A 1.495 0.025 13.898 0.143 0.756 0.023 1.156 0.017 14.912 0.193 0.759 0.018 0.850 0.037 0.820 0.016
102 L 1.521 0.026 14.547 0.141 0.713 0.021 1.110 0.013 15.717 0.176 0.774 0.015 0.836 0.034 0.831 0.015
103 T 1.573 0.019 14.442 0.112 0.821 0.015 1.165 0.011 15.685 0.129 0.778 0.012 0.896 0.025 0.872 0.010
104 A 1.542 0.017 12.616 0.080 0.739 0.015 1.172 0.010 13.852 0.102 0.787 0.011 0.867 0.022 0.838 0.010
105 A 1.477 0.019 13.341 0.113 0.784 0.018 1.106 0.014 15.203 0.157 0.767 0.015 0.808 0.031 0.769 0.013
(Table continued on next page)
Table S2: 15
N spin relaxation data
268
Residues 500 MHz 600 MHz 800 MHz
# AA R1 (s-1) δR1 (-1) R2 (-1) δR2 (-1) NOE δNOE R1 (s
-1) δR1 (-1) R2 (-1) δR2 (-1) NOE δNOE R1 (s-1) δR1 (-1) NOE δNOE
106 G 1.692 0.033 12.584 0.165 0.793 0.024 1.237 0.021 13.656 0.194 0.733 0.019 0.911 0.050 0.779 0.017
107 V
108 P
109 S
110 E
111 T
112 I 1.591 0.018 14.721 0.095 0.808 0.015 1.178 0.011 14.539 0.103 0.797 0.012 0.907 0.025 0.795 0.010
113 T
114 E 1.559 0.017 12.792 0.088 0.800 0.015 1.249 0.012 13.691 0.111 0.784 0.012 0.883 0.023 0.875 0.010
115 I 1.637 0.022 12.181 0.116 0.769 0.019 1.333 0.017 12.705 0.138 0.768 0.016 0.932 0.036 0.787 0.014
116 L 1.680 0.027 13.555 0.127 0.782 0.022 1.282 0.015 14.762 0.154 0.798 0.016 0.926 0.033 0.835 0.016
117 G 1.494 0.019 13.493 0.107 0.815 0.017 1.131 0.013 14.863 0.134 0.803 0.014 0.852 0.028 0.843 0.012
118 V 1.578 0.020 11.835 0.103 0.786 0.018 1.303 0.014 13.147 0.114 0.772 0.014 0.936 0.027 0.850 0.012
119 I 1.596 0.029 12.881 0.163 0.732 0.024 1.248 0.020 14.101 0.188 0.747 0.019 0.891 0.043 0.849 0.018
120 A 1.499 0.019 13.287 0.108 0.741 0.017 1.201 0.013 13.844 0.124 0.751 0.014 0.819 0.030 0.857 0.013
121 P
122 L 1.515 0.019 12.488 0.116 0.750 0.018 1.231 0.014 13.716 0.127 0.810 0.015 0.863 0.027 0.822 0.013
123 A 1.561 0.015 13.208 0.084 0.743 0.014 1.221 0.011 14.370 0.104 0.797 0.012 0.852 0.025 0.902 0.012
124 V 1.417 0.016 13.605 0.107 0.729 0.016 1.055 0.010 14.992 0.123 0.678 0.013 0.825 0.024 0.757 0.012
125 D 1.422 0.017 11.964 0.095 0.676 0.016 1.074 0.011 12.967 0.108 0.659 0.014 0.836 0.024 0.739 0.012
126 V 1.558 0.030 13.161 0.156 0.733 0.026 1.217 0.019 14.656 0.199 0.725 0.021 0.877 0.043 0.819 0.021
127 T 1.548 0.028 12.408 0.142 0.710 0.022 1.178 0.017 14.072 0.172 0.743 0.017 0.862 0.034 0.802 0.015
128 S
129 G 2.050 0.126 7.635 0.271 0.433 0.042 1.513 0.047 7.633 0.240 0.548 0.031 1.243 0.126 0.605 0.026
130 E 1.946 0.042 6.535 0.072 0.236 0.018 1.563 0.017 6.146 0.069 0.325 0.013 1.366 0.048 0.480 0.012
131 S
132 T
133 T 1.532 0.096 3.631 0.173 -0.823 0.049 1.201 0.039 3.375 0.145 -0.374 0.028 1.258 0.121 0.010 0.022
134 A 1.337 0.015 3.115 0.024 -1.099 0.010 1.166 0.006 2.789 0.019 -0.706 0.007 1.251 0.022 -0.200 0.006
135 P
136 V 0.825 0.002 1.656 0.007 -1.783 0.004 0.753 0.002 1.117 0.004 -1.536 0.004 0.800 0.005 -0.658 0.002
Table S3: Model-free analysis results
Residue Model S2 δS2 S2f δS2
f S2s δS2
f τe δτe Rex 600MHz δRex 600MHz
1 MET
269
2 GLY
3 LEU
4 LEU
5 SER
6 ARG
7 LEU 5 0.324 0.021 0.862 0.035 0.377 0.029 887.501 41.513
8 ARG
9 LYS
10 ARG
11 GLU 5 0.439 0.014 0.829 0.020 0.530 0.020 901.448 40.467
12 PRO
13 ILE 5 0.492 0.010 0.812 0.014 0.606 0.011 987.453 35.949
14 SER 2 0.857 0.016 109.277 33.890
15 ILE 1 0.923 0.022
16 TYR 1 0.917 0.020
17 ASP 1 0.928 0.018
18 LYS
19 ILE 2 0.891 0.018 17.020 9.685
20 GLY 1 0.889 0.015
21 GLY 2 0.873 0.014 17.378 7.190
22 HIS 1 0.928 0.018
23 GLU 2 0.913 0.016 42.615 12.639
24 ALA 5 0.820 0.013 0.881 0.012 0.931 0.008 1279.948 216.280
25 ILE 2 0.902 0.017 27.594 9.830
26 GLU 1 0.947 0.018
27 VAL
28 VAL 1 0.881 0.015
29 VAL
30 GLU 3 0.876 0.019 2.029 0.363
31 ASP 1 0.927 0.016
32 PHE 1 0.927 0.017
33 TYR 3 0.894 0.022 1.450 0.416
34 VAL 2 0.900 0.015 13.505 6.691
35 ARG 1 0.917 0.019
(Table continued on next page)
Table S3: Model-free analysis results
Residue Model S2 δS2 S2f δS2
f S2s δS2
f τe δτe Rex
600MHz
δRex
600MHz
36 VAL 1 0.909 0.018
37 LEU 1 0.952 0.017
270
38 ALA 1 0.918 0.016
39 ASP 1 0.853 0.014
40 ASP 1 0.897 0.016
41 GLN 2 0.900 0.016 21.828 7.240
42 LEU 2 0.884 0.018 26.409 8.412
43 SER 1 0.872 0.014
44 ALA 5 0.888 0.016 0.957 0.016 0.928 0.011 1460.318 357.782
45 PHE 1 0.887 0.015
46 PHE 1 0.889 0.017
47 SER 2 0.889 0.013 17.176 4.434
48 GLY
49 THR 1 0.858 0.014
50 ASN
51 MET 1 0.963 0.030
52 SER 1 0.940 0.028
53 ARG 2 0.904 0.016 28.335 9.000
54 LEU
55 LYS 1 0.913 0.018
56 GLY 1 0.905 0.017
57 LYS
58 GLN 1 0.896 0.017
59 VAL 1 0.899 0.016
60 GLU 2 0.904 0.016 17.387 7.860
61 PHE 1 0.921 0.016
62 PHE 1 0.931 0.017
63 ALA 1 0.927 0.016
64 ALA 2 0.903 0.016 29.534 7.735
65 ALA
66 LEU 1 0.872 0.016
67 GLY 1 0.933 0.017
68 GLY 1 0.912 0.016
69 PRO
70 GLU 5 0.781 0.016 0.862 0.015 0.906 0.014 1266.666 254.080
(Table continued on next page)
Table S3: Model-free analysis results
Residue Model S2 δS2 S2f δS2
f S2s δS2
f τe δτe Rex
600MHz
δRex
600MHz
71 PRO
72 TYR 2 0.788 0.014 26.339 3.448
73 THR 1 0.907 0.022
271
74 GLY
75 ALA 5 0.809 0.017 0.891 0.016 0.908 0.015 1146.893 220.982
76 PRO
77 MET 1 0.974 0.021
78 LYS 1 0.932 0.022
79 GLN 5 0.747 0.014 0.832 0.014 0.897 0.010 665.041 83.421
80 VAL 5 0.889 0.018 0.940 0.022 0.947 0.015 415.945 205.281
81 HIS 2 0.875 0.023 60.397 55.779
82 GLN 2 0.842 0.013 23.639 4.417
83 GLY 4 0.779 0.019 16.257 3.983 2.749 0.338
84 ARG 5 0.742 0.032 0.913 0.019 0.813 0.034 5535.414 2044.161
85 GLY 1 0.858 0.014
86 ILE 1 0.859 0.021
87 THR 4 0.789 0.019 8.004 3.032 3.234 0.285
88 MET
89 HIS
90 HIS 3 0.857 0.021 2.143 0.400
91 PHE 3 0.821 0.018 3.028 0.289
92 SER 3 0.865 0.022 1.408 0.418
93 LEU 1 0.895 0.016
94 VAL 4 0.857 0.018 19.191 4.864 2.172 0.291
95 ALA 3 0.860 0.019 2.753 0.360
96 GLY 2 0.889 0.015 11.061 5.553
97 HIS 2 0.898 0.015 17.563 8.429
98 LEU 4 0.817 0.016 12.400 2.901 2.514 0.239
99 ALA 3 0.877 0.017 2.035 0.327
100 ASP 2 0.922 0.015 27.115 9.998
101 ALA 3 0.836 0.021 2.645 0.431
102 LEU 3 0.837 0.019 3.093 0.392
103 THR 1 0.940 0.015
104 ALA 2 0.872 0.014 12.134 4.239
105 ALA 4 0.779 0.017 12.727 3.157 3.722 0.320
(Table continued on next page)
Table S3: Model-free analysis results
Residue Model S2 δS2 S2f δS2
f S2s δS2
f τe δτe Rex
600MHz
δRex
600MHz
106 GLY 5 0.828 0.021 0.904 0.020 0.916 0.016 1619.513 660.151
107 VAL
272
108 PRO
109 SER
110 GLU
111 THR
112 ILE 4 0.855 0.017 12.916 4.120 2.624 0.255
113 THR
114 GLU 1 0.893 0.015
115 ILE 2 0.882 0.015 26.375 8.153
116 LEU 1 0.952 0.017
117 GLY 1 0.899 0.015
118 VAL 1 0.880 0.016
119 ILE 1 0.912 0.019
120 ALA 1 0.882 0.015
121 PRO
122 LEU 1 0.886 0.015
123 ALA 1 0.907 0.015
124 VAL 2 0.862 0.014 31.918 5.426
125 ASP 5 0.780 0.014 0.838 0.014 0.931 0.010 635.625 134.955
126 VAL 1 0.914 0.018
127 THR 2 0.874 0.017 23.347 7.201
128 SER
129 GLY 5 0.434 0.030 0.813 0.034 0.534 0.036 1537.863 149.921
130 GLU 5 0.323 0.009 0.825 0.015 0.391 0.011 1255.365 36.660
131 SER
132 THR
133 THR 5 0.166 0.018 0.749 0.034 0.222 0.026 702.565 25.944
134 ALA 5 0.132 0.003 0.752 0.008 0.176 0.004 601.909 8.469
135 PRO
136 VAL 5 0.030 0.001 0.545 0.003 0.055 0.001 470.089 6.849
273
Table S4. MD-derived dynamics parameter
Residue
M1a M2
b
A-TrHbN B-TrHbN Global
S2 Conv.
c S
2 Conv. Conv.
d S
2
2 G - - - - - -
3 L 0.665 yes 0.592 yes yes 0.642
4 L 0.761 yes 0.678 yes yes 0.733
5 S 0.742 yes 0.684 yes yes 0.732
6 R 0.721 yes 0.643 yes yes 0.691
7 L 0.760 yes 0.674 yes yes 0.725
8 R 0.775 yes 0.714 yes yes 0.762
9 K 0.694 yes 0.632 yes yes 0.681
10 R 0.658 yes 0.558 yes yes 0.596
11 E 0.713 yes 0.639 yes yes 0.665
12 P - - - - - -
13 I 0.632 yes 0.459 yes yes 0.539
14 S 0.703 yes 0.635 yes yes 0.683
15 I 0.888 yes 0.888 yes yes 0.890
16 Y 0.903 yes 0.909 yes yes 0.907
17 D 0.898 yes 0.900 yes yes 0.901
18 K 0.897 yes 0.896 yes yes 0.898
19 I 0.891 yes 0.890 yes yes 0.891
20 G 0.833 yes 0.833 yes yes 0.836
21 G 0.853 yes 0.845 yes yes 0.849
22 H 0.870 yes 0.853 yes yes 0.861
23 E 0.877 yes 0.865 yes yes 0.872
24 A 0.873 yes 0.865 yes yes 0.869
25 I 0.903 yes 0.896 yes yes 0.899
26 E 0.915 yes 0.914 yes yes 0.915
27 V 0.908 yes 0.905 yes yes 0.907
28 V 0.912 yes 0.912 yes yes 0.913
29 V 0.935 yes 0.935 yes yes 0.935
30 E 0.922 yes 0.922 yes yes 0.922
31 D 0.920 yes 0.920 yes yes 0.920
32 F 0.931 yes 0.931 yes yes 0.932
33 Y 0.924 yes 0.923 yes yes 0.924
34 V 0.889 yes 0.882 yes yes 0.885
35 R 0.917 yes 0.915 yes yes 0.916
36 V 0.927 yes 0.925 yes yes 0.925
37 L 0.919 yes 0.914 yes yes 0.916
38 A 0.853 yes 0.855 yes yes 0.854
(Table continued on next page)
274
Table S4. MD-derived dynamics parameter
Residue
M1a M2
b
A-TrHbN B-TrHbN Global
S2 Conv.
c S
2 Conv. Conv.
d S
2
39 D 0.709 yes 0.723 yes yes 0.716
40 D 0.821 yes 0.831 yes yes 0.824
41 Q 0.808 yes 0.838 yes yes 0.822
42 L 0.863 yes 0.886 yes yes 0.872
43 S 0.900 yes 0.901 yes yes 0.901
44 A 0.892 yes 0.885 yes yes 0.890
45 F 0.882 yes 0.882 yes yes 0.883
46 F 0.882 yes 0.848 no yes 0.869
47 S 0.756 no 0.378 no no 0.586
48 G 0.628 no 0.063 no no 0.244
49 T 0.597 no 0.339 no no 0.418
50 N 0.802 yes 0.770 no yes 0.793
51 M 0.875 yes 0.868 yes yes 0.874
52 S 0.893 yes 0.895 yes yes 0.893
53 R 0.906 yes 0.908 yes yes 0.906
54 L 0.915 yes 0.916 yes yes 0.915
55 K 0.924 yes 0.929 yes yes 0.928
56 G 0.888 yes 0.894 yes yes 0.892
57 K 0.904 yes 0.911 yes yes 0.908
58 Q 0.925 yes 0.929 yes yes 0.928
59 V 0.927 yes 0.932 yes yes 0.930
60 E 0.923 yes 0.924 yes yes 0.923
61 F 0.931 yes 0.932 yes yes 0.932
62 F 0.933 yes 0.931 yes yes 0.933
63 A 0.924 yes 0.924 yes yes 0.925
64 A 0.917 yes 0.921 yes yes 0.919
65 A 0.918 yes 0.921 yes yes 0.920
66 L 0.907 yes 0.907 yes yes 0.908
67 G 0.881 yes 0.879 yes yes 0.881
68 G 0.861 yes 0.863 yes yes 0.863
69 P - - - - - -
70 E 0.635 no 0.731 yes yes 0.678
71 P - - - - - -
72 Y 0.733 no 0.771 no no 0.490
73 T 0.743 no 0.715 no no 0.721
74 G 0.768 no 0.739 no no 0.762
75 A 0.779 no 0.751 no no 0.779
(Table continued on next page)
275
Table S4. MD-derived dynamics parameter
Residue
M1a M2
b
A-TrHbN B-TrHbN Global
S2 Conv.
c S
2 Conv. Conv.
d S
2
79 Q 0.872 yes 0.864 yes yes 0.867
80 V 0.885 yes 0.889 yes yes 0.887
81 H 0.897 yes 0.829 no yes 0.874
82 Q 0.861 yes 0.882 yes yes 0.869
83 G 0.821 no 0.826 no no 0.807
84 R 0.748 no 0.801 no no 0.754
85 G 0.802 no 0.694 no no 0.751
86 I 0.863 yes 0.850 yes yes 0.862
87 T 0.812 yes 0.785 yes yes 0.793
88 M 0.907 yes 0.909 yes yes 0.907
89 H 0.912 yes 0.909 yes yes 0.911
90 H 0.912 yes 0.915 yes yes 0.913
91 F 0.916 yes 0.918 yes yes 0.917
92 S 0.927 yes 0.926 yes yes 0.927
93 L 0.926 yes 0.926 yes yes 0.925
94 V 0.930 yes 0.932 yes yes 0.931
95 A 0.937 yes 0.938 yes yes 0.938
96 G 0.918 yes 0.917 yes yes 0.918
97 H 0.917 yes 0.919 yes yes 0.918
98 L 0.929 yes 0.929 yes yes 0.929
99 A 0.935 yes 0.933 yes yes 0.934
100 D 0.933 yes 0.931 yes yes 0.932
101 A 0.931 yes 0.928 yes yes 0.930
102 L 0.935 yes 0.932 yes yes 0.934
103 T 0.925 yes 0.922 yes yes 0.923
104 A 0.927 yes 0.923 yes yes 0.925
105 A 0.868 yes 0.866 yes yes 0.867
106 G 0.806 yes 0.801 yes yes 0.804
107 V 0.876 yes 0.874 yes yes 0.875
108 P - - - - - -
109 S 0.892 yes 0.883 yes yes 0.888
110 E 0.903 yes 0.894 yes yes 0.899
111 T 0.892 yes 0.885 yes yes 0.889
112 I 0.921 yes 0.915 yes yes 0.919
113 T 0.921 yes 0.913 yes yes 0.918
114 E 0.918 yes 0.912 yes yes 0.915
115 I 0.926 yes 0.913 yes yes 0.919
(Table continued on next page)
276
Table S4. MD-derived dynamics parameter
Residue
M1a M2
b
A-TrHbN B-TrHbN Global
S2 Conv. c S2 Conv. Conv.d S2
119 I 0.872 no 0.842 no no 0.861
120 A 0.869 no 0.851 no no 0.873
121 P - - - - - -
122 L 0.848 yes 0.869 yes yes 0.857
123 A 0.888 yes 0.887 yes yes 0.889
124 V 0.884 yes 0.872 yes yes 0.875
125 D 0.858 yes 0.861 yes yes 0.851
126 V 0.916 yes 0.916 yes yes 0.916
127 T 0.902 yes 0.874 no yes 0.891
128 S 0.858 yes 0.604 no yes 0.193
129 G 0.353 no 0.197 no no 0.109
130 E 0.067 no 0.450 no no 0.151
131 S 0.190 no 0.121 no no 0.235
132 T 0.217 no 0.007 no no 0.146
133 T 0.157 no 0.128 no no 0.143
134 A 0.205 no 0.074 no no 0.177
135 P - - - - - -
136 V 0.105 no 0.083 no no 0.173
119 I 0.872 no 0.842 no no 0.861
120 A 0.869 no 0.851 no no 0.873
121 P - - - - - -
122 L 0.848 yes 0.869 yes yes 0.857
123 A 0.888 yes 0.887 yes yes 0.889
124 V 0.884 yes 0.872 yes yes 0.875
125 D 0.858 yes 0.861 yes yes 0.851
126 V 0.916 yes 0.916 yes yes 0.916
127 T 0.902 yes 0.874 no yes 0.891
128 S 0.858 yes 0.604 no yes 0.193
129 G 0.353 no 0.197 no no 0.109
130 E 0.067 no 0.450 no no 0.151
131 S 0.190 no 0.121 no no 0.235
132 T 0.217 no 0.007 no no 0.146
133 T 0.157 no 0.128 no no 0.143
134 A 0.205 no 0.074 no no 0.177
135 P - - - - - -
136 V 0.105 no 0.083 no no 0.173
a. Internal autocorrelation in invidual simulations
b. Internal autocorrelation by randomization of all simulations
c. Converged during the simulation
d. Converged in at least one simulation
277
References
1. Couture, M., S. R. Yeh, B. A. Wittenberg, J. B. Wittenberg, Y. Ouellet, D. L. Rousseau,
and M. Guertin. 1999. A cooperative oxygen-binding hemoglobin from Mycobacterium
tuberculosis. Proc Natl Acad Sci U S A 96:11223-11228.
2. Scott, N. L., and J. T. Lecomte. 2000. Cloning, expression, purification, and
preliminary characterization of a putative hemoglobin from the cyanobacterium
Synechocystis sp. PCC 6803. Protein Sci 9:587-597.
3. Berry, E. A., and B. L. Trumpower. 1987. Simultaneous determination of hemes a, b,
and c from pyridine hemochrome spectra. Anal Biochem 161:1-15.
4. Tjandra, N., P. Wingfield, S. Stahl, and A. Bax. 1996. Anisotropic rotational diffusion
of perdeuterated HIV protease from 15
N NMR relaxation measurements at two
magnetic fields. J Biomol NMR 8:273-284.
5. Gong, Q., and R. Ishima. 2007. 15
N-{1H} NOE experiment at high magnetic field
strengths. J Biomol NMR 37:147-157.
6. d'Auvergne, E. J., and P. R. Gooley. 2008. Optimisation of NMR dynamic models II. A
new methodology for the dual optimisation of the model-free parameters and the
Brownian rotational diffusion tensor. J Biomol NMR 40:121-133.
7. d'Auvergne, E. J., and P. R. Gooley. 2008. Optimisation of NMR dynamic models I.
Minimisation algorithms and their performance within the model-free and Brownian
rotational diffusion spaces. J Biomol NMR 40:107-119.
8. Morin, S., and S. M. Gagne. 2009. NMR dynamics of PSE-4 beta-lactamase: an
interplay of ps-ns order and µs-ms motions in the active site. Biophys J 96:4681-4691.
9. Lipari, G., and A. Szabo. 1982. Model-Free Approach to the Interpretation of Nuclear
Magnetic Resonance Relaxation in Macromolecules - Theory and Range of Validity. J
Am Chem Soc 104:4546-4559.
10. Lipari, G., and A. Szabo. 1982. Model-Free Approach to the Interpretation of Nuclear
Magnetic Resonance Relaxation in Macromolecules - Analysis of Experimental
Results. J Am Chem Soc 104:4559-4570.
11. Morin, S., and M. G. S. 2009. Simple tests for the validation of multiple field spin
relaxation data. J Biomol NMR 45:361-372.
12. Pawley, N. H., C. Wang, S. Koide, and L. K. Nicholson. 2001. An improved method for
distinguishing between anisotropic tumbling and chemical exchange in analysis of 15
N
relaxation parameters. J Biomol NMR 20:149-165.
278
13. Bai, Y., J. S. Milne, L. Mayne, and S. W. Englander. 1993. Primary structure effects on
peptide group hydrogen exchange. Proteins 17:75-86.
14. Connelly, G. P., Y. Bai, M. F. Jeng, and S. W. Englander. 1993. Isotope effects in
peptide group hydrogen exchange. Proteins 17:87-92.
15. MacKerell, A. D., D. Bashford, M. Bellott, R. L. Dunbrack, J. D. Evanseck, M. J. Field,
S. Fischer, J. Gao, H. Guo, S. Ha, D. Joseph-McCarthy, L. Kuchnir, K. Kuczera, F. T.
K. Lau, C. Mattos, S. Michnick, T. Ngo, D. T. Nguyen, B. Prodhom, W. E. Reiher, B.
Roux, M. Schlenkrich, J. C. Smith, R. Stote, J. Straub, M. Watanabe, J. Wiorkiewicz-
Kuczera, D. Yin, and M. Karplus. 1998. All-Atom Empirical Potential for Molecular
Modeling and Dynamics Studies of Proteins. Journal of Physical Chemistry B
102:3586-3616
16. Frisch, M. J., G. W. Trucks, H. B. Schlegel, G. E. Scuseria, M. A. Robb,
J. R. Cheeseman, J. A. Montgomery, T. Vreven, K. N. Kudin, J. C. Burant,
J. M. Millam, S. S. Iyengar, J. Tomasi, V. Barone, B. Mennucci, M. Cossi,
G. Scalmani, N. Rega, G. A. Petersson, H. Nakatsuji, M. Hada, M. Ehara, K. Toyota,
R. Fukuda, J. Hasegawa, M. Ishida, T. Nakajima, Y. Honda, O. Kitao, H. Nakai,
M. Klene, X. Li, J. E. Knox, H. P. Hratchian, J. B. Cross, V. Bakken, C. Adamo,
J. Jaramillo, R. Gomperts, R. E. Stratmann, O. Yazyev, A. J. Austin, R. Cammi,
Pomelli, J. W. Ochterski, P. Y. Ayala, K. Morokuma, G. A. Voth, P. Salvador,
J. J. Dannenberg, V. G. Zakrzewski, S. Dapprich, A. D. Daniels, M. C. Strain, O. arkas,
D. K. Malick, A. D. Rabuck, K. Raghavachari, J. B. Foresman, J. V. Ortiz, Q. Cui, A.
G. Baboul, S. Clifford, J. Cioslowski, B. B. Stefanov, G. Liu, A. Liashenko, P. Piskorz,
I. Komaromi, R. L. Martin, D. J. Fox, T. Keith, A. Laham, C. Y. Peng, A. Nanayakkara,
M. Challacombe, P. M. W. Gill, B. Johnson, W. Chen, M. W. Wong, C. Gonzalez, and
J. A. Pople. 2003. Gaussian 03, Revision C.02.
17. Autenrieth, F., E. Tajkhorshid, J. Baudry, and Z. Luthey-Schulten. 2004. Classical force
field parameters for the heme prosthetic group of cytochrome c. J Comput Chem
25:1613-1622.
18. Daigle, R., M. Guertin, and P. Lague. 2009. Structural characterization of the tunnels of
Mycobacterium tuberculosis truncated hemoglobin N from molecular dynamics
simulations. Proteins : Struc. Func. Bioinf. 75:735-747.
19. Milani, M., Y. Ouellet, H. Ouellet, M. Guertin, A. Boffi, G. Antonini, A. Bocedi,
M. Mattu, M. Bolognesi, and P. Ascenzi. 2004. Cyanide binding to truncated
hemoglobins: a crystallographic and kinetic study. Biochemistry 43:5213-5221.
20. Brooks, B. R., R. E. Bruccoleri, B. D. Olafson, D. J. States, S. Swaminathan, and
M. Karplus. 1983. CHARMM: A program for macromolecular energy, minimization,
and dynamics calculations. Journal of Computational Chemistry 4:187-217.
279
21. Phillips, J. C., R. Braun, W. Wang, J. Gumbart, E. Tajkhorshid, E. Villa, C. Chipot, R.
D. Skeel, L. Kalé, and K. Schulten. 2005. Scalable molecular dynamics with NAMD. J
Comput Chem 26:1781-1802.
22. Mackerell, A. D., M. Feig, and C. L. Brooks. 2004. Extending the treatment of
backbone energetics in protein force fields: limitations of gas-phase quantum
mechanics in reproducing protein conformational distributions in molecular dynamics
simulations. J Comput Chem 25:1400-1415.
23. Price, D. J., and C. L. B. III. 2004. A modified TIP3P water potential for simulation
with Ewald summation. The Journal of Chemical Physics 121:10096-10103.
24. Darden, T., D. York, and L. Pedersen. 1993. Particle mesh Ewald: An N·log(N) method
for Ewald sums in large systems. The Journal of Chemical Physics 98:10089-10092.
25. Miyamoto, S., and P. Kollman. 1992. Settle: An analytical version of the SHAKE and
RATTLE algorithm for rigid water models. Journal of Computational Chemistry
13:952-962.
26. Ryckaert, J.-P., G. Ciccotti, and H. J. C. Berendsen. 1977. Numerical integration of the
cartesian equations of motion of a system with constraints: molecular dynamics of
nalkanes. Journal of Computational Physics 23:327-341.
280
Annexe 4
Matériel supplémentaire du chapitre 9
Complete experimental procedures
Mutagenesis, expression and purification – Amino acid substitutions were carried out
using the QuickChange Site-Directed Mutagenesis kit (Stratagene) following the
recommended protocol. The cloned M. tuberculosis glbN gene was used as a template with
the complementary oligonucleotide primers, Ala24(B1)Leu: 5’GATCGGCGGGCATG
AGCTGATCGAAGTCGTCGTCG3’ with 5’CGACGACGACTTCGATCAGCTCATGC
CCGCCGATC3’; Ala65(E18)Ile: 5’GAGTTTTTCGCGGCCATACTTGGCGGGCCCG
AG3’ with 5’CTCGGGCCCGCCAAGTATGGCCGCGAAAAACTC3’; Ala95(G9)Ile:
5’CCACTTCAGCCTGGTCATCGGACACTTGGCCGACG3’ with 5’CGTCGGCCAAGT
GTCCGATGACCAGGCTGAAGTGG3’. The expression and purification of the
recombinant proteins were performed in accordance with the previously published
method (1).
NOD reaction – NOD reaction we measured by stopped-flow spectrophotometry under
single turnover conditions as previously described (2). Reaction rates were measured at 5°C
using an Applied Photophysics SX.18MV-R stopped-flow spectrophotometer (Leatherhead,
U.K.) equipped with a photodiode array detector. The integration time was 2.5 ms. 1600
Spectra were collected on time scales ranging from 1.3 to 4100 ms. Singular value
decomposition and global analysis were performed using the Specfit/32 (3.0.37) program.
Kinetics constants obtained from fitting had uncertainties of 5%. The results shown in
Figures 2, 3, S1 and S2 are representative of at least two experiments.
Flash-photolysis experiments – Laser flash-photolysis studies of the ferric •NO complexes
of the different proteins were carried out as previously described (3) using the LKS.60
281
Spectrometer from Applied Photolysis (Leatherhead, U.K.) at 23 °C. Photolysis was
initiated by a 5 ns pulse of light at 532 nm provided by a Brillant B Nd:YAG laser
(QUANTEL S.A., Fr.). Absorbance changes were measured at 392 nm using the
monochromator-filtered light from a 150 W xenon arc lamp. Passing through the sample,
the probe light beam was refocused on the slits (slits widths at 1 mm) of a second
monochromator. Changes in transmitted probe light intensity were detected by a 1P28 PMT
coupled with a HP 54830B DSO digital oscilloscope (Agilent Technologies Inc., USA) and
transferred on a RISC platform PC (Acorn, U.K.) for processing. An average of at least ten
kinetic traces from at least two separate experiments were averaged and analyzed with the
instrument manufacturer software (Applied Photolysis, U.K.) to obtain the rate constants.
The fraction of geminate rebinding was calculated as described in (4). Plots showing
absorbance changes following •NO photolysis were obtained using the KaleidaGraph
software (Synergy Software, USA).
MD simulations - Simulations were performed using CHARMM (5) and the CHARMM22
all-atom potential energy parameter set (6) with φ, ψ cross term map correction
(CMAP) (7) and modified TIP3P waters (8). Electrostatic interactions were calculated via
the Particle Mesh Ewald method (9) using a sixth-order spline interpolation for
complementary function, with κ = 0.34 Å-1
, and a fast-Fourier grid density of ≈ 1 Å.
Cutoffs for the real space portion of the Particle Mesh Ewald calculation and the truncation
of the Lennard-Jones interactions were 10 Å, with the latter smoothed via a shifting
function over the range of 8 Å to 10 Å. The SHAKE algorithm (10) was used to constrain
all covalent bonds involving hydrogen atoms. All simulations employed the leapfrog
algorithm and an integration step of 1 femtosecond (fs). Coordinates were saved every
picosecond (ps) for analysis. Nonbond and image lists were updated heuristically. All
simulations were performed at constant pressure and temperature (NPT ensemble) using
Hoover algorithm for temperature control (11). The mass of the thermal piston was 20 000
kcal •mol-1
•ps2 and the mass of the pressure piston equaled 1000 amu. All simulations were
carried out at 298 K and 1 atm. The net translation and rotation of the systems were
removed every 10 000 steps.
282
System setup - The structure and dynamics of the mutant, under the FeIIO2 form, was
studied by performing a 30 ns MD simulation. The coordinates of the mutant protein were
built from an equilibrated MD frame of wild-type oxygenated TrHbN (wt-TrHbN). The
simulation methodology employed was the same as previously used for wt-TrHbN (12).
The first 5 ns were considered as the equilibration phase giving 25 ns in production mode.
The analysis of this simulation was performed in comparisons with two 30 ns MD
simulations of wt-TrHbN presented earlier (13).
Evaluation of tunnel entrance openings – The opening of the tunnel entrances was
evaluated as follows. First, each tunnel path is mapped on a 3D cylindrical grid of 4 Å
radius and 8.2 Å length. Grids were centered on mutated residues, and tunnel paths were
taken from a previous study (39). Points on the grids were separated by 0.25A (i.e. voxels
of (0.25 Å3). Second, voxels occupied by protein atoms were found; the atomic radii used
were 1.20 Å for H, 1.70 Å for C, 1.52 Å O, 1.55 Å for N, 1.80 Å for S and Fe. Next, empty
voxels accessible by a probe of 1.4 Å radius were grouped into cavities. If a cavity
extended from the solvent to the protein core by at least 3 Å each side of the mutated
residue (center of the grid) the tunnel was considered opened. All of the 25 000 MD frames
of wt-TrHbN (from previous work) and the mutant were analyzed. Similarly, all MD
frames from LES simulations were analyzed to measure impacts of •NO molecules.
Interactions formed by the mutated side chain and other tunnel residues -
LT: Leu24(B1) makes contacts with side chains from internal residues Ile19(A15),
Ile25(B2), Val28(B5), Val29(B6), Leu102(G16) and Val107(GH5). Among these residues,
interactions with residues on positions B5, G16 and GH5 are new while contacts with
residue B6 are significantly increased.
ST: Ile95(G9) is making contacts with surface residues Phe91(G5), Leu116(H8),
Ala120(H12) and the internal residues Val94(G8), Leu98(G12) and Ile119(H11). Among
these residues, novel interactions concerns residues on positions G8, G12 and H12 while
interactions with residues G5, H8 and H11 are increased.
283
EHT: Ile65(E18) interacts with side chains from surface residues Phe61(E14),
Val118(H10), Leu122(H14) and internal residues Leu66(E19) and Ile119(H11). Among
these interactions, contacts with Ile119(H11) were not observed in wt-TrHbN while the
others are all increased.
284
Table S1. Rotameric species observed for mutated side chains
Mutation Tunnels Rotamers* Occupancy Blocking
†
Ala24(B1)Leu Long tp
tt
mm
mt
outliers
0.843
0.079
0.001
0.041
0.035
+
+
-
-
Ala65(E18)Ile EH tp
tt
mm
outliers
0.422
0.425
0.037
0.116
+
+
+
Ala95(G9)Ile Short pp
pt
tp
tt
mt
outliers
0.031
0.846
0.006
0.074
0.014
0.028
+
+
+
+
+
* Based on rotameric nomenclature of Lovell and al. (14)
† Indicate if the rotamer is blocking (+) or not (-) the tunnel entrance
285
Table S2. Side-chain conformations and dynamics observed in the mutant protein relative to wt-TrHbN
Residue Tunnel s-chain
position Contacts with other tunnel residues
*
wt-TrHbN versus triple mutant†
Dynamics Conformations Ile15(A11) LT Internal A15 - E19 - H7 Yes No
Ile19(A15) LT Internal A11 - B1 - B2 – B5 - E15 - E19 - G16 - GH5 Yes No
Leu/Ala(B1) LT Surface A15 - B2 – B5 – B6 - G16 - GH5 - -
Ile25(B2) LT Internal A15 – B1 - B5 – B6 - E15 - E19 Yes No
Val28(B5) LT Internal A15 - B1 - B2 – B6 - B9 - E15 - G12 - G16 No No
Val29(B6) LT Internal B2 – B5 - B9 - B10 - E11 - E15 No No
Phe32(B9) DHP-ST Internal B5 – B6 – B10 – E11 – E15 – G8 – G12 No No
Tyr33(B10) DHP Internal B6 – B9 – CD1 – E7 – E11 No No
Phe46(CD1) DHP Internal B10 – CD1 – E4 – E7 – G8 No No
Leu54(E7) DHP Internal B1- CD1 – E11 No No
Gln58(E11) DHP Internal B9 – B10 – E7 No No
Phe61(E14) EHT Surface E11 – E15 – E18 – H11 – H14 No No
Phe62(E15) LT-EHT Internal A15 – B2 – B5 – B6 – B9 – E11 – E14 – E18 – E19 – G12 – G16 – H7 – H11 Yes No
Ala/Ile65(E18) EHT Surface E14 – E15 – E19 – H10 – H11 - -
Leu66(E19) LT-EHT Internal A11 – A15 – B2 – E15 – E18 No No
Phe91(G5) ST Surface G9 – H11 – H12 – H14 No No
Val94(G8) DHP Internal B9 – CD1 – G8 – G9 No No
Ala/Ile95(G9) ST Surface G5 – G8 – G12 –H8 – H11 – H12 - -
Leu98(G12) EHT-LS-ST Internal B5 – B9 – E15 – G9 – G16 – H7- H8 – H11 No No
Leu102(G16) LT Internal A15 – B5 – E15 – G12 – GH5 – H7 – H8 No No
Ile115(H7) LT Internal A11 – A15 – E15 – E19 – G12 –G16 –GH5 – H10 No No
Leu116(H8) ST Surface G9 – G12 – G16 – H7 - H11 - H12 No No
Val118(H10) EHT Surface A11 – E18 – E19 – H7 – H11 Yes Yes
Ile119(H11) EHT-ST Internal E14 – E15 – E18 – E19 – G5 – G9 – G12 – H7 – H8 Yes Yes
Ala120(H12) ST Surface G5 – G9 – H8 No No
Leu122(H14) EHT Surface E14 –E18 – G5 – H10 – H11 No No
* Residues in bold are for side-chain contacts observed in the triple mutant trajectory that are not present in wt-TrHbN. Underlined
residues are those where contacts are significantly augmented. Side chain contacts were analyzed using a cutoff arbitrarily set to 3.5 Å.
286
Figure S1. Reaction of horse heart MbFeII
(O2) (5 M) with one equivalent of •NO at
5 ºC, pH 9.5. (a) Evolution of the optical spectra acquired during the first 500 ms and
collected on time scales ranging from 1.3 ms (red line) to 500 ms (blue line) with an
integration time of 2.5 ms. Abs, absorbance units. (b) First spectrum (417, 544 and 580 nm)
recorded after mixing (1.3 ms). (c) The reaction of oxidation of MbFeII(O2) by •NO was
well described using a double exponential function (ABC). The kinetics at 580 nm
(red) and the fit (black) are shown. (d) optical spectra of the species obtained by singular
value decomposition and global analysis of the rapid scan data from (a): Species A (red),
species B (black) and species C (blue). Abs: absorbance.
287
Figure S2. Reaction of the FeII
(O2) forms (5 M) of TrHbN and the LT/ST/EHT
mutant (5 M) with one equivalent of •NO at 5 ºC, pH 9.5. Optical pectrum recorded at
1.3 ms for (a) wt-TrHbN and (b) LT/ST/EHT mutant. The mutant shows a significant LS
character (409, 544 and 582 nm) relative to that of wt-TrHbN. Abs, absorbance units.
288
Figure S3. Conformational flexibility of side chains blocking (a) LT (A24L), (b) EHT
(A65I) and (c) ST (A95I). Plot showing side-chain dihedral over time (top) and (bottom)
the corresponding rotamer populations.
289
Figure S3. (continued, EHT (Ile65(E18)) Plot showing side-chain dihedral over time (top)
and (bottom) the corresponding rotamer populations.
290
Figure S3. (continued, EHT (Ile95(G9)) Plot showing side-chain dihedral over time (top)
and (bottom) the corresponding rotamer populations.
291
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
Figure S4. Side-chain flexibility of all tunnel-residues of the mutant (red) and wt-
TrHbN (blue). (left) Plot showing side-chain dihedral over time and (right) the
corresponding rotamer populations. Graphes a (top), b (middle) and c (bottom) are shown.
(Continued on next page)
292
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
Figure S4. (Continued) Graphes d (top), e (middle) and f (bottom) are shown.
293
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
Figure S4. (Continued) Graphes g (top), h (middle) and i (bottom) are shown.
294
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
Figure S4. (Continued) Graphes j (top), k (middle) and l (bottom) are shown.
295
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
Figure S4. (Continued) Graphes m (top), n (middle) and o (bottom) are shown.
296
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
Figure S4. (Continued) Graphes p (top), q (middle) and r (bottom) are shown.
297
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------
Figure S4. (Continued) Graphes s (top), t (middle) and u (bottom) are shown.
298
Figure S5. PMF profiles for •NO diffusion in the different tunnels for the wt-TrHbN
(blue) and mutant (red and green). Shaded gray zones correspond to tunnel region filled
by the mutations. For LT (a), profile in red was calculated for the mutant without
Ala24(B1) mm and mt rotamers. For tunnel passing by GHc (d), profile in red was
calculated mutant without Ile119(H11) rotamers tt and tp. To highlight Xe1, Xe2, Xe5
cavities along LT, PMF was calculated depending on Phe62(E15) conformations (rotamers
t80 or m30/m-85) and only rotamers m30/m-85 is shown here for picture clarity. PMF
profiles calculated with t80 rotamers is show in Figure 5 in the main text. ILS calculation
using all 25 000 MD frames from the mutant is shown by the green line. Errorbars,
depending on calculated PMF levels, are not shown for picture clarity (see method).
299
Figure S6. Exits and entry events as function of time observed in simulations of wt-
TrHbN and the mutant. wt-TrHbN : Total exit events observed (red filled circles), entry
events (blue filled squares). The exit of every single •NO (without considering •NO that
reentered), is plotted in green triangles. Mutant: Total exits events observed (open black
squares).
300
Figure S7. •NO diffusion pathways in wt-TrHbN (top) and the mutant, (bottom) from
locally enhanced sampling MD simulations. Diffusion occurring in different tunnels are
colored in purple for the LT, red for the ST, yellow for the EHT, blue for the GH and green
for the EH2. •NO molecule colored in gray are located where tunnel are merging.
301
References
1. Mukai, M., P. Y. Savard, H. Ouellet, M. Guertin, and S. R. Yeh. 2002. Unique
ligand-protein interactions in a new truncated hemoglobin from Mycobacterium
tuberculosis. Biochemistry 41:3897-3905.
2. Ouellet, H., Y. Ouellet, C. Richard, M. Labarre, B. Wittenberg, J. Wittenberg, and
M. Guertin. 2002. Truncated hemoglobin HbN protects Mycobacterium bovis from
nitric oxide. Proc Natl Acad Sci U S A 99:5902-5907.
3. Ouellet, Y. H., R. Daigle, P. Lague, D. Dantsker, M. Milani, M. Bolognesi, J. M.
Friedman, and M. Guertin. 2008. Ligand binding to truncated hemoglobin N from
Mycobacterium tuberculosis is strongly modulated by the interplay between the
distal heme pocket residues and internal water. J Biol Chem 283:27270-27278.
4. Salter, M. D., K. Nienhaus, G. U. Nienhaus, S. Dewilde, L. Moens, A. Pesce, M.
Nardini, M. Bolognesi, and J. S. Olson. 2008. The apolar channel in cerebratulus
lacteus hemoglobin is the route for O2 entry and exit. J Biol Chem. 283:35689-
35702.
5. Brooks, B. R., R. E. Bruccoleri, B. D. Olafson, D. J. States, S. Swaminathan, and
M. Karplus. 1983. CHARMM: A program for macromolecular energy,
minimization, and dynamics calculations. Journal of Computational Chemistry
4:187-217.
6. MacKerell, A. D., D. Bashford, M. Bellott, R. L. Dunbrack, J. D. Evanseck, M. J.
Field, S. Fischer, J. Gao, H. Guo, S. Ha, D. Joseph-McCarthy, L. Kuchnir, K.
Kuczera, F. T. K. Lau, C. Mattos, S. Michnick, T. Ngo, D. T. Nguyen, B. Prodhom,
W. E. Reiher, B. Roux, M. Schlenkrich, J. C. Smith, R. Stote, J. Straub, M.
Watanabe, J. Wiorkiewicz-Kuczera, D. Yin, and M. Karplus. 1998. All-Atom
Empirical Potential for Molecular Modeling and Dynamics Studies of Proteins. J.
Phys. Chem. B 102:3586-3616.
7. Mackerell, A. D., M. Feig, and C. L. Brooks. 2004. Extending the treatment of
backbone energetics in protein force fields: limitations of gas-phase quantum
mechanics in reproducing protein conformational distributions in molecular
dynamics simulations. J Comput Chem 25:1400-1415.
8. Price, D. J., and C. L. B. III. 2004. A modified TIP3P water potential for simulation
with Ewald summation. The Journal of Chemical Physics 121:10096-10103.
9. Darden, T., D. York, and L. Pedersen. 1993. Particle mesh Ewald: An N•log(N)
method for Ewald sums in large systems. The Journal of Chemical Physics
98:10089-10092.
302
10. Ryckaert, J.-P., G. Ciccotti, and H. J. C. Berendsen. 1977. Numerical integration of
the cartesian equations of motion of a system with constraints: molecular dynamics
of n-alkanes. Journal of Computational Physics 23:327-341.
11. Feller, S. E., Y. Zhang, R. W. Pastor, and B. R. Brooks. 1995. Constant pressure
molecular dynamics simulation: The Langevin piston method. The Journal of
Chemical Physics 103:4613-4621.
12. Daigle, R., M. Guertin, and P. Lague. 2009. Structural characterization of the
tunnels of Mycobacterium tuberculosis truncated hemoglobin N from molecular
dynamics simulations. Proteins-Structure Function and Bioinformatics 75:735-747.
13. Daigle, R., J. A. Rousseau, M. Guertin, and P. Lague. 2009. Theoretical
Investigations of Nitric Oxide Channeling in Mycobacterium tuberculosis
Truncated Hemoglobin N. Biophysical Journal 97:2967-2977.
14. Lovell, S. C., J. M. Word, J. S. Richardson, and D. C. Richardson. 2000. The
penultimate rotamer library. Proteins 40:389-408.