Transcript
Page 1: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Supplementary Information

Mitochondrial and Y-chromosome diversity of the prehistoric Koban culture of the North Caucasus

Eugenia Boulygina1, Svetlana Tsygankova1, Fedor Sharko1,2, Natalia V. Slobodova1 Natalia Gruzdeva1, Sergey Rastorguev1, Andrej Belinsky3, Heinrich Härke4, Anna Kadieva5, Sergej Demidenko6, Tatiana Shvedchikova7, Maria Dobrovolskaya7, Irina Reshetova7, Dmitry Korobov7,*, Artem Nedoluzhko8,*

1 National Research Center “Kurchatov Institute”, Kurchatov sq. 1, 123182 Moscow, Russia.2 Institute of Bioengineering, Research Center of Biotechnology of the Russian Academy of Sciences. 33, bld. 2 Leninsky Ave., Moscow 119071, Russia3 LLC Nasledie, K. Marx av., 56, Stavropol’ 355017, Russia4 Centre for Classical and Oriental Archaeology, National Research University Higher School of Economics, ul. Staraya Basmannaya 21/4c1, Moscow 105066, Russia; and Department of Medieval Archaeology, University of Tübingen, Schloss Hohentübingen, D-72070 Tübingen, Germany5 Department of Archaeology, State Historical Museum, Krasnaya pl., 1, Moscow 109012, Russia6 Department of Scythian and Sarmatian Archaeology, Institute of Archaeology, Russian Academy of Sciences, Dm. Uljanova str., 19, Moscow 117292, Russia7 Department of Theory and Methods, Institute of Archaeology, Russian Academy of Sciences, Dm. Uljanova str., 19, Moscow 117292, Russia8 Faculty of Biosciences and Aquaculture, Nord University, Bodø 8049 Norway

* - These authors contributed equally

e-mail: [email protected], [email protected]

Page 2: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Supplementary FiguresFigure S1. Postmortem DNA damage patterns in the specimen 1 (Klin-Yar 3; Excavation ID 353; More details are presented in Table 1).

Page 3: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S2. Postmortem DNA damage patterns in the specimen 2 (Klin-Yar 3; Excavation ID 355; More details are presented in Table 1).

Page 4: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S3. Postmortem DNA damage patterns in the specimen 3 (Klin-Yar 3; Excavation ID 375; More details are presented in Table 1).

Page 5: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S4. Postmortem DNA damage patterns in the specimen 4 (Klin-Yar 3; Excavation ID 376; More details are presented in Table 1).

Page 6: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S5. Postmortem DNA damage patterns in the specimen 5 (Klin-Yar 3; Excavation ID 377; More details are presented in Table 1).

Page 7: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S6. Postmortem DNA damage patterns in the specimen 6 (Zayukovo-3; Excavation ID 71; More details are presented in Table 1).

Page 8: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S7. Postmortem DNA damage patterns in the specimen 7 (Zayukovo-3; Excavation ID 72; More details are presented in Table 1).

Page 9: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S8. Postmortem DNA damage patterns in the specimen 8 (Zayukovo-3; Excavation ID 79; More details are presented in Table 1).

Page 10: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S9. Postmortem DNA damage patterns in the specimen 9 (Zayukovo-3; Excavation ID 80; More details are presented in Table 1).

Page 11: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S10. Postmortem DNA damage patterns in the specimen 10 (Zayukovo-3; Excavation ID 81; More details are presented in Table 1).

Page 12: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S11. Postmortem DNA damage patterns in the specimen 11 (Zayukovo-3; Excavation ID 82/1; More details are presented in Table 1).

Page 13: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S12. Postmortem DNA damage patterns in the specimen 12 (Zayukovo-3; Excavation ID 82; More details are presented in Table 1).

Page 14: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S13. Postmortem DNA damage patterns in the specimen 13 (Zayukovo-3; Excavation ID 91; More details are presented in Table 1).

Page 15: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S14. Postmortem DNA damage patterns in the specimen 14 (Zayukovo-3; Excavation ID 95; More details are presented in Table 1).

Page 16: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S15. Postmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1).

Page 17: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S16. Frequency (%) of Y-chromosome G2a1a haplogroup in the modern North Caucasian ethnic groups based on previously published data (Balanovsky et al. 2011).

Page 18: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S17. Frequency (%) of Y-chromosome R1a haplogroup in the modern North Caucasian ethnic groups based on previously published data (Balanovsky et al. 2011).

Page 19: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Figure S18. Frequency (%) of Y-chromosome R1b haplogroup in the modern North Caucasian ethnic groups based on previously published data

Page 20: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Supplementary Tables

Table S1. Mitochondrial HVR1 primer pairs (L for the light, and H for the heavy strand of human mitochondrial genome) and their sequences that were used in the study

HVR1 primers

pair

PCR produ

ct size, bp

Sequence for L primer, 5’ – 3’ Sequence for H primer, 5’ – 3’

L16122 -

H16218

138 CATTACTGCCAGCCACCATGAATA TGTGTGATAGTTGAGGGTTG

L16131 -

H16281

190 CACCATGAATATTGTACGGT TTAAGGGTGGGTAGGTTTGT

L16185 -

H16356

210 AACCCAATCCACATCAAAACC GTCATCCATGGGGACGAGAA

L16261 -

H16401

196 CAACTATCACACATCAACTGCAA TGATTTCACGGAGGATGGTG

Table S2. Coverage of mitochondrial DNA (rCRS, NC_012920.1) by Illumina reads

Sample ID Coverage, ×Sample2 22.83Sample7 10.33Sample8 9.61Sample9 10.5

Sample11 8.84

Table S3. Haplogroup-specific SNPs (mtDNA) with diagnostic potential and other discovered SNPs (Illumina sequencing)

SampleID

Haplogroup-specific mutations

Other mutations

Sample2

462T 489C 3010A 5460A 11719A 13708A 14766T 16126C 16145A 16261T

10398G 10410A 12612G 13879C 15452A

Sample7

7028T 9477A 11719A 12308G 12346T 12372A 14766T 14793G 16270T

263G 750G 4769G 8860G 11467G 13617C 15326G

Sample8

7028T 9554A 2706G

Sample9

7028T 8697A 9899C 11719A 14905A 15928A 16186T

16189C 16294T

152C 195C 8860G 13368A 16126C

Sample N2 5046A 12705T 16223T 8860G 15326G

Page 21: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

11

Page 22: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Table S4. Haplogroup-specific SNPs (mtDNA) with diagnostic potential (Sanger sequencing)

SampleID Haplogroup-specific mutationsSample1 16311C 16328A 16429ASample2 16069T 16126C 16145A 16261T 16519CSample6 16223TSample7 16256T 16270T 16294T 16399GSample8 16067TSample9 16126C 16163G 16186T 16189C 16294T 16498T 16519CSample10 16106K 16129ASample11 16223T 16292T 16362C 16519C

Sample12-1 16129A 16362C 16519CSample12-2 16129A 16230G 16362C 16519CSample14 16129A 16362C 16519CSample15 16129A 16173Y 16189C 16223T 16311C 16391A

Page 23: ars.els-cdn.com€¦ · Web viewPostmortem DNA damage patterns in the specimen 15 (Zayukovo-3; Excavation ID 105; More details are presented in Table 1). Figure S16. Frequency (%)

Supplementary References

Balanovsky O, Dibirova K, Dybo A, Mudrak O, Frolova S, Pocheshkhova E, Haber M, Platt D, Schurr T, Haak W et al. 2011. Parallel Evolution of Genes and Languages in the Caucasus Region. Molecular Biology and Evolution. 28(10):2905-2920. English.


Top Related