thèse en cotutelle - univ-oran1.dz · célia sarand, vivien mabilat, cathérine loy, muriel blin,...
Post on 26-Jul-2020
15 Views
Preview:
TRANSCRIPT
1
Thèse en cotutelle
En vue de l’obtention du diplôme de DOCTORAT, en biologie
Spécialité : Science de la santé et du développement
Pathologie vasculaire et nutrition
Présentée par
Tawfik ADDI
Intitulé :
Rôle de la voie AhR dans la régulation de l’expression des
gènes ; Identification des partenaires moléculaires répondant à l'Activation d'Aryl
hydrocarbon Receptor par les toxines urémiques
Soutenue le 10/04/2019
Devant le jury :
Président : Mr Habib Hammou Professeur, Université Oran 1
Examinateur : Mme Khedidja Mekki Professeur, Université Oran 1
Examinateur : Mr Christophe Soulage Maitre de Conférence-Professeur
Associé, Université de Lyon 1
Examinateur : Mr Christophe Dubois Professeur, Aix-Marseille Université
Directeur de thèse : Mr Omar Kheroua Professeur, Université Oran 1
Co-directeur de thèse : Mr Stéphane Burtey Professeur, Aix-Marseille Université
Membre invité : Mme Hafida Merzouk Professeur, Université de Tlemcen
Aix-Marseille Université Faculté de Pharmacie de Marseille
Ecole Doctorale Sciences de la Vie et de la Santé
Université Oran 1 Faculté des Sciences de la Nature et de la vie
Ecole doctorale sciences de la santé et du développement
2
Je dédie cette thèse chaleureusement à ma famille
À mes parents ;
Ma mère mon père « les anges gardiens de leurs fils, qui nous ont tout
donné pour réussir, sans jamais mesurer leurs efforts »
Tout au long de ma vie, vous m’avez encouragé à persévérer dans mes études.
Ainsi, cet accomplissement est le fruit de votre soutien. Merci pour votre
bienveillance en espérant vous avoir rendu fier de moi.
Que Dieu vous garde Inchallah.
À mes frères et belles-sœurs ; Karim, Mohammed Y, Sofiane, Mounir (mon
jumeau), Fouad (le Mazouzi) et Fatima, Khadidja et Imene.
Je vous remercie pour votre confiance inébranlable, et soutien que vous m’avez
apporté durant la réalisation de cette thèse.
Je vous souhaite une pleine réussite dans la vie.
À mes nièces et neveux ;
Abdellah M, Wassim M, Abderrahmane F, Ibrahim A, Dayena, sa sœur
jumelle Malek (qui est au paradis) et Mohammed R.
Mes chères nièces et neveux ; il faut déjà apprendre à lire pour comprendre ses
mots, mais voilà j’espère qu’ont grandissant vous aurez l’occasion de lire cette
thèse, et de comprendre comment vous avez aidé votre tonton à réaliser ce
travail. C’est simple, dans les moments où la lumière dans le tunnel paraissait
de plus en plus loin, ou quand toutes les portes semblaient fermées ; votre rire,
joie, et surtout l’insouciance et l’innocence à la vie me permettaient de me
relaxer, et de voir les choses avec recule, ce qui est la clé pour surmonter toutes
les difficultés et avancer ; comme le dit l’expression « lorsque nous sommes trop
proches de l’arbre, il est impossible de voir la forêt ». Que Dieu vous garde en
bonne santé, je vous souhaite tout le bonheur de cette vie.
Dédicace
3
Remerciements
Remerciements
Cette thèse en Cotutelle a été réalisé entre Aix-Marseille Université, Centre de Recherche en Cardio-
Vasculaire et Nutrition (C2VN) l’Université Oran 1, Laboratoire de Physiologie de la Nutrition et de
la Sécurité Alimentaire (LPNSA)
Je remercie vivement ;
Le Professeur Françoise DIGNAT-GEORGE de m’avoir permis de travailler au sein du
laboratoire UMR_S 1076 (C2VN actuel), et de m’avoir fait intégrer la meilleure équipe de recherche
qu’on puisse espérer ; l’Équipe «Urémie» qui m’a accueilli à bras ouverts depuis mon master 2.
Le Professeur Marie-Christine ALESSI, dans la continuité d’accueil au sein du C2VN.
J’adresse mes intenses remerciements à mon directeur de thèse d’Aix-Marseille Université, le
Professeur Stéphane BURTEY. Merci pour le soutien indéfectible que vous m’avez apporté. Merci de
m’avoir conseillé, orienté, et accueilli cordialement dans l’équipe «Urémie». Cette équipe qui a
toujours cru en moi, qui m’a formé et fait adorer la recherche, et que je considère comme ma famille
scientifique.
Je tiens également à adresser mes sincères remerciements à mon directeur de thèse de
l’Université d’Oran, LPNSA, le Professeur Omar KHEROUA, de m’avoir constamment appuyé et
encouragé durant cette thèse. Aussi, pour m’avoir donné l’opportunité de voir grand, en ayant initié
le Master international.
Mes vifs remerciements vont également aux membres du jury pour avoir accepté la lecture et
l’évaluation de cette thèse, et pour l’intérêt qu’ils ont porté à ce travail.
Je remercie vivement le professeur Habib HAMMOU, responsable du Master international, pour
son appui fondamental depuis le Master, dans l’initiation de la cotutelle et durant l’organisation de la
soutenance.
Je remercie également les enseignants de l’université Oran 1, LPNSA, pour leurs soutiens,
particulièrement : le Pr Djamel SAIDI, le Pr Hanane KADDOURI et le Pr Ahmed BOUALGA.
Le Master international qui reste un élément déclencheur de cette concrétisation ; mis en place en
collaboration conjointe avec le professeur Omar KHEROUA, le professeur Christophe DUBOIS, le
professeur Jean-Louis MÈGE, à qui j’exprime également mes profonds remerciements.
Je remercie pareillement le Docteur Kamel El Eddine El MECHERFI d’avoir été à mes côtés, et de
m’avoir apporté ses conseils durant le début de cette thèse.
Un remerciement particulier au Dr Laetitia DOU, mon mentor scientifique et amie, qui a
également encadré cette thèse. Merci…..Merci de m’avoir fait confiance, de m’avoir transmis le
savoir scientifique sans retenue, et de m’encourager toujours à repousser mes limites pour aller plus
loin, dans la joie, l’enthousiasme et la bonne humeur.
4
Remerciements
Je souhaite remercier très fortement le Dr Stéphane POITEVIN de m’avoir soutenu durant ma thèse
jusqu’au bout, et d’avoir été toujours là dans les moments de travail et les moments de rigolade avec
sa bonne humeur et ses bonnes blagues « Mes amitiés….. ».
Un autre remerciement particulier à Lady Nathalie McKAY, mon soutien moral durant cette thèse.
Merci d’avoir été toujours là, de m’avoir soutenu, aider et encourager jusqu’au bout avec ta joie, ta
bonne humeur toujours présente et ton amitié.
Je remercie chaleureusement le Dr Claire CERINI pour ses conseils, son soutien, son sourire
d’encouragement et son amitié tout au long de cette thèse.
Je tiens également à remercier : Marion SALEE, Noémie JOURDE CHICHE, Camélia MAKHLOUFI,
Stanislas BATAILLE et Guillaume LANO, pour leurs conseils apportés.
Je souhaite saluer le courage des patients de la clinique ST-Hubert & Es-Seddikia d’Oran et de
l’hôpital la conception de Marseille. Je les remercie d’avoir participé aux études dans le but de faire
avancer la recherche.
Je tiens à remercier spécialement le groupe Rénadial et les médecins-chefs ; le Dr Nadia FAHSSI et
le Dr Mustapha REMAOUN, de m’avoir permis de réaliser l’étude clinique au sein de leur centre (St-
Hubert Es-Seddikkia). Je remercie également tous les médecins et le personnel des centres
Rénadial qui ont contribué dans cette étude. Mes remerciements vont aussi vers les médecins et
personnels qui ont participé au recrutement des patients à l’hôpital de la conception de Marseille.
Durant mes séjours à Marseille (à ex UMR_S1076), j’ai eu la joie d’être entouré par des amis que je
remercie d’avoir été là, et avec qui nous avons partagé des moments qui resteront à jamais gravés
dans la mémoire :
Tacy SANATANA MACHADO, Anthony BABA, la famille McKAY : Nathalie & Bruno, Karim FALLAGUE,
Célia SARAND, Vivien MABILAT, Cathérine LOY, Muriel BLIN, Clarissa VON KOTZE, la famille TELLIER :
Edwige Nicolas.
Également : Belkacem BRICHI, Amine BECHAR, Romain Nassima VIAL, Karima MOUSSOUNI.
J’adresse également mes remerciements ;
À mes potes-frères de m’avoir supporté tout au long de cette thèse : Ilyes BELHAYARA, Mehdi
MEHADJI, Yacine LEZOUL, Saiid LEZOUL, Wanis KAZI, Kamel KHALOUT, Amine MALTI, Khelifa
BELABASSI, Fethi TEGHLI, Mehdi BOUKACEM, Mehdi KAHOUADJI, Mohammed MALOUFI, Walid SARI,
Saleh ZERROUK, Omar KALAFATE.
Pour leurs soutiens ; à Ilhem MELLOUK, Wiam BRIKCI et Dalel REDOUANE.
Pour leurs amabilités et encouragements ; à tous les membres du laboratoire C2VN de Marseille ; aux
membres du laboratoire LPNSA d’Oran « Lila AMIER, Nawel BOUTIBA », et à tous mes collègues
inscrits en thèse, à qui je souhaite une carrière fructueuse.
5
Résumé
Résumé
La maladie rénale chronique (MRC) a pour principale complication les maladies
cardiovasculaires. Le risque cardiovasculaire est multiplié par 3 à 100 au cours de la MRC. Les
facteurs de risque traditionnels n’expliquent pas le sur risque observé. Il est avéré que
l’accumulation de certaines toxines urémiques chez les patients avec une MRC intervient
dans la survenue des complications cardiovasculaires. Les toxines urémiques dérivées de la
voie indolique du métabolisme du tryptophane, l’indole-3-acétique acide (IAA) et l’Indoxyl
sulfate (IS), sont impliquées dans un phénomène clé des événements cardiovasculaires ; la
thrombose. Notre équipe a montré que les deux toxines urémiques indoliques IAA et IS,
induisent l'expression et l'activité pro coagulante du facteur tissulaire, principal initiateur
cellulaire de la coagulation sanguine. Le facteur de transcription, Aryl Hydrocarbon Receptor
(AHR), un récepteur cellulaire pour les toxines indoliques, est impliqué dans l'induction du FT
endothélial. Les mécanismes par lesquels AhR contrôle l’expression du FT dans les cellules
endothéliales sont peu connus.
L’objectif principal de cette thèse était de déterminer les voies de signalisation et les
facteurs de transcription impliqués dans l'expression du FT médiée par AhR et induit par
l’IAA et l’IS. Nous avons également étudié le lien entre le facteur tissulaire circulant et les
taux d’IAA et d’IS chez les patients hémodialysés de Marseille.
Dans la littérature, nous ne disposons pas des valeurs des toxines indoliques dans des
populations dialysant hors des pays occidentaux. Pour compléter ce manque, nous avons
déterminé et comparé les taux de ces toxines dans une cohorte de patients hémodialysés en
Algérie.
6
Résumé
L’expression du facteur tissulaire induite par l’IAA et l’IS au niveau endothélial est
contrôlée principalement par la transcription. L’IAA et l’IS activent la voie génomique
classique d’AhR. Cependant, l’expression du FT n'est pas médiée par cette voie. L’AhR ne se
fixant pas au promoteur du FT en CHIP. L’activation du FT en réponse à l’IAA passe par une
voie AhR-p38MAPK-NF-B.
Dans une cohorte de 92 patients atteints de MRC sous hémodialyse, le FT circulant était
indépendamment lié à l'IAA sérique en analyse multivariée.
Enfin, les taux sériques d’IS étaient significativement plus élevés chez les patients oranais
par rapport aux patients marseillais. Cependant, après un suivi d’un an, le taux de mortalité
et d’événement cardiovasculaire n’était pas significativement diffèrent entre les deux
populations de patients.
En conclusion, l’induction par l'IAA du FT dans les cellules endothéliales humaines
implique la voie non génomique d’AhR-p38MAPK/NF-B. L’identification de cette voie de
signalisation suggère que nous puissions dissocier l’effet détoxifiant d’AhR dépendant de la
voie génomique, de l’effet prothrombotique. Nous préserverons ainsi les effets positifs de
l’activation d’AhR, en limitant ses effets délétères en particulier prothrombotiques induits
par les toxines urémiques.
7
Abstract
Abstract
Chronic kidney disease (CKD) has as main complication, the cardiovascular pathology. The
cardiovascular risk is multiplied by 3 to 100 during the CKD. Traditional risk factors do not
explain the observed risk. It is known that the accumulation of some uremic toxins is
involved in the occurrence of cardiovascular complications in CKD. Uremic toxins derived
from the indolic pathway of tryptophan metabolism indole-3-acetic acid (IAA) and indoxyl
sulfate (IS) are involved in a key phenomenon of cardiovascular events; the thrombosis. Our
team has previously shown that both indolic uremic toxins, indole-3-acetic acid and indoxyl
sulfate induce the expression and procoagulant activity of tissue factor, the main cellular
initiator of blood coagulation. The transcription factor, Aryl Hydrocarbon Receptor (AHR), a
cellular receptor for indolic toxins, is involved in the induction of endothelial TF. However,
the mechanisms by which AhR controls the expression of TF in endothelial cells are poorly
understood.
The main objective of this thesis was to determine the signaling pathways and
transcription factors involved in AhR mediated TF expression induced by IAA and IS. We also
studied the link between circulating tissue factor and IAA/IS levels in hemodialysis patients
in Marseille.
In the literature, we do not have the values of indole toxins in dialysis populations
outside Western countries. To complete this deficiency, we have determined and compared
the levels of these toxins in a cohort of hemodialysis patients in Algeria.
Tissue factor expression induced by IAA and IS at the endothelial level is mainly
controlled by transcription. IAA and IS activate the classical genomic AhR pathway. However,
the expression of TF is not mediated by this way. AhR does not bind to the TF promoter in
8
Abstract
CHIP. Activation of TF in response to the IAA is mediated by an AhR-p38MAPK-NF-B
pathway.
In a cohort of 92 patients with CKD under hemodialysis, circulating TF was independently
related to serum IAA in multivariate analysis.
Finally, serum IS levels were significantly higher in oran patients than in marseille
patients. However, after a one-year follow-up, the mortality and cardiovascular event rate
was not significantly different between the two patient populations.
In conclusion, induction by IAA of TF in human endothelial cells involves the non-genomic
AhR-p38MAPK/NF-B pathway. The identification of this signaling pathway suggests that we
can dissociate the detoxifying effect of AhR dependent on the genomic pathway, to the
prothrombotic effect. We could thus preserve the positive effects of AhR activation and
limiting its deleterious effects, in particular the prothrombotic effects induced by uremic
toxins.
9
ملخص
ملخص
تضاعف مخاطر القلب واألوعية هو المضاعفات الرئيسية ألمراض القلب واألوعية الدموية. مرض الكلى المزمن
وقد تبين أن تراكم عوامل الخطر التقليدية ال تشرح الخطر المرصود. . مرض الكلى المزمنخالل 100إلى 3الدموية من
تشارك في حدوث مضاعفات القلب واألوعية مرض الكلى المزمنبعض السموم يوريمي في المرضى الذين يعانون من
3 حامض إيندول من التريبتوفان األيض ، وحامض indolic المستمدة من مسار Uremicالسموم الدموية.
أظهر تجلط الدم. : ( ، متورطون في ظاهرة رئيسية من األحداث القلبية الوعائيةIS) األكسدة وكبريتات (IAA) أسيتيك
، والبادئ (FT) ، لحث التعبير والنشاط تجلط الدم الموالية العامل النسيجيISو اإلندول السموم يوريميIAA فريقنا أن كال
( وهو مستقبالت الخلوية AHR) مستقبالت تشارك الهيدروكربون أريل عامل النسخ ، الخلوي الرئيسي لتخثر الدم.
في الخاليا FTفي التعبير عن AhR تتحكم بها التياآلليات فهم ال يتم البطانية. FT، في تحريض اإلندول للسموم
البطانية.
وكان الهدف الرئيسي من هذه الرسالة لتحديد مسارات اإلشارات وعوامل النسخ المشاركة في التعبير عن
FT بوساطة AhR والناجمة عنIAA وIS. درسنا أيضا العالقة بين عامل النسيج المتداولة ومستوياتIAA وIS في
مرضى غسيل الكلى في مرسيليا.
إلكمال هذا في مجموعات غسيل الكلى خارج البلدان الغربية. اإلندول ، ليس لدينا قيم السمومفي األدبيات العلمية
جموعة من مرضى غسيل الكلى في الجزائر.النقص ، قمنا بتحديد ومقارنة مستويات هذه السموم في م
على مستوى البطانية يتم التحكم في المقام األول عن طريق IAA/IS التعبير عن عامل األنسجة الناجم عن
بهذه FTالتعبير عن بوساطة ومع ذلك ، ال يتم . AhR بتفعيل المسار الجيني الكالسيكي لـ ISو IAAتقوم النسخ.
. NF-B/p38/AhR مسار يمر عبر IAAردا على FTتفعيل .CHIP في FTغير ملزم للمروج AhRو الطريقة.
المنتشرة بشكل مستقل إلى مصل FTترتبط الكلى،على غسيل مرض الكلى المزمنمريضا مع 92في مجموعة من
IAA متعدد المتغيرات في التحليل .
ومع ذلك ، في المصل أعلى بشكل ملحوظ في مرضى وهران مقارنة بمرضى مرسيليا. IS وأخيرا ، كانت مستويات
بعد سنة واحدة من المتابعة ، لم يكن معدل الوفيات ومعدل األوعية القلبية مختلفا بشكل كبير بين المجموعتين المريضتين.
في الخاليا البطانية البشرية على المسار غير الجيني ل FTلـ IAAفي الختام ، ينطوي االستقراء بواسطة
B/p38MAPK /AhR ـNF من إزالة السموم يشير تحديد مسار اإلشارة هذا إلى أننا نستطيع فصل تأثيرAhR الذي
، مما يحد من AhR على اآلثار اإليجابية لتنشيط وبالتالي ،سنحافظ . البروثرومبوتيك يعتمد على المسار الجينومي ، تأثير
التي تسببها السموم اليوريمية. البروثروموتيك آثاره الضارة ، خاصة
10
Liste des figures
Liste des figures
Introduction
Figure 1 : L’Expression anormale du FT active la cascade de coagulation ............................ 22
Figure 2 : Induction du promoteur du facteur tissulaire humain (FT) dans les cellules
endothéliales .................................................................................................................. 23
Figure 3 : Activation de la voie classique génomique de l’AhR ............................................ 25
Revue bibliographique
Figure 1 : Mechanisms of tryptophan-derived uremic toxins promoting thrombosis ........... 37
Méthodologie de travail
Figure 1 : Western blot des niveaux de protéines d’AhR dans les HUVEC transfectées avec
un siRNA contrôle ou siRNA AhR ...................................................................................... 48
Figure 2 : Construction des plasmides rapporteurs du promoteur du FT............................. 53
Résultat (5.1.) : Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA
Figure 1 (A)(B) : Effet de l'IAA sur l'expression du FT en ARNm (A) et en protéines (B) dans
différents types de cellules endothéliales humaines .......................................................... 62
Figure 1 (C)(D) : Effet de l'IAA sur l'induction de l'ARNm (C) et de la protéine (D) du FT
dans les cellules HUVEC, dans un milieu contenant 4% d'albumine sérique humaine .......... 62
Figure 1 (E) : Effet de l'inhibiteur de la transcription Actinomycine D (1 pg/ml)
sur l'expression de l'ARNm du facteur tissulaire induit par l’IAA ......................................... 63
Figure 2 (A)(B) : Effet de l'inhibiteur d’AhR le CH-223191 (10μM) et du siRNA AhR
sur l'expression de l'ARNm (A) et de la protéine (B) du FT induit par l’IAA .......................... 65
Figure 2 (C)(D) : Étude de la liaison d’AhR aux promoteurs et analyse de
la translocation nucléaire d’AhR provoqué par l’IAA .......................................................... 66
Figure 2 (E)(F) : Expression d’ARNm des gènes cibles d’AhR induit par l’IAA ....................... 66
Figure 3 (A) : Identification du site de liaison du facteur de transcription sensible a l'IAA
dans le promoteur du FT .................................................................................................. 69
11
Liste des figures
Figure 3 (B)(C) : Effet de l'inhibiteur de NF- sur l'expression de l'ARNm (B) et de la
protéine (C) du FT induit par l’IAA .................................................................................... 69
Figure 3 (D) : Étude de l'expression de la p50 endothéliale dans les extraits nucléaires
induit par l’IAA ............................................................................................................... 70
Figure 4 (A)(B) : Effet des inhibiteurs de PKC, p38 MAPK, ERK1/2 sur l'expression de
l'ARNm (A) et de la protéine (B) du FT induit par l’IAA ....................................................... 72
Figure 4 (C) : Effet des inhibiteurs de PKC et p38 MAPK sur l'expression de la
p50 endothéliale induit par l’IAA dans les extraits nucléaires ............................................. 73
Figure 5 : Les mécanismes liés à l'AhR sous-jacent à la transcription du FT induit par l'IAA
dans les cellules HUVEC ................................................................................................... 74
Figure supplémentaire 1 : Effet de l'IAA sur les niveaux nucléaires des sous-unités AP-1 ;
c-Jun et c-Fos ................................................................................................................. 80
Figure supplémentaire 2 : Effet de l'IAA sur les niveaux nucléaires de NF-B p65 ............... 80
Figure supplémentaire 3 : Effet du siRNA AhR sur l'expression nucléaire de p50 ................ 81
Résultat (5.2.) : Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS
Figure 1 : Effet de l'inhibiteur de la transcription Actinomycine D (1μg/mL) sur
l'expression de l'ARNm du FT induit par l’IS ...................................................................... 83
Figure 2 (A)(B) : Effet des siRNA AhR sur l'expression de l'ARNm (A) et de la protéine (B)
du FT après incubation des HUVEC avec 200 μM d'IS (Gondouin et al. 2013) ...................... 84
Figure 2 (C)(D) : Étude de la liaison d’AhR aux promoteurs et analyse de la
translocation nucléaire provoquée par l’IS ........................................................................ 85
Figure 2 (E)(F) : Expression d’ARNm des gènes cibles d’AhR induit par l’IS .......................... 85
Figure 3 (A) : Identification du site de liaison du facteur de transcription sensible a l'IS
dans le promoteur du FT .................................................................................................. 87
Figure 3 (B)(C) : Effet de l'inhibiteur de NF- sur l'expression du FT induit par l’IS ............ 87
Figure 4 (A)(B) : Effet des inhibiteurs de PKC, p38MAPK, ERK1/2 sur l'expression
de l'ARNm (A) et de la protéine (B) du FT induit par l’IS .................................................... 89
12
Liste des tableaux
Liste des tableaux
Introduction
Tableau 1 : Pronostic, fréquence et stratégie de suivi des MRC en fonction du débit
de filtration glomérulaire et de l’albuminurie ................................................................... 19
Résultat (5.3.) : Étude du lien entre le FT circulant et les taux sériques d’IAA et d’IS chez
les patients HD de Marseille
Tableau 1 : Caractéristiques de base de la population HD (n=92) ....................................... 95
Tableau 2 : Corrélations de Spearman à Two-tailed des caractéristiques de base avec les
taux plasmatiques de FT dans la cohorte HD (n=92) .......................................................... 96
Tableau 3 : Analyse de régression linéaire multivariée pour évaluer la relation entre
les variables indépendantes et les taux plasmatiques de FT chez les patients
HD (n=92) ....................................................................................................................... 97
Résultat (5.4.) : Étude comparative entre deux cohortes de patients HD (Oran vs Marseille)
Tableau 1 : Caractéristiques des patients HD (Oran/Marseille) ........................................ 102
Tableau 2 : Taux des toxines urémiques chez les patients HD (Oran/Marseille) ................ 103
Tableau 3 : Suivi à 1 an des patients HD.......................................................................... 103
13
Liste des abréviations
Liste des abréviations
AhR : Aryl hydrocarbon receptor
ARNT : Aryl hydrocarbon receptor nuclear translocator
AhRR : Aryl hydrocarbon receptor repressor
AP-1: Activator Protein 1
AVF : Arteriovenous fistula
AA : Anthranilic acid
AVC : Arrêt vasculaire cérébrale
CYP450 : Cytochromes P450
COX-2 : Cyclooxygénase-2
CVD : Cardiovascular disease
CKD : Chronic kidney disease
CRP : Protéine C réactive
DFG : Débit de filtration glomérulaire
DRE : Dioxin response element
Egr-1 : Early Growth Response 1
ERK 1/2 : Extracellular signal-regulated kinase 1/2
FT: Facteur tissulaire
FTc : Facteur tissulaire circulant
HTA : Hypertension artérielle
Hsp 90 : Heat shock protein 90
HUVEC : Human umbilical vein endothelial cell
HD: Hémodialysé
IAA : Indole-3 acetic acid
14
Liste des abréviations
IS : Indoxyl Sulfate
IL-6 : L'interleukine 6
IDO : Indoleamine 2,3-dioxygenaseIDO
IRC : Insuffisance rénale chronique
ICAM-1 : Intercellular Adhesion Molecule 1
KTR : Kynurenine/tryptophan ratio
KYN : Kynurenine
KYNA : Kynurenic acid
MRC : Maladie rénale chronique
MRC 5D : MRC stade 5 dialysée
MRC 5T : MRC stade 5 transplantée
MCP-1 : Monocyte chemoattractant protein 1
NO : Nitric oxide
NF-B : nuclear factor-kappa B
NFAT: Nuclear factor of activated T-cells
NC-XRE : Non-consensus xenobiotic response element
PCS : p-Cresyl sulfate
PBMC : Cellule mononuclée sanguine périphérique
P38 MAPK : P38 mitogen-activated protein kinases
PAH : Hydrocarbure aromatique polycyclique
PAI-1/PAI-2 : Plasminogen activator inhibitor-1/2
PKC : Protéine kinase C
QA : Quinolinic acid
RANTES : Regulated on activation, normal T cell expressed and secreted
15
Liste des abréviations
ROS : Reactive oxygen species
SiRNA: Small interfering RNA
SP1 : Specificity protein 1
TUDT: Toxines urémiques dérivées du tryptophane
TCDD : 2,3,7,8-tetrachlorodibenzo-p-dioxin
t-PA : Tissue plasminogen activator
TFPI : Tissue factor pathway inhibitor
TDO : Tryptophan 2,3-dioxygenase
TNF: Tumor necrosis factor
uPA : Urokinase plasminogen activator
uPAR : Urokinase plasminogen activator receptor
vWF: Facteur Willebrand
vSMC : vascular smooth muscle cells
XRE : Xenobiotic response element
XAP2 : HBV X-associated protein 2
3-HAA : 3 hydroxyanthranilic acid
3-HKYN : 3-hydroxykynurenine
16
Sommaire
Sommaire
Résumé (Français/Anglais/Arabe) ........................................................................5
Liste des figures ...................................................................................................10
Liste des tableaux ................................................................................................12
Liste des abréviations ...........................................................................................13
1. Introduction .....................................................................................................19
2. Revue bibliographique .....................................................................................28
3. Objectif de thèse ..............................................................................................46
4. Méthodologie de travail ...................................................................................47
4.1. Culture de cellules endothéliales ......................................................................... 47
4.2. Traitement avec les toxines urémiques IAA ou IS ................................................. 47
4.3. Extinction de la protéine d’AhR avec le SiRNA (Small interfering RNA) ................... 48
4.4. Extraction de l'ARN et analyse RT-PCR quantitative de l'expression de l'ARNm ...... 49
4.5. Test d'immunoprécipitation de la chromatine (ChIP) ............................................ 50
4.6. Western blot et analyse densitométrique de Western blots ................................. 51
4.7. Transfection transitoire des HUVEC et test d’expression de la luciférase
sous le contrôle du promoteur du facteur tissulaire ............................................. 52
4.8. Translocations nucléaires de NF-B et AP-1 ......................................................... 53
4.9. Étude de corrélation entre la concentration de FT circulant et les taux
sériques d’IAA et d’IS chez les patients HD de Marseille ........................................ 54
4.10. Mesure du FT par dosage immuno-enzymatique ................................................ 55
17
4.11. Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) ........ 55
4.11.1. Critères d’inclusion .................................................................................. 56
4.11.2. Critères d’exclusion .................................................................................. 56
4.11.3. Arrêt d’étude ........................................................................................... 57
4.11.4. Les éléments cliniques et biologiques d’intérêt ......................................... 57
4.11.5. Dosages des toxines ................................................................................. 57
4.11.6. Suivi des patients ..................................................................................... 57
4.12. Analyses statistiques ......................................................................................... 58
5. Résultats et discussions ....................................................................................59
5.1. Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA .........60
5.1.1. Étude de l'expression du FT induit par l'IAA dans les
cellules endothéliales ............................................................................. 61
5.1.2. L’IAA induit l'expression du FT par l'intermédiaire de l'activation
d’AhR mais sans la liaison d'AhR au promoteur du FT ............................... 64
5.1.3. Le site NF-B du promoteur du FT est nécessaire pour l'induction
du FT par l'IAA ........................................................................................ 67
Coopération entre AhR et NF-B dans l'induction du FT par l'IAA .............. 68
5.1.4. Implication de p38 MAPK dans l'induction du FT par l'IAA ......................... 71
Discussion ....................................................................................................... 75
Figures supplémentaires ................................................................................ 80
5.2. Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS ............82
5.2.1. L’induction de l'expression du FT dans les cellules endothéliales
HUVEC par l’IS est contrôlée au niveau transcriptionnel ........................... 83
5.2.2. L’IS induit une activation d’AhR sans la fixation de ce dernier sur
le promoteur du FT ................................................................................. 84
Sommaire
18
Sommaire
5.2.3. Une voie non-génomique indirecte d’AhR activant d’autres facteurs
de transcription semble être impliquée dans la régulation de l’expression
du FT induit par l'IS ................................................................................. 86
5.2.4. Implication de p38 MAPK et PKC dans l'expression du FT induit
par l'IS ................................................................................................... 88
Discussion ....................................................................................................... 90
5.3. Étude du lien entre le FT circulant et les taux sériques d’IAA et d’IS
chez les patients HD de Marseille ..............................................................93
- Les taux de FT circulants sont indépendamment liés au niveau d'IAA mais
pas d’IS chez les patients hémodialysés de Marseille ................................ 94
Discussion ......................................................................................................... 98
5.4. Étude comparative entre deux cohortes de patients HD
(Oran vs Marseille) .....................................................................................100
5.4.1. Comparaison de la cohorte de patients HD d’Oran et des patients HD
de Marseille ........................................................................................... 103
5.4.2. Les taux d’IS sont significativement plus élevés chez les HD d’Oran ............ 103
5.4.3. Le taux de mortalité et des événements cardiovasculaires ne sont
pas différents entre la cohorte de patients HD d’Oran et celle de
Marseille après un suivi d’un an ............................................................... 103
Discussion ........................................................................................................ 104
6. Conclusion et perspectives ...............................................................................109
Références bibliographiques ................................................................................114
Annexes ...............................................................................................................127
Productions scientifiques .....................................................................................135
19
1. Introduction
L’incidence de la maladie rénale chronique (MRC) augmente régulièrement dans le
monde (Levey et al. 2007). Selon « The Global Burden of Disease », une personne sur dix
dans le monde souffre d'un certain degré de maladie rénale chronique (GBD 2015 Disease
and Injury Incidence and Prevalence ).
La MRC est caractérisée par une altération irréversible et lente des fonctions normales du
rein aussi bien exocrines et qu’endocrines. Sa définition la plus fréquente est un débit de
filtration glomérulaire (DFG) inférieur à 60 ml/min/1,73 m2 ou l’existence d’une protéinurie,
durant au moins 3 mois (Stevens et al. 2013). La MRC est définie par des stades en fonction
de la sévérité de l’altération du DFG et de la protéinurie (tableau 1).
La prévalence du stade 5 (nécessitant le recours à une technique de suppléance, dialyse
« stade 5D » ou transplantation « stade 5T ») varie de 200 à 2400 cas par million selon les
pays (Levey and Coresh 2012). La mortalité chez les patients atteints de MRC stade 5D est de
10 à 20 fois plus élevée que dans la population générale (Parmar 2002). La mortalité dans les
Tableau 1
Introduction
20
stades plus précoces est aussi plus importante essentiellement du fait de la pathologie
cardiovasculaire (Webster et al. 2017).
Les complications cardiovasculaires sont les premières causes de mortalité et de
morbidité chez les patients MRC (Weiner et al. 2004). Ces complications incarnent plus de
50% des causes de décès chez ces patients (Foley et al. 1998; Di Angelantonio et al. 2007;
Perkovic et al. 2008; Wattanakit et al. 2008).
La thrombose est au cœur des principales pathologies cardiovasculaires: la cardiopathie
ischémique (infarctus du myocarde), l’accident vasculaire cérébral et la thromboembolie
veineuse (Perkovic et al. 2008; Wattanakit et al. 2008; ISTH Steering Committee for World
Thrombosis Day 2014). La MRC est associée à un risque thrombotique accru (Daneschvar et
al. 2008; Ocak et al. 2013; Carney 2016). En effet, les patients avec une MRC présentent plus
de risques de thrombose veineuse profonde (Parikh et al. 2011), d’embolie pulmonaire (Lutz
et al. 2014; Parikh et al. 2011), de thrombose des abords vasculaires (Arora et al. 2000;
Pavord and Myers 2011; Ravani et al. 2013; Lutz et al. 2014), d’infarctus du myocarde, d’AVC
ischémique et d’artériopathie des membres inférieurs (Casserly and Dember 2003; Pavord
and Myers 2011; Lutz et al. 2014),. Les facteurs de risque cardiovasculaire classique comme
l’HTA, la dyslipidémie, le diabète ou le tabagisme, n’expliquent pas la fréquence observée au
cours de la MRC. D’autres facteurs non classiques tels que les toxines urémiques jouent un
rôle dans la pathologie cardiovasculaire au cours de la MRC.
Les toxines urémiques sont des composées normalement éliminées par le rein, qui
s’accumulent dans le sang et les tissus des patients avec une MRC (Vanholder et al. 2003).
Ces toxines sont classées en composés de petite taille hydrosoluble comme l’acide urique.
Composés de petite taille liée aux protéines, comme les indoles dont les principaux
représentants sont l’Indole-3 Acetique Acide (IAA) et l’Indoxyl Sulfate (IS), et les phénols
Introduction
21
Introduction
dont le chef de file est le Para Crésol Sulfate (pCS). Enfin, des composés dits moyennes
molécules comme la β2-microglobulin (Vanholder et al. 2003). Nos travaux se sont focalisés
sur les deux toxines urémiques indoliques liées aux protéines, l’Indole-3 Acétique Acide (IAA)
et l’Indoxyl Sulfate (IS). Ces toxines sont issues du métabolisme du tryptophane apporté par
l’alimentation. Du fait de leurs liaisons aux protéines (Jourde-Chiche et al. 2009), elles sont
mal épurées par la dialyse (Neirynck et al. 2013a) et s’accumulent chez les patients en stade
5D. L’accumulation d’indoles IAA et IS chez les patients atteints de MRC est impliqué dans les
évènements thrombotiques. Ces indoles induisent une dysfonction endothéliale et
plaquettaire favorisant la thrombose (Dou et al. 2015; Yang et al. 2017). Ils augmentent la
libération et l’activité de microparticules procoagulantes (Faure et al. 2006; Gondouin et al.
2013). Ils sont également associés à l’augmentation des facteurs plasmatiques
procoagulants, vWF et FT chez les patients MRC (Pawlak et al. 2009; Gondouin et al. 2013;
Kamiński et al. 2017).
Notre équipe a montré que l'IAA et l’IS augmentent l'expression et l'activité
procoagulante du FT dans les cellules endothéliales du cordon ombilical humain (HUVEC) et
dans les cellules mononucléaires périphériques sanguines (PBMC) (Gondouin et al. 2013). Ce
mécanisme est déterminant dans les survenues thrombotiques chez les patients avec une
MRC. Le but de notre travail était d’explorer les mécanismes cellulaires impliqués dans
l’expression du FT induit par l’IAA et l’IS.
Le Facteur Tissulaire (FT), aussi appelé « CD142 », « facteur III » ou « thromboplastine»,
est une glycoprotéine transmembranaire qui est l’initiateur de la voie dite extrinsèque de la
coagulation en cas de brèche vasculaire. La formation du complexe FT-facteur VII activé
déclenche l'activation des cascades de la coagulation, entrainant la génération de thrombine
et la formation de fibrine. Le FT est exprimé de manière constitutive dans les cellules de la
22
paroi vasculaire, comme les fibroblastes et les cellules musculaires lisses (vSMC), afin de
réduire les saignements après une lésion vasculaire (Camerer et al. 1996). En condition
normale, il n'est pas exprimé par les cellules qui sont en contact direct avec la circulation
sanguine, telle que les cellules endothéliales et les monocytes. Cependant, dans des
conditions pathologiques, il peut être exprimé de façon inductible par ces cellules favorisant
ainsi la formation d’un thrombus en activant la cascade de coagulation (Reny 2001,Bode and
Mackman 2014)(Figure 1).
Cette glycoprotéine de 47 kDa est synthétisée sous forme d’un propeptide de 295 AA qui
après clivage du peptide signale de 32 AA donne la protéine mature de 263 AA. Cette
protéine comporte un domaine extracellulaire (1-219 AA), un domaine transmembranaire
(220-242 AA) et un domaine cytoplasmique (243-263 AA). Le gène du FT est situé sur le
chromosome 1 en position 1p21-22, et est constitué de 12 400 paires de bases et comprend
6 exons séparés par 5 introns, une région 5' non transcrite comportant le promoteur du gène
et une région 3' non transcrite. La région codante comporte 885 paires de bases (Ternisien
and Prost 1995). Le promoteur du gène comporte, outre une TATA box, cinq motifs de type
SP1 dont trois sites de chevauchement avec les facteurs de transcription (zinc finger) Egr-1,
Olivier Reynard, et al, Medecine Sciences: M/S 31, no 2 (2015): 143‑50
Figure 1 : L’Expression anormale du FT active la cascade de coagulation
Introduction
23
Introduction
deux sites de type AP-1 et un site de type NF-B chevauchant le site de liaison du facteur
nucléaire des cellules T activées (NFAT) (Ternisien and Prost 1995; Cui et al. 1996; Ruf and
Riewald 2013; Bode and Mackman 2014)(Figure 2). Ces sites sont des séquences consensus
de l'ADN sur lesquelles peuvent se fixer des facteurs de transcription, AP-1, NF-B et Egr-1
responsables de la transcription inductible de F3 (gêne du FT) , et Sp1 qui est nécessaire
pour la transcription constitutive de F3 (Figure 2) (Oeth et al. 1997; Mackman 1997; Li et al.
2009).
L’IAA, l’IS, et la dioxine induisent l’expression du FT via le facteur de transcription l’Aryl
hydrocarbon receptor (AhR) dans les cellules endothéliales HUVEC et les monocytes
(Gondouin et al. 2013). La voie de signalisation responsable de cette expression est
inconnue.
Figure 2 : Induction du promoteur du facteur tissulaire humain (FT) dans les cellules
endothéliales.
24
AhR est un membre de la famille des facteurs de transcriptions basic helix-loop-helix/Per-
Arnt-Sim (bHLH/PAS)(Mandal 2005, Stevens et al. 2009). Il a été découvert dans les années
1990. La protéine de 96 kD (848 AA) est codée par le gène AHR de 47,5 kb, constitué de 11
exons et localisé sur le chromosome 7p21.1. La liaison d’un ligand à AhR permet l’activation
de la voie génomique en induisant sa translocation dans le noyau où il se fixera aux sites XRE
ou DRE dans le promoteur de nombreux gènes (Figure 3). Les ligands classiques sont les
contaminants environnementaux comme la dioxine TCDD (2,3,7,8-tetrachlorodibenzo-p-
dioxin), et les polychlorobiphényles (PCB) (Chevallier et al. 2011). Ces composés lipophiles
diffusent librement à travers les membranes cellulaires, et exercent leurs effets toxiques en
se liant à AhR. En absence de ligand, AhR forme un complexe cytoplasmique avec HSP90
(heat shock protein 90), XAP2 (hepatitis B virus X-associated protein 2) et une protéine
accessoire p23 (Petrulis and Perdew 2002). La fixation des ligands provoque sa libération du
complexe multimérique (Heid et al. 2000), sa translocation dans le noyau permet son
interaction avec ARNT (aryl-hydrocarbon nuclear translocator). L’hétérodimère, localisé dans
le noyau, peut reconnaître des séquences spécifiques sur les promoteurs des gènes cibles
(Dolwick et al. 1993). Il s’agit de motifs XRE (Xenobiotic Response Element), présents par
exemple en 5’ des gènes de la famille des cytochromes P450, dits de la phaseI (Fujii-
Kuriyama and Mimura 2005), comme CYP1A1, CYP1A2 ou CYP1B1 (Zanger and Schwab 2013)
(Figure 3). Ces enzymes jouent un rôle majeur dans le métabolisme des xénobiotiques, dont
les médicaments, et ont un rôle primordial dans la protection de l’organisme contre les
agressions extérieures (polluants, pesticides...). Parmi les gènes cibles d’AhR, on peut
également citer AHRR (Aryl hydrocarbon receptor répressor) qui assure le rétrocontrôle de
la voie AhR.
Introduction
25
Récemment, une nouvelle voie génomique d’AhR indépendante de l'ARNT pour
l'expression génique a été décrite (Jackson et al. 2015), avec un nouveau XRE non-consensus
(NC-XRE), dans les promoteurs de PAI-1 (Huang and Elferink 2012) et de p21Cip1 (Jackson et
al. 2014). Une voie non génomique d’AhR indépendante de l'ARNT induisant l’inflammation
a également été décrite (Zhao et al. 2002; Sciullo et al. 2008; Matsumura 2009; Kim et al.
2012). En effet, il a été montré que des ligands d’AhR, tels que la TCDD, induisent
l'expression de protéines impliquées dans l'inflammation comme l'IL-6, RANTES, TNF et COX-
2 (Zhao et al. 2002; Sciullo et al. 2008; Kim et al. 2012). Dans la voie non-génomique, AhR
agit comme une molécule de signalisation qui interagit avec plusieurs voies de signalisation
(Borlak and Jenke 2008; Henklová et al. 2008; Ma et al. 2009; Puga et al. 2009). Notre équipe
a récemment rapporté que l’IAA induit la COX-2 endothéliale via une voie non-génomique
d’AhR impliquant la signalisation p38MAPK/NF-B (Dou et al. 2015).
L'objectif du travail était de déterminer les voies de signalisation et les facteurs de
transcription impliqués dans l'induction du FT médiée par AhR en réponse à l’IAA et l’IS.
, AHRR
Figure 3 : Activation de la voie classique génomique de l’Aryl Hydrocarbon Receptor (AHR)
Introduction
26
Introduction
L’activation d’AhR est impliquée dans la pathogénie des maladies cardiovasculaires
(Korashy and El-Kadi 2006; Wu et al. 2011; Ansari et al. 2013), dont les événements
thrombotiques chez les patients avec une MRC (Shivanna et al. 2016; Kolachalama et al.
2018). L’induction du FT par l’IAA et l’IS via AhR, semble être un mécanisme clé dans la
survenue des événements thrombotiques chez ces patients. Ce mécanisme pourrait en effet
être lié aux taux élevés de FT circulant (FTc) observés chez les patients MRC (Gondouin et al.
2013; Shivanna et al. 2016). C’est pourquoi dans cette thèse nous avons également étudié le
lien entre les toxines indoliques et le FTc chez des patients MRC hémodialysés (HD).
Outre l’effet thrombotique, l’IAA et l’IS favorisent l’inflammation, le stress oxydant et
l’athérosclérose (Dou et al. 2015; Gao and Liu 2017), augmentant ainsi les risques des
maladies cardiovasculaires. En effet, l’augmentation de ces toxines dans les sérums des
patients MRC est prédicteur des complications cardiovasculaires et de la mortalité chez ces
patients (Lin et al. 2012; Lin et al. 2013; Dou et al. 2015). Chez les patients urémiques, la
concentration sérique moyenne de l’IAA est de 5,9µM, et de 81,04µM pour l’IS (Calaf et al.
2011), tandis que chez des sujets sains la concentration de l’IAA est de 2,12µM et de 1,03µM
d’IS. Cependant, ces taux peuvent varier d’une population à une l’autre (Vanholder et al.
2003). Dans la littérature, nous ne disposons que de données des taux de toxines urémiques
dérivées du tryptophane de patients vivants dans des pays occidentaux. Les taux de l’IAA et
de l’S n’ont jusqu'à présent jamais été dosés dans une population hémodialysée algérienne.
C’est pourquoi, dans ce travail de thèse, nous avons déterminé les taux de ces toxines dans
le sérum d’une population HD en Algérie de la ville d’Oran, puis comparé avec les taux d’une
population HD en France de la ville de Marseille. Les indoles, IAA et IS sont issus du
métabolisme du tryptophane par l’apport nutritionnel, qui est principalement métabolisé
par le microbiote intestinal. Ainsi, il est logique de penser qu’un régime alimentaire différent
27
et une flore intestinale variant d’une population à une autre en fonction des différents
facteurs culturels, sociaux, environnementaux et surtout nutritionnels de différents pays,
puissent jouer un rôle important dans la variabilité des taux sériques de l’IAA et l’IS. Nous
avons fait l’hypothèse que des différences de taux sériques pourraient être observées entre
la cohorte de patients HD oranaise et marseillaise. Il s’agit du premier travail clinique sur ces
toxines dans un pays du Sud.
Introduction
28
Revue bibliographique
2. Revue bibliographique
Je propose un article de synthèse bibliographique comme révision de l’état de la
littérature ;
La revue de synthèse sous le titre de “Tryptophan-Derived Uremic Toxins and Thrombosis
in Chronic Kidney Disease” résume les effets thrombotiques de l’accumulation des toxines
urémiques dérivées du tryptophane (TUDT) chez les patients atteints de maladie rénale
chronique. Cette revue décrit également les différents mécanismes thrombotiques activés
par les TUDT. L’induction du facteur tissulaire via une nouvelle voie dépendante du facteur
de transcription Aryl hydrocarbon receptor, représente un des mécanismes clés dans les
survenues thrombotiques chez les patients MRC. Une meilleure compréhension des
mécanismes prothrombotiques induits par les TUDT pourrait aider à trouver de nouvelles
cibles thérapeutiques pour prévenir la thrombose chez les patients MRC.
29
Revue bibliographique
Abstract: Patients with chronic kidney disease (CKD) display an elevated risk of
thrombosis.
Thrombosis occurs in cardiovascular events, such as venous thromboembolism,
stroke, and acute coronary syndrome, and is a cause of hemodialysis vascular access
dysfunction. CKD leads to the accumulation of uremic toxins, which exerts toxic
effects on blood and the vessel wall. Some uremic toxins result from tryptophan
metabolization in the gut through the indolic and the kynurenine pathways. An
increasing number of studies are highlighting the link between such uremic toxins
and thrombosis in CKD. In this review, we describe the thrombotic mechanisms
induced by tryptophan-derived uremic toxins (TDUT). These mechanisms include an
increase in plasma levels of procoagulant factors, induction of platelet hyperactivity,
induction of endothelial dysfunction/ impairment of endothelial healing, decrease in
nitric oxide (NO) bioavailability, and production of procoagulant microparticles. We
focus on one important prothrombotic mechanism: The induction of tissue factor
(TF), the initiator of the extrinsic pathway of the blood coagulation. This induction
occurs via a new pathway, dependent on the transcription factor Aryl hydrocarbon
receptor (AhR), the receptor of TDUT in cells. A better understanding of the
prothrombotic mechanisms of uremic toxins could help to find novel therapeutic
targets to prevent thrombosis in CKD.
Keywords: uremic toxins; thrombosis; chronic kidney disease; tryptophan
Key Contribution: This review summarizes the thrombotic effects of tryptophan-
derived uremic toxins, and provides an insight into the mechanisms involved.
Toxins 2018,10,412; doi:10.3390/toxins10100412 www.mdpi.com/journal/toxins
30
Revue bibliographique
1. Introduction
Chronic kidney disease (CKD) is defined as the occurrence of abnormalities of
kidney structure or function, present for >3 months [1]. A decreased glomerular
filtration rate (GFR) to less than 60 mL/min per 1.73 m2 is the commonest
manifestation of CKD [2]. The decline of GFR is related to a substantial risk of
mortality and cardiovascular disease (CVD) [3–6]. CVDs such as congestive heart
failure, coronary artery disease, cerebrovascular disease, peripheral arterial diseases,
atrial fibrillation, and sudden cardiac death represent cardiovascular pathologies that
occur in patients with CKD [5,6].
Thrombosis is in the heart of the three major cardiovascular events: Ischemic
stroke, ischemic heart disease, and venous thromboembolism [7]. CKD patients
display an increased thrombotic risk, paradoxically associated with a bleeding
tendency [8,9]. In CKD, thrombotic events occur in the cerebral, coronary, and retinal
arteries, in the deep venous system, heart, and at sites of vascular access in
hemodialysis patients [10]. Thrombus formation in arteries is often associated with
atherosclerosis [8]. The risk of pulmonary embolism and deep vein thrombosis is
significantly increased in CKD patients [11]. Moderate decrease in kidney function
(30 < eGFR < 60 mL/min per 1.73 m2) and severe decrease in kidney function (eGFR <
30 mL/min per 1.73 m2) are respectively associated with a 2.5-fold and a 5.5-fold
increase in venous thrombosis risk [12]. CKD patients display a higher mortality rate
than patients with normal kidney function due to pulmonary embolism [8]. In CKD
patients, the atrial fibrillation risk is higher and associated with an increased
neurovascular risk [13]. In hemodialysis patients, thrombosis can complicate stenosis,
leading to access failure [14].
2. Uremic Toxins from Tryptophan Metabolism
CKD leads to the accumulation of uremic toxins [15]. This accumulation exerts a
deleterious effect on multiple organs/systems [15]. In 2003, the European Uremic
Toxin Work Group (EUTOX) classified 90 uremic compounds. The number of
compounds has been extended since [15]. The classification of uremic toxins includes
three groups: Small water-soluble molecules (≤ 500 Da); middle molecules (>500 Da);
and protein-bound molecules [15].
Some uremic toxins result from tryptophan metabolism through the indolic and
the kynurenine pathways [16]. Dietary tryptophan is metabolized by the gut
microbiota via three major pathways, leading to serotonin, kynurenines, and indole
derivatives [16]. The kynurenine pathway that metabolizes 95% of tryptophan is
mediated by enzymes tryptophan 2,3-dioxygenase (TDO) and indoleamine 2,3-
dioxygenase (IDO). The activity of IDO leads to kynurenine from tryptophan and is
31
Revue bibliographique
reflected by the kynurenine/tryptophan ratio (KTR). Then, various metabolites can
derive from kynurenine (KYN): 3 hydroxyanthranilic acid (3-HAA), 3-
hydroxykynurenine (3-HKYN), kynurenic acid (KYNA), anthranilic acid (AA), and
quinolinic acid (QA) [16]. The concentration of all kynurenine metabolites is
increased in CKD patients, while tryptophan decreases. The indolic pathway leads to
the indolic uremic toxins indoxyl sulfate (IS), indoxyl-β-D-glucuronide, and indole-3-
acetic acid (IAA) [16]. In this pathway, tryptophan is converted to indole by the gut
microbiota and absorbed into the blood circulation, then oxidized and sulfated in the
liver by the microsomal p450 cytochrome CYP2E1 enzyme and sulfatase (SULT1A1)
to form IS [17]. IAA is directly produced in the gut from tryptophan metabolism, or
endogenously in tissue via tryptamine [16]. Because they are protein-bound, IS and
IAA are badly cleared by dialysis [18].
3. Tryptophan-Derived Uremic Toxins and Thrombotic Events
An increasing number of studies are highlighting the link between tryptophan
metabolites and thrombotic events in CKD. Studies support a role of tryptophan-
derived uremic toxins (TDUT) and vascular access thrombosis in hemodialysis
patients. Using multivariate Cox regression analysis in 306 patients undergoing
endovascular interventions for dialysis access dysfunction, Wu et al. reported the
amount of free IS predicts vascular access thrombosis, suggesting serum IS is a new
risk factor for post-angioplasty thrombosis [19]. In 473 patients with advanced CKD,
Chitalia et al. also demonstrated that patients with subsequent arteriovenous fistula
(AVF) thrombosis had higher levels of IS, KYN, and KYNA than those without
thrombosis [20]. Studies also showed the association of TDUT with cardiovascular
events in CKD patients. KYN, 3-HKYN, KYNA, and KTR plasma concentrations are
associated with increased risk of myocardial infarction [21–23]. In a cohort of CKD
patients, Barreto et al. have shown IS predicts cardiovascular mortality [24]. In 120
patients with CKD, we demonstrated serum IAA predicts cardiovascular events and
mortality, even after adjustment for CKD stage [25].
TDUT have an impact on thrombus formation. In Wistar rats, Karbowska et al.
demonstrated that IS increases the weight of thrombus after vascular injury [26]. In
mice exposed to high doses of IS, greater thrombus formation was observed after
laser-induced endothelial injury, compared to non-IS exposed mice [26]. Another
study showed that KYN enhances thrombosis after vascular injury in mice [20].
Chitalia’s group demonstrated that treatment of vascular smooth muscle cells
(vSMC) by IS or IAA increases their thrombogenicity [27]. An important clot
formation was observed in primary human vSMC pretreated with IS or IAA when
exposed to coronary-like blood flow in an ex-vivo flow loop model [28].
32
Revue bibliographique
4. Thrombotic Mechanisms Induced by Tryptophan-Derived Uremic Toxins
After an endothelial lesion or a blood vessel injury, subendothelial components are
exposed to the blood and activate the process of hemostasis to initiate a blood clot
formation [29]. The platelet plug formation involves platelet activation, adhesion to
exposed subendothelial matrix components, and platelet aggregation [29]. Several
platelet receptors and adhesive proteins, like the von Willebrand factor (vWF),
fibrinogen, or collagen, as well as platelet-derived agonists, are involved in the
interactions that normally occur only in the case of a vessel injury [29]. At the site of
injury, the tissue factor (TF) from the vessel wall initiates the extrinsic pathway of the
coagulation cascade. The complex TF/factor VIIa leads to the generation of factor Xa,
which proteolytically cleaves prothrombin to form thrombin. Thrombin then
mediates fibrin generation and platelet activation [29]. The coagulation cascade is
also down-regulated by different factors, such as serine protease inhibitors
antithrombin and tissue factor pathway inhibitor (TFPI) [29]. The deposition of
insoluble fibrin and its incorporation into and around the platelet plug strengthen
and stabilize the blood clot [29]. The fibrinolysis pathway, which breaks down the
fibrin clot, also plays a substantial role in hemostasis [29]. In this pathway, tissue
plasminogen activator (t-PA) released by the injured endothelium, and urokinase
(uPA) in the presence of its receptor (uPAR) convert plasminogen to plasmin, which
cleaves and destroys fibrin. Within the clot, t-PA activates plasminogen, which
decomposes the fibrin mesh. t-PA and urokinase are inhibited by plasminogen
activator inhibitor-1 and -2 (PAI-1 and PAI-2) [29].
A controlled balance between procoagulant and anticoagulant systems is essential,
and a dysregulation can lead to pathological bleeding, or pathological thrombus
formation, that is, thrombosis [29]. CKD, as well as TDUT, induce a profound
deregulation of the mechanisms of hemostasis that affects all the players involved.
4.1. Deregulation of Plasma Coagulation Factors
Several abnormalities in plasma factors of hemostasis are reported in CKD
patients. These abnormalities are in favor of a hypercoagulable state, with enhanced
levels of vWF, fibrinogen, thrombin, factor VII, TF, and PAI-1 [10,30], as well as
reduced antithrombin activity [30]. In patients with CKD, we found that the
concentration of circulating TF positively correlates with plasma levels of IS and IAA
[31]. IS level also correlates with TF procoagulant activity [32] and with vWF in CKD
patients [33]. Kynurenine is positively associated with vWF [34] and with
prothrombin fragments F(1+2), reflecting hypercoagulability in CKD patients [35].
AA is also significantly associated with TF and prothrombin fragments F(1+2) [35],
and negatively correlated with the fibrinolytic system uPA/uPAR in severe-to-end-
33
Revue bibliographique
stage CKD [36]. QA is positively associated with vWF [34], TF, and prothrombin
fragments F(1+2) [35]. 3-hydroxykynurenine is positively associated with vWF [34]
and with the TF/TFPI system [37] in CKD patients.
4.2. Platelet Hyperactivity
CKD is associated with both platelet dysfunction and activation [38,39]. Platelet
activity is increased in CKD mice that display increased IS levels [40]. Ex vivo and in
vitro, IS increases platelet activity, including an enhanced response to collagen and
thrombin, increase in platelet microparticle production, and increase in platelet–
monocyte aggregates [40]. In addition, IS-mediated platelet activation takes part in
thrombus formation ex vivo and in vivo [40]. Reactive oxygen species (ROS)-induced
p38MAPK signaling in platelets plays a crucial role in IS-induced platelet activation
[40]. The inhibition of the ROS/p38 activation pathway by the ROS scavenger N-
acetylcysteine (NAC) suppresses IS-induced platelet hyperactivation and platelet–
monocyte aggregates, and strikingly attenuates IS-induced thrombus formation [40].
4.3. Endothelial Dysfunction
The vascular endothelium is essential for maintaining hemostasis and preventing
thrombosis [41]. Healthy endothelial cells maintain an anticoagulant surface by
expressing molecules that prevent platelet aggregation and fibrin formation [41].
When dysfunctional or activated, the endothelium can become prothrombotic and
proinflammatory [41].
In CKD patients, endothelium dysfunction begins in the early stages of CKD [42]
and takes a substantial part in thrombotic events [43]. In hemodialysis patients,
endothelial injury is associated with an increased risk of AVF thrombosis [44–46].
The modifications of hemodynamic stress in vascular access and the accumulation of
uremic toxins play a major role in endothelium dysfunction [45]. Tryptophan-
derived indolic toxins induce a profound endothelial dysfunction, characterized by a
procoagulant, pro-oxidant and proinflammatory phenotype [16,25]. In case of injury,
these toxins could impair endothelial healing and vessel repair by inhibiting
endothelial proliferation and migration, inducing endothelial senescence [16], and
promoting progenitor cell apoptosis [44]. Another aspect of endothelial function is
the generation of pro- and anticoagulant prostaglandins, which play an important
role in hemostasis. Notably, endothelial cells produce Prostaglandin E2 (PGE2),
which is generated by cyclooxygenases (COX) from arachidonic acid. PGE2 elicits
platelet aggregation via its binding on platelet EP3 receptors and promotes
thrombosis [47,48]. We demonstrated that IAA induces COX-2 expression in cultured
endothelial cells via an aryl hydrocarbon receptor (AhR)/p38MAPK/Nuclear Factor
kappa B (NF-B) pathway [25]. Importantly, this increase in COX-2 enhances
34
Revue bibliographique
endothelial PGE2 synthesis [25], suggesting that IAA could promote platelet
aggregation via endothelial synthesis of COX-2/PGE-2.
4.4. Decrease in NO Bioavailability
Nitric oxide (NO) released from endothelium and platelets prevents platelet
adhesion to the vessel wall and inhibits platelet recruitment, aggregation, and
activity [49]. NO supplies a negative feedback mechanism for thrombus propagation,
and bioactive NO deficiency is associated with platelet dysfunction and arterial
thrombosis [49]. CKD patients display NO deficiency, mainly to high concentration
of the endogenous NO Synthase (NOS) inhibitor asymmetric dimethylarginine
(ADMA), and defects in NOS activity [50]. Importantly, the increase in oxidative
stress in CKD patients further reduces NO bioavailability [50]. Reactive oxygen
species (ROS) have many effects on NO bioavailability: ROS increase ADMA levels,
the ROS superoxide can react with NO to produce peroxynitrite that depletes the
bioactivity of NO, and ROS oxidize tetrahydrobiopterin (BH4), which is crucial for
eNOS activity [50]. Tryptophan-derived indolic toxins affect NO production: IS
inhibits NO production in endothelial cells [51], but increases it in mononuclear cells
[52]. In parallel, these toxins increase ROS production in blood mononuclear cells [52]
and in vascular endothelial cells [25,53] by increasing endothelial NAD(P)H oxidase
activity and decreasing the cellular amount of the antioxidant glutathione [53]. Thus,
by favoring a pro-oxidant environment, indolic toxins could decrease NO
bioavailability and thus contribute to increased platelet reactivity.
4.5. Production of Procoagulant Microparticles
CKD patients display high plasma levels of microparticles from platelet and
endothelium [54,55]. Microparticles are membrane fragments that result from the
remodeling of plasma membrane in response to activation or apoptosis [55].
Microparticles expose on their surfaces both phosphatidylserine, which facilitates the
transformation of prothrombin to thrombin; and TF, which leads to thrombin
generation, thus conferring a procoagulant potential [56,57]. Microparticles
exhibiting TF are able to form a thrombus in vivo [58]. In vitro, we have shown that
IS significantly enhances the release of microparticles by the endothelium [54].
Importantly, microparticles from endothelial cells incubated with indolic toxins
exhibit a higher procoagulant activity [31]. Gao et al. also reported that IS and IAA
enhance the procoagulant activity of red blood cells through releasing microparticles
and exposing phosphatidyserine [59].
35
Revue bibliographique
4.6. Overexpression of Cell Tissue Factor
TF induction in vascular cells by TDUT could be an important prothrombotic
mechanism. TF is constitutively expressed in vascular wall cells, like fibroblasts and
vSMC, to reduce bleeding after a vascular lesion [41]. TF is usually not expressed in
endothelium, but activated endothelium and leukocytes could express active TF after
a vascular lesion or inflammation [41]. Blood-borne TF comes mainly from
leukocytes, platelets, and TF-bearing microparticles or circulates as a soluble protein
[60]. TF exists as an encrypted form, with little or no procoagulant activity, which
becomes activated (decrypted) upon vascular stimulation or injury [41].
In human aortic smooth muscle cells (SMC) that constitutively express TF, IS and
KYN, as well as uremic serum, induce TF overexpression and increase its activity
[20,27,61,62]. A prior treatment with an anti-TF neutralizing antibody reduces clot
formation in vSMC exposed to coronary flow [27]. We reported that indolic toxins IS
and IAA also induce TF expression in various types of cultured human endothelial
cells that usually not express TF [31,63], as well as in leukocytes [31]. IS and IAA
exacerbates the procoagulant activity of TF in endothelial cells and in endothelial
microparticles [31]. In vivo, TF activity is greater in CKD patients with subsequent
arteriovenous thrombosis than in those without thrombosis [20].
We demonstrated that TF induction by IS and IAA in endothelial cells occurred via
a new pathway, dependent on the transcription factor AhR [31]. AhR is a receptor of
some environmental contaminants, like 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)
[64]. Indolic toxins IS, IAA, as well as kynurenines are potent endogenous agonists of
AhR [16,65]. In resting cells, AhR forms a complex in the cytoplasm with HSP90,
XAP2, and p23 [65]. Activation of the AhR genomic pathway by ligand binding
causes AhR release from the heterodimeric complex and its interaction with its
nuclear translocator ARNT (Aryl Hydrocarbon Nuclear Translocator) [65]. In the
nucleus, the AhR/ARNT heterodimer recognizes specific XRE (Xenobiotic Response
Elements) sequences on the promoters of AhR target genes, like genes of the
cytochrome P450 family: CYP1A1, CYP1A2, or CYP1B1 [65]. Once activated by
ligand, AhR can also cross-talk with multiple signaling pathways and elicit
inflammation through a non-genomic pathway that does not require ARNT [66]. This
non-genomic inflammatory pathway of AhR is involved in the induction of
inflammatory genes, such as IL-1, IL-8, MCP-1, and COX-2 [25,67].
In endothelial cells, AhR inhibitors and AhR si RNA completely inhibit TF
induction by indolic toxins [31,63]. We further showed that IAA induces endothelial
TF expression via a non-genomic inflammatory pathway of AhR that induces
p38MAPK and NF-B activation [63]. In vSMC, IS extends TF half-life by reducing TF
ubiquitination [27]. Shivanna et al. demonstrated that AhR activated by IS directly
36
Revue bibliographique
interacts with and stabilizes functional TF [32]. AHR regulates TF through STUB1, an
ubiquitin ligase, which interacts with TF and degrades it through ubiquitination [68].
Consequently, IS thrombogenicity is significantly abrogated by the AHR antagonist
in a flow loop ex vivo model [32]. KYN also increases TF expression via AhR in
primary human aortic SMC [20] and regulates thrombosis after a carotid lesion in
mice in an AhR-dependent way [20]. We demonstrated that patients and mice with
CKD have high amounts of AhR agonists associated with cellular activation of AhR
[69]. In 116 CKD patients, we further observed that cardiovascular events are more
frequent in patients with high levels of AhR agonists [69]. In CKD patients, Shivanna
et al. demonstrated IS levels correlate with AHR-inducing activity of serum and with
TF activity [32]. CKD patients with arteriovenous thrombosis have a significant
greater activity of AHR and TF than those without thrombosis [20]. AhR plays an
important role in platelet production [70,71] and function [72]. The activation of the
AhR/p38 MAPK pathway was observed in platelets in response to AhR agonists and
resulted in enhanced platelet aggregation [73]. Therefore, AHR activation by TDUT
could affect primary hemostasis, in addition to activation of coagulation, and could
be a new prothrombotic mechanism in CKD patients. Clinical studies are now
necessary to demonstrate that targeting AhR activation could be a new therapeutic
option for preventing thrombosis in CKD patients.
5. Modulation of Microbiota and Diet to Reduce TDUT Production
Considering that TDUT arise from the metabolization of dietary tryptophan by the
gut microbiota [16] and that gut dysbiosis begins in the initial stages of CKD [74],
modifications of diet and/or use of prebiotics, probiotics, and symbiotics is a
tempting approach. Results on probiotic therapies in CKD are conflicting. In a recent
study, probiotic supplementation failed to reduce plasma levels of IS, IAA, and
inflammatory markers in HD patients [75], whereas it decreased serum levels of IS in
another study [76]. In CKD patients, symbiotic therapy did not significantly reduce
serum IS [77], but probiotics may be interesting to reduce inflammation [74]. Results
from diet modifications seem more promising. A low protein-diet reduces plasma
levels of IS and urine levels of IS, indoxyl glucuronide, KA, and QA in healthy
subjects [78]. In hemodialyzed patients, an increase in dietary fibers reduces the
plasma levels of IS [79]. Finally, a diet with a higher proportion of protein from plant
sources is associated with lower levels of IS [80] and with lower mortality rates in
patients with CKD [81].
37
Revue bibliographique
6. Conclusions
TDUT accumulating in patients with CKD could induce thrombosis via several
mechanisms: Activation of primary hemostasis and coagulation, endothelial
dysfunction, decrease in NO bioavailability, and production of procoagulant
microparticles (Figure 1). One important prothrombotic mechanism is the induction
of tissue factor via AhR (Figure 1). This uremic toxins/AhR/TF axis may offer new
therapeutic options to prevent thrombosis in CKD.
Figure 1. Mechanisms of tryptophan-derived uremic toxins promoting thrombosis.
Tryptophan derived uremic toxins promote thrombosis by inducing platelet
hyperactivity, endothelial dysfunction, production of endothelial and platelet
microparticles, and TF expression on monocytes, vSMC, and EC. TF induction is
mediated by AhR activation. A decrease in NO bioavailability and an induction of
ROS in platelets and endothelial cells participate in the thrombotic effects of
tryptophan derived uremic toxins. AhR: Aryl hydrocarbon Receptor; TF: Tissue
Factor; EC: Endothelial cells, vSMC: Vascular smooth muscle cells; ROS: Reactive
oxygen species; NO: Nitric Oxide.
Author Contributions: All authors participated in the redaction and review of the
manuscript.
Funding: This research received no external funding.
Acknowledgments: We thank University of Oran 1 Ahmed Benbella for the PhD
student granting of T.A.
Conflicts of Interest: The authors declare no conflicts of interest.
38
Revue bibliographique
References
1. Levin, A.; Stevens, P.; Bilous, R.W.; Coresh, J.; De Francisco, A.L.; De Jong, P.E.;
Griffi, K.E.; Hemmelgarn, B.R.; Isek, K.; Lamb, E.J.; et al. KDIGO clinical practice
guideline for the evaluation and management of chronic kidney disease. Chapter 1:
Definition and classification of CKD. Kidney Int. Suppl. 2013, 3, 19–62. [CrossRef]
2. Stevens, P.E.; Levin, A. Kidney Disease: Improving Global Outcomes Chronic
Kidney Disease Guideline DevelopmentWork Group Members Evaluation and
management of chronic kidney disease: Synopsis of the kidney disease: Improving
global outcomes 2012 clinical practice guideline. Ann. Intern. Med. 2013, 158, 825–
830. [CrossRef] [PubMed]
3. Coresh, J.; Turin, T.C.; Matsushita, K.; Sang, Y.; Ballew, S.H.; Appel, L.J.; Arima, H.;
Chadban, S.J.; Cirillo, M.; Djurdjev, O.; et al. Decline in estimated glomerular
filtration rate and subsequent risk of end-stage renal disease and mortality. JAMA
2014, 311, 2518–2531. [CrossRef] [PubMed]
4. Di Angelantonio, E.; Danesh, J.; Eiriksdottir, G.; Gudnason, V. Renal function and
risk of coronary heart disease in general populations: New prospective study and
systematic review. PLoS Med. 2007, 4, e270. [CrossRef] [PubMed]
5. Herzog, C.A.; Asinger, R.W.; Berger, A.K.; Charytan, D.M.; Díez, J.; Hart, R.G.;
Eckardt, K.-U.; Kasiske, B.L.; McCullough, P.A.; Passman, R.S.; et al. Cardiovascular
disease in chronic kidney disease. A clinical update from Kidney Disease: Improving
Global Outcomes (KDIGO). Kidney Int. 2011, 80, 572–586. [CrossRef] [PubMed]
6. Go, A.S.; Chertow, G.M.; Fan, D.; McCulloch, C.E.; Hsu, C.Y. Chronic kidney
disease and the risks of death, cardiovascular events, and hospitalization. N. Engl. J.
Med. 2004, 351, 1296–1305. [CrossRef] [PubMed]
7. Raskob, G.E.; Angchaisuksiri, P.; Blanco, A.N.; Buller, H.; Galluse, A.; Hunt, B.J.;
Hylek, E.M.; Kakkar, A.; Konstantinidesi, S.V.; McCumber, M.; et al. ISTH Steering
Committee for World Thrombosis Day Thrombosis: A major contributor to global
disease burden. Thromb. Res. 2014, 134, 931–938. [CrossRef] [PubMed]
8. Lutz, J.; Menke, J.; Sollinger, D.; Schinzel, H.; Thurmel, K. Haemostasis in chronic
kidney disease. Nephrol. Dial. Transplant. 2014, 29, 29–40. [CrossRef] [PubMed]
9. Parikh, A.M.; Spencer, F.A.; Lessard, D.; Emery, C.; Baylin, A.; Linkletter, C.;
Goldberg, R.J. Venous thromboembolism in patients with reduced estimated GFR: A
population-based perspective. Am. J. Kidney Dis. 2011, 58, 746–755. [CrossRef]
[PubMed]
10. Pavord, S.; Myers, B. Bleeding and thrombotic complications of kidney disease.
Blood Rev. 2011, 25, 271–278. [CrossRef] [PubMed]
39
Revue bibliographique
11. Wattanakit, K.; Cushman, M.; Stehman-Breen, C.; Heckbert, S.R.; Folsom, A.R.
Chronic kidney disease increases risk for venous thromboembolism. J. Am. Soc.
Nephrol. 2008, 19, 135–140. [CrossRef] [PubMed]
12. Ocak, G.; Lijfering, W.M.; Verduijn, M.; Dekker, F.W.; Rosendaal, F.R.;
Cannegieter, S.C.; Vossen, C.Y. Risk of venous thrombosis in patients with chronic
kidney disease: Identification of high-risk groups. J. Thromb. Haemost. 2013, 11, 627–
633. [CrossRef] [PubMed]
13. Carrero, J.J.; Trevisan, M.; Sood, M.M.; Bárány, P.; Xu, H.; Evans, M.; Friberg, L.;
Szummer, K. Incident Atrial Fibrillation and the Risk of Stroke in Adults with
Chronic Kidney Disease: The Stockholm CREAtinine Measurements (SCREAM)
Project. Clin. J. Am. Soc. Nephrol. 2018, 13, 1314–1320. [CrossRef] [PubMed]
14. Viecelli, A.K.; Mori, T.A.; Roy-Chaudhury, P.; Polkinghorne, K.R.; Hawley, C.M.;
Johnson, D.W.; Pascoe, E.M.; Irish, A.B. The pathogenesis of hemodialysis vascular
access failure and systemic therapies for its prevention: Optimism unfulfilled. Semin.
Dial. 2018, 31, 244–257. [CrossRef] [PubMed]
15. Vanholder, R.; Pletinck, A.; Schepers, E.; Glorieux, G. Biochemical and Clinical
Impact of Organic Uremic Retention Solutes: A Comprehensive Update. Toxins 2018,
10. [CrossRef] [PubMed]
16. Sallee, M.; Dou, L.; Cerini, C.; Poitevin, S.; Brunet, P.; Burtey, S. The aryl
hydrocarbon receptor-activating effect of uremic toxins from tryptophan metabolism:
A new concept to understand cardiovascular complications of chronic kidney
disease. Toxins 2014, 6, 934–949. [CrossRef] [PubMed]
17. Meyer, T.W.; Hostetter, T.H. Uremic solutes from colon microbes. Kidney Int.
2012, 81, 949–954. [CrossRef] [PubMed]
18. Neirynck, N.; Glorieux, G.; Schepers, E.; Pletinck, A.; Dhondt, A.; Vanholder, R.
Review of protein-bound toxins, possibility for blood purification therapy. Blood
Purif. 2013, 35 (Suppl. 1), 45–50. [CrossRef]
19. Wu, C.-C.; Hsieh, M.-Y.; Hung, S.-C.; Kuo, K.-L.; Tsai, T.-H.; Lai, C.-L.; Chen, J.-
W.; Lin, S.-J.; Huang, P.-H.; Tarng, D.-C. Serum Indoxyl Sulfate Associates with
Postangioplasty Thrombosis of Dialysis Grafts. J. Am. Soc. Nephrol. 2016, 27, 1254–
1264. [CrossRef] [PubMed]
20. Kolachalama, V.B.; Shashar, M.; Alousi, F.; Shivanna, S.; Rijal, K.; Belghasem,
M.E.;Walker, J.; Matsuura, S.; Chang, G.H.; Gibson, C.M.; et al. Uremic Solute-Aryl
Hydrocarbon Receptor-Tissue Factor Axis Associates with Thrombosis after Vascular
Injury in Humans. J. Am. Soc. Nephrol. 2018, 29, 1063–1072. [CrossRef] [PubMed]
21. Eussen, S.J.P.M.; Ueland, P.M.; Vollset, S.E.; Nygård, O.; Midttun, Ø.; Sulo, G.;
Ulvik, A.; Meyer, K.; Pedersen, E.R.; Tell, G.S. Kynurenines as predictors of acute
40
Revue bibliographique
coronary events in the Hordaland Health Study. Int. J. Cardiol. 2015, 189, 18–24.
[CrossRef] [PubMed]
22. Sulo, G.; Vollset, S.E.; Nygård, O.; Midttun, Ø.; Ueland, P.M.; Eussen, S.J.P.M.;
Pedersen, E.R.; Tell, G.S. Neopterin and kynurenine-tryptophan ratio as predictors of
coronary events in older adults, the Hordaland Health Study. Int. J. Cardiol. 2013,
168, 1435–1440. [CrossRef] [PubMed]
23. Yu, E.; Ruiz-Canela, M.; Guasch-Ferré, M.; Zheng, Y.; Toledo, E.; Clish, C.B.;
Salas-Salvadó, J.; Liang, L.; Wang, D.D.; Corella, D.; et al. Increases in Plasma
Tryptophan Are Inversely Associated with Incident Cardiovascular Disease in the
Prevención con Dieta Mediterránea (PREDIMED) Study. J. Nutr. 2017, 147, 314–322.
[CrossRef] [PubMed]
24. Barreto, F.C.; Barreto, D.V.; Liabeuf, S.; Meert, N.; Glorieux, G.; Temmar, M.;
Choukroun, G.; Vanholder, R.; Massy, Z.A. Serum indoxyl sulfate is associated with
vascular disease and mortality in chronic kidney disease patients. Clin. J. Am. Soc.
Nephrol. 2009, 4, 1551–1558. [CrossRef] [PubMed]
25. Dou, L.; Sallée, M.; Cerini, C.; Poitevin, S.; Gondouin, B.; Jourde-Chiche, N.;
Fallague, K.; Brunet, P.; Calaf, R.; Dussol, B.; et al. The cardiovascular effect of the
uremic solute indole-3 acetic acid. J. Am. Soc. Nephrol. 2015, 26, 876–887. [CrossRef]
[PubMed]
26. Karbowska, M.; Kaminski, T.W.; Marcinczyk, N.; Misztal, T.; Rusak, T.; Smyk, L.;
Pawlak, D. The Uremic Toxin Indoxyl Sulfate Accelerates Thrombotic Response after
Vascular Injury in Animal Models. Toxins 2017, 9, 229. [CrossRef] [PubMed]
27. Chitalia, V.C.; Shivanna, S.; Martorell, J.; Balcells, M.; Bosch, I.; Kolandaivelu, K.;
Edelman, E.R. Uremic serum and solutes increase post-vascular interventional
thrombotic risk through altered stability of smooth muscle cell tissue factor.
Circulation 2013, 127, 365–376. [CrossRef] [PubMed]
28. Kolandaivelu, K.; Swaminathan, R.; Gibson, W.J.; Kolachalama, V.B.; Nguyen-
Ehrenreich, K.-L.; Giddings, V.L.; Coleman, L.; Wong, G.K.; Edelman, E.R. Stent
thrombogenicity early in high-risk interventional settings is driven by stent design
and deployment and protected by polymer-drug coatings. Circulation 2011, 123,
1400–1409. [CrossRef] [PubMed]
29. Gale, A.J. Current Understanding of Hemostasis. Toxicol. Pathol. 2011, 39, 273–
280. [CrossRef] [PubMed]
30. Jalal, D.I.; Chonchol, M.; Targher, G. Disorders of hemostasis associated with
chronic kidney disease. Semin. Thromb. Hemost. 2010, 36, 34–40. [CrossRef]
[PubMed]
31. Gondouin, B.; Cerini, C.; Dou, L.; Sallée, M.; Duval-Sabatier, A.; Pletinck, A.;
Calaf, R.; Lacroix, R.; Jourde-Chiche, N.; Poitevin, S.; et al. Indolic uremic solutes
41
Revue bibliographique
increase tissue factor production in endothelial cells by the aryl hydrocarbon receptor
pathway. Kidney Int. 2013, 84, 733–744. [CrossRef] [PubMed]
32. Shivanna, S.; Kolandaivelu, K.; Shashar, M.; Belghasim, M.; Al-Rabadi, L.;
Balcells, M.; Zhang, A.;Weinberg, J.; Francis, J.; Pollastri, M.P.; et al. The Aryl
Hydrocarbon Receptor is a Critical Regulator of Tissue Factor Stability and an
Antithrombotic Target in Uremia. J. Am. Soc. Nephrol. 2016, 27, 189–201. [CrossRef]
[PubMed]
33. Kami´ nski, T.W.; Pawlak, K.; Karbowska, M.; My´sliwiec, M.; Pawlak, D. Indoxyl
sulfate-the uremic toxin linking hemostatic system disturbances with the prevalence
of cardiovascular disease in patients with chronic kidney disease. BMC Nephrol.
2017, 18, 35. [CrossRef] [PubMed]
34. Pawlak, K.; Domaniewski, T.; Mysliwiec, M.; Pawlak, D. Kynurenines and
oxidative status are independently associated with thrombomodulin and von
Willebrand factor levels in patients with end-stage renal disease. Thromb. Res. 2009,
124, 452–457. [CrossRef] [PubMed]
35. Pawlak, K.; Mysliwiec, M.; Pawlak, D. Hypercoagulability is independently
associated with kynurenine
pathway activation in dialysed uraemic patients. Thromb. Haemost. 2009, 102, 49–55.
[CrossRef] [PubMed]
36. Kaminski, T.W.; Pawlak, K.; Karbowska, M.; Mysliwiec, M.; Grzegorzewski, W.;
Kuna, J.; Pawlak, D. Association between uremic toxin-anthranilic acid and
fibrinolytic system activity in predialysis patients at different stages of chronic
kidney disease. Int. Urol. Nephrol. 2018, 50, 127–135. [CrossRef] [PubMed]
37. Pawlak, K.; Tankiewicz, J.; Mysliwiec, M.; Pawlak, D. Tissue factor/its pathway
inhibitor system and kynurenines in chronic kidney disease patients on conservative
treatment. Blood Coagul. Fibrin. 2009, 20, 590–594. [CrossRef] [PubMed]
38. Thijs, A.; Nanayakkara, P.W.; Ter Wee, P.M.; Huijgens, P.C.; van Guldener, C.;
Stehouwer, C.D.A. Mild-to-moderate renal impairment is associated with platelet
activation: A cross-sectional study. Clin. Nephrol. 2008, 70, 325–331. [PubMed]
39. Boccardo, P.; Remuzzi, G.; Galbusera, M. Platelet dysfunction in renal failure.
Semin. Thromb. Hemost. 2004, 30, 579–589. [CrossRef] [PubMed]
40. Yang, K.; Du, C.; Wang, X.; Li, F.; Xu, Y.; Wang, S.; Chen, S.; Chen, F.; Shen, M.;
Chen, M.; et al. Indoxyl sulfate induces platelet hyperactivity and contributes to
chronic kidney disease-associated thrombosis in mice. Blood 2017, 129, 2667–2679.
[CrossRef] [PubMed]
41. Yau, J.W.; Teoh, H.; Verma, S. Endothelial cell control of thrombosis. BMC
Cardiovasc. Disord. 2015, 15, 130. [CrossRef] [PubMed]
42
Revue bibliographique
42. Stam, F.; van Guldener, C.; Becker, A.; Dekker, J.M.; Heine, R.J.; Bouter, L.M.;
Stehouwer, C.D.A. Endothelial dysfunction contributes to renal function-associated
cardiovascular mortality in a population with mild renal insufficiency: The Hoorn
study. J. Am. Soc. Nephrol. 2006, 17, 537–545. [CrossRef] [PubMed]
43. Malyszko, J. Mechanism of endothelial dysfunction in chronic kidney disease.
Clin. Chim. Acta 2010, 411, 1412–1420. [CrossRef] [PubMed]
44. Jourde-Chiche, N.; Dou, L.; Sabatier, F.; Calaf, R.; Cerini, C.; Robert, S.; Camoin-
Jau, L.; Charpiot, P.; Argiles, A.; Dignat-George, F.; et al. Levels of circulating
endothelial progenitor cells are related to uremic toxins and vascular injury in
hemodialysis patients. J. Thromb. Haemost. 2009, 7, 1576–1584. [CrossRef] [PubMed]
45. Roy-Chaudhury, P.; Sukhatme, V.P.; Cheung, A.K. Hemodialysis vascular access
dysfunction: A cellular and molecular viewpoint. J. Am. Soc. Nephrol. 2006, 17, 1112–
1127. [CrossRef] [PubMed]
46. Chen, T.Y.; Lin, T.T.; Hsieh, M.Y.; Lin, L.; Yang, C.W.; Chuang, S.Y.; Huang, P.H.;
Wu, C.C. Circulating Progenitor Cells Affect Thrombosis of Dialysis Arteriovenous
Fistulas. Am. J. Nephrol. 2016, 44, 428–438. [CrossRef] [PubMed]
47. Fabre, J.E.; Nguyen, M.; Athirakul, K.; Coggins, K.; McNeish, J.D.; Austin, S.;
Parise, L.K.; FitzGerald, G.A.; Coffman, T.M.; Koller, B.H. Activation of the murine
EP3 receptor for PGE2 inhibits cAMP production and promotes platelet aggregation.
J. Clin. Investig. 2001, 107, 603–610. [CrossRef] [PubMed]
48. Gross, S.; Tilly, P.; Hentsch, D.; Vonesch, J.L.; Fabre, J.E. Vascular wall–produced
prostaglandin E2 exacerbates
arterial thrombosis and atherothrombosis through platelet EP3 receptors. J. Exp.
Med. 2007, 204, 311–320. [CrossRef] [PubMed]
49. Loscalzo, J. Nitric oxide insufficiency, platelet activation, and arterial thrombosis.
Circ. Res. 2001, 88, 756–762. [CrossRef] [PubMed]
50. Baylis, C. Nitric oxide synthase derangements and hypertension in kidney
disease. Curr. Opin. Nephrol. Hypertens. 2012, 21, 1–6. [CrossRef] [PubMed]
51. Tumur, Z.; Niwa, T. Indoxyl sulfate inhibits nitric oxide production and cell
viability by inducing oxidative stress in vascular endothelial cells. Am. J. Nephrol.
2009, 29, 551–557. [CrossRef] [PubMed]
52. Pieniazek, A.; Gwozdzinski, L.; Hikisz, P.; Gwozdzinski, K. Indoxyl sulfate
generates free radicals, decreases antioxidant defense and leads to damage to
mononuclear blood cells. Chem. Res. Toxicol. 2018. [CrossRef] [PubMed]
53. Dou, L.; Jourde-Chiche, N.; Faure, V.; Cerini, C.; Berland, Y.; Dignat-George, F.;
Brunet, P. The uremic solute indoxyl sulfate induces oxidative stress in endothelial
cells. J. Thromb. Haemost. 2007, 5, 1302–1308. [CrossRef] [PubMed]
43
Revue bibliographique
54. Faure, V.; Dou, L.; Sabatier, F.; Cerini, C.; Sampol, J.; Berland, Y.; Brunet, P.;
Dignat-George, F. Elevation of circulating endothelial microparticles in patients with
chronic renal failure. J. Thromb. Haemost. 2006, 4, 566–573. [CrossRef] [PubMed]
55. Daniel, L.; Dou, L.; Berland, Y.; Lesavre, P.; Mecarelli-Halbwachs, L.; Dignat-
George, F. Circulating microparticles in renal diseases. Nephrol. Dial. Transplant.
2008, 23, 2129–2132. [CrossRef] [PubMed] 56. Freyssinet, J.M.; Toti, F. Formation of
procoagulant microparticles and properties. Thromb. Res. 2010, 125 (Suppl. 1), S46–
S48. [CrossRef]
57. Connor, D.E.; Exner, T.; Ma, D.D.; Joseph, J.E. Detection of the procoagulant
activity of microparticle-associated phosphatidylserine using XACT. Blood Coagul.
Fibrin. 2009, 20, 558–564. [CrossRef] [PubMed]
58. Biró, E.; Sturk-Maquelin, K.N.; Vogel, G.M.; Meuleman, D.G.; Smit, M.J.; Hack,
C.E.; Sturk, A.; Nieuwland, R. Human cell-derived microparticles promote thrombus
formation in vivo in a tissue factor-dependent manner. J. Thromb. Haemost. 2003, 1,
2561–2568. [CrossRef] [PubMed]
59. Gao, C.; Ji, S.; Dong, W.; Qi, Y.; Song, W.; Cui, D.; Shi, J. Indolic uremic solutes
enhance procoagulant activity of red blood cells through phosphatidylserine
exposure and microparticle release. Toxins 2015, 7, 4390–4403. [CrossRef] [PubMed]
60. Chu, A.J. Tissue factor, blood coagulation, and beyond: An overview. Int. J.
Inflam. 2011, 2011, 367284. [CrossRef] [PubMed]
61. Ng, H.Y.; Bolati,W.; Lee, C.T.; Chien, Y.S.; Yisireyili, M.; Saito, S.; Pei, S.N.;
Nishijima, F.; Niwa, T. Indoxyl Sulfate Downregulates Mas Receptor via Aryl
Hydrocarbon Receptor/Nuclear Factor-kappa B, and Induces Cell Proliferation and
Tissue Factor Expression in Vascular Smooth Muscle Cells. Nephron 2016, 133, 205–
212. [CrossRef] [PubMed]
62. Yisireyili, M.; Saito, S.; Abudureyimu, S.; Adelibieke, Y.; Ng, H.Y.; Nishijima, F.;
Takeshita, K.; Murohara, T.; Niwa, T. Indoxyl sulfate-induced activation of (pro)renin
receptor promotes cell proliferation and tissue factor expression in vascular smooth
muscle cells. PLoS ONE 2014, 9, e109268. [CrossRef] [PubMed]
63. Addi, T.; Poitevin, S.; McKay, N.; El Mecherfi, K.E.; Kheroua, O.; Jourde-Chiche,
N.; de Macedo, A.; Gondouin, B.; Cerini, C.; Brunet, P.; et al. Mechanisms of tissue
factor induction by the uremic toxin indole-3 acetic acid through aryl hydrocarbon
receptor/nuclear factor kappa B signaling pathway in human endothelial cells. Arch.
Toxicol. In press.
64. Mandal, P.K. Dioxin: A review of its environmental effects and its aryl
hydrocarbon receptor biology. J. Comp. Physiol. B 2005, 175, 221–230. [CrossRef]
[PubMed]
44
Revue bibliographique
65. Hubbard, T.D.; Murray, I.A.; Perdew, G.H. Indole and Tryptophan Metabolism:
Endogenous and Dietary Routes to Ah Receptor Activation. Drug Metab. Dispos.
2015, 43, 1522–1535. [CrossRef] [PubMed]
66. Matsumura, F. The significance of the nongenomic pathway in mediating
inflammatory signaling of the dioxin-activated Ah receptor to cause toxic effects.
Biochem. Pharmacol. 2009, 77, 608–626. [CrossRef] [PubMed]
67. Puga, A.; Ma, C.; Marlowe, J.L. The aryl hydrocarbon receptor cross-talks with
multiple signal transduction pathways. Biochem. Pharmacol. 2009, 77, 713–722.
[CrossRef] [PubMed]
68. Shashar, M.; Belghasem, M.E.; Matsuura, S.;Walker, J.; Richards, S.; Alousi, F.;
Rijal, K.; Kolachalama, V.B.; Balcells, M.; Odagi, M.; et al. Targeting STUB1-tissue
factor axis normalizes hyperthrombotic uremic phenotype without increasing
bleeding risk. Sci. Transl. Med. 2017, 9, eaam8475. [CrossRef] [PubMed]
69. Dou, L.; Poitevin, S.; Sallée, M.; Addi, T.; Gondouin, B.; McKay, N.; Denison, M.S.;
Jourde-Chiche, N.; Duval-Sabatier, A.; Cerini, C.; et al. Aryl hydrocarbon receptor is
activated in patients and mice with chronic kidney disease. Kidney Int. 2018, 93, 986–
999. [CrossRef] [PubMed]
70. Lindsey, S.; Papoutsakis, E.T. The aryl hydrocarbon receptor (AHR) transcription
factor regulates megakaryocytic polyploidization. Br. J. Haematol. 2011, 152, 469–484.
[CrossRef] [PubMed]
71. Strassel, C.; Brouard, N.; Mallo, L.; Receveur, N.; Mangin, P.; Eckly, A.; Bieche, I.;
Tarte, K.; Gachet, C.; Lanza, F. Aryl hydrocarbon receptor-dependent enrichment of a
megakaryocytic precursor with a high potential to produce proplatelets. Blood 2016,
127, 2231–2240. [CrossRef] [PubMed]
72. Lindsey, S.; Jiang, J.; Woulfe, D.; Papoutsakis, E.T. Platelets from mice lacking the
aryl hydrocarbon receptor exhibit defective collagen-dependent signaling. J. Thromb.
Haemost. 2014, 12, 383–394. [CrossRef] [PubMed]
73. Pombo, M.; Lamé, M.W.;Walker, N.J.; Huynh, D.H.; Tablin, F. TCDD and
omeprazole prime platelets through the aryl hydrocarbon receptor (AhR) non-
genomic pathway. Toxicol. Lett. 2015, 235, 28–36. [CrossRef] [PubMed]
74. Simeoni, M.; Citraro, M.L.; Deodato, F.; Provenzano, M.; Capria, M.; Comi, A.;
Libri, E.; Andreucci, M.; Puja, A.; Abenavoli, L.; Cocchi, M.; Fuiano, G. An open-
label, randomized, placebo-controlled study on the effectiveness of a novel probiotics
administration protocol (ProbiotiCKD) in patients with mild renal insufficiency
(stage 3a of CKD). Eur J. Nutr. 2018, 1–12. [CrossRef]
75. Borges, N.A.; Carmo, F.L.; Stockler-Pinto, M.B.; de Brito, J.S.; Dolenga, C.J.;
Ferreira, D.C.; Nakao, L.S.; Rosado, A.; Fouque, D.; Mafra, D. Probiotic
45
Revue bibliographique
Supplementation in Chronic Kidney Disease: A Double-blind, Randomized, Placebo-
controlled Trial. J. Ren Nutr. 2018, 28, 28–36. [CrossRef] [PubMed]
76. Takayama, F.; Taki, K.; Niwa, T. Bifidobacterium in gastro-resistant seamless
capsule reduces serum levels of indoxyl sulfate in patients on hemodialysis. Am. J.
Kidney Dis. 2003, 41, S142–S145. [CrossRef] [PubMed]
77. Rossi, M.; Johnson, D.W.; Morrison, M.; Pascoe, E.M.; Coombes, J.S.; Forbes, J.M.;
Szeto, C.C.; McWhinney, B.C.; Ungerer, J.P.; Campbell, K.L. Synbiotics Easing Renal
Failure by Improving Gut Microbiology (SYNERGY): A Randomized Trial. Clin J.
Am. Soc. Nephrol. 2016, 11, 223–231. [CrossRef] [PubMed]
78. Poesen, R.; Mutsaers, H.A.;Windey, K.; van den Broek, P.H.; Verweij, V.;
Augustijns, P.; Kuypers, D.; Jansen, J.; Evenepoel, P.; Verbeke, K.; et al. The Influence
of Dietary Protein Intake on Mammalian Tryptophan and Phenolic Metabolites. PLoS
ONE 2015, 10, e0140820. [CrossRef] [PubMed]
79. Sirich, T.L.; Plummer, N.S.; Gardner, C.D.; Hostetter, T.H.; Meyer, TW. Effect of
increasing dietary fiber on plasma levels of colon-derived solutes in hemodialysis
patients. Clin. J. Am. Soc. Nephrol. 2014, 9, 1603–1610. [CrossRef] [PubMed]
80. Kandouz, S.; Mohamed, A.S.; Zheng, Y.; Sandeman, S.; Davenport, A. Reduced
protein bound uraemic toxins in vegetarian kidney failure patients treated by
haemodiafiltration. Hemodial. Int. 2016, 20, 610–617. [CrossRef] [PubMed]
81. Chen, X.; Wei, G.; Jalili, T.; Metos, J.; Giri, A.; Cho, M.E.; Boucher, R.; Greene, T.;
Beddhu, S. The Associations of Plant Protein Intake with All-Cause Mortality in
CKD. Am. J. Kidney Dis. 2016, 67, 423–430. [CrossRef] [PubMed]
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open
access article distributed under the terms and conditions of the Creative Commons
Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
46
Objectifs de la thèse
3. Objectifs de la thèse
➢ Étude des mécanismes impliqués dans l’expression du Facteur Tissulaire via AhR
activé par l’IAA et par l’IS ;
- Déterminer si l'induction du FT par l’IAA et l’IS est médiée par une voie
génomique d’AhR, ou par une voie non génomique d’AhR impliquant d'autres
voies de signalisation et facteurs de transcription.
➢ Étude du lien entre le FT circulant et les taux d’IAA et d’IS chez des patients HD de
Marseille.
➢ Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) ;
- Comparaisons des taux sériques de toxine urémique entre les deux cohortes de
patients.
- Comparaison des fréquences d’événements cardiovasculaires et des taux de
mortalité entre les deux populations.
47
Méthodologie de travail
4. Méthodologie de travail
4.1. Culture de cellules endothéliales
Dans les expériences in vitro, nous avons cultivé et utilisé des cultures primaires de cellules
endothéliales. Les HUVEC ont été obtenus à partir de la veine du cordon ombilical par
digestion de collagénase comme décrit (Jaffe et al. 1973) et cultivé jusqu'au quatrième
passage dans le milieu EGM-2 (Lonza, France) contenant 2% de sérum fœtal bovin, dans des
conditions de culture cellulaire standard (atmosphère humidifiée à 37 ° C, 5% CO2). Les
cellules endothéliales aortiques humaines (HAoEC) et les cellules endothéliales
microvasculaires (MV) dérivées du cœur (HMVEC-C) ont été obtenues auprès de Lonza. Les
HMVEC-C ont été cultivées jusqu'au cinquième passage dans un milieu EGM-2 MV (Lonza,
France) contenant 5% de sérum fœtal bovin dans des conditions de culture cellulaire
standard. Les HAoEC ont été cultivées jusqu'au cinquième passage dans le milieu EGM-2
dans des conditions de culture cellulaire standard.
4.2. Traitement avec les toxines urémiques IAA ou IS
Les cellules ont été incubées avec de l’IAA à 50µM (Sigma-Aldrich, France) ou avec de l'IS à
200μM (Sigma-Aldrich, France), les concentrations moyennes décrites chez les patients
urémiques (Vanholder et al. 2003). Elles ont été traitées pendant les temps indiqués, avec ou
sans l'inhibiteur d’AhR ; CH-229131 à 10μM (Sigma-Aldrich), l'inhibiteur de NF-B ; BAY 11-
7082 à 10μM (Merck Chemicals), l'inhibiteur de PKC ; Bisindolymaleimide I à 5μM (Merck
Chemicals), l'inhibiteur de p38 ; SB203580 à 10μM (Sigma-Aldrich), l'inhibiteur de ERK1/2 ;
PD98059 à 10μM (Sigma-Aldrich) et l'inhibiteur de transcription ; Actinomycin D à 1μg / ml
(Sigma-Aldrich). L’IS étant vendu sous forme de sels de potassium pour le milieu contrôle, les
cellules étaient incubées en présence de KCl 1/1000e. L’IAA étant dilué dans l’éthanol, pour
48
Méthodologie de travail
le milieu contrôle, les cellules étaient incubées en présence d’éthanol 1/1000e. Nous avons
inclus un contrôle pour les inhibiteurs dilués avec le DMSO où les cellules étaient incubées
avec du DMSO 1/1000e en présence de l’IAA ou de l’IS. Dans certaines expériences, de la
sérumalbumine humaine (LFB, France) a été ajoutée dans le milieu de culture, à la
concentration trouvée dans le sérum humain (4 g/dL).
4.3. Extinction de la protéine d’AhR avec le SiRNA (Small interfering RNA)
Les HUVEC ont été transfectées avec 20nM de siRNA contrôle (Contrôle Universel Négatif,
Stealth ™ RNAi, Life Technologies, France) ou un pool contenant trois siRNA Silencer® Select
dirigés contre AhR à 20nM chacun (1200, 1999 et 1998, Life Technologies, France) par
magnétofection en utilisant des billes SilenceMag au 200éme (OZ Biosciences, France) dans du
milieu réduit en sérum Opti-MEMTM (Gibco, Life Technologies, France), selon les instructions
du fabricant. Le knock-out d’AhR a été vérifié par western blot sur des extraits cellulaires
48heures après transfection (Figure 1). L'induction du FT et la translocation nucléaire de p50
ont été réalisées 48 heures après la transfection.
Figure 1. Western blot des niveaux de protéine d’AhR dans les HUVEC transfectées avec un un
siRNA contrôle ou siRNA AhR
L'expression endothéliale d’AhR dans des extraits cellulaires a été mesurée par Western blot 48h
après transfection avec des siRNA contrôle ou siRNA AhR.
AhR
+
-
Si contrôle
SiAhR
- +
Actine
49
Méthodologie de travail
4.4. Extraction de l'ARN et analyse RT-PCR quantitative de l'expression de l'ARNm
Après incubation avec de l’IAA50µM ou de l’IS200µM, les cellules ont été lavées avec du PBS
puis lysées avec 350µl de tampon RLT supplémenté en β-mercaptoéthanol. Les ARN totaux
ont été extraits et purifiés à l’aide d’un mini-kit RNeasy (Qiagen, France) selon les
recommandations du fabricant. Une digestion à la DNase (RNAse Free DNAse Set, Qiagen) a
été réalisée afin d’éliminer toutes traces d’ADN dans les échantillons d’ARN. Les
concentrations d’ARN ont été déterminées à l’aide d’un spectrophotomètre nanodrop
(NanoDrop® ND-1000 Spectrophotometer) et tous les échantillons présentaient un rapport
de densité optique de 260 nm sur 280 nm supérieur à 1,9. La reverse transcription (RT) a été
réalisée sur 500 ng d'ARN total en utilisant le kit de réactif Takara PrimeScriptTM RT (Ozyme,
Saint Quentin en Yvelines, France) suivi de qPCR sur 25 ng d'ADNc en utilisant le Takara SYBR
qPCR Premix Ex Taq (Ozyme). Nous avons quantifié les gènes cibles suivants : F3 (gène du
FT), CYP1A1 et CYP1B1. Le gène contrôle HPRT a été utilisé pour la normalisation des valeurs
des gènes cibles. Les séquences d'amorces étaient les suivantes : F3 forward :
5'TGCAGTAGCTCCAACAGTGC 3', F3 reverse : 5'GAGTGTATGGGCCAGGAGAA 3'; CYP1A1
forward : 5'GACAGATCCCATCTGCCCTA 3', CYP1A1 reverse : 5'ATAGCACCATCAGGGGTGAG 3’;
CYP1B1 forward : 5'TGATGGACGCCTTTATCCTC 3', CYP1B1 reverse:
5'CCACGACCTGATCCAATTCT 3'; HPRT forward : 5'GGATTATACTGCCTGACCAAGGAAAGC 3',
HPRT reverse: 5'GAGCTATTGTAATGACCAGTCAACAGG 3'.
Les PCR quantitatives ont été réalisées à l’aide du Light cycleur MX 3000 (Agilent
Technologies). La mesure de la fluorescence émise par le marqueur fluorescent de l’ADN
double brin, le SYBR green, a été mesurée à la fin de la phase d’élongation de chaque cycle,
ce qui permet de suivre la quantité d’ADNc amplifié. Les efficacités de la réaction PCR ont
été déterminées avec le logiciel MxPro (Agilent) et se situaient toujours entre 90% et 110%.
50
Méthodologie de travail
Une courbe de fusion, réalisée après la PCR, a permis de s’assurer de la spécificité de la
réaction d’amplification. Les taux d’ARNm des gènes d'intérêt exprimés en facteur
d’augmentation par rapport aux conditions témoins éthanol et KCL ont été calculés en
utilisant la méthode 2−ΔΔCt. La transcription du gène contrôle HPRT a été utilisée pour la
normalisation des données.
4.5. Test d'immunoprécipitation de la chromatine (ChIP)
Des monocouches d'HUVEC (6x106 cellules) ont été traitées avec de l’IAA (50µM) ou de
l’éthanol (contrôle) ou avec de l'IS (200 µM) ou de KCL (contrôle) pendant 60 minutes. Les
cellules ont été fixées (DNA-protein crosslinks) en ajoutant du formaldéhyde directement
dans le milieu à une concentration finale de 1% et incubées pendant 10 minutes à
température ambiante puis 40 minutes à 4°C, puis traiter avec de la glycine à une
concentration finale de 0,125 mol/l pendant 10 minutes à température ambiante. Le test
ChIP (immunoprécipitation de la chromatine) a été réalisé en utilisant le kit
d'immunoprécipitation de la chromatine EZ-Magna ChIP ™ A/G (Merck Millipore, France).
Conformément aux instructions du kit, les cellules ont été collectées après lavage avec du
PBS puis lysées avec des tampons du kit. Les échantillons de chromatines récoltées ont été
soniqués pour obtenir des longueurs d’ADN de 200-1000 pb. Des immunoprécipitations ont
été réalisées pendant une nuit à 4 °C avec 5 µg d'IgG de lapin (IgG témoin) ou d'anticorps
polyclonal de lapin contre AhR (Santa Cruz Biotechnology, Tebu-Bio, France). Après
différents lavages, le complexe a été inversé par digestion par la protéinase K, incubée à
62°C pendant 3 heures avec agitation de 600 tr/min à 95 °C pendant 10 minutes et enfin à
20°C pendant 20 min. Les extraits d'ADN purifiés suivant le kit, la quantification par PCR en
temps réel des enrichissements ChIP ont été effectués sur un instrument MX3000P
(Stratagene) en utilisant le Brilliant II SYBR Green QPCR Master Mix (Takara bio, France). Les
51
Méthodologie de travail
séquences d'amorces spécifiques pour les promoteurs étaient les suivantes: FT en forward,
5'-GCCCTCCCTTTCCTGCCATAGA-3 ', FT reverse: 5'-CCTCCCGGTAGGAAACTCCG-3'; CYP1A1 en
forward: 5'-ACGCAGACCTAGACCCTTTGC-3 ', CYP1A1 reverse: 5'-CGGGTGCGCGATTGAA-3';
CYP1B1 forward: 5'-ATATGACTGGAGCCGACTTTCC-3 ', CYP1B1 reverse: 5'-
GGCGAACTTTATCGGGTTGA-3'. L'enrichissement en fold a été calculé en utilisant la méthode
2−ΔΔCt, où ΔΔCt représente la différence entre les cycles de seuil d'anticorps polyclonaux
expérimentaux de lapin dirigés contre AhR sur IgG contrôle de lapin.
4.6. Western blot et analyse densitométrique de Western blots
Après incubation des HUVEC cultivées en flasque de T75 avec 50µM d’IAA ou 200µM d’IS
pendant 30 min, avec ou sans l'inhibiteur d’AhR, le CH-229131 à 10 µM (Sigma-Aldrich), des
extraits nucléaires ont été préparés en utilisant le kit d'extraction nucléaire de Cayman
Chemical (Interchim, France). Des extraits cytosoliques ont été préparés en utilisant 1 ml de
tampon de lyse contenant 20 mM de MOPS, 50 mM de ß-glycerolphosphate, 50 mM de
fluorure de sodium, 1 mM d'orthovanadate de sodium, 5 mM d'EGTA, 2 mM d'EDTA, 1%
NP40, 1 mM de dithiothréitol (DTT) 1mM de benzamidine, 1 mM de
phénylméthanesulfonylfluorure (PMSF) et 10 ug / ml de leupeptine et d'aprotinine. Les
cellules ont été incubées 10 min sur de la glace puis recueillies avec un grattoir. Les extraits
cytosoliques ont été obtenus après centrifugation des lysats cellulaires à 13 000 tr/min
pendant 15 min. Les concentrations en protéines ont été mesurées avec le kit d'acide
bicinchoninique (BCA1, Sigma-Aldrich).
Des quantités de 20µg d’échantillons protéiques avec une qsp 30µl ajusté avec du tampon
de lyse RIPA, ont été mélangés avec du tampon d'échantillon LDS (25% du volume final) et
du β-mercaptoéthanol (5% du VF), puis chauffer 5 minutes à 95°C. Les protéines ont été
séparées en utilisant le gel de protéine 4-12% NuPAGETM (Life technologies) avec un tampon
52
Méthodologie de travail
de migration MOPS à 1X. Les protéines ont été transférées sur une membrane de
nitrocellulose avec un tampon de transfert (tris amino acid-glycine-éthanol) et saturé avec
du PBS-lait écrémé à 5% pendant 1h à température ambiante. La membrane a été incubée
pendant une nuit à 4°C avec des anticorps dirigés contre AhR (Santa Cruz, France), contre
NF-B p50 (Cell Signaling, Ozyme, France), ou l'actine (Cell Signaling, France), puis avec
l'anticorps secondaire conjugué à la peroxydase (Beckman-Coulter, France). Les révélations
ont été réalisées par chimiluminescence (ECL Western blotting substrate, Pierce). Les images
de gel ont été capturées en utilisant le Syngene GBox (Ozyme) et analysées avec le logiciel
geneSys (Ozyme).
4.7. Transfection transitoire des HUVEC et test d’expression de la luciférase sous le
contrôle du promoteur du facteur tissulaire
Les plasmides rapporteurs du promoteur du FT de type sauvage humain (-227 hTF WT), du
FT-mutant AP-1 (-227 hTF mAP1), du NF-B mutant (-227 hTF mNF-B) contrôlant
l’expression du gène de la luciférase en pGL2 basic étaient offert par Nigel Mackman
(Addgene plasmid # 15442, 15443, 15444 respectively) (Figure 2).
Les HUVEC (1,5 x 105 cellules) ont été ensemencées dans des plaques de 6 puits dans du
milieu EGM-2 16 h avant la transfection. Les cellules ont ensuite été incubées 1 h avant la
transfection avec du milieu à sérum réduit Opti-MEMTM (Gibco, Life Technologies, France).
La transfection a été réalisée en utilisant la Lipofectamine 2000 (Life Technologies, France)
associée à la magnétofection en utilisant des billes CombimagTMbeads (OZ Bioscience,
Marseille, France) selon les instructions du fabricant. Brièvement, 1µg des plasmides
rapporteurs ont été mélangés avec 2 µl de Lipofectamine dans 200 µl de milieu sérique
réduit d’Opti-MEM pendant 20 minutes, puis 1 µl de billes CombimagTM a été ajouté aux
complexes ADN-Lipofectamine. Les complexes ADN-lipofectamine-billes ont été incubés
53
Méthodologie de travail
pendant 20 min à température ambiante, puis incubée avec les HUVEC pendant 1h à 37 °C
sur une plaque magnétique à 5% de CO2, ensuite remplacés par du milieu de croissance.
Après 48h, les HUVEC ont été traitées avec de l’IAA ou éthanol (contrôle) ou avec de l'IS ou
du KCL (contrôle) pendant 6 heures. Les cellules ont été lysées avec le tampon reporter lysis
buffer et les lysats ont été testés pour les activités de luciférase en utilisant le système de
dosage de la luciférase et le système de détection GloMax®-Multi (Promega, France). Le
vecteur témoin le pSV-ß-galactosidase (Promega) a été cotransfecté de sorte que les
efficacités de transfection pourraient être normalisées avec les activités de ß-galactosidase
déterminée en utilisant le système de test b-Glo® (Promega).
4.8. Translocations nucléaires de NF-B et AP-1
Après incubation d’environ 107 d’HUVEC avec 50µM d’IAA pendant 30 min, avec ou sans
l'inhibiteur d’AhR ; CH-229131 à 10μM (Sigma-Aldrich), l'inhibiteur de NF-B ; BAY 11-7082 à
10μM (Merck Chemicals), l'inhibiteur de la PKC Bisindolymaleimide I à 5µM (Merck
Figure 2. Construction des plasmides rapporteurs du promoteur du FT
Les cellules endothéliales HUVEC ont été transféctées avec des plasmides de luciférase contenant un
promoteur de FT de type sauvage (-227 WT), ou un contenant un mutant non-liant NF-B (-227 mNF-B),
ou un contenant des sites non-liants AP-1 (-227 mAP1).
54
Méthodologie de travail
Chemicals), l'inhibiteur de p38 SB203580 à 10 µM (Sigma-Aldrich), des extraits nucléaires ont
été préparés en utilisant le kit d'extraction nucléaire de Cayman Chemical (Interchim,France)
La fraction p50 de NF-B a été détectée dans des extraits nucléaires par le kit de dosage du
facteur de transcription combo NF-B (humain p50) de Cayman Chemical (Interchim). Ce kit
est un test ELISA à 96 puits avec une séquence d'ADN double brin spécifique contenant
l'élément de réponse NF-B. La NF-B p50 contenue dans les extraits nucléaires est détectée
avec un anticorps primaire spécifique et un anticorps secondaire conjugué à HRP qui fournit
une lecture colorimétrique à 450 nm. Dans certaines expériences, la localisation de p50 a été
étudiée par Western blots. L'expression de p65 endothéliale dans des extraits nucléaires a
été mesurée après 30 min d'incubation des HUVEC avec l’IAA 50µM, et détectée dans des
extraits nucléaires par le kit de test de facteur de transcription combo NF-B (humain p50 /
p65) de Cayman Chemical (Interchim).
Les sous-unités d’AP-1, c-Fos et c-Jun ont été détectées dans des extraits nucléaires par le kit
de test de facteur de transcription AP1 (c-Fos/Fos/Fra1/c-Jun/JunB/JunD) (Abcam, Paris,
France).
4.9. Étude de corrélation entre la concentration de FT circulant et les taux sériques
d’IAA et d’IS chez les patients HD de Marseille
Nous avons réalisé une étude prospective monocentrique chez 92 patients hémodialysés
marseillais, provenant du centre de néphrologie et transplantation rénale de l’hôpital de la
conception à Marseille, sélectionné selon les critères suivants : âge> 18 ans; aucun
événement cardiovasculaire (infarctus du myocarde, accident vasculaire cérébral, maladie
vasculaire périphérique avec amputation ou besoin d'angioplastie), infection ou intervention
chirurgicale (sauf pour l'angioplastie d'accès vasculaire) au cours des 3 derniers mois; pas de
grossesse; aucun antécédent récent de malignité; pas de prise de corticostéroïdes ou
55
Méthodologie de travail
d'agents immunosuppresseurs. Les patients ont été dialysés au moins 3 fois par semaine
pendant un minimum de 6 mois. Des échantillons de sang ont été prélevés chez des patients
pendant la séance d'hémodialyse en milieu de semaine ; dans des tubes citrates pour
récupérer le plasma et doser le FT, et des tubes secs pour doser l’IAA et l’IS dans le sérum.
Des procédures de laboratoire standard ont été utilisées pour les évaluations de la chimie du
sang. L’IAA et IS total ont été mesurés par HPLC suivant la méthode de Calaf et al. 2011.
Un consentement éclairé a été obtenu de tous les participants individuels inclus dans
l'étude. L'étude a été approuvée par le comité d'éthique local (De Marseille) et est conforme
aux principes énoncés dans la Déclaration d'Helsinki.
4.10. Mesure du FT par dosage immuno-enzymatique
Le FT a été quantifié dans du plasma humain citraté et dans des lysats cellulaires d’HUVEC
avec le kit de dosage immuno-enzymatique (ELISA Sandwich) Quantikine Facteur de
coagulation humain III / Tissue Factor (R & D Systems, Lille, France) selon les instructions du
fabricant.
4.11. Étude comparative entre deux cohortes de patients HD (Oran vs Marseille)
L’étude a inclus 103 patients hémodialysés chroniques oranais et 133 patients hémodialysés
chroniques marseillais qui ont donné leur consentement éclairé pour participer à l’étude
(Annexe1). Les patients hémodialysés d’Oran ont été recrutés à la clinique Rénadial ST-
Hubert, et à la clinique Rénadial ES-SEDIKKIA, ils ont été recrutés sur cinq mois (d’Avril à
Septembre 2015). Les patients hémodialysés de Marseille ont été recrutées au centre de
néphrologie et de transplantation rénale de l’hôpital de la conception à Marseille en Juin
2014. Il s’agit de patients hémodialysés avec une MRC terminale à distance de toutes
infections et ne prenant pas d’antibiotique (la prise d’antibiotique peut modifier jusqu’à 1
56
Méthodologie de travail
mois après l’arrêt la flore digestive) et ne présentant pas de colectomie. Un interrogatoire à
l’inclusion a été présenté aux patients pour recueillir les informations personnelles, les
antécédents et les médicaments pris par les patients au moment des prélèvements (Annexes
2). Les informations obtenues sont confidentielles et les données privées des patients ont
été anonymisées par l’attribution d’un numéro d’inclusion.
Des prélèvements ont été réalisés dans deux tubes secs de 4,5 ml au début d’une dialyse de
milieu de semaine. L’ensemble des prélèvements biologiques ont été réalisés suivant les
procédures des cliniques d’hémodialyses. La préparation du sérum a été faite de manière
stérile et conservée à -80°. Avec l’accord des patients, nous avons entamé un suivi d’une
année. Cette période appelée la période d’observation consiste à suivre tous les événements
indésirables durant l’année.
4.11.1. Critères d’inclusion
Les critères d’inclusion sont :
- Sujets adultes des 2 sexes âgés de 18 ans ou plus
- Sujets capables de donner leur consentement éclairé
- Patients hémodialysés quelle que soit l’étiologie de leur insuffisance rénale
- Patients n’étant pas sous antibiothérapie
- Acceptant de participer à l’étude et ayant signé un consentement
4.11.2. Critères d’exclusion
Les critères d’exclusion sont :
- Femmes enceintes ou allaitantes
- Personnes hospitalisées sans consentement
- Majeurs sous protection légale ou hors d’état d’exprimer leur consentement
- Refus du patient
57
Méthodologie de travail
- Possibilité de récupération d’une fonction rénale (sclérodermie par exemple)
- Patients porteurs d’une infection virale répliquant (HCV, VIH).
- Prise d’une antibiothérapie sur le mois précédent le 1er prélèvement
4.11.3. Arrêt d’étude
- Transplantation rénale
- Décès du patient
- Perdu de vue ou changement de centre
4.11.4. Les éléments cliniques et biologiques d’intérêt :
Les informations concernant les patients et leurs antécédents ont été recueillies à partir de
leur dossier médical.
Des analyses biologiques ont été réalisées au sein de l’hôpital de Marseille à partir des
sérums récoltés lors des prélèvements uniques. Ces analyses ont été réalisées pour avoir une
universalité des résultats des dosages.
4.11.5. Dosages des toxines :
Les dosages des toxines urémiques IAA, IS et PCs ont été réalisés par méthodes d’HPLC. La
méthode d’HPLC (chromatographie en phase liquide de haute performance) d’absorption et
échangeuse d’ion permet un dosage simultané des toxines urémiques à partir du sérum en
utilisant un flux isocratique et quantifié avec une détection de fluorescence. La méthode a
été élaborée au sein du laboratoire UMR-S1076 par R.CALAF et al en 2011.
4.11.6. Suivi des patients :
Un suivi d’un an a été entamé à partir de la date des prélèvements sanguins. La date et la
cause de décès ont été récupérées au cours de l’année (Annexe 3). Les événements
cardiovasculaires tels que ; l’infarctus du myocarde, accident vasculaire cérébral, maladie
vasculaire périphérique avec amputation, arrêt cardiaque fatal et les événements
58
Méthodologie de travail
thrombotiques graves tels que l’embolie pulmonaire et la thrombose veineuse profonde ont
été enregistrées avec la date de l’événement.
4.12. Analyses statistiques
Pour les études in vitro, des analyses statistiques ont été effectuées avec le logiciel Prism
(GraphPad Software Inc, CA). Des différences significatives ont été révélées par le test du
rang signé Wilcoxon ou par le test de Mann Whitney. Les données sont exprimées en
moyenne ± SEM d'expériences indépendantes réalisées sur différentes préparations
cellulaires.
Dans les études des patients HD, les données sont exprimées en moyenne ± écart-type (ET)
pour les valeurs avec distribution normale ou médiane (min, max) pour les valeurs non-
normalement distribuées. Les variables numériques ont été testées pour la normalité par le
test de Shapiro-Wilk. Les corrélations entre le FT plasmatique et les variables continues ont
été obtenues en utilisant les coefficients de corrélation de Spearman ; des analyses
statistiques ont été réalisées avec le logiciel Prism (GraphPad Software Inc, CA). Pour
identifier les facteurs indépendamment associés au FT plasmatique, des analyses de
régression linéaire multiple ont été réalisées avec le logiciel R. Les comparaisons entre la
cohorte de patient HD d’Oran et de Marseille ont été obtenues par le test de Mann Whitney
(test non paramétrique) pour les valeurs non-normalement distribué et par le test de
student pour les valeurs qui assume la distribution gaussienne. Les variables qualitatives ont
été comparées avec le test exact de Fisher. Une valeur p inférieure à 0.05 a été considérée
comme significative.
59
Résultats et discussions
5. Résultats et discussions
Les résultats et discussions des travaux de thèse sont présentés en plusieurs études selon le
plan suivant :
5.1. Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA.
5.2. Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS .
5.3. Étude du lien entre le FT circulant et les taux sériques d’IAA et d’IS chez les
patients HD de Marseille.
5.4. Étude comparative entre deux cohortes de patients HD (Oran vs Marseille).
60
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats et discussion
5.1. Étude de la régulation du Facteur Tissulaire via
AhR induit par l’IAA
61
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
Résultats
5.1.1. Étude de l'expression du FT induit par l'IAA dans les cellules
endothéliales
Notre équipe a montré que l'IAA régule à la hausse l'expression de FT dans les HUVEC
(Gondouin et al. 2013). Dans ce travail, nous avons étudié l'effet de l'IAA sur l'expression du
FT en ARNm et en protéines dans d'autres types de cellules endothéliales humaines, qui sont
pertinentes pour les événements cardiovasculaires observés chez les patients : artérielle
(HAoEC, cellules endothéliales aortiques) et microvasculaire (HMVEC-C, cellules
endothéliales microvasculaires cardiaques). Dans toutes les cellules endothéliales humaines
étudiées, l’IAA a significativement augmenté l'expression du FT en ARNm (Figure 1A) et en
protéines (Figure 1B) après 4 ou 6 heures d'incubation.
Nous avons réalisé les mêmes expériences avec de l’albumine humain à 4g/dL dans le milieu
de culture pour augmenter la fraction liée à la protéine de l'IAA. Après 4 heures
d'incubation, l'induction de l'ARNm (Figure 1C) et de la protéine (Figure 1D) du FT par l’IAA
était similaire avec ou sans addition d'albumine.
Pour tester si la transcription était la façon principale de contrôler l'expression du FT après
stimulation par l’IAA dans les cellules endothéliales, nous avons ajouté l'inhibiteur de la
transcription Actinomycine D (Figure 1E). L'actinomycine D a aboli l'induction de l'expression
de l'ARNm du FT par l’IAA, ainsi que l'expression basale de l'ARNm du FT. Ces résultats
suggèrent que l'expression du FT induit par l’IAA dans les cellules endothéliales est
contrôlée au niveau transcriptionnel contrairement à la cellule musculaire lisse vasculaire
(Chitalia et al. 2013).
62
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
Figure 1 (A)(B) : Effet de l'IAA sur l'expression du FT en ARNm (A) et en protéines (B) dans différents
types de cellules endothéliales humaines.
(A) L'induction de l'ARNm du FT par l’IAA dans les HUVEC (veine ombilicale), HAoEC (aortique), et
HMVEC-C (cardiaques microvasculaires), après une incubation de 4 heures avec 50μM d’IAA, a été
étudiée par RT-qPCR comparative et exprimée en facteur de variation d’ARNm vs contrôle. (B) Les
niveaux de protéines du FT dans les HUVEC, HAoEC et HMVEC-C après une incubation de 6 heures
avec 50μM d’IAA ont été étudiés par ELISA. Les données (A)(B) représentent la moyenne ± SEM de 4
expériences indépendantes. * p <0,05, ** p <0,01.
Figure 1 (C) (D) : Effet de l'IAA sur l'induction de l'ARNm (C) et de la protéine (D) du FT dans les
cellules HUVEC, dans un milieu contenant 4% d'albumine sérique humaine.
(C) L'induction de l'ARNm du FT après 4 heures d’incubation des HUVEC avec 50μM d’IAA a été
étudiée par RT-qPCR comparative et exprimée en facteur de variation d’ARNm vs contrôle. (D) Le
niveau de protéines du FT après une incubation de 6 heures des HUVEC avec 50μM d’IAA a été
étudiée par ELISA. Les données représentent la moyenne ± SEM de 5 expériences indépendantes * p
<0,05.
63
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
Figure 1 (E) : Effet de l'inhibiteur de la transcription Actinomycine D (1 pg/ml) sur l'expression de
l'ARNm du facteur tissulaire induit par l’IAA.
Les HUVEC ont été incubés pendant 4 heures +/- IAA 50µM, +/- Actinomycine D. L’expression
d’ARNm a été étudiée par RT-qPCR comparative. Les données exprimées en facteur de variation de
l'ARNm par rapport au contrôle, représentent la moyenne ± SEM de 4 expériences indépendantes. *
p <0,05, ** p <0,01.
64
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
5.1.2. L’IAA induit l'expression du FT par l'intermédiaire de l'activation d’AhR
mais sans la liaison d'AhR au promoteur du FT
Nous avons confirmé l'implication d’AhR dans l'expression du FT médiée par l'IAA en utilisant
un inhibiteur pharmacologique d’AhR, le CH223191, et le siRNA d’AhR. L'expression induite
par l’IAA de l'ARNm du FT (Figure 2A) et de la protéine (Figure 2B) a été abolie par le
CH223191 et par le siRNA AhR. Le CH223191 et le siRNA AhR seul n'ont pas d'effet significatif
sur l'expression basale de l'ARNm et de la protéine du FT (Figures 2A et 2B).
L’AhR peut réguler la transcription directement en se liant au promoteur du gène par une
voie dite génomique, ou indirectement en activant d'autres facteurs de transcription par une
voie dite non génomique. Nous avons étudié par des expériences de ChIP, si AhR se lie
directement au promoteur du FT pour induire l'expression du FT dans les HUVEC. Il n’y a
aucun enrichissement d'AhR sur le promoteur du FT, montrant qu’AhR n'était pas
directement recruté au niveau du promoteur du FT dans les cellules endothéliales après
stimulation par l’IAA (Figure 2C). Après stimulation des HUVEC par l’IAA, l’AhR a été retrouvé
au niveau des promoteurs de CYP1A1 et CYP1B1, connus pour contenir des séquences XRE
(Figure 2C). L’IAA induit la liaison d’AhR dans les promoteurs de gènes régulés par la voie
génomique. Nous avons analysé la translocation nucléaire d’AhR en étudiant l'expression
d’AhR dans des extraits nucléaires et cytoplasmiques après stimulation des HUVEC par l’IAA
en présence de l'inhibiteur d’AhR, le CH223191. L’IAA augmente le niveau nucléaire d’AhR,
cet enrichissement est diminué lorsque les cellules sont incubées avec l'inhibiteur CH223191
(Figure 2D). En parallèle, l'IAA a provoqué une diminution du taux cytoplasmique d'AhR, qui
est prévenue par le CH223191. Nous avons ensuite examiné l'effet de l'IAA sur la régulation
positive du CYP1A1 et du CYP1B1 dans les HUVEC en présence de CH223191. L’IAA a induit
65
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
une augmentation significative de l'expression de l'ARNm de CYP1A1 et CYP1B1, qui a été
aboli en présence du CH223191 (Figure 2E et 2F).
Figure 2 (A)(B) : Effet de l'inhibiteur d’AhR le CH-223191 (10μM) et du siRNA AhR sur l'expression de
l'ARNm (A) et de la protéine (B) du FT induit par l’IAA.
L'expression de l'ARNm du FT a été étudiée par RT-qPCR comparative après une incubation de 4 h
des HUVEC avec 50μM d'IAA, +/- CH-223191, +/-siRNA. Les données sont exprimées en facteur de
variation de l'ARNm par rapport au contrôle. L'expression de la protéine du FT a été étudiée par
ELISA après 6 heures d’incubation. Les données représentent la moyenne ± SEM d'au moins 5
expériences indépendantes. * p <0,05, ** p <0,01, *** p <0,0001.
66
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
Figure 2 (C)(D) : Étude de la liaison d’AhR aux promoteurs et analyse de la translocation nucléaire
d’AhR provoqué par l’IAA
(C) La liaison de l’AhR aux promoteurs du facteur tissulaire, CYP1A1 et CYP1B1 a été étudiée par
immunoprécipitation de la chromatine (ChIP) après 1 heure de stimulation des HUVEC avec 50μM
d’IAA. Les données exprimées en termes d'enrichissement, représentent la moyenne ± SEM de n = 6
expériences indépendantes. (D) Le taux d'AhR dans les extraits nucléaires et cytoplasmiques a été
étudié par Western blot après 30 min de stimulation des HUVEC avec 50μM d'IAA en présence de
l'inhibiteur d’AhR, le CH223191 (10μM). Les images sont représentatives de 3 expériences
indépendantes.
Figure 2 (E)(F) : Expression d’ARNm des gènes cibles d’AhR induit par l’IAA
L’expression d’ARNm des gènes cibles d’AhR, CYP1A1 (E) et CYP1B1 (F) après 4h d'incubation des
HUVEC avec l’IAA (50μM) a été étudiée par RT-qPCR comparative en présence de l'inhibiteur d’AhR,
le CH-223191 (10μM). Les données exprimées en facteur de variation de l'ARNm par rapport au
contrôle, représentent la moyenne ± SEM de 10 expériences indépendantes. ** p <0,01, *** p
<0,001.
67
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
5.1.3. Le site NF-B du promoteur du FT est nécessaire pour l'induction du FT
par l'IAA
AhR ne se lie pas au promoteur du FT après stimulation des HUVEC par l’IAA. Nous avons
étudié la régulation de la transcription du FT en utilisant des plasmides contenant le
promoteur du FT contrôlant l’expression de la luciférase, les constructions utilisées
comportent des sites de liaison pour les facteurs de transcription: AP-1, NF -B, Egr-1 et Sp1
et pour certaines d’entre elles des délétions de ces sites de fixation (Oeth et al. 1997; Li et al.
2009). Nous nous sommes concentrés sur les facteurs de transcription impliqués dans la
régulation positive du FT par des stimuli inflammatoires: AP-1 et NF-B (Bode and Mackman
2014). Les plasmides contenant un promoteur de FT non muté (-227 WT), ou un contenant
un mutant ne fixant pas NF-B (-227 mNF-B), ou un contenant des sites ne liants pas AP-1 (-
227 mAP1), ont été transfectés dans des HUVEC. Dans les cellules transfectées avec la
construction de type FT sauvage, l'activité de la luciférase était de 70% plus élevée dans les
cellules stimulées par l’IAA que dans les cellules témoins (Figure 3A). La perte du site AP-1 (-
227-mAP1) a significativement diminué l'activité de la luciférase à la fois dans les cellules
témoins (éthanol) et stimulées par l’IAA (Figure 3A). Cependant, l'activité du promoteur FT -
227-mAP-1 était 53% plus élevée dans les cellules traitées à l'IAA que dans les cellules
témoins traitées à l'éthanol. Ceci nous a conduits à étudier le niveau nucléaire des sous-
unités AP-1 ; c-Fos et c-Jun dans les cellules HUVEC stimulées par l'IAA. Le niveau nucléaire
de c-fos et de c-jun n'était pas plus élevé dans les cellules traitées par l’IAA que dans les
cellules témoins (Figure supplémentaire 1). L'induction de l'activité du promoteur par l’IAA
était significativement plus faible dans la construction NF-B mutante que dans la forme
sauvage. L'activité du promoteur du FT mutée pour le site NF-B était similaire dans les
cellules traitées par l'IAA et dans les cellules témoins traitées à l'éthanol (Figure 3A). De plus,
68
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
dans les cellules témoins, aucune différence d'activité du promoteur n'a été observée entre
les cellules transfectées avec le promoteur FT -227WT et le FT -227 mNF-B. Ces données
indiquent que le site NF-B est crucial pour la transcription du gène du FT médiée par l'IAA.
Coopération entre AhR et NF-B dans l'induction du FT par l'IAA
Nous avons incubé les HUVEC avec 50 µM d’IAA pendant 4 heures en présence de
l'inhibiteur pharmacologique d’IkB kinase (IkK), le BAY 11-7082 (Inhibiteur de la voie NF-B).
Le BAY 11-7082 a radicalement diminué l'induction de l'ARNm du FT (Figure 3B) et de la
protéine (Figure 3C) en présence d’IAA. Ceci suggère que l'activation de NF-B est impliquée
dans l'induction du FT par IAA.
Par la suite, nous avons étudié le niveau des sous-unités de NF-B p50 et p65 dans des
extraits nucléaires d’HUVEC stimulés pendant 30 min avec de l’IAA. L’IAA a augmenté le
niveau nucléaire de NF-B p50 (figure 3D) et p65 (Figure supplémentaire 2). Nous avons
ensuite analysé l'effet des inhibiteurs pharmacologiques de la voie NF-B (BAY 11-7082) et
d’AhR (CH223191). La translocation nucléaire de p50 a été inhibée par l'inhibiteur BAY 11-
7082 (Figure 3D). L'augmentation du niveau nucléaire de p50 était également inhibée par
l'inhibiteur d’AhR, le CH223191 (Figure 3D) et par le siRNA AhR (Figure supplémentaire 3),
montrant que l'IAA active NF-B via AhR.
69
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
Figure 3 (A) : Identification du site de liaison du facteur de transcription sensible a l'IAA dans le
promoteur du FT.
Le site de liaison du facteur de transcription sensible à l'IAA dans le promoteur du FT a été étudié en
utilisant le système rapporteur FT promoteur luciférase. Des plasmides de luciférase contenant soit
un promoteur du FT de type sauvage (-227 WT), soit un mutant non-liant NF-B (-227 mNF-B) ou un
site non-liant AP-1 (-227 mAP1) ont été transfectés dans des cellules HUVEC. Après 6 heures de
stimulation des HUVEC par 50μM d’IAA, les données exprimées dans l'activité de la luciférase ont été
normalisées en facteur d’induction. Les données représentent la moyenne ± SEM de 6 expériences
indépendantes, * p <0,05, ** p <0,01.
Figure 3 (B)(C) : Effet de l'inhibiteur de NF- sur l'expression de l'ARNm (B) et de la protéine (C) du
FT induit par l’IAA.
Après incubation des HUVEC +/- IAA (50μM) pendant 4h +/- l'inhibiteur I Kappa Kinase (IkK) BAY 11-
7082 (10μM), l'expression de l'ARNm du FT (B) a été étudiée par RT-qPCR comparative et exprimée
en facteur de variation de l'ARNm vs contrôle. L'expression de la protéine du facteur tissulaire (C) a
été étudiée par ELISA après 6h d’incubation. Les données représentent la moyenne ± SEM de 4 (B)(C)
expériences indépendantes, * p <0,05.
70
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
Figure 3 (D) : Étude de l'expression de la p50 endothéliale dans les extraits nucléaires induite par
l’IAA.
L'expression de la p50 endothéliale dans les extraits nucléaires a été mesurée après 30 min
d'incubation des HUVEC avec l’IAA 50 µM, en présence de l'inhibiteur d’AhR, le CH223191 (10 µM) ou
de l'inhibiteur IKK, le BAY 11-7082 (10 µM). Les inhibiteurs ont également été utilisés seul. Les
données représentent la moyenne ± SEM de 5 expériences indépendantes, * p <0,05.
71
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
5.1.4. Implication de p38 MAPK dans l'induction du FT par l'IAA
Nous avons étudié l'implication de la protéine kinase C (PKC) et des MAP kinases p38 et
ERK1/2 dans l'induction du FT par l’IAA. Les cellules HUVEC ont été stimulées par l'IAA
pendant 4 heures en présence de l'inhibiteur de la PKC ; Bisindolymaleimide I, de l'inhibiteur
de la p38 ; SB203580 et de l'inhibiteur de ERK1/2 ; PD98059. L'induction d'ARNm du FT par
l’IAA a été significativement diminuée par les inhibiteurs de p38 et PKC, mais non modifiée
par l'inhibiteur d’ERK1/2 (Figure 4A). Les inhibiteurs de p38 et PKC ont également diminué
l'induction de la protéine du FT par l’IAA (Figure 4B). Ceci suggère que les voies de la p38 et
de la PKC sont impliquées dans la régulation positive du FT induite par l'IAA.
Enfin, nous avons évalué l'effet des inhibiteurs de la p38 et de la PKC sur l'activation de NF-
B induit par l'IAA. L'augmentation du niveau de p50 nucléaire provoquée par l’IAA (Figure
4C) a été inhibée par l’inhibiteur de p38, le SB203580 mais pas par le Bisindolymaléimide I,
suggérant que p38 mais pas la PKC est impliquée dans la translocation nucléaire de NF-B
induite par l’IAA.
Nos données montrent que l’IAA régule l'expression du FT par une voie inflammatoire non
génomique AhR / p38 MAPK / NF-B (Figure 5).
72
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
Figure 4 (A)(B) : Effet des inhibiteurs de PKC, p38MAPK, ERK1/2 sur l'expression de l'ARNm (A) et de
la protéine (B) du FT induit par l’IAA.
L'expression de l'ARNm (A) du facteur tissulaire a été étudiée par RT-qPCR comparative après 4h
d'incubation des HUVEC avec l’IAA (50μM) en présence de l'inhibiteur de PKC (Bisindolymaleimide I,
5μM), de l'inhibiteur p38 MAPK (SB203580, 10μM), l’inhibiteur de ERK1/2 (PD98059, 10 µM). Les
données sont exprimées en facteur de variation de l'ARNm par rapport au contrôle. L'expression
protéique (B) du facteur tissulaire a été étudiée par ELISA après 6h incubation des HUVEC avec l’IAA
(50μM) en présence de l'inhibiteur de la PKC (Bisindolymaleimide I, 5μM) et de l'inhibiteur de la p38
MAPK (SB203580, 10μM). Les inhibiteurs ont également été utilisés seuls. Les données représentent
la moyenne ± SEM d'au moins 5 expériences indépendantes, * p <0,05.
73
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
Figure 4 (C) : Effet des inhibiteurs de PKC et p38 MAPK sur l'expression de la p50 endothéliale induite
par l’IAA dans les extraits nucléaires.
Le niveau de p50 endothéliale a été mesuré dans des extraits nucléaires après 30 min d'incubation
des HUVEC avec l’IAA 50µM, en présence de l'inhibiteur de PKC (Bisindolymaléimide I, 5 µM) et de
l'inhibiteur de p38 MAPK (SB203580, 10µM).
Les inhibiteurs ont également été utilisés seul. Les données représentent la moyenne ± SEM d'au
moins 5 expériences indépendantes, * p <0,05.
74
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats
Figure 5. Les mécanismes liés à l'AhR sous-jacent à la transcription du FT induit par l'IAA dans les
cellules HUVEC
La régulation à la hausse du FT par l’IAA dans les HUVEC est médiée par une voie non génomique
AhR/p38 MAPK/NF-B. Cette régulation à la hausse n'implique pas la liaison d'AhR au promoteur du
FT; AhR active p38 MAPK, qui assure la médiation de la translocation nucléaire de NF-B p50/p65 et
la liaison au promoteur du FT, conduisant à la transcription du FT.
75
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Discussion
Discussion
Dans cette étude, nous avons démontré que l'induction du FT par l’IAA est médiée par
une voie non génomique d’AhR impliquant l'activation de p38MAPK et NF-B.
L'IAA est une toxine urémique liée aux protéines, issue principalement de la
métabolisation du tryptophane par les bactéries intestinales (Fernandez-Prado et al. 2017).
L’IAA est un agoniste d’AhR endogène, qui a des effets endothéliaux similaires à ceux des
polluants exogènes activant AhR comme la TCDD, benzo [a] pyrène, PCB126 et PCB77 (Sallée
et al. 2014). Il induit la production des ROS, régule à la hausse l'expression des molécules
inflammatoires COX-2, IL-8, ICAM-1 et MCP-1 (Dou et al. 2015), et augmente l'expression et
l'activité procoagulante du FT dans les HUVEC (Gondouin et al. 2013). Dans ce travail, nous
montrons que l’IAA augmente l'expression du FT dans les cellules endothéliales d'autres
types de vaisseaux : artériel (aortique) et microvasculaire (cardiaque). Nous avons également
observé que l’ajout de sérum albumine humain ne modifie pas l'effet de l'IAA sur l'induction
du facteur tissulaire. l'IAA, qu'il soit libre ou lié aux protéines, induit une régulation positive
du FT.
Le FT n'est généralement pas exprimé par les cellules endothéliales dans des conditions
normales. Cependant, il est exprimé dans certaines conditions pathologiques in vivo (Bode
and Mackman 2014). L'induction in vitro de l'expression du FT dans les cellules endothéliales
est médiée par diverses voies de signalisation intracellulaires et par les facteurs de
transcription NF-B, AP-1 et Egr-1, en fonction du stimulus ; LPS, IL-1β, TNF- α, thrombine et
VEGF (Bode and Mackman 2014). En utilisant le siRNA AhR, notre équipe à précédemment
décrit une nouvelle voie d'induction de FT par l’IAA qui est médiée par l'activation de l’AhR
(Gondouin et al. 2013). Nous confirmons ici qu'un antagoniste spécifique d’AhR, le
CH223191, est capable de diminuer l'expression de FT médiée par l'IAA.
76
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Discussion
L'induction du FT en réponse à des stimuli est principalement régulée au niveau
transcriptionnel; mais certains stimuli peuvent également augmenter la stabilité de l'ARNm
et/ou de la protéine du FT (Crossman et al. 1990; Brand et al. 1991; Ahern et al. 1993; Reddy
et al. 2004). La régulation de FT par l’IAA a été bien étudiée dans les cellules musculaires
lisses vasculaires par le groupe de Chitalia. Ils ont montré que l'IAA prolonge la demi-vie de
la protéine du FT en diminuant son ubiquitination (Chitalia et al. 2013). En outre, Ils ont
démontré dans les cellules musculaires lisses vasculaires que l’AhR interagit directement
avec le FT et réduit le niveau d'ubiquitination de ce dernier (Shivanna et al. 2016). Dans
notre étude sur les cellules endothéliales, la régulation à la hausse de l'ARNm du FT par l’IAA
a été abolie en présence de l'inhibiteur de transcription, l’actinomycine D, montrant que la
transcription est le mécanisme majeur de l'induction de l'ARNm du FT par l'IAA dans les
cellules endothéliales. Cependant, on ne peut pas exclure qu'il puisse exister une régulation
post-traductionnelle de FT, comme dans les cellules musculaires lisses vasculaires.
La voie génomique classique active l’expression des gènes par la dimérisation d’AhR et
d’aryl-hydrocarbon nuclear translocator (ARNT). Lors de la liaison du ligand à AhR, il est
transloqué dans le noyau où il s'associe à son partenaire d'hétérodimérisation ARNT.
L'hétérodimère AHR/ARNT se lie au motif de séquence d'ADN, appelé XRE, dans les
promoteurs des gènes cibles. Dans le XRE (5'-TNGCGTG-3 '), une séquence centrale minimale
de 5'-GCGTG-3' est requise pour la liaison de l’AHR/ARNT (Swanson et al. 1995) et l'induction
de gènes cibles comme les enzymes métabolisant les xénobiotiques, CYP1A1 et CYP1B1
(Dolwick et al. 1993; Fujii-Kuriyama and Mimura 2005). Récemment, une voie génomique
indépendante de l'ARNT d’AhR a été rapportée (Jackson et al. 2015), avec un nouveau XRE
non-consensus (NC-XRE) décrit dans le promoteur de PAI-1 (Huang and Elferink 2012) et
dans le promoteur de p21Cip1 (Jackson et al. 2014). L'expression du gène AhR-dépendante
77
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Discussion
médiée par le NC-XRE n'implique pas l'ARNT en tant que composant du complexe AhR lié à
NC-XRE. Dans ce travail, nous rapportons que l’IAA active la voie génomique classique d’AhR
dans les HUVEC. L’IAA induit la translocation nucléaire d’AhR et AhR se lie aux promoteurs
des gènes cibles CYP1A1 et CYP1B1, conduisant à la régulation positive des ARNm du CYP1A1
et CYP1B1. L'inhibiteur d’AhR, le CH223191 réduit la translocation nucléaire d’AhR médiée
par l’IAA et abolit l'expression induite par l’IAA de CYP1A1 et CYP1B1. Le CH223191 a été
initialement décrit comme un inhibiteur de la liaison de TCDD à AhR, qui inhibe la
translocation nucléaire d’AhR induite par la TCDD (Kim et al. 2006). On peut supposer que le
CH223191 inhibe également la liaison de l'IAA à AhR. À l’inverse, nous avons montré que
l’AhR ne se lie pas au promoteur du FT, la voie génomique classique de l'activation de l’AhR
n'est pas impliquée dans la régulation à la hausse du FT par l'IAA. Ce résultat concorde avec
l'absence de séquences XRE ou NC-XRE dans le promoteur du FT.
Une fois activé par le ligand, l’AhR peut activer une voie non-génomique dite
inflammatoire, ceci ne nécessite pas la participation de l'ARNT (Matsumura 2009). Il a été
démontré que l’AhR pouvait activer d'autres facteurs de transcription tels que ; AP-1 (Di
Meglio et al. 2014; Ito et al. 2016) et NF-B (Borlak and Jenke 2008; Vogel and Matsumura
2009; Øvrevik et al. 2014) pour conduire à l'expression des gènes, par une voie non-
génomique. Notre équipe a précédemment rapporté que l'IAA induit une expression de la
COX-2 endothéliale inflammatoire via une voie non génomique de l’AhR impliquant NF-B
(Dou et al. 2015). Dans mon travail, nous avons clairement démontré le rôle de NF-B dans
l'expression du FT médiée par l'IAA. Nous avons montré que le site NF-B est essentiel dans
l'activité du promoteur du FT induite par l'IAA. De plus, l’inhibiteur de l’IkB-kinase, qui inhibe
la phosphorylation d’IkB et l'activation ultérieure de NF-B, inhibe fortement l'ARNm du FT
et l'induction de la protéine par l'IAA. Ensuite, nous avons montré que l'IAA augmentait le
78
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Discussion
niveau nucléaire des sous-unités p50 et p65 de NF-B, qui sont des régulateurs critiques du
FT (Li et al. 2009). Cela n'exclut pas que d'autres sous-unités de NF-B tels que ; p52, RelB et
c-Rel puissent être activées par l’IAA. Il est intéressant de noter que la translocation
nucléaire de la p50 induite par l'IAA a diminué lorsque l'AhR était inhibée. La translocation
nucléaire de p50 était donc médiée par l'activation de l’AhR. Tous ces résultats ont
démontré le rôle crucial de NF-B dans l'induction de FT induite par l’IAA via AhR. Nous
avons également observé que la mutation du site AP-1 diminuait significativement l'activité
du promoteur du FT dans les cellules témoins et celles stimulées avec l’IAA, mais l’IAA
augmente l'activité du promoteur du FT lorsque le site AP-1 est muté. En outre, l'IAA n'a pas
augmenté le niveau nucléaire des sous-unités c-Jun et c-fos de l'AP-1. Ces résultats
suggèrent que le site AP-1 est requis pour l'expression basale du FT et qu'il n'est que
partiellement impliqué dans l'induction du FT par l'IAA. On ne peut pas exclure que d'autres
sous-unités d’AP-1 ; Fos-B/Fra-1/Fra-2/Jun-B/Jun-D puissent être impliquées, ou qu’AP-1
coopère avec NF-B pour induire l'expression du FT comme décrit pour d'autres agonistes
comme le TNF-alpha et IL-1 bêta (Mackman et al. 1991; Armstead et al. 1999; Xia et al. 2013,
2016).
Plusieurs études ont montré l’interaction d'AhR avec de multiples voies de signalisation,
notamment les MAP kinases (Henklová et al. 2008; Puga et al. 2009); et les activateurs
conventionnels d’AhR tels que le TCDD, le benzo [a] pyrène et les MAP kinases (Henklová et
al. 2008; Puga et al. 2009). Dans une étude précédente, notre équipe a démontré que l'IAA
induit la phosphorylation de p38 MAPK et ERK (Dou et al. 2015). Dans cette étude nous
avons trouvé que p38 MAPK, mais pas ERK, est impliqué dans la régulation du FT par l'IAA.
L'inhibition de p38 diminuait l’expression du FT initialement induit par l’IAA. De plus, la
translocation nucléaire de la p50 induite par l'IAA a été diminuée par les inhibiteurs d'AhR et
79
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Discussion
de p38 MAPK. Par conséquent, en plus de l'activation de la voie génomique classique, la
liaison d'IAA à AhR active une voie de signalisation cytoplasmique passant par p38 MAPK et
NF-B pour induire l'expression du FT.
Nous avons également observé l'implication de PKC dans l’expression du FT induit par
l’IAA, mais l'absence d'inhibition de la translocation nucléaire de p50 par l'inhibiteur PKC
suggère que la PKC n'est pas impliquée dans la voie de signalisation cytoplasmique AhR / p38
qui conduit à la translocation nucléaire de p50. Les PKC sont connus pour leur rôle clé dans
la transduction du signal cytoplasmique; elles peuvent également réguler directement
l'expression génique par la transduction du signal dans le noyau, un processus distinct des
voies de signalisation cytoplasmiques (Lim et al. 2015). Au sein du noyau, les PKC peuvent
réguler directement la transcription génique en phosphorylant des résidus d'histones
spécifiques ou en phosphorylant des facteurs de transcription (Lim et al. 2015). Par exemple,
PKCα peut phosphoryler NF-B p65 à S276, ce qui est nécessaire pour l'activation
transcriptionnelle de NF-B (Lim et al. 2015). Nos résultats permettent de supposer que PKC
pourrait jouer un rôle dans la transcription du FT induite par l’IAA comme un régulateur
épigénétique plutôt que comme un transducteur de signal cytoplasmique impliqué dans la
voie AhR/p38.
En conclusion, l'IAA induit l'expression du FT par l'intermédiaire d'une voie inflammatoire
AhR/p38MAPK/NF-B. Une meilleure compréhension des mécanismes impliqués dans
l'induction du FT par les toxines urémiques pourrait fournir de nouvelles cibles
thérapeutiques pour réduire le risque thrombotique chez les patients atteints de MRC.
80
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Figures supplémentaires
Figures supplémentaires
Figure supplémentaire 1. Effet de l'IAA sur les niveaux nucléaires des sous-unités AP-1 ; c-Jun (A)
et c-Fos (B)
L'expression endothéliale de c-Fos et c-Jun dans les extraits nucléaires a été mesurée après 30
minutes d'incubation des HUVEC avec de l'IAA 50μM. Les données représentent la moyenne ± SEM
de 6 expériences indépendantes, * p<0.05, **p<0.01.
Figure supplémentaire 2. Effet de l'IAA sur les niveaux nucléaires de NF-B p65
L'expression de p65 endothélial dans les extraits nucléaires a été mesurée après 30 min d'incubation
des HUVEC avec de l'IAA 50μM. Les données représentent la moyenne ± SEM de 6 expériences
indépendantes,
* p<0.05.
CTRL IAA
0
10
20
30
40
50
Nor
mal
ized
c-fo
snu
clea
rex
pres
sion
0
50
100
150N
orm
aliz
edc-
jun
nucl
ear
expr
essi
on
CTRL IAA
A B
0.0
0.5
1.0
1.5
2.0
2.5
*
Nor
mal
ized
p65
nucl
ear
exp
ress
ion
CTRL IAA
Exp
ress
ion
de
c-fo
s n
ucl
éair
e
no
rmal
isée
Exp
ress
ion
de
c-ju
n n
ucl
éair
e
no
rmal
isée
81
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Figures supplémentaires
Figure supplémentaire 3. Effet du siRNA AhR sur l'expression nucléaire de p50
Les cellules HUVEC transfectées avec le siRNA contrôle ou AhR ont été stimulées avec de l'IAA 50 µM
ou de l'éthanol (dilution au 1/1000). Le niveau de p50 endothélial dans les extraits nucléaires a été
étudié par Western blot. Les images sont représentatives de 3 expériences indépendantes.
Exp
ress
ion
de
p5
0 n
ucl
éair
e
no
rmal
isée
IAA - + +
Si AhR - - +
p50
Actine
IAA - + +
Si AhR - - +
0
2
4
6
8
82
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Résultats et discussion
5.2. Étude de la régulation du Facteur Tissulaire via
AhR induit par l’IS
83
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Résultats
Résultats
5.2.1. L’induction de l'expression du FT dans les cellules endothéliales HUVEC
par l’IS est contrôlée au niveau transcriptionnel
Nous avons utilisé l'inhibiteur de la transcription l’actinomycin D pour confirmer que la
transcription était la principale façon de contrôler l'expression du FT après stimulation des
HUVEC par l’IS (Figure 1). L'actinomycine D a aboli l'expression de l'ARNm du FT induit par
l’IS, ainsi que l'expression basale de l'ARNm du FT. Ces résultats suggèrent que l'expression
du FT induit par l’IS dans les cellules endothéliales est contrôlée au niveau transcriptionnel.
Figure 1 : Effet de l'inhibiteur de la transcription Actinomycine D (1μg/mL) sur l'expression de l'ARNm
du FT induit par l’IS.
Les HUVEC ont été incubés pendant 4 heures avec IS200µM en présence de l’Actinomycine D.
L’expression d’ARNm a été étudiée par RT-qPCR comparative. Les données exprimées en facteur de
variation de l'ARNm par rapport au contrôle, représentent la moyenne ± SEM de 4 expériences
indépendantes, ** p <0,01.
84
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Résultats
5.2.2. L’IS induit une activation d’AhR sans la fixation de ce dernier sur le
promoteur du FT
Notre équipe avait montré que l'IS induisait l'expression en ARNm et en protéine du facteur
tissulaire via AhR (Gondouin et al. 2013) (Figure 2 A,B). Nous avons réalisé des expériences
de ChIP, afin de déterminer si l’IS permettait la fixation d’AhR sur le promoteur du FT pour
l’induction de gène du FT dans les HUVEC (Figure 2C). Aucun enrichissement d’AhR sur le
promoteur du FT n’a été observé, montrant qu’AhR n'était pas directement recruté dans le
promoteur du FT après une stimulation par l’IS. L'IS a induit le recrutement d'AhR au niveau
des promoteurs des gènes cibles, CYP1A1 et CYP1B1 (Figure 2C). L’IS a augmenté la
translocation nucléaire d’AhR (Figure 2D). Contrairement aux résultats récemment publiés
avec l’IAA, l'inhibiteur d’AhR , le CH223191 n’a eu aucun effet sur la translocation nucléaire
d’AhR induite par l’IS (Figure 2D). Nous avons ensuite examiné l'effet de l'IS sur la régulation
du CYP1A1 et du CYP1B1 dans les HUVEC. L’IS a induit une augmentation significative de
l'expression en ARNm du CYP1A1 et CYP1B1 (Figure 2E,F). Cette augmentation n’a pas été
inhibée par le CH223191.
Figure 2 (A)(B) : Effet des siRNA AhR sur l'expression de l'ARNm (A) et de la protéine (B) du FT après
incubation des HUVEC avec 200μM d'IS (Gondouin et al. 2013).
85
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Résultats
Figure 2 (C)(D) : Étude de la liaison d’AhR aux promoteurs et analyse de la translocation nucléaire
provoquée par l’IS.
(C) La liaison d'AhR aux promoteurs du FT, CYP1A1, et CYP1B1 a été étudiée par immunoprécipitation
de la chromatine (ChIP) après 1 heure d’incubation des HUVEC avec 200μM d’IS. Les données
exprimées en termes d'enrichissement représentent la moyenne ± SEM de 6 expériences
indépendantes. (D) Le taux d'AhR dans les extraits nucléaires a été étudié par Western blot après 30
min de stimulation des HUVEC avec 200µM d'IS en présence de l'inhibiteur de l’AhR, CH223191 (10
µM). Les images sont représentatives de 3 expériences indépendantes.
Figure 2 (E)(F) : Expression d’ARNm des gènes cibles d’AhR induit par l’IS
L’expression d’ARNm des gènes cible d’AhR, CYP1A1 (E) et CYP1B1 (F) après 4h d'incubation des
HUVEC avec l’IS (200μM) a été étudiée par RT-qPCR comparative en présence de l'inhibiteur d’AhR,
CH223191 (10μM). Les données, exprimées en facteur de variation de l'ARNm par rapport au
contrôle, représentent la moyenne ± SEM de 5 expériences indépendantes, * p<0.05.
86
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Résultats
5.2.3. Une voie non-génomique indirecte d’AhR activant d’autres facteurs de
transcription semble être impliquée dans la régulation de l’expression
du FT induit par l'IS
L’AhR ne se fixe pas directement au promoteur du FT lors de la stimulation des HUVEC par
l’IS. Comme dans l’étude précédente avec l’IAA, nous avons étudié la régulation de la
transcription du FT en utilisant les plasmides. Dans les cellules transfectées avec la
construction du promoteur de FT de type sauvage (-227 WT), l'activité de la luciférase était
57% plus élevée dans les cellules stimulées par l'IS que dans les cellules contrôles (Figure
3A). La mutation des sites AP-1 dans la construction du promoteur de FT (-227-mAP1) a
significativement diminué l'activité de la luciférase à la fois dans les cellules contrôles et
celles stimulées par l'IS (Figure 3A). De plus, l'activité du promoteur de FT muté AP-1 n’était
que 24% plus élevée dans les cellules traitées à l'IS par rapport aux contrôles. Ces résultats
suggèrent qu’AP-1 jouerait un rôle dans l’expression du FT induit par l’IS.
L'induction de l'activité de la luciférase par l’IS était significativement plus faible dans la
construction de promoteur de FT muté pour le site NF-B (-227 mNF-B) que dans le
sauvage (-227WT) (Figure 3A). De manière intéressante, l'activité du promoteur (-227 mNF-
B) n’était pas significativement augmentée dans les cellules traitées par l’IS par rapport aux
cellules contrôles (Figure 3A). Ces résultats confirment le rôle crucial du site NF-B pour la
transcription du gène du FT induit par l'IS.
Nous avons confirmé l'implication de la voie NF-B dans l'induction du FT par l'IS avec
l’inhibiteur pharmacologique de la voie NF-B, le BAY 11-7082. L’inhibiteur a drastiquement
diminué l'induction de l'ARNm du FT (Figure 3B) et de la protéine (Figure 3C) induit par l’IS.
Ceci confirme l’implication de la voie NF-B dans la régulation de l’expression du FT induit
par l'IS.
87
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Résultats
Figure 3 (A) : Identification du site de liaison du facteur de transcription sensible a l'IS dans le
promoteur du FT.
L'identification du site de liaison du facteur de transcription sensible à l'IS dans le promoteur du FT a
été étudiée en utilisant le système rapporteur FT promoteur luciférase. Des plasmides de luciférase
contenant soit un promoteur de FT de type sauvage (-227 WT), soit un mutant non-liant NF-B (-227
mNF-B) ou un site non-liant AP-1 (-227 mAP1) ont été transfectés dans des cellules HUVEC. Après 6
heures de stimulation des HUVEC par 200μM d’IS, les données exprimées en activité de la luciférase
ont été normalisées en facteur d’induction. Les données représentent la moyenne ± SEM de 6
expériences indépendantes, * p <0,05.
Figure 3 (B)(C) : Effet de l'inhibiteur de NF- sur l'expression du FT induit par l’IS.
Après 4h d’incubation des HUVEC avec l’IS (200μM) en présence de l'inhibiteur de ; I Kappa Kinase
(IkK) de la voie NF-B, le BAY 11-7082 (10μM), l'expression de l'ARNm du FT (B) a été étudiée par RT-
qPCR comparative et exprimée en facteur de variation de l'ARNm vs contrôle. L'expression de la
protéine du FT (C) a été étudiée par ELISA après 6h d’incubation. Les données représentent la
moyenne ± SEM de 5 (B) (C) expériences indépendantes, * p <0,05, ** p <0,01.
88
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Résultats
5.2.4. Implication de p38 MAPK et PKC dans l’éxpresion du FT induit par l'IS
Nous avons analysé l'implication de la protéine kinase C (PKC) et des MAP kinases p38 et
ERK1/2 dans l'induction du FT par l’IS. Les cellules HUVEC ont été stimulées par l'IS pendant
4 heures en présence de l'inhibiteur de la PKC ; le Bisindolymaleimide I, de l'inhibiteur de la
p38 ; le SB203580 et de l'inhibiteur de ERK1/2 ; le PD98059. Les inhibiteurs de p38 et PKC
ont diminué l’expression en ARNm et en protéines du FT initialement induit par l’IS, mais pas
de modification significative observée avec l’inhibiteur d’ERK1/2 (Figure 4A, 4B). Ces
résultats suggèrent que p38 MAPK et la PKC seraient impliquées dans la régulation du FT
induit par l'IS comme dans l’IAA.
89
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Résultats
Figure 4 (A)(B) : Effet des inhibiteurs de PKC, p38MAPK, ERK1/2 sur l'expression de l'ARNm (A) et de
la protéine (B) du FT induit par l’IS.
L'expression de l'ARNm (A) du FT a été étudiée par RT-qPCR comparative après 4h d'incubation des
HUVEC avec l’IS (200μM) en présence de l'inhibiteur de PKC (Bisindolymaleimide I, 5μM), de
l'inhibiteur de p38 MAPK (SB203580, 10μM) et l’Inhibiteur de ERK1/2 (PD98059, 10 µM). Les données
sont exprimées en facteur de variation de l'ARNm par rapport au contrôle. L'expression protéique (B)
du FT a été étudiée par ELISA après 6h d’incubation des HUVEC avec l’IS (200μM) en présence de
l'inhibiteur de la PKC (Bisindolymaleimide I, 5μM) et de l'inhibiteur de la p38 MAPK (SB203580,
10μM). Les données représentent la moyenne ± SEM de 5 (A) (B) d’expériences indépendantes, ** p
<0,01.
90
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Discussion
Discussion
L’IS induit l’expression du facteur tissulaire endothélial via une voie non-génomique
dépendante d’AhR, impliquant d’autres facteurs de transcription et molécules de
signalisation.
L’IS, comme l’IAA, est une toxine urémique dérivée de la voie indolique du métabolisme
du tryptophane. Contrairement à l’IAA qui est issue principalement après métabolisation du
tryptophane par la flore bactérienne intestinale (Koga et al. 1994), l’IS est issue de la
conversion du tryptophane alimentaire en indole dans l’intestin, et après oxydation et
sulfatation de cet indole au niveau du foie (Aronov et al. 2011). L’IS s’accumule chez les
patients MRC avec une IRC terminale, et est mal épuré par la dialyse du faîte de sa liaison
aux protéines (Neirynck et al. 2013b). L’accumulation de l’IS dans les sérums des patients
MRC est associée à une augmentation du risque de complications cardiovasculaires et de
mortalité (Barreto et al. 2009). L’IS induit une dysfonction endothéliale (Yu et al. 2011;
Jourde-Chiche et al. 2011), un stress oxydant endothélial (Dou et al. 2007), une expression
des molécules inflammatoire MCP-1, ICAM et IL-6 (Tumur et al. 2010; Masai et al. 2010;
Adelibieke et al. 2014), et notamment l’expression du facteur pro-thrombotique, le facteur
tissulaire dans les HUVEC (Gondouin et al. 2013). Notre équipe a précédemment montré que
l’IS induit l’expression du FT endothélial via un nouveau facteur de transcription l’Aryl
hydrocarbon receptor en utilisant des siRNA AhR (Gondouin et al. 2013). Dans cette étude,
l’utilisation de l’inhibiteur de la transcription l’Actinomycine D a aboli l’expression de l’ARNm
du FT induite par l’IS. Ceci suggère que la régulation du facteur tissulaire par AhR est
principalement transcriptionnelle, après stimulation des HUVEC par l’IS. Ce résultat a été
également décrit avec la toxine urémique indolique IAA.
91
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Discussion
Comme dans l’étude précédente avec l’IAA, nous avons montré que l’IS active la voie
génomique classique d’AhR, en induisant une translocation nucléaire d’AhR, une fixation
d’AhR au niveau des promoteurs de ces gènes cibles, et une induction de l’expression de
CYP1A1 et CYP1B1. En outre, nous avons montré avec la chromatine immunoprecipitation
que l’AhR ne se fixe pas directement au niveau du promoteur du facteur tissulaire, après
stimulation des HUVEC avec l’IS.
Nous avons précédemment montré que le CH223191 inhibait l’effet de l’IAA sur
l’activation d’AhR et sur l’induction du FT. Les présents résultats montrent que le CH223191
n’inhibe pas la translocation nucléaire d’AhR et l’expression des gènes cibles d’AhR induit par
l’IS. De plus, nous avons constaté que le CH223191 n’inhibait pas l’expression en ARNm et en
protéines du facteur tissulaire induit par l’IS (Données non présentées).
Le CH223191 est un antagoniste ligand-sélectif de l’AhR (Zhao et al. 2010). En effet, le
CH223191 a la capacité d’inhiber certaines classes d’agonistes d’AhR comme, le 2,3,7,8-
tétrachlorodibenzo-p-dioxine, mais pas d'autres comme certains PAHs, flavonoïdes ou
l’indirubine (Zhao et al. 2010). La diversité structurelle des ligands d’AhR contribue à la
variation sélective de l’effet du CH223191 dans l’inhibition de la liaison des ligands à l’AhR.
Ainsi, la capacité du CH223191 à inhiber l’activation de l’AhR en présence d’IAA, mais pas en
présence de l’IS, pourrait être due aux différences structurelles que présentent les deux
toxines indoliques (Sallée et al. 2014). Cette différence structurelle pourrait également jouer
un rôle dans l’affinité de l’IS et IAA à l’AhR, et/ou dans les variations des régions de fixations
des toxines indoliques sur le site de fixation des ligands sur l’AhR. Une étude récente a
montré qu’une mutation au niveau des sites de liaison des ligands d’AhR, modifie
sélectivement l’affinité des ligands exogènes à l’AhR, mais pas des ligands endogènes d’AhR,
92
Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Discussion
suggérant que ces derniers ne se fixent pas dans la même région sur le site de liaison des
ligands de l’AhR (Hubbard et al. 2016).
Les sites de fixation des facteurs de transcriptions NF-B et AP-1 sont primordiaux dans
l’activité du promoteur induite par l’IS. La mutation du site AP-1 a diminué l’activité du
promoteur du facteur tissulaire dans les cellules contrôles et celles stimuler avec l’IS,
suggérant l’importance du facteur de transcription AP-1 dans l’expression basale du facteur
tissulaire, et son implication lors de l’induction du FT par l’S. La mutation du site du facteur
de transcription NF-B a aboli l’activité du promoteur du FT induite par l’IS. En outre,
l’utilisation d’un inhibiteur de la voie NF-B dans les cellules HUVEC stimulées avec l’IS a
inhibé l’expression du facteur tissulaire, ce qui confirme l’implication de la voie NF-B dans
l’expression du FT induit par l’IS. Ces résultats soutiennent que les facteurs de transcription
NF-B et AP-1 sont tous deux nécessaires dans l’induction du facteur tissulaire induit par l’IS.
Des résultats similaires sont observés dans l’étude de l’expression du FT induit par l’IAA.
L’utilisation de l’inhibiteur de p38 et PKC a inhibé l’expression en ARNm et en protéines
du facteur tissulaire induit par l’IS, ceci conforte le rôle de MAPKp38 et PKC dans la
régulation de l’expression du FT induite par l’IS, et suggère une voie similaire à celle décrite
pour l’IAA. Cependant, plus d’investigations sont nécessaires pour confirmer cela.
En conclusion, la voie génomique d’AhR n’est pas impliquée dans la régulation de
l’expression du facteur tissulaire induit par l’IS. Une voie non-génomique d’AhR impliquant
des molécules de signalisation p38MAPK/PKC et les facteurs de transcription NF-B/AP-1
seraient responsable de la régulation du facteur tissulaire induit par l’IS.
93
Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Résultats et discussion
5.3. Étude du lien entre le FT circulant et les taux
sériques d’IAA et d’IS chez les patients HD de
Marseille
94
Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Résultats
Résultats
Les taux de FT circulants sont indépendamment liés au niveau d'IAA mais pas
d’IS chez les patients hémodialysés de Marseille
Les toxines indoliques IAA et l’IS augmentent l’expression du FT dans les cellules
endothéliales et dans les cellules mononuclées sanguines périphériques (PBMC) (Gondouin
et al 2013). L’augmentation de l’expression du FT induit par les toxines indoliques pourrait
expliquer les taux élevés de FT circulant (FTc) observés chez les patients atteints de MRC.
Dans cette étude, nous avons mesuré les taux plasmatiques de FTc d’une cohorte de 92
patients hémodialysés (HD) (Tableau 1). Les valeurs moyennes de FTc étaient de 133 ± 66
pg/mL (médiane 131 pg/mL) et allaient de 36 à 410 pg/mL. En analyse univariée les taux de
FTc étaient négativement corrélés avec la fonction rénale résiduelle (r = -0,27, p <0,01) et
positivement corrélés avec le cholestérol sérique (r = 0,24 p <0,05), le HDL-cholestérol (r =
0,22, p <0,05), et avec les toxines urémiques B2-microglobuline (r = 0,22 p <0,05) et l’IAA (r =
0,32, p <0,01) (Tableau 2). Dans l'analyse de régression linéaire multivariée chez les patients
HD, seule l'IAA sérique (estimation = 3,36, IC 95% [0,41 à 6,3], p <0,05) était
significativement associée au taux de FTc (Tableau 3).
95
Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Résultats
Tableau 1. Caractéristiques de base de la population HD (n=92)
Âge (année) 70 (23 ; 91)
Sexe (F/H) 33/59
Indice de masse corporelle (kg/m2) 24.0 (14.3 ; 47)
Maladie rénale
Glomérulopathie (Diabétique incluse) 20 (22%)
PKD* 7 (7%)
Vasculaire 30 (33%)
Interstitiel 11 (12%)
Autre et héréditaire 2 (2%)
Indéterminé 22 (24%)
Hypertension 82 (91%)
Fonction rénale résiduelle 20 (21%)
Pression artérielle systolique (mmHg) 144± 24
Pression artérielle diastolique (mmHg) 73 ± 15
Fumeurs actuels 27 (29%)
Historique de maladie cardiovasculaire 37 (40%)
Médicaments antihypertenseurs 61 (66 %)
Statines 30 (32%)
Médicaments antiplaquettaires 49 (53%)
Médicaments anticoagulants 23 (25%)
Traitement à l’érythropoïétine 71 (77%)
Hémoglobine (g/dL) 11.6 ± 1.1
FT plasmatique (pg/mL) 131 (36 ; 410)
Taux de CRP sérique (mg/L) 7 (0 ; 78)
Taux d’albumine sérique (g/L) 36.3 ± 4.4
Taux de calcium sérique (mmol/L) 2.34 ± 0.14
Taux de phosphate sérique (mmol/L) 1.53 (0.54 ; 3.17)
Taux d’urée sérique (mmol/L) 19.9 ± 5.4
Taux de créatinine sérique (µmol/L) 759 (213 ; 1533)
Taux de cholestérol sérique (mmol/L) 4.3 ± 1.0
Taux de LDL-cholestérol sérique (mmol/L) 2.45 ± 0.87
Taux de HDL-cholestérol sérique (mmol/L) 1.05 (0.28 ; 2.57)
Taux de triglycérides sérique (mmol/L)) 1.3 (0.6 ; 3.7)
Taux de 2microglobulin sérique (mg/L) 32.2 (17.4 ; 66.9)
Taux de p-crésyl sulfate sérique (µM) 104 (4.3 ; 443.6)
Taux d’indole-3 acétique acide (µM) 4.3 (1.0 ; 19.1)
Taux d’indoxyle sulfate sérique (µM) 88.6 (0.2 ; 256.2)
*PKD: maladie rénale polykystique autosomique dominante
Les résultats sont donnés en moyenne ± SD si la distribution est gaussienne, ou en médiane
(min; max) si non.
96
Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Résultats
Tableau 2. Corrélations de Spearman à Two-tailed des caractéristiques de base avec les
taux plasmatiques de FT dans la cohorte HD (n=92)
FT
r p
Âge (année) 0.08 0.4
Sexe (F/H) -0.19 0.08
Indice de masse corporelle 0.00 1
Maladie rénale -0.18 0.08
Fonction rénale résiduelle -0.27 <0.01
Pression artérielle systolique -0.01 0.9
Pression artérielle diastolique -0.08 0.4
Fumeurs actuels -0.05 0.6
Historique de maladie cardiovasculaire -0.05 0.6
Médicaments antihypertenseurs -0.08 0.5
Statines -0.18 0.4
Médicaments antiplaquettaires -0.18 0.08
Médicaments anticoagulants 0.12 0.3
Traitement à l’érythropoïétine -0.11 0.3
Hémoglobine 0.17 0.1
Taux de CRP sérique (mg/L) 0.12 0.3
Taux d’albumine sérique (g/L) -0.08 0.4
Taux de calcium sérique (mmol/L) -0.07 0.5
Taux de phosphate sérique (mmol/L) -0.15 0.2
Taux d’urée sérique (mmol/L) -0.05 0.6
Taux de créatinine sérique (µmol/L) 0.03 0.7
Taux de cholestérol sérique (mmol/L) 0.24 <0.05
Taux de LDL-cholestérol sérique (mmol/L) 0.18 0.09
Taux de HDL-cholestérol sérique (mmol/L) 0.22 <0.05
Taux de triglycérides sérique (mmol/L)) 0.04 0.7
Taux de 2microglobulin sérique (mg/L) 0.22 <0.05
Taux de p-crésyl sulfate sérique (µM) 0.07 0.5
Taux d’indole-3 acétique acide (µM) 0.32 <0.01
Taux d’indoxyle sulfate sérique (µM) -0.1 0.3
97
Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Résultats
Tableau 3. Analyse de régression linéaire multivariée pour évaluer la relation entre les
variables indépendantes et les taux plasmatiques de FT chez les patients HD (n=92)
FT
Estimation 95% CI p
Âge 0.18 [-0.75 to 1.12] 0.7
Sexe 21.66 [-7.36 to 50.69] 0.14
Fonction rénale résiduelle -23.81 [-55.45 to 7.83] 0.14
Taux d’indole-3acetic acide sérique 3.54 [0.66 to 6.43] <0.05
Taux de 2microglobuline sérique 1.1 [-0.4 to 2.61] 0.15
Taux de cholestérol sérique 11.21 [-3.13 to 25.55] 0.12
Taux de HDL-cholestérol sérique 3.35 [−30.86 to 37.56] 0.8
98
Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Discussion
Discussion
Dans cette étude, nous avons montré que l’IAA était indépendamment lié au FT circulant
chez les patients HD de Marseille. L’augmentation de l’expression du FT induite par l'IAA et
l’IS a des conséquences fonctionnelles sur le risque thrombotique. En effet, l'augmentation
de l'abondance des protéines du FT induite par l'IAA et l’IS, est associée à une activité
procoagulante accrue dans les cellules endothéliales, dans les cellules musculaires lisses
vasculaires (Gondouin et al 2013), et augmente la thrombogénicité dans un modèle ex-vivo
(Chitalia et al. 2013). Il est montré qu’un anticorps contre le FT endothélial empêche le
dépôt plaquettaire sur les cellules endothéliales en culture induit par le sérum urémique
(Serradell et al. 2001), suggérant que la présence du FT endothélial est responsable du dépôt
plaquettaire. Les patients atteints de MRC présentent des taux élevés de FTc et une activité
procoagulante FT-dépendante accrue (Gondouin et al. 2013; Shivanna et al. 2016). Les taux
de FTc chez les patients atteints de MRC sont liés à certaines toxines urémiques qui sont des
agonistes de l'AhR. Les niveaux de kynurénine sont associés aux taux de FTc et à
l'hypercoagulabilité chez les patients HD (Pawlak et al. 2009). Les taux de FTc sont corrélés
avec l'indoxyl sulfate chez les patients atteints MRC non dialysés (Gondouin et al. 2013).
Nous avons montré que le niveau de FTc était positivement corrélé avec le cholestérol
sérique, le HDL-cholestérol, et avec les toxines urémiques B2-microglobuline et l’IAA dans
l'analyse univariée. Cependant, nous n'avons pas trouvé de corrélation positive entre le FTc
et l’indoxyl sulfate chez les patients HD, comme il a été précédemment observé chez les
patients MRC non dialysés (Goundouin et al. 2013). Dans l'analyse de régression linéaire
multivariée, seule l'IAA sérique était significativement et indépendamment associée au taux
de FTc. Notre équipe a déjà identifié l’IAA comme un prédicteur indépendant des
événements cardiovasculaires et de la mortalité chez les patients atteints de MRC (Dou et al.
99
Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Discussion
2015). La régulation positive du FT fait partie des mécanismes par lesquels l'IAA peut induire
une athérothrombose chez les patients MRC. De plus, le FTc était négativement corrélé avec
la fonction rénale résiduelle (en analyse simple) chez les patients HD dans la présente étude,
et avec le DFG estimé chez les patients MRC non dialysés dans une étude précédente
(Gondouin et al. 2013). Ceci suggère que la préservation de la fonction rénale chez les
patients HD pourrait être avantageuse pour prévenir l'augmentation des taux de FTc et
limiter le risque thrombotique.
La stratégie de cibler spécifiquement la voie thrombotique/inflammatoire non
génomique de l'activation de l'AhR pourrait être déterminante pour le contrôle des taux de
FTc chez les patients MRC.
100
Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Résultats et Discussion
5.4. Étude comparative entre deux cohortes de
patients HD (Oran vs Marseille)
101
Étude comparative entre une cohorte de patient HD d’Oran vs Marseille Résultats
Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Résultats
Résultats
5.4.1. Comparaison de la cohorte de patients HD d’Oran et des patients HD
de Marseille
Nous avons commencé à comparer les caractéristiques des deux cohortes de patients HD
« Oran vs Marseille » (Tableau 1). Dans la cohorte de patients HD d’Oran nous avons moins
d’hypertendus, moins de fumeurs actifs et moins de patients avec une néphropathie
d’origine glomérulaire et interstitielle. Les patients HD d’Oran avaient plus de créatinine que
les patients HD de Marseille (médiane µmol/l; 852 vs 753 ; P<0.05), de potassium
(médiane mmol/l; 5.54 vs 4.92 ; P<0.001) et moins de HDL cholestérol (médiane mmol/l;
0.74 vs 1.15 ; P<0.0001), de calcium (médiane mmol/l; 2.06 vs 2.32 ; P<0.0001) , de
bicarbonate (moyenne mmol/l; 16.47 vs 20.79 ; P<0.0001), d’hémoglobine (médiane g/dl;
9.6 vs 10.6 ; P<0.0001) et de CRP (médiane mg/l; 1.5 vs 5 ; P<0.0001). L’albuminémie est
aussi plus basse dans la cohorte algérienne.
102
Étude comparative entre deux cohortes de patients HD (Oran vs Marseille)
Résultats
Tableau 1.
Caractéristiques des patients
Patients HD Oran
(n=103)
Patients HD Marseille
(n=133)
P
Âge (année) 56 (18 ; 89) 60 (18 ; 89) 0.208
Sex-ratio (F/H) 45/58 52/81 0.506
Indice de masse corporelle (kg/m2) 23.0 (14.0 ; 40.0) 24.6 (16.4 ; 46,6) <0.01
Initiation de la dialyse (Mois) 48 (0.9 ; 276) 34 (0.3 ; 437) 0.41
Hypertension 74 (72 %) 124 (93 %) <0.0001
Diabète 31 (30 %) 51 (38 %) 0.2
Tabagisme 8 % 23 % <0.01
Origine de la néphropathie
Glomérulaire 7.8 % (8) 19.5 % (26) <0.05
Diabétique 21.4 % (22) 24.0 % (32) 0.6
Interstitielle 7.8 % (8) 18.0 % (24) <0.05
Indéterminé 26.2 % (27) 16.5 % (22) 0.07
Polykystose 15.5 % (16) 6.0 % (8) <0.05
Vasculaire 15.5 % (16) 12.0 % (16) 0.4
Héréditaire 1.9 % (2) 0.75 % (1) 1
Autre 3.88 % (4) 3.0 % (4) 0.6
Urée sérique (mmol/L) 22.9 ± 7.3 22.1 ± 6.7 0.41
Créatinine sérique (µmol/L) 852 (176 ; 1848) 753 (179 ; 1777) <0.05
Albumine sérique (g/L) 37.1 (18.8 ; 43.6) 38.7 (14.3 ; 52.1) <0.05
Cholestérol sérique (mmol/L) 3.96 (1.80 ; 6.72) 4.11 (1.33 ; 8.47) 0.54
HDL-cholestérol sérique (mmol/L) 0.74 (0.36 ; 1.62) 1.15 (0.57 ; 2.77) <0.0001
LDL-cholestérol sérique (mmol/L) 1.99 (1.04 ; 4.02) 1.95 (0.46 ; 5.04) 0.98
Triglycérides sérique (mmol/L) 1.61 (0.44 ; 5.14) 1.42 (0 ; 7.11) 0.12
Calcium sérique (mmol/L) 2.06 (1.04 ; 3.19) 2.32 (1.68 ; 3.09) <0.0001
Phosphate sérique (mmol/L) 1.63 (0.87 ; 2.85) 1.60 (0.38 ; 4.03) 0.79
Potassium sérique (mmol/L) 5.54 (4.31 ; 8.31) 4.92 (3.27 ; 7.26) <0.0001
Bicarbonates sériques (mmol/L) 16.47 ± 2.22 20.79 ± 2.35 <0.0001
Hémoglobine (g/dL) 9.6 (6.0 ; 15.7) 10.6 (7.0 ; 13.4) <0.0001
CRP sérique (mg/L) 1.5 (0.3 ; 46.7) 4.9 (0 ; 94.1) <0.0001
103
Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Résultats
5.4.2. Les taux d’IS sont significativement plus élevés chez les HD d’Oran
Nous avons comparé les taux de toxines urémiques dérivées du tryptophane, l’IAA et l’IS, et
celles dérivées de la tyrosine/phénylalanine, le PCs. Nous avons constaté que les taux d’IS
étaient significativement plus élevés chez les patients HD d’Oran avec une médiane de
123µM versus 86 µM (P<0.0001) chez les patients HD de Marseille (Tableau 2).
5.4.3. Le taux de mortalité et des événements cardiovasculaires ne sont pas
différents entre la cohorte de patients HD d’Oran et celle de Marseille
après un suivi d’un an
L’accumulation d’IS chez les patients MRC est associée à une augmentation des risques de
complications cardiovasculaires et de mortalité. Ainsi, des taux plus élevés d’IS chez les
patients HD d’Oran, pouvaient faire craindre une augmentation de la mortalité et des
événements cardiovasculaires. Les taux des événements cardiovasculaires et de mortalité
n’étaient pas plus fréquents chez les patients HD d’Oran par rapport aux patients HD de
Marseille sur un suivi d’un an (Tableau 3).
*TVP/EP ; Thrombose veineuse profonde / Embolie pulmonaire
Tableau 2.
Taux des toxines urémiques
Patients HD Oran
(n=103)
Patients HD Marseille
(n=133)
P
Indole-3 acétique acide (µM) 3.6 (0 ; 13.1) 3.3 (0.7 ; 33.5) 0.12
Indoxyl sulfate (µM) 123 (10 ; 308) 86 (0 ; 240) <0.0001
P-crésyl sulfate (µM) 155 (0 ; 613) 145 (0 ; 391) 0.82
Tableau 3.
Suivi à 1 an
Patients HD Oran
(n=103)
Patients HD Marseille
(n=133)
P
Taux de mortalité 12.6 % (13/103) 9.7 % (13/133) 0.5
Évènement cardiovasculaire 10.6 % (11/103) 11.2 % (15/133) 1
Evènement thrombotique TVP/EP* 1.9 % (2/103) 2.2 % (3/133) 1
104
Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Discussion
Discussion
Nous avons montré que les taux d’IS, mais pas d’IAA et du PCs, étaient plus élevés chez
les patients HD d’Oran en comparaison avec les patients HD de Marseille. Après un an de
suivi, il n’y a pas de différences significatives des taux des événements cardiovasculaires et
de mortalité entre les deux populations.
L’indoxyl sulfate est issue de la métabolisation du tryptophane alimentaire. Ainsi, un
apport alimentaire plus important et notamment plus riche en protéines pourrait expliquer
les différences des taux d’IS observées chez les HD d’Oran. Il a été montré qu’une
consommation plus importante en protéine augmente les taux plasmatiques d’IS chez les
patients MRC (Marzocco et al. 2013). Inversement, l’apport en fibre diminue les taux
circulants d’IS et de pCS chez les patients hémodialysés (Sirich et al. 2014). Dans une autre
étude, il a été montré que les végétariens ont une production d’IS diminué, en consommant
25% moins de protéine et 69% de fibre de plus par rapport aux personnes ayant une
alimentation non limitée en substance carnée (Patel et al. 2012). Ainsi, les différences des
taux sériques d’IS pourraient être expliquées par des habitudes alimentaires différentes
notamment en termes d’apport protéique entre les deux populations. Ceci est conforté par
des taux significativement plus importants de créatinine dans la population oranaise. La
créatinine est un produit de dégradation du phosphate de créatine dans le muscle. Ce
dernier est synthétisé de manière endogène dans l’organisme et également apporté par
l’alimentation (Patel et al. 2013). Il a été montré qu’un apport alimentaire plus important et
notamment plus riche en protéine augmente les taux sériques de créatinine (Delanghe et al.
1989; Kalantar-Zadeh et al. 2004; Shinaberger et al. 2006; Preiss et al. 2007; Dragsted 2010).
Ainsi, les taux plus élevés de créatinine observés chez les HD d’Oran suggèrent un apport
alimentaire plus conséquent et plus riche en protéine chez ces patients. De même, les taux
105
Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Discussion
de bicarbonate plus bas dans la cohorte oranaise peuvent refléter un apport protéique plus
important. En effet, Il est montré qu’un régime alimentaire riche en protéines diminue le
taux de bicarbonate sanguin chez les sujets atteints de MRC (Trilok and Draper 1989; Mitch
2002; Gennari et al. 2006; Di Iorio et al. 2017).
La consommation accrue de protéines alimentaire est également liée à la production
d'urée (Young et al. 2000). Dans notre étude, nous n’avons pas trouvé de différence des taux
d’urée entre les deux populations. De plus, l’albumine qui est un marqueur de l’état
nutritionnel (Gama-Axelsson et al. 2012; Ikizler 2014), semble plus élevée chez la population
HD de Marseille, reflétant ainsi un meilleur état nutritionnel dans cette population. L'apport
en protéines alimentaire est un des facteurs importants dans la détermination de l'albumine
sérique (Kaysen et al. 1989; Thalacker-Mercer and Campbell 2008; Sarwar and Sherman
2016). La différence observée entre les albuminémies bien que statistiquement significatives
n’est pas cliniquement pertinente. L’albuminémie étant dans les deux cohortes normales.
En raison de leurs géolocalisations, les deux populations analysées dans cette étude
devraient partager un régime méditerranéen, caractérisé par une consommation modérée
de protéines animale et une consommation élevée de fruit, de légume, de pain, de haricot,
de noix, de graines et d’autres céréales (Noah and Truswell 2001; Garcia-Closas et al. 2006;
Simopoulos and Visioli 2007). Cependant, le régime méditerranéen varie avec un ratio
d’apports alimentaires différent d’un pays à l’autre, en fonction de la situation socio-
économique, culturelle et traditionnelle entre les différents pays de la méditerranée (Noah
and Truswell 2001; Garcia-Closas et al. 2006; Simopoulos and Visioli 2007; Vernaglione
2009). De plus, dans plusieurs pays méditerranéens, dont l’Algérie et la France, les habitudes
alimentaires ont évolué, s'éloignant du régime méditerranéen pour aller vers une nourriture
plus riche en graisses animales et en sucre.
106
Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Discussion
Dans cette étude, nous pensons que les différences des taux d’IS observé entre les
patients HD oranais et marseillais pourraient être dues à un régime alimentaire différent,
notamment en apport protéique. Afin de valider notre hypothèse, il est nécessaire de
réaliser une enquête alimentaire dans les deux cohortes de patients HD.
La flore digestive joue un rôle crucial dans le processus de la métabolisation du
tryptophane et l’absorption des indoles (Mishima et al. 2017; Agus et al. 2018). Il est montré
qu’une altération de la flore intestinale peut influencer les taux sériques des indoles (Holler
et al. 2014; Nazzal et al. 2017). Plusieurs facteurs peuvent contribuer à la diversité de la flore
intestinale (microbiote) le sexe, l’âge, le mode de vie, l’hygiène, l’environnement et surtout
l’alimentation (Lepage et al. 2008 ; Annalisa et al. 2014 ; Xie et al. 2016 ; Smits et al. 2017 ;
McDonald et al. 2018 ; Zhao et al. 2018). Les habitudes alimentaires influent sur la formation
de la composition du microbiote intestinal, et déterminent également le répertoire des
métabolites microbiens produits (Geypens et al. 1997; Filippis et al. 2015; Riaz Rajoka et al.
2017). De plus, l’apport en pré/probiotiques peut modifier la flore digestive et par
conséquent les concentrations d’IS (Takayama et al. 2003). Ainsi, une diversité du microbiote
intestinal soutenu par un écosystème différent entre les deux populations pourrait
également expliquer la variabilité des taux sériques d’IS.
Les toxines indoliques s’accumulent chez les patients atteints de MRC et sont mal
épurées par la dialyse (Neirynck et al. 2013a), car 80% des indoles sont liés aux protéines (De
Smet et al. 2007). Seule la fraction non liée des toxines indoliques peut être éliminée par HD
ou par filtration. La clairance des toxines indoliques liées aux protéines est difficile par HD en
raison de leurs fortes capacités de liaison à l'albumine (Watanabe et al. 2011; Davenport
2014). À l’heure actuelle, aucune technique de dialyse n’a pu montrer une amélioration en
termes d’épuration des toxines indoliques (Krieter et al. 2010; Neirynck et al. 2013a;
107
Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Discussion
Yamamoto et al. 2018). Les méthodes de dialyse utilisées dans les deux centres sont des
méthodes conventionnelles avec des membranes de dialyse classiques. Nous pouvons
exclure l’implication de différence de méthode de dialyse entre les centres de recrutements
pour expliquer la différence des taux d’IS observée entre les deux populations d’HD.
La protéine C réactive (CRP), impliquée dans les réactions inflammatoires et qui sert de
marqueurs biologiques à celle-ci (Ballantyne and Nambi 2005), est significativement plus
élevée chez les patients HD de Marseille. Ceci suggère un état inflammatoire plus important
dans la cohorte marseillaise. Cette variabilité entre les deux cohortes pourrait également
être due à la différence ethnique. En effet, dans une étude il a été montré que le taux de CRP
pouvait varier selon l’origine ethnique (Kelley-Hedgepeth et al. 2008). L’effet anti-
inflammatoire d’un régime alimentaire plus riche en légumes et végétaux pourrait
également être impliqué dans la variation des taux sériques de CRP (Krajcovicova-
Kudlackova and Blazicek 2005; Jaceldo-Siegl et al. 2018).
L’augmentation de l’IS chez les patients MRC est associée à un risque de complications
cardiovasculaires et une mortalité élevée (Gao and Liu 2017). Nous avons constaté des taux
plus élevés d’IS chez les patients HD d’Oran sans impact sur le risque cardiovasculaire ou de
décès. Un suivi plus long pourrait permettre d’observer une éventuelle différence entre les
deux populations. Les différences des taux d’IS observé entre la population HD d’Oran et
celle de Marseille, ne sont peut être pas suffisamment importantes pour observer des
différences. Enfin, il est possible que le taux d’IS reflétant un apport protéique plus
important ce dernier qui est recommandé en HD par tous les guidelines permettent de
dégager un bénéfice pour les patients d’Oran sans impact délétère sur un suivi court.
En conclusion, les taux d’IS, mais pas d’IAA, sont significativement plus importants dans la
population HD d’Oran. Les différences culturelles, sociales, environnementales et
108
Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Discussion
nutritionnelles pourraient jouer un rôle clé pour expliquer cette différence. La détermination
des taux sériques de toxines urémiques indoliques dans une population algérienne
représente le premier travail de ce type réalisé dans un pays du Sud.
109
Conclusion et perspectives
6. Conclusion et perspectives
L’accumulation des toxines urémiques indoliques IAA et IS jouent un rôle important dans
les survenues des accidents thrombotiques chez les patients avec une maladie rénale
chronique. Ces toxines augmentent l’expression du facteur tissulaire, et par ce biais joue
probablement un rôle majeur dans l’augmentation du risque thrombotique. Les patients
atteints d'insuffisance rénale chronique présentent des taux élevés de FT circulant. Nous
avons constaté que la concentration plasmatique en IAA était indépendamment liée aux
taux circulants de FT chez les hémodialysées de Marseille. AHR est l’élément clé de la
mécanique cellulaire contrôlant l'expression du FT induite par l'IAA et l'IS. Dans cette thèse,
nous avons montré que l’expression du facteur tissulaire induite par IAA et IS, dans les
cellules endothéliales, est médié par la voie non-génomique d’AhR. L’IAA induit l’expression
du facteur tissulaire via la voie inflammatoire AhR/p38 MAPK/NF-B. L’IS induit l’expression
du facteur tissulaire en impliquant des voies de signalisation et des facteurs de transcription
qui semblent similaires à ceux activés par l’IAA. Chez les patients atteints de MRC, nous
avons montré un niveau élevé d'agonistes plasmatiques d’AhR et une activation de la voie
AhR dans les cellules de ces patients (Dou et al. 2018). L’AhR est une cible thérapeutique
pour réduire les taux de FT et ainsi limiter le risque thrombotique chez les patients atteints
de maladie rénale chronique (Shivanna et al. 2016; Mackman and Erlich 2018). Inhiber AhR
entraînerait une inhibition de la voie génomique d’AhR qui est cruciale dans les processus de
détoxification, et une dérégulation de la physiologie cellulaire. Par conséquent, cibler
spécifiquement la voie non génomique pro- thrombotique/inflammatoire d'AhR, tout en
préservant la voie génomique de l'AhR est une stratégie séduisante. Notre travail permet
d’identifier de nouvelles pistes dans le contrôle de l’activation de la voie non génomique
d’AHR comme le contrôle de l’activation de NF-B ou d’AP1.
110
Conclusion et perspectives
Approches alternatives
À côté du développement de molécules ciblant les voies de signalisation contrôlées par AhR,
d’autres possibilités existent que nos travaux permettent d’entrevoir ;
➢ Un régime alimentaire adapté aux patients MRC
La diététique fait partie intégrante de la prise en charge des patients souffrant de maladie
rénale chronique. Des modifications de la quantité et de la qualité alimentaire peuvent être
nécessaires afin de réduire l’accumulation des toxiques responsables du processus
pathologique. Effectivement, plusieurs études ont montré qu’un régime alimentaire riche en
protéines augmente les taux plasmatiques d’IS et d’IAA (Marzocco et al. 2013; Poesen et al.
2015). De plus, l’apport en fibres a été montré comme pouvant diminuer les taux circulants
de certains indoles chez les patients hémodialysés (Sirich et al. 2014). Nous avons constaté
que les taux d’IS été significativement plus élevés chez la population HD d’Oran par rapport à
la population HD de Marseille. Nous pensons qu’un régime alimentaire différent et
notamment plus riche en protéines chez les patients HD d’Oran pourrait expliquer les taux
plus élevés d’IS chez cette population. Ainsi, un régime alimentaire limité en protéines en
particulier animal et riche en fibres pourrait être une des alternatives pour diminuer les taux
d’indoles chez les MRC. Le régime méditerranéen doit être conseillé aux patients
(Montemurno et al. 2014, chauveaundt 2018). Le régime méditerranéen diminue les
facteurs de risque cardiovasculaire comme ; la dyslipidémie, l’inflammation et le stress
oxydant (Mekki et al. 2010; Huang et al. 2013; Chauveau et al. 2018).
➢ Contrôles de l’accumulation des indoles à travers le microbiote intestinal
L'utilisation des pré biotiques, glucides non digestibles (fibres) qui stimulent les bactéries
intestinales et des pro biotiques, compléments de bactéries bénéfiques vivantes, est de plus
en plus populaire (Neu 2014). En néphrologie, l'augmentation de la production intestinale
111
Conclusion et perspectives
des indoles est associée à la perturbation du microbiote chez les patients MRC (Vaziri et al.
2013), suggèrent qu’un traitement en pré et pro biotique dans le but de rétablir
l’homéostasie de la flore pourrait être bénéfique chez les patients. Il a été montré que
l’intervention par des probiotiques « lactobacilles ou bifidobactéries» chez des patients HD,
diminué de 30% l’IS sérique, associée avec une diminution des entérobactéries fécales (E.
coli), qui possède l’une des activités enzymatiques les plus élevées observées pour la
production de toxine indolique (Hida et al. 1996; Takayama et al. 2003). De plus, une
intervention prébiotique chez des individus en bonne santé a montré une réduction
significative du PC (65%) et de l’indole (25%) ainsi qu’une augmentation des bifidobactéries
et des lactobacilles, responsables de la suppression de PCS et de l’IS, et une diminution des
Bacteroidaceae (Ito et al. 1993) productrices de PCS. Dans une autre étude, il est montré que
le pré-biotique, galacto-oligosaccharides, abaisse les niveaux sériques d’IS dans un modèle
animal d’IRC (Furuse et al. 2014). Sirich et al ont également montré que les prébiotiques
diminuer les taux d’IS chez des patients HD (Sirich et al. 2014). Il a été suggéré que la
thérapie symbiotique (co-administration de pré- et pro biotiques) pouvait être prometteuse
afin de réduire les concentrations sériques de certaines toxines indoliques (Rossi et al. 2014).
Il reste à confirmer par des études randomisées en doubles aveugles que ces approches sont
utiles en clinique humaine.
La manipulation des gènes bactériens est une approche possible pour réduire la capacité
des bactéries à synthétiser des précurseurs de toxines urémiques. Dans le cas des toxines
indoliques. Les tryptophanases bactériennes sont responsables de la conversion du
tryptophane en indole, aboutissant à la production d’IAA dans l’intestin, et à l’IS après
absorption et métabolisation de l’indole dans le foie. Devlin S et al ont identifié la famille des
Bacteroides comme les bactéries possèdent les tryptophanases les plus abondantes dans le
112
Conclusion et perspectives
microbiote humaine (Devlin et al. 2016). Une mutation du gène de la tryptophanase réduit la
synthèse de l’indole in vitro. Dans les modèles animaux, en modifiant l'expression génique
de la tryptophanase des bactéries colonisées dans des souris, ou en réduisant l'abondance
des Bacteroides par des antibiotiques, ils ont pu réduire la production d’IS (Devlin et al.
2016). Ainsi, la manipulation des gènes bactériens pourrait être une clé pour contrôler
l’accumulation des toxines indoliques chez les patients MRC.
➢ Réduction de l’accumulation des toxines indoliques par la thérapie orale
AST 120 : L’AST-120 est un adsorbant intestinal oral microsphérique de carbone à haute
porosité (Schulman et al. 2014). L'administration orale de l’AST 120 peut inhiber l'absorption
gastro-intestinale des précurseurs des toxines urémiques liées aux protéines, dont les
indoles, en adsorbant et en améliorant leur excrétion dans les fèces (Yamaguchi et al. 2017),
diminuant ainsi les taux sériques d’IS (Niwa et al. 1991; Niwa et al. 1997; Schulman et al.
2006; Yamamoto et al. 2015) chez les patients MRC HD ou non, mais pas d’IAA chez les
patients HD (Yamamoto et al. 2015). L’AST-120 est utilisé dans des pays comme le Japon
(depuis 1991), la Corée (depuis 2005) et les Philippines (depuis 2010), principalement pour
réduire les symptômes urémiques et pour la prévention de la progression des maladies
rénales chroniques (Schulman et al. 2014). Cependant, étant un adsorbant oral, il a le
potentiel de se lier à d’autres nutriments bénéfiques avec les toxines urémiques. Il est
associé à la survenue de troubles gastro-intestinaux (Yamaguchi et al. 2017).
Les polyphénols phytochimiques : telle que la quercétine et le resvératrol, réduisent
également la synthèse d’IS chez le rat, par l'inhibition de la sulfotransférase (SULT), une
enzyme impliquée dans la synthèse de l'IS dans le foie (Kusumoto et al. 2011). Cependant,
plus d’investigations sont nécessaires pour évaluer les effets secondaires et valider cette
approche chez les patients MRC.
113
Conclusion et perspectives
La compréhension des voies de signalisation mise en action par les solutés indoliques doit
nous permettre de proposer de nouvelles pistes thérapeutiques. La modulation de
l’activation d’AHR parait être une piste engageante. Nos travaux apportent une nouvelle
compréhension aux mécanismes en œuvre. La distinction entre une voie génomique plutôt
bénéfique par ses capacités de détoxification des xénobiotiques et d’une voie pro
inflammatoire non génomique trace un modèle qui permet de proposer de nouvelles
stratégies d’intervention.
114
Références bibliographiques
Références bibliographiques
Abramowitz MK (2017) Bicarbonate Balance and Prescription in ESRD. J Am Soc Nephrol 28:726–734.
doi: 10.1681/ASN.2016070780
Adelibieke Y, Yisireyili M, Ng H-Y, et al (2014) Indoxyl Sulfate Induces IL-6 Expression in Vascular
Endothelial and Smooth Muscle Cells through OAT3-Mediated Uptake and Activation of AhR/NF-κB
Pathway. NEE 128:1–8. doi: 10.1159/000365217
Agus A, Planchais J, Sokol H (2018) Gut Microbiota Regulation of Tryptophan Metabolism in Health
and Disease. Cell Host Microbe 23:716–724. doi: 10.1016/j.chom.2018.05.003
Ahern SM, Miyata T, Sadler JE (1993) Regulation of human tissue factor expression by mRNA
turnover. J Biol Chem 268:2154–2159
Annalisa N, Alessio T, Claudette TD, et al (2014) Gut Microbioma Population: An Indicator Really
Sensible to Any Change in Age, Diet, Metabolic Syndrome, and Life-Style. Mediators Inflamm 2014:.
doi: 10.1155/2014/901308
Ansari MA, Maayah ZH, Bakheet SA, et al (2013) The role of aryl hydrocarbon receptor signaling
pathway in cardiotoxicity of acute lead intoxication in vivo and in vitro rat model. Toxicology 306:40–
49. doi: 10.1016/j.tox.2013.01.024
Aparicio M, Chauveau P, Combe C (2001) Low protein diets and outcome of renal patients. J Nephrol
doi 14:433–439
Armstead VE, Opentanova IL, Minchenko AG, Lefer AM (1999) Tissue factor expression in vital organs
during murine traumatic shock: role of transcription factors AP-1 and NF-kappaB. Anesthesiology
91:1844–1852. doi: 10.1097/00000542-199912000-00039
Aronov PA, Luo FJ-G, Plummer NS, et al (2011) Colonic contribution to uremic solutes. J Am Soc
Nephrol 22:1769–1776. doi: 10.1681/ASN.2010121220
Ballantyne CM, Nambi V (2005) Markers of inflammation and their clinical significance. Atheroscler
Suppl 6:21–29. doi: 10.1016/j.atherosclerosissup.2005.02.005
Barreto FC, Barreto DV, Liabeuf S, et al (2009) Serum Indoxyl Sulfate Is Associated with Vascular
Disease and Mortality in Chronic Kidney Disease Patients. CJASN 4:1551–1558. doi:
10.2215/CJN.03980609
Bode M, Mackman N (2014) Regulation of tissue factor gene expression in monocytes and
endothelial cells: Thromboxane A2 as a new player. Vascul Pharmacol 62:57–62. doi:
10.1016/j.vph.2014.05.005
Borlak J, Jenke HS (2008) Cross-talk between aryl hydrocarbon receptor and mitogen-activated
protein kinase signaling pathway in liver cancer through c-raf transcriptional regulation. Mol Cancer
Res 6:1326–1336. doi: 10.1158/1541-7786.MCR-08-0042
115
Références bibliographiques
Bover J, Cozzolino M (2011) Mineral and bone disorders in chronic kidney disease and end-stage
renal disease patients: new insights into vitamin D receptor activation. Kidney International
Supplements 1:122–129. doi: 10.1038/kisup.2011.28
Brand K, Fowler BJ, Edgington TS, Mackman N (1991) Tissue factor mRNA in THP-1 monocytic cells is
regulated at both transcriptional and posttranscriptional levels in response to lipopolysaccharide.
Mol Cell Biol 11:4732–4738
Bueno AL, Czepielewski MA (2008) The importance for growth of dietary intake of calcium and
vitamin D. J Pediatr (Rio J) 84:386–394. doi: doi:10.2223/JPED.1816
Calaf R, Cerini C, Génovésio C, et al (2011) Determination of uremic solutes in biological fluids of
chronic kidney disease patients by HPLC assay. J Chromatogr B Analyt Technol Biomed Life Sci
879:2281–2286. doi: 10.1016/j.jchromb.2011.06.014
Carney EF (2016) Thrombosis: New mechanism of thrombus formation in CKD. In: Nature Reviews
Nephrology. https://www-nature-com.gate2.inist.fr/articles/nrneph.2016.155. Accessed 28 Nov
2017
Casserly LF, Dember LM (2003) Thrombosis in end-stage renal disease. Semin Dial doi: 16:245–256
Chauveau P, Aparicio M, Bellizzi V, et al (2018) Mediterranean diet as the diet of choice for patients
with chronic kidney disease. Nephrol Dial Transplant 33:725–735. doi: 10.1093/ndt/gfx085
Chevallier A, Bui L-C, Coumoul X (2011) Le récepteur de la dioxine : rôle endogène et médiateur de la
toxicité de la dioxine. Cahiers de Nutrition et de Diététique 46:67–74. doi: 10.1016/j.cnd.2011.01.002
Chitalia VC, Shivanna S, Martorell J, et al (2013) Uremic serum and solutes increase post-vascular
interventional thrombotic risk through altered stability of smooth muscle cell tissue factor.
Circulation 127:365–376. doi: 10.1161/CIRCULATIONAHA.112.118174
Cibulka R, Racek J (2007) Metabolic disorders in patients with chronic kidney failure. Physiol Res doi:
56:697–705
Crossman DC, Carr DP, Tuddenham EG, et al (1990) The regulation of tissue factor mRNA in human
endothelial cells in response to endotoxin or phorbol ester. J Biol Chem 265:9782–9787
Cui MZ, Parry GC, Oeth P, et al (1996) Transcriptional regulation of the tissue factor gene in human
epithelial cells is mediated by Sp1 and EGR-1. J Biol Chem 271:2731–2739
Daneschvar HL, Seddighzadeh A, Piazza G, Goldhaber SZ (2008) Deep vein thrombosis in patients with
chronic kidney disease. Thromb Haemost 99:1035–1039. doi: 10.1160/TH08-02-0107
Davenport A (2014) How can dialyzer designs improve solute clearances for hemodialysis patients?
Hemodial Int 18 Suppl 1:S43-47. doi: 10.1111/hdi.12223
De Smet R, Dhondt A, Eloot S, et al (2007) Effect of the super-flux cellulose triacetate dialyser
membrane on the removal of non-protein-bound and protein-bound uraemic solutes. Nephrol Dial
Transplant 22:2006–2012. doi: 10.1093/ndt/gfm065
116
Références bibliographiques
Delanghe J, De Slypere JP, De Buyzere M, et al (1989) Normal reference values for creatine,
creatinine, and carnitine are lower in vegetarians. Clin Chem 35:1802–1803
Denison MS, Soshilov AA, He G, et al (2011) Exactly the same but different: promiscuity and diversity
in the molecular mechanisms of action of the aryl hydrocarbon (dioxin) receptor. Toxicol Sci 124:1–
22. doi: 10.1093/toxsci/kfr218
Devlin AS, Marcobal A, Dodd D, et al (2016) Modulation of a Circulating Uremic Solute via Rational
Genetic Manipulation of the Gut Microbiota. Cell Host Microbe 20:709–715. doi:
10.1016/j.chom.2016.10.021
Di Angelantonio E, Danesh J, Eiriksdottir G, Gudnason V (2007) Renal function and risk of coronary
heart disease in general populations: new prospective study and systematic review. PLoS Med
4:e270. doi: 10.1371/journal.pmed.0040270
Di Iorio BR, Di Micco L, Marzocco S, et al (2017) Very Low-Protein Diet (VLPD) Reduces Metabolic
Acidosis in Subjects with Chronic Kidney Disease: The “Nutritional Light Signal” of the Renal Acid
Load. Nutrients 9:. doi: 10.3390/nu9010069
Di Meglio P, Duarte JH, Ahlfors H, et al (2014) Activation of the aryl hydrocarbon receptor dampens
the severity of inflammatory skin conditions. Immunity 40:989–1001. doi:
10.1016/j.immuni.2014.04.019
Dolecek TA, Olson MB, Caggiula AW, et al (1995) Registered dietitian time requirements in the
Modification of Diet in Renal Disease Study. J Am Diet Assoc 95:1307–1312
Dolwick KM, Swanson HI, Bradfield CA (1993) In vitro analysis of Ah receptor domains involved in
ligand-activated DNA recognition. Proc Natl Acad Sci USA 90:8566–8570
Dou L, Jourde-Chiche N, Faure V, et al (2007) The uremic solute indoxyl sulfate induces oxidative
stress in endothelial cells. J Thromb Haemost 5:1302–1308. doi: 10.1111/j.1538-7836.2007.02540.x
Dou L, Poitevin S, Sallée M, et al (2018) Aryl hydrocarbon receptor is activated in patients and mice
with chronic kidney disease. Kidney Int. doi: 10.1016/j.kint.2017.11.010
Dou L, Sallée M, Cerini C, et al (2015) The cardiovascular effect of the uremic solute indole-3 acetic
acid. J Am Soc Nephrol 26:876–887. doi: 10.1681/ASN.2013121283
Dragsted LO (2010) Biomarkers of meat intake and the application of nutrigenomics. Meat Sci
84:301–307. doi: 10.1016/j.meatsci.2009.08.028
Drake TA, Morrissey JH, Edgington TS (1989) Selective cellular expression of tissue factor in human
tissues. Implications for disorders of hemostasis and thrombosis. Am J Pathol 134:1087–1097
Fernandez-Prado R, Esteras R, Perez-Gomez MV, et al (2017) Nutrients Turned into Toxins:
Microbiota Modulation of Nutrient Properties in Chronic Kidney Disease. Nutrients 9:. doi:
10.3390/nu9050489
117
Références bibliographiques
Filippis FD, Pellegrini N, Vannini L, et al (2015) High-level adherence to a Mediterranean diet
beneficially impacts the gut microbiota and associated metabolome. Gut gutjnl-2015-309957. doi:
10.1136/gutjnl-2015-309957
Foley RN, Parfrey PS, Sarnak MJ (1998) Epidemiology of cardiovascular disease in chronic renal
disease. J Am Soc Nephrol 9:S16-23
Fouque D, Laville M (2009) Low protein diets for chronic kidney disease in non diabetic adults.
Cochrane Database Syst Rev CD001892. doi: 10.1002/14651858.CD001892.pub3
Fujii-Kuriyama Y, Mimura J (2005) Molecular mechanisms of AhR functions in the regulation of
cytochrome P450 genes. Biochem Biophys Res Commun 338:311–317. doi:
10.1016/j.bbrc.2005.08.162
Furuse SU, Ohse T, Jo-Watanabe A, et al (2014) Galacto-oligosaccharides attenuate renal injury with
microbiota modification. Physiol Rep 2:. doi: 10.14814/phy2.12029
Gama-Axelsson T, Heimbürger O, Stenvinkel P, et al (2012) Serum albumin as predictor of nutritional
status in patients with ESRD. Clin J Am Soc Nephrol 7:1446–1453. doi: 10.2215/CJN.10251011
Gao H, Liu S (2017) Role of uremic toxin indoxyl sulfate in the progression of cardiovascular disease.
Life Sci 185:23–29. doi: 10.1016/j.lfs.2017.07.027
Garcia-Closas R, Berenguer A, González CA (2006) Changes in food supply in Mediterranean countries
from 1961 to 2001. Public Health Nutr 9:53–60
GBD 2015 Disease and Injury Incidence and Prevalence Collaborators (2016) Global, regional, and
national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990-
2015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet 388:1545–1602. doi:
10.1016/S0140-6736(16)31678-6
Gennari FJ, Hood VL, Greene T, et al (2006) Effect of dietary protein intake on serum total CO2
concentration in chronic kidney disease: Modification of Diet in Renal Disease study findings. Clin J
Am Soc Nephrol 1:52–57. doi: 10.2215/CJN.00060505
Geypens B, Claus D, Evenepoel P, et al (1997) Influence of dietary protein supplements on the
formation of bacterial metabolites in the colon. Gut 41:70–76
Gondouin B, Cerini C, Dou L, et al (2013) Indolic uremic solutes increase tissue factor production in
endothelial cells by the aryl hydrocarbon receptor pathway. Kidney Int 84:733–744. doi:
10.1038/ki.2013.133
Hakim RM, Lazarus JM (1988) Biochemical parameters in chronic renal failure. Am J Kidney Dis
11:238–247
Heid SE, Pollenz RS, Swanson HI (2000) Role of heat shock protein 90 dissociation in mediating
agonist-induced activation of the aryl hydrocarbon receptor. Mol Pharmacol 57:82–92
Henklová P, Vrzal R, Ulrichová J, Dvorák Z (2008) Role of mitogen-activated protein kinases in aryl
hydrocarbon receptor signaling. Chem Biol Interact 172:93–104. doi: 10.1016/j.cbi.2007.12.005
118
Références bibliographiques
Hida M, Aiba Y, Sawamura S, et al (1996) Inhibition of the accumulation of uremic toxins in the blood
and their precursors in the feces after oral administration of Lebenin, a lactic acid bacteria
preparation, to uremic patients undergoing hemodialysis. Nephron 74:349–355. doi:
10.1159/000189334
Holler E, Butzhammer P, Schmid K, et al (2014) Metagenomic analysis of the stool microbiome in
patients receiving allogeneic stem cell transplantation: loss of diversity is associated with use of
systemic antibiotics and more pronounced in gastrointestinal graft-versus-host disease. Biol Blood
Marrow Transplant 20:640–645. doi: 10.1016/j.bbmt.2014.01.030
Huang G, Elferink CJ (2012) A novel nonconsensus xenobiotic response element capable of mediating
aryl hydrocarbon receptor-dependent gene expression. Mol Pharmacol 81:338–347. doi:
10.1124/mol.111.075952
Huang X, Jiménez-Moleón JJ, Lindholm B, et al (2013) Mediterranean diet, kidney function, and
mortality in men with CKD. Clin J Am Soc Nephrol 8:1548–1555. doi: 10.2215/CJN.01780213
Hubbard TD, Murray IA, Bisson WH, et al (2016) Divergent Ah Receptor Ligand Selectivity during
Hominin Evolution. Mol Biol Evol 33:2648–2658. doi: 10.1093/molbev/msw143
Ikizler HO, Zelnick L, Ruzinski J, et al (2016) Dietary acid load is associated with serum bicarbonate
but not insulin sensitivity in chronic kidney disease. J Ren Nutr 26:93–102. doi:
10.1053/j.jrn.2015.08.008
Ikizler TA (2014) Using and interpreting serum albumin and prealbumin as nutritional markers in
patients on chronic dialysis. Semin Dial 27:590–592. doi: 10.1111/sdi.12288
ISTH Steering Committee for World Thrombosis Day (2014) Thrombosis: a major contributor to global
disease burden. Thromb Res 134:931–938. doi: 10.1016/j.thromres.2014.08.014
Ito M, Kimura M, Deguchi Y, et al (1993) Effects of transgalactosylated disaccharides on the human
intestinal microflora and their metabolism. J Nutr Sci Vitaminol 39:279–288
Ito S, Osaka M, Edamatsu T, et al (2016) Crucial Role of the Aryl Hydrocarbon Receptor (AhR) in
Indoxyl Sulfate-Induced Vascular Inflammation. J Atheroscler Thromb 23:960–975. doi:
10.5551/jat.34462
Jaceldo-Siegl K, Haddad E, Knutsen S, et al (2018) Lower C-reactive protein and IL-6 associated with
vegetarian diets are mediated by BMI. Nutr Metab Cardiovasc Dis. doi:
10.1016/j.numecd.2018.03.003
Jackson DP, Joshi AD, Elferink CJ (2015) Ah Receptor Pathway Intricacies; Signaling Through Diverse
Protein Partners and DNA-Motifs. Toxicol Res (Camb) 4:1143–1158
Jackson DP, Li H, Mitchell KA, et al (2014) Ah receptor-mediated suppression of liver regeneration
through NC-XRE-driven p21Cip1 expression. Mol Pharmacol 85:533–541. doi:
10.1124/mol.113.089730
119
Références bibliographiques
Jaffe EA, Nachman RL, Becker CG, Minick CR (1973) Culture of human endothelial cells derived from
umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest 52:2745–2756.
doi: 10.1172/JCI107470
Jourde-Chiche N, Dou L, Cerini C, et al (2009) Protein-bound toxins--update 2009. Semin Dial 22:334–
339. doi: 10.1111/j.1525-139X.2009.00576.x
Jourde-Chiche N, Dou L, Cerini C, et al (2011) Vascular incompetence in dialysis patients--protein-
bound uremic toxins and endothelial dysfunction. Semin Dial 24:327–337. doi: 10.1111/j.1525-
139X.2011.00925.x
Kalantar-Zadeh K, Block G, McAllister CJ, et al (2004) Appetite and inflammation, nutrition, anemia,
and clinical outcome in hemodialysis patients. Am J Clin Nutr 80:299–307. doi: 10.1093/ajcn/80.2.299
Kamiński TW, Pawlak K, Karbowska M, et al (2017) Indoxyl sulfate - the uremic toxin linking
hemostatic system disturbances with the prevalence of cardiovascular disease in patients with
chronic kidney disease. BMC Nephrol 18:35. doi: 10.1186/s12882-017-0457-1
Kaysen GA (1998) Biological basis of hypoalbuminemia in ESRD. J Am Soc Nephrol 9:2368–2376
Kaysen GA, Jones H, Hutchison FN (1989) High protein diets stimulate synthesis at the site of albumin
mRNA transcription. Current Topics in Neurochemistry, KIDNEY INT, Kidney international, Kidney
international 36:
Kaysen GA, Rathore V, Shearer GC, Depner TA (1995) Mechanisms of hypoalbuminemia in
hemodialysis patients. Kidney Int 48:510–516
Kelley-Hedgepeth A, Lloyd-Jones DM, Colvin A, et al (2008) Ethnic differences in C-reactive protein
concentrations. Clin Chem 54:1027–1037. doi: 10.1373/clinchem.2007.098996
Kim MJ, Pelloux V, Guyot E, et al (2012) Inflammatory pathway genes belong to major targets of
persistent organic pollutants in adipose cells. Environ Health Perspect 120:508–514. doi:
10.1289/ehp.1104282
Kim S-H, Henry EC, Kim D-K, et al (2006) Novel compound 2-methyl-2H-pyrazole-3-carboxylic acid (2-
methyl-4-o-tolylazo-phenyl)-amide (CH-223191) prevents 2,3,7,8-TCDD-induced toxicity by
antagonizing the aryl hydrocarbon receptor. Mol Pharmacol 69:1871–1878. doi:
10.1124/mol.105.021832
Koga J, Syono K, Ichikawa T, Adachi T (1994) Involvement of L-tryptophan aminotransferase in indole-
3-acetic acid biosynthesis in Enterobacter cloacae. Biochim Biophys Acta 1209:241–247
Kolachalama VB, Shashar M, Alousi F, et al (2018) Uremic Solute-Aryl Hydrocarbon Receptor-Tissue
Factor Axis Associates with Thrombosis after Vascular Injury in Humans. J Am Soc Nephrol. doi:
10.1681/ASN.2017080929
Korashy HM, El-Kadi AOS (2006) The Role of Aryl Hydrocarbon Receptor in the Pathogenesis of
Cardiovascular Diseases. Drug Metabolism Reviews 38:411–450. doi: 10.1080/03602530600632063
120
Références bibliographiques
Krajcovicova-Kudlackova M, Blazicek P (2005) C-reactive protein and nutrition. Bratisl Lek Listy
106:345–347
Krieter DH, Hackl A, Rodriguez A, et al (2010) Protein-bound uraemic toxin removal in haemodialysis
and post-dilution haemodiafiltration. Nephrol Dial Transplant 25:212–218. doi: 10.1093/ndt/gfp437
Kusumoto M, Kamobayashi H, Sato D, et al (2011) Alleviation of cisplatin-induced acute kidney injury
using phytochemical polyphenols is accompanied by reduced accumulation of indoxyl sulfate in rats.
Clin Exp Nephrol 15:820–830. doi: 10.1007/s10157-011-0524-z
Lepage P, Colombet J, Marteau P, et al (2008) Dysbiosis in inflammatory bowel disease: a role for
bacteriophages? Gut 57:424–425. doi: 10.1136/gut.2007.134668
Levey AS, Atkins R, Coresh J, et al (2007) Chronic kidney disease as a global public health problem:
approaches and initiatives - a position statement from Kidney Disease Improving Global Outcomes.
Kidney Int 72:247–259. doi: 10.1038/sj.ki.5002343
Levey AS, Coresh J (2012) Chronic kidney disease. Lancet 379:165–180. doi: 10.1016/S0140-
6736(11)60178-5
Levey AS, Coresh J, Balk E, et al (2003) National Kidney Foundation practice guidelines for chronic
kidney disease: evaluation, classification, and stratification. Ann Intern Med 139:137–147
Li Y-D, Ye B-Q, Zheng S-X, et al (2009) NF-kappaB transcription factor p50 critically regulates tissue
factor in deep vein thrombosis. J Biol Chem 284:4473–4483. doi: 10.1074/jbc.M806010200
Lim PS, Sutton CR, Rao S (2015) Protein kinase C in the immune system: from signalling to chromatin
regulation. Immunology 146:508–522. doi: 10.1111/imm.12510
Lin C-J, Chuang C-K, Jayakumar T, et al (2013) Serum p-cresyl sulfate predicts cardiovascular disease
and mortality in elderly hemodialysis patients. Arch Med Sci 9:662–668. doi:
10.5114/aoms.2013.36901
Lin C-J, Liu H-L, Pan C-F, et al (2012) Indoxyl Sulfate Predicts Cardiovascular Disease and Renal
Function Deterioration in Advanced Chronic Kidney Disease. Archives of Medical Research 43:451–
456. doi: 10.1016/j.arcmed.2012.08.002
Lutz J, Menke J, Sollinger D, et al (2014) Haemostasis in chronic kidney disease. Nephrol Dial
Transplant 29:29–40. doi: 10.1093/ndt/gft209
Ma C, Marlowe JL, Puga A (2009) The aryl hydrocarbon receptor at the crossroads of multiple
signaling pathways. In: Molecular, Clinical and Environmental Toxicology. Birkhäuser Basel, pp 231–
257
Mackman N (1997) Regulation of the tissue factor gene. Thromb Haemost 78:747–754
Mackman N, Brand K, Edgington TS (1991) Lipopolysaccharide-mediated transcriptional activation of
the human tissue factor gene in THP-1 monocytic cells requires both activator protein 1 and nuclear
factor kappa B binding sites. J Exp Med 174:1517–1526
121
Références bibliographiques
Mackman N, Erlich JH (2018) The uremic solute-AHR-tissue factor axis in vascular cells, mouse models
and thrombosis in chronic kidney disease patients. Ann Transl Med 6:. doi: 10.21037/atm.2018.04.27
Mandal PK (2005) Dioxin: a review of its environmental effects and its aryl hydrocarbon receptor
biology. J Comp Physiol B 175:221–230. doi: 10.1007/s00360-005-0483-3
Marzocco S, Piaz FD, Micco LD, et al (2013) Very Low Protein Diet Reduces Indoxyl Sulfate Levels in
Chronic Kidney Disease. BPU 35:196–201. doi: 10.1159/000346628
Masai N, Tatebe J, Yoshino G, Morita T (2010) Indoxyl sulfate stimulates monocyte chemoattractant
protein-1 expression in human umbilical vein endothelial cells by inducing oxidative stress through
activation of the NADPH oxidase-nuclear factor-κB pathway. Circ J 74:2216–2224
Matsumura F (2009) The significance of the nongenomic pathway in mediating inflammatory
signaling of the dioxin-activated Ah receptor to cause toxic effects. Biochem Pharmacol 77:608–626.
doi: 10.1016/j.bcp.2008.10.013
McDonald D, Hyde E, Debelius JW, et al (2018) American Gut: an Open Platform for Citizen Science
Microbiome Research. mSystems 3:e00031-18. doi: 10.1128/mSystems.00031-18
Mekki K, Bouzidi-bekada N, Kaddous A, Bouchenak M (2010) Mediterranean diet improves
dyslipidemia and biomarkers in chronic renal failure patients. Food Funct 1:110–115. doi:
10.1039/c0fo00032a
Mishima E, Fukuda S, Mukawa C, et al (2017) Evaluation of the impact of gut microbiota on uremic
solute accumulation by a CE-TOFMS–based metabolomics approach. Kidney International 92:634–
645. doi: 10.1016/j.kint.2017.02.011
Mitch WE (2002) Insights into the abnormalities of chronic renal disease attributed to malnutrition. J
Am Soc Nephrol 13 Suppl 1:S22-27
Montemurno E, Cosola C, Dalfino G, et al (2014) What would you like to eat, Mr CKD Microbiota? A
Mediterranean Diet, please! Kidney Blood Press Res 39:114–123. doi: 10.1159/000355785
Murray IA, Patterson AD, Perdew GH (2014) Aryl hydrocarbon receptor ligands in cancer: friend and
foe. Nat Rev Cancer 14:801–814. doi: 10.1038/nrc3846
Naylor HL, Jackson H, Walker GH, et al (2013) British Dietetic Association evidence-based guidelines
for the protein requirements of adults undergoing maintenance haemodialysis or peritoneal dialysis.
J Hum Nutr Diet 26:315–328. doi: 10.1111/jhn.12052
Nazzal L, Roberts J, Singh P, et al (2017) Microbiome perturbation by oral vancomycin reduces
plasma concentration of two gut-derived uremic solutes, indoxyl sulfate and p-cresyl sulfate, in end-
stage renal disease. Nephrol Dial Transplant 32:1809–1817. doi: 10.1093/ndt/gfx029
Neirynck N, Glorieux G, Schepers E, et al (2013a) Review of protein-bound toxins, possibility for blood
purification therapy. Blood Purif 35 Suppl 1:45–50. doi: 10.1159/000346223
Neirynck N, Glorieux G, Schepers E, et al (2013b) Review of Protein-Bound Toxins, Possibility for
Blood Purification Therapy. BPU 35:45–50. doi: 10.1159/000346223
122
Références bibliographiques
Neu J (2014) The developing intestinal microbiome: probiotics and prebiotics. World Rev Nutr Diet
110:167–176. doi: 10.1159/000358465
Niwa T, Emoto Y, Maeda K, et al (1991) Oral sorbent suppresses accumulation of albumin-bound
indoxyl sulphate in serum of haemodialysis patients. Nephrol Dial Transplant 6:105–109
Niwa T, Nomura T, Sugiyama S, et al (1997) The protein metabolite hypothesis, a model for the
progression of renal failure: an oral adsorbent lowers indoxyl sulfate levels in undialyzed uremic
patients. Kidney Int Suppl 62:S23-28
Noah A, Truswell AS (2001) There are many Mediterranean diets. Asia Pac J Clin Nutr 10:2–9
Ocak G, Lijfering WM, Verduijn M, et al (2013) Risk of venous thrombosis in patients with chronic
kidney disease: identification of high-risk groups. J Thromb Haemost 11:627–633. doi:
10.1111/jth.12141
Oeth P, Parry GC, Mackman N (1997) Regulation of the tissue factor gene in human monocytic cells.
Role of AP-1, NF-kappa B/Rel, and Sp1 proteins in uninduced and lipopolysaccharide-induced
expression. Arterioscler Thromb Vasc Biol 17:365–374
O’Halloran SA, Grimes CA, Lacy KE, et al (2016) Dietary Intake and Sources of Potassium and the
Relationship to Dietary Sodium in a Sample of Australian Pre-School Children. Nutrients 8:. doi:
10.3390/nu8080496
Øvrevik J, Låg M, Lecureur V, et al (2014) AhR and Arnt differentially regulate NF-κB signaling and
chemokine responses in human bronchial epithelial cells. Cell Commun Signal 12:48. doi:
10.1186/s12964-014-0048-8
Parikh AM, Spencer FA, Lessard D, et al (2011) Venous thromboembolism in patients with reduced
estimated GFR: a population-based perspective. Am J Kidney Dis 58:746–755. doi:
10.1053/j.ajkd.2011.06.021
Parmar MS (2002) Chronic renal disease. BMJ 325:85–90
Patel KP, Luo FJ-G, Plummer NS, et al (2012) The Production of p-Cresol Sulfate and Indoxyl Sulfate in
Vegetarians Versus Omnivores. CJASN 7:982–988. doi: 10.2215/CJN.12491211
Patel SS, Molnar MZ, Tayek JA, et al (2013) Serum creatinine as a marker of muscle mass in chronic
kidney disease: results of a cross-sectional study and review of literature. Journal of Cachexia,
Sarcopenia and Muscle 4:19. doi: 10.1007/s13539-012-0079-1
Pavord S, Myers B (2011) Bleeding and thrombotic complications of kidney disease. Blood Reviews
25:271–278. doi: 10.1016/j.blre.2011.07.001
Pawlak K, Mysliwiec M, Pawlak D (2009) Hypercoagulability is independently associated with
kynurenine pathway activation in dialysed uraemic patients. Thromb Haemost 102:49–55. doi:
10.1160/TH08-10-0696
Perkovic V, Verdon C, Ninomiya T, et al (2008) The relationship between proteinuria and coronary
risk: a systematic review and meta-analysis. PLoS Med 5:e207. doi: 10.1371/journal.pmed.0050207
123
Références bibliographiques
Petrulis JR, Perdew GH (2002) The role of chaperone proteins in the aryl hydrocarbon receptor core
complex. Chem Biol Interact 141:25–40
Poesen R, Mutsaers HAM, Windey K, et al (2015) The Influence of Dietary Protein Intake on
Mammalian Tryptophan and Phenolic Metabolites. PLoS ONE 10:. doi:
10.1371/journal.pone.0140820
Preiss DJ, Godber IM, Lamb EJ, et al (2007) The influence of a cooked-meat meal on estimated
glomerular filtration rate. Ann Clin Biochem 44:35–42. doi: 10.1258/000456307779595995
Puga A, Ma C, Marlowe JL (2009) The aryl hydrocarbon receptor cross-talks with multiple signal
transduction pathways. Biochemical Pharmacology 77:713–722. doi: 10.1016/j.bcp.2008.08.031
Ravani P, Palmer SC, Oliver MJ, et al (2013) Associations between hemodialysis access type and
clinical outcomes: a systematic review. J Am Soc Nephrol 24:465–473. doi: 10.1681/ASN.2012070643
Reddy KV, Bhattacharjee G, Schabbauer G, et al (2004) Dexamethasone enhances LPS induction of
tissue factor expression in human monocytic cells by increasing tissue factor mRNA stability. J Leukoc
Biol 76:145–151. doi: 10.1189/jlb.0204068
Reny J-L (2001) Facteur tissulaire et athérothrombose. Sang Thrombose Vaisseaux 13:609–11
Riaz Rajoka MS, Shi J, Mehwish HM, et al (2017) Interaction between diet composition and gut
microbiota and its impact on gastrointestinal tract health. Food Science and Human Wellness 6:121–
130. doi: 10.1016/j.fshw.2017.07.003
Rossi M, Johnson DW, Morrison M, et al (2014) SYNbiotics Easing Renal failure by improving Gut
microbiologY (SYNERGY): a protocol of placebo-controlled randomised cross-over trial. BMC Nephrol
15:106. doi: 10.1186/1471-2369-15-106
Ruf W, Riewald M (2013) Regulation of Tissue Factor Expression. Landes Bioscience
Sallée M, Dou L, Cerini C, et al (2014) The Aryl Hydrocarbon Receptor-Activating Effect of Uremic
Toxins from Tryptophan Metabolism: A New Concept to Understand Cardiovascular Complications of
Chronic Kidney Disease. Toxins 6:934–949. doi: 10.3390/toxins6030934
Sandeman SR, Howell CA, Phillips GJ, et al (2014) An adsorbent monolith device to augment the
removal of uraemic toxins during haemodialysis. J Mater Sci Mater Med 25:1589–1597. doi:
10.1007/s10856-014-5173-9
Sarnatskaya VV, Yushko LA, Sakhno LA, et al (2007) New approaches to the removal of protein-bound
toxins from blood plasma of uremic patients. Artif Cells Blood Substit Immobil Biotechnol 35:287–
308. doi: 10.1080/10731190701378618
Sarwar S, Sherman RA (2016) How Well Does Serum Albumin Correlate With Dietary Protein Intake in
Dialysis Patients? Kidney Int Rep 2:90–93. doi: 10.1016/j.ekir.2016.09.004
Schulman G, Agarwal R, Acharya M, et al (2006) A multicenter, randomized, double-blind, placebo-
controlled, dose-ranging study of AST-120 (Kremezin) in patients with moderate to severe CKD. Am J
Kidney Dis 47:565–577. doi: 10.1053/j.ajkd.2005.12.036
124
Références bibliographiques
Schulman G, Vanholder R, Niwa T (2014) AST-120 for the management of progression of chronic
kidney disease. Int J Nephrol Renovasc Dis 7:49–56. doi: 10.2147/IJNRD.S41339
Sciullo EM, Vogel CF, Li W, Matsumura F (2008) Initial and extended inflammatory messages of the
nongenomic signaling pathway of the TCDD-activated Ah receptor in U937 macrophages. Arch
Biochem Biophys 480:143–155. doi: 10.1016/j.abb.2008.09.017
Serradell M, Díaz-Ricart M, Cases A, et al (2001) Uremic medium disturbs the hemostatic balance of
cultured human endothelial cells. Thromb Haemost 86:1099–1105
Shinaberger CS, Kilpatrick RD, Regidor DL, et al (2006) Longitudinal associations between dietary
protein intake and survival in hemodialysis patients. Am J Kidney Dis 48:37–49. doi:
10.1053/j.ajkd.2006.03.049
Shivanna S, Kolandaivelu K, Shashar M, et al (2016) The Aryl Hydrocarbon Receptor is a Critical
Regulator of Tissue Factor Stability and an Antithrombotic Target in Uremia. J Am Soc Nephrol
27:189–201. doi: 10.1681/ASN.2014121241
Simopoulos AP, Visioli F (2007) More on Mediterranean Diets. Karger Medical and Scientific
Publishers
Sirich TL, Plummer NS, Gardner CD, et al (2014) Effect of increasing dietary fiber on plasma levels of
colon-derived solutes in hemodialysis patients. Clin J Am Soc Nephrol 9:1603–1610. doi:
10.2215/CJN.00490114
Siri-Tarino PW (2011) Effects of diet on high-density lipoprotein cholesterol. Curr Atheroscler Rep
13:453–460. doi: 10.1007/s11883-011-0207-y
Smits SA, Leach J, Sonnenburg ED, et al (2017) Seasonal cycling in the gut microbiome of the Hadza
hunter-gatherers of Tanzania. Science 357:802–806. doi: 10.1126/science.aan4834
Sorg O, Zennegg M, Schmid P, et al (2009) 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) poisoning in
Victor Yushchenko: identification and measurement of TCDD metabolites. Lancet 374:1179–1185.
doi: 10.1016/S0140-6736(09)60912-0
Stevens EA, Mezrich JD, Bradfield CA (2009) The aryl hydrocarbon receptor: a perspective on
potential roles in the immune system. Immunology 127:299–311. doi: 10.1111/j.1365-
2567.2009.03054.x
Stevens PE, Levin A, Kidney Disease: Improving Global Outcomes Chronic Kidney Disease Guideline
Development Work Group Members (2013) Evaluation and management of chronic kidney disease:
synopsis of the kidney disease: improving global outcomes 2012 clinical practice guideline. Ann
Intern Med 158:825–830. doi: 10.7326/0003-4819-158-11-201306040-00007
Stockinger B, Hirota K, Duarte J, Veldhoen M (2011) External influences on the immune system via
activation of the aryl hydrocarbon receptor. Semin Immunol 23:99–105. doi:
10.1016/j.smim.2011.01.008
Swanson HI, Chan WK, Bradfield CA (1995) DNA binding specificities and pairing rules of the Ah
receptor, ARNT, and SIM proteins. J Biol Chem 270:26292–26302
125
Références bibliographiques
Takayama F, Taki K, Niwa T (2003) Bifidobacterium in gastro-resistant seamless capsule reduces
serum levels of indoxyl sulfate in patients on hemodialysis. Am J Kidney Dis 41:S142-145. doi:
10.1053/ajkd.2003.50104
Ternisien C, Prost D de (1995) Le facteur tissulaire : structure, expression normale et pathologique,
fonctions et régulation. Hématologie 1:379–84
Thalacker-Mercer AE, Campbell WW (2008) Dietary protein intake affects albumin fractional
synthesis rate in younger and older adults equally. Nutr Rev 66:91–95. doi: 10.1111/j.1753-
4887.2007.00012.x
Trilok G, Draper HH (1989) Sources of protein-induced endogenous acid production and excretion by
human adults. Calcif Tissue Int 44:335–338
Tumur Z, Shimizu H, Enomoto A, et al (2010) Indoxyl Sulfate Upregulates Expression of ICAM-1 and
MCP-1 by Oxidative Stress-Induced NF-ĸB Activation. AJN 31:435–441. doi: 10.1159/000299798
Vanholder R, De Smet R, Glorieux G, et al (2003) Review on uremic toxins: classification,
concentration, and interindividual variability. Kidney Int 63:1934–1943. doi: 10.1046/j.1523-
1755.2003.00924.x
Vaziri ND, Wong J, Pahl M, et al (2013) Chronic kidney disease alters intestinal microbial flora. Kidney
Int 83:308–315. doi: 10.1038/ki.2012.345
Vernaglione L (2009) The Mediterranean diet: a matter of history, tradition, culture and health. J
Nephrol 22 Suppl 14:149–158
Vogel CFA, Li W, Wu D, et al (2011) Interaction of Aryl hydrocarbon receptor and NF-κB subunit RelB
in breast cancer is associated with Interleukin-8 overexpression. Arch Biochem Biophys 512:78–86.
doi: 10.1016/j.abb.2011.05.011
Vogel CFA, Matsumura F (2009) A new cross-talk between the Aryl hydrocarbon receptor and RelB, a
member of the NF-κB family. Biochem Pharmacol 77:734–745. doi: 10.1016/j.bcp.2008.09.036
Watanabe H, Miyamoto Y, Otagiri M, Maruyama T (2011) Update on the pharmacokinetics and redox
properties of protein-bound uremic toxins. J Pharm Sci 100:3682–3695. doi: 10.1002/jps.22592
Wattanakit K, Cushman M, Stehman-Breen C, et al (2008) Chronic Kidney Disease Increases Risk for
Venous Thromboembolism. J Am Soc Nephrol 19:135–140. doi: 10.1681/ASN.2007030308
Webster AC, Nagler EV, Morton RL, Masson P (2017) Chronic Kidney Disease. Lancet 389:1238–1252.
doi: 10.1016/S0140-6736(16)32064-5
Weiner DE, Tighiouart H, Amin MG, et al (2004) Chronic kidney disease as a risk factor for
cardiovascular disease and all-cause mortality: a pooled analysis of community-based studies. J Am
Soc Nephrol 15:1307–1315
Wu D, Nishimura N, Kuo V, et al (2011) Activation of Aryl Hydrocarbon Receptor Induces Vascular
Inflammation and Promotes Atherosclerosis in Apolipoprotein E−/− Mice. Arteriosclerosis,
Thrombosis, and Vascular Biology 31:1260–1267. doi: 10.1161/ATVBAHA.110.220202
126
Références bibliographiques
Xia L, Xie H, Yu Y, et al (2016) The Effects of NF-κB and c-Jun/AP-1 on the Expression of Prothrombotic
and Proinflammatory Molecules Induced by Anti-β2GPI in Mouse. PLoS ONE 11:e0147958. doi:
10.1371/journal.pone.0147958
Xia L, Zhou H, Hu L, et al (2013) Both NF-κB and c-Jun/AP-1 involved in anti-β2GPI/β2GPI-induced
tissue factor expression in monocytes. Thromb Haemost 109:643–651. doi: 10.1160/TH12-09-0655
Xie H, Guo R, Zhong H, et al (2016) Shotgun Metagenomics of 250 Adult Twins Reveals Genetic and
Environmental Impacts on the Gut Microbiome. Cell Syst 3:572-584.e3. doi:
10.1016/j.cels.2016.10.004
Yamaguchi J, Tanaka T, Inagi R (2017) Effect of AST-120 in Chronic Kidney Disease Treatment: Still a
Controversy? NEF 135:201–206. doi: 10.1159/000453673
Yamamoto S, Kazama JJ, Omori K, et al (2015) Continuous Reduction of Protein-Bound Uraemic
Toxins with Improved Oxidative Stress by Using the Oral Charcoal Adsorbent AST-120 in
Haemodialysis Patients. Sci Rep 5:14381. doi: 10.1038/srep14381
Yamamoto S, Sato M, Sato Y, et al (2018) Adsorption of Protein-Bound Uremic Toxins Through Direct
Hemoperfusion With Hexadecyl-Immobilized Cellulose Beads in Patients Undergoing Hemodialysis.
Artif Organs 42:88–93. doi: 10.1111/aor.12961
Yang K, Du C, Wang X, et al (2017) Indoxyl sulfate induces platelet hyperactivity and contributes to
chronic kidney disease-associated thrombosis in mice. Blood 129:2667–2679. doi: 10.1182/blood-
2016-10-744060
Yeun JY, Kaysen GA (1998) Factors influencing serum albumin in dialysis patients. Am J Kidney Dis
32:S118-125
Young VR, El-Khoury AE, Raguso CA, et al (2000) Rates of urea production and hydrolysis and leucine
oxidation change linearly over widely varying protein intakes in healthy adults. J Nutr 130:761–766.
doi: 10.1093/jn/130.4.761
Yu M, Kim YJ, Kang D-H (2011) Indoxyl sulfate-induced endothelial dysfunction in patients with
chronic kidney disease via an induction of oxidative stress. Clin J Am Soc Nephrol 6:30–39. doi:
10.2215/CJN.05340610
Zanger UM, Schwab M (2013) Cytochrome P450 enzymes in drug metabolism: Regulation of gene
expression, enzyme activities, and impact of genetic variation. Pharmacology & Therapeutics
138:103–141. doi: 10.1016/j.pharmthera.2012.12.007
Zhao B, DeGroot DE, Hayashi A, et al (2010) CH223191 Is a Ligand-Selective Antagonist of the Ah
(Dioxin) Receptor. Toxicol Sci 117:393–403. doi: 10.1093/toxsci/kfq217
Zhao D, Pritts EA, Chao VA, et al (2002) Dioxin stimulates RANTES expression in an in-vitro model of
endometriosis. Mol Hum Reprod 8:849–854
Zhao J, Yao Y, Li D, et al (2018) Characterization of the Gut Microbiota in Six Geographical
Populations of Chinese Rhesus Macaques (Macaca mulatta), Implying an Adaptation to High-Altitude
Environment. Microb Ecol 76:565–577. doi: 10.1007/s00248-018-1146-8
127
Annexes
Annexes
128
Annexes
Annexe 1 : Lettre d’information et consentement
Titre de l’étude : Étude comparative entre deux cohortes de patients HD (Oran vs Marseille)
Promoteur de l’étude : (Université Oran 1, Faculté de science de la nature et de la vie, BP
1524 EL M_Naouer 31000 Oran ,Algérie). (Aix-Marseille Université, Faculté de
Pharmacie, 27 Bd Jean Moulin 13385 Marseille cedex 05, France).
Organisme de recherche : Laboratoire de physiologie de la nutrition et de la sécurité
alimentaire LPNSA, BP 1524 EL M_Naouer 31000 Oran ,Algérie).ex UMR_S 1076
endothélium, pathologies vasculaires et cibles thérapeutiques, Faculté de Pharmacie,
27 Bd Jean Moulin 13385 Marseille cedex 05, France). (LPNSA/ C2VN ex UMR_S1076)
Médecins investigateurs locaux et chercheurs:( Dr Fahssi Nadia, Dr Remaoui Mustapha,
Néphrologue, centre d’hémodialyse Renadial, ST-Hubert ES-SEDIKKIA),(Dr Kamel El
Mecherfi (MCA),Doctorant Addi Tawfik, Pr Kheroua Omar, Université Oran 1) , International ;
(Pr Stéphane Burtey, Néphrologue, AMU, Marseille France).
I Information essentielle à votre décision de participer (4 pages)
Introduction
Vous êtes invité à participer à une étude clinique destinée à évaluer le dosage de plusieurs toxines
urémiques dans le sang. Le but de ce travail est d’évaluer la quantité de toxines urémiques
s’accumulant chez les patients avec une maladie rénale chronique hémodialysé. Nous évaluerons si
la quantité de toxines urémiques est associée à la survenue d’événements indésirables pendant un
an.
Il n’y a aucun bénéfice de votre participation à cette étude.
Avant que vous n’acceptiez d’y participer, nous vous invitons à prendre connaissance de ses
implications en termes d’organisation, avantages et risques éventuels, afin que vous puissiez prendre
une décision en toute connaissance de cause. Ceci s’appelle donner un « consentement éclairé ».
Veuillez lire attentivement ces quelques pages d’information et poser toutes les questions que vous
souhaitez à l’investigateur ou à la personne qui le représente. Ce document comprend 3 parties :
l’information essentielle à votre prise de décision, votre consentement écrit et des informations
complémentaires (annexes) qui détaillent certaines parties de l’information de base.
Si vous participez à cette étude clinique, vous devez savoir que :
➢ Votre participation est volontaire et doit rester libre de toute contrainte. Elle nécessite la signature d’un document exprimant votre consentement. Même après l’avoir signé, vous pouvez arrêter de participer en informant le médecin investigateur. Votre décision de ne pas ou de ne plus participer à l’étude n’aura aucun impact sur la qualité de vos soins ni sur vos relations avec le médecin investigateur.
➢ Les données recueillies à cette occasion sont confidentielles et votre anonymat est garanti lors de la publication des résultats.
➢ Aucuns frais ne vous seront facturés pour les visites / consultations, ou prélèvements. ➢ Vous pouvez toujours contacter le médecin investigateur ou un membre de son équipe si vous
avez besoin d’informations complémentaires.
129
Annexes
➢ Objectifs et description du protocole de l’étude Nous vous proposons de participer à une étude clinique portant sur le dosage de lindoxyl sulfate de
l’indole-3 acétique acide et du para crésol sulfate qui devrait inclure environ 100 patients
hémodialysés en Algérie.
Le but du travail est de déterminer le taux de ces toxines dans une population hémodialysée en
Algérie .
Il s’agit d’une étude observationnelle.
Déroulement de l’étude
L’étude sera basée sur un interrogatoire à l’inclusion. Il sera prélevé uniquement deux tubes secs
avant une dialyse de milieu de semaine.
Votre participation à l’étude s’inscrivant dans le cadre de la prise en charge de votre situation clinique,
une partie des visites et examens que nous allons décrire font partie de la norme de soin en usage
dans votre hôpital (centre) tandis que d’autres sont proposées par l’étude.
Si vous acceptez de participer à l’étude et si vous répondez à toutes les conditions requises pour être
enrôlé(e) dans l’étude, vous passerez les tests et examens décrits ci-dessous :
Interrogatoire
Deux tubes secs au branchement en dialyse du milieu de semaine
Suivi d’une année
Risques et inconvénients
Les informations obtenues grâce à cette étude peuvent contribuer à une meilleure connaissance des
complications de l’insuffisance rénale chronique. Il n’y a pas de risque supplémentaire si vous
participez à cette étude qui s’intègre dans vos soins habituels.
Échantillons de matériel biologique collectés au cours de l’étude
Le promoteur de l’étude s’engage à ce que les échantillons soient utilisés exclusivement dans le
contexte défini dans la rubrique « Déroulement de la recherche clinique » et ses annexes.
1) Échantillons collectés pour les analyses décrites pour l’étude dans ce document
Le surplus de vos échantillons sera détruit dès que les analyses décrites dans ce document auront été
effectuées soit en principe dans 2 années.
Si vous participez à cette étude clinique, nous vous demandons :
➢ De collaborer pleinement au bon déroulement de cette recherche.
➢ De ne masquer aucune information relative à votre état de santé, aux médicaments que vous prenez (plus précisément les antibiotiques) ou aux symptômes que vous ressentez.
➢ De ne pas modifie vos habitudes quotidiennes (alimentation, régime..etc).
➢ De transmettre certaines données personnelles pour le recueil d’information.
➢ De faire certaines analyses supplémentaires pour le recueil des paramètres biologiques, cité dans l’annexe (interrogatoire), dans le cas où elles sont gratuites.
Contact
Si vous avez besoin d’informations complémentaires, mais aussi en cas de problème ou d’inquiétude,
vous pouvez contacter votre médecin (Le Dr Fahssi Nadia, Dr Remaoui Mustapha (médecin
investigateur)) ou un membre de l’équipe de recherche (ADDI, Tawfik).
130
Annexes
Titre de l’étude : Étude comparative entre deux cohortes de patients HD (Oran vs Marseille)
II Consentement éclairé (de 1 à 2 pages)
Participant
Je déclare que j’ai été informé sur la nature de l’étude, son but, sa durée, les éventuels bénéfices et
ce que l’on attend de moi. J’ai pris connaissance du document d’information et des annexes à ce
document.
J’ai eu suffisamment de temps pour y réfléchir et en parler avec une personne de mon choix comme
mon médecin ou un membre de ma famille.
J’ai eu l’occasion de poser toutes les questions qui me sont venues à l’esprit et j’ai obtenu une
réponse satisfaisante à mes questions.
J’ai compris que ma participation à cette étude est volontaire et que je suis libre de mettre fin à ma
participation à cette étude sans que cela ne modifie mes relations avec l’équipe thérapeutique en
charge de ma santé.
J’ai compris que des données me concernant seront récoltées pendant toute ma participation à cette
étude et que le médecin investigateur et le promoteur de l’étude se portent garants de la
confidentialité de ces données.
Je consens au traitement de mes données personnelles selon les modalités décrites dans la rubrique
traitant de garanties de confidentialité (annexe I). Je donne également mon accord au transfert et au
traitement de ces données dans d’autres pays que l’Algérie.
[En fonction des études] J’accepte / n’accepte pas (biffer la mention inutile) que les données de
recherche récoltées pour les objectifs de la présente étude puissent être traitées ultérieurement pour
autant que ce traitement soit limité au contexte de la présente étude pour une meilleure connaissance
et prise en charge de la maladie.
[En fonction des études] J’accepte / n’accepte pas (biffer la mention inutile) que le promoteur conserve
des échantillons de matériel biologique récolté en cours d’étude pendant 2 années à des fins de
recherches ultérieures, mais limitées au contexte de la présente étude.
J’accepte/ n’accepte pas (biffer la mention inutile) que mon médecin généraliste ou d'autres médecins
spécialistes en charge de ma santé soient informés de ma participation à cette étude clinique.
J’ai reçu une copie de l’information au participant et du consentement éclairé.
Nom, prénom, date et signature du volontaire.
131
Annexes
Médecin investigateur
Je soussigné [Dr Fahssi Nadia, Dr Remaoui Mustapha] médecin investigateur / assistant de recherche
clinique confirme avoir fourni oralement les informations nécessaires sur l'étude et avoir fourni un
exemplaire du document d’information au participant.
Je confirme qu'aucune pression n'a été exercée pour que le patient accepte de participer à l'étude et
que je suis prêt à répondre à toutes les questions supplémentaires, le cas échéant.
Je confirme travailler en accord avec les principes éthiques énoncés dans la dernière version de la
« Déclaration d’Helsinki », des « Bonnes pratiques cliniques » et de la loi belge du 7 mai 2004, relative
aux expérimentations sur la personne humaine.
Nom, prénom, Date et signature Nom, Prénom, Date et signature
Promoteur de l’étude du médecin investigateur
132
Annexes
Annexe 2 : Interrogatoire Centre : Numéro d’inclusion patient :
I. Identification du patient
Nom : Prénom : Date de naissance :
Sexe : F M
Tel :
Adresse :
Situation familiale : Mariée Divorcé Célibataire Veuve
Profession et lieu de travail :
II. Antécédent médical :
Colectomie : oui non
Maladies cardiovasculaires
Infarctus du myocarde : (oui/non) :
Coronaropathie :
AVC :
Insuffisance cardiaque :
Artériopathie des membres inférieurs :
Amputation :
Phlébite :
Embolie pulmonaire :
Autre :
Maladie chronique associée à l’IRC :
HTA Diabètes Hypercholestérolémie Autre ;
Maladie non chronique : infectieuse troubles digestifs Autre ;
III. Autres facteurs
Résidence prés :
D’une Zone industrielle ou usine Zone urbaine en campagne
Fumeur : Oui jamais À arrêter rarement Nombre de paquets par
années ;
F Passif : Oui Non
Alimentation et Appétit :
Bonne Moyenne Faible
Habitude alimentaire : XXX (+/-)
viande Légumes Fruit Poisson fruit sec légume sec café
Sous régime alimentaire : oui non
Médication : Sous Antibiotique : oui non Date de la dernière prise d’antibiotique :
Autre mdt : Catégorie de mdt :
133
Annexes
IV. Diagnostic de l’IRC
Âge de l’IRC :
Degré d’IRC
Modérer Sévère Terminale
Nombre de dialyse par semaine :
Paramètres cliniques :
Date d'Inclusion :
Néphropathie :
Date de survenue de l'IRCT (Date de mise en
dialyse) :
Antécédents de Transplantation rénale :
Voie d’abord :
Poids :
Taille :
Diurèse (estimée par l'interrogatoire du patient) :
Troubles du transit intestinal : constipation,
diarrhée.
Les paramètres de dialyse :
Les traitements :
Paramètres biologiques :
GB :
Lymphocytes :
Plaquettes :
Hémoglobine :
Ferritine :
Coefficient de Saturation :
INR en cas de prise d’anticoagulant :
Calcium :
Phosphate :
Potassium :
CRP :
Albumine :
Réserve alcaline :
Urée sanguine :
β2-microglobuline (si faite) :
Acide urique :
TSH (si faite) :
HbA1c (si faite) :
Créatinine :
Clairance de la Créatinine :
Bicarbonate :
Cholestérol :
HDL-cholestérol :
LDL-cholestérol :
Triglycérides :
Prélèvement : Avant Dialyse Après Dialyse
134
Annexes
Annexe 3 : fiche de suivi
Nom et prénom du patient :
Date de l’inclusion du patient :
Date d’initiation du suivi du patient :
Taux de toxines urémiques sériques trouvées chez le patient :
IS : IAA : PCs :
Information concernant les survenues cardiovasculaires du patient
sur une période d’une année
Visite trois mois après l’initiation du suivi
Nombre et Type de complications :
Date de manifestation clinique :
Six mois après l’initiation
Nombre et Type de complications :
Date de manifestation clinique :
Décès (Cause, date) ;
Neuf mois après l’initiation
Type de complication :
Date de manifestation clinique :
Douze mois après l’initiation
Nombre et Type de complications :
Date de manifestation clinique :
135
Productions scientifiques
Productions scientifiques
Publications
➢ Article original publié dans ‘Archives of toxicology’ « Mechanisms Of Tissue Factor Induction
By The Uremic Toxin Indol-3 Acetic Acid Through Aryl Hydrocarbon Receptor/Nuclear
Factor-Kappa B Signaling Pathway in Human Endothelial Cells».
DOI : https://doi.org/10.1007/s00204-018-2328-3. (1erauteur) (Publié en Octobre 2018).
➢ Revue scientifique publié dans ‘Toxins’ « Tryptophan-Derived Uremic Toxins and
Thrombosis in Chronic Kidney Disease ».
DOI: https://doi.org/10.3390/toxins10100412. (1erauteur) (Publié en Octobre 2018).
➢ Article original publié dans ‘Kidney International’ « Aryl hydrocabon receptor is activated
in humans and mice with chronic kidney disease»
DOI: https://doi.org/10.1016/j.kint.2017.11.010. (4emeauteur, 2017).
Communications
➢ “Travel Grants” pour une communication orale, 1er auteur, à « European congress on
thrombosis and Haemostasis, ECTH 2018, 24/25/26 October 2018, Marseille » “Aryl
Hydrocarbon Receptor-Related Mechanisms Of Endothelial Tissue Factor Induction By
The Uremic Toxin Indole-3 Acetic Acid”.
➢ Communication 2eme auteur « Comment Aryl hydrocarbon receptor active-t-il
l’expression du facteur tissulaire dans l’endothélium humain en réponse à l’indole-3
acétique acide ? » Néphrologie & Thérapeutique, 3e congrès de la Société francophone
de néphrologie, dialyse et transplantation, Lille – 1 au 5 octobre 2018.
➢ Communication orale poster, 1er auteur « Cooperative roles of Aryl hydrocarbon
Receptor and NF-B in Tissue Factor expression induced by indolic uremic toxins »,
Journée de la Recherche Faculté de pharmacie, Marseille (19 Octobre 2017).
➢ Communication 2eme auteur « Aryl hydrocarbon receptor est activé in vivo au cours de
l’insuffisance rénale chronique » Néphrologie & Thérapeutique, 17e Réunion commune
de la Société de néphrologie (SN) et de la Société francophone de dialyse (SFD) Lyon –
29 septembre au 2 octobre 2015.
Vol.:(0123456789)1 3
Archives of Toxicology https://doi.org/10.1007/s00204-018-2328-3
MOLECULAR TOXICOLOGY
Mechanisms of tissue factor induction by the uremic toxin indole-3 acetic acid through aryl hydrocarbon receptor/nuclear factor-kappa B signaling pathway in human endothelial cells
Tawfik Addi1,2 · Stéphane Poitevin1 · Nathalie McKay1 · Kamel Eddine El Mecherfi2,3 · Omar Kheroua2 · Noémie Jourde‑Chiche1,4 · Alix de Macedo5 · Bertrand Gondouin6 · Claire Cerini1 · Philippe Brunet1,4 · Françoise Dignat‑George1 · Stéphane Burtey1,4 · Laetitia Dou1
Received: 1 February 2018 / Accepted: 9 October 2018 © Springer-Verlag GmbH Germany, part of Springer Nature 2018
AbstractChronic kidney disease (CKD) is associated with high risk of thrombosis. Indole-3 acetic acid (IAA), an indolic uremic toxin, induces the expression of tissue factor (TF) in human umbilical vein endothelial cells (HUVEC) via the transcription factor aryl hydrocarbon receptor (AhR). This study aimed to understand the signaling pathways involved in AhR-mediated TF induc-tion by IAA. We incubated human endothelial cells with IAA at 50 µM, the maximal concentration found in patients with CKD. IAA induced TF expression in different types of human endothelial cells: umbilical vein (HUVEC), aortic (HAoEC), and cardiac-derived microvascular (HMVEC-C). Using AhR inhibition and chromatin immunoprecipitation experiments, we showed that TF induction by IAA in HUVEC was controlled by AhR and that AhR did not bind to the TF promoter. The analysis of TF promoter activity using luciferase reporter plasmids showed that the NF-κB site was essential in TF induction by IAA. In addition, TF induction by IAA was drastically decreased by an inhibitor of the NF-κB pathway. IAA induced the nuclear translocation of NF-κB p50 subunit, which was decreased by AhR and p38MAPK inhibition. Finally, in a cohort of 92 CKD patients on hemodialysis, circulating TF was independently related to serum IAA in multivariate analysis. In conclusion, TF up-regulation by IAA in human endothelial cells involves a non-genomic AhR/p38 MAPK/NF-κB pathway. The understanding of signal transduction pathways related to AhR thrombotic/inflammatory pathway is of interest to find therapeutic targets to reduce TF expression and thrombotic risk in patients with CKD.
Keywords Tissue factor · Uremic toxins · Aryl hydrocarbon receptor · Nuclear factor kappa-B · Indole-3 acetic acid · Chronic kidney disease
Introduction
Cardiovascular disease (CVD) is the leading cause of death in patients with chronic kidney disease (CKD) (Go et al. 2004; Tonelli et al. 2006). Thrombosis is a key event in CVD; and CKD is associated with an increased thrombotic risk Electronic supplementary material The online version of this
article (https ://doi.org/10.1007/s0020 4-018-2328-3) contains supplementary material, which is available to authorized users.
* Laetitia Dou laetitia.dou@univ-amu.fr
1 Faculté de pharmacie, Aix-Marseille Université, INSERM, INRA, C2VN, 27 bd Jean Moulin, 13005 Marseille, France
2 Département de Biologie, Université d’Oran 1 Ahmed Benbella, LPNSA, Oran, Algeria
3 Université Mohamed Boudiaf USTO, Dpt génétique Moléculaire Appliquée (GMA), Oran, Algeria
4 Centre de Néphrologie et Transplantation Rénale, AP-HM, Marseille, France
5 Service de Pédiatrie-Néonatologie, Hôpital Fondation Saint Joseph, Marseille, France
6 Association des dialysés Provence-Corse (ADPC), Marseille, France
Archives of Toxicology
1 3
(Daneschvar et al. 2008; Wattanakit and Cushman 2009; Car-ney 2016). In patients with CKD, the balance of the coagula-tion system is dysregulated, with higher levels of factor VII, factor VIII, thrombin and tissue factor (TF) (Jalal et al. 2010; Huang et al. 2017). Accumulation of some uremic toxins nor-mally eliminated by the kidney is correlated with CVD and mortality in patients with CKD (Barreto et al. 2009; Moradi et al. 2013; Han et al. 2015; Storino et al. 2015). The uremic toxin indole-3 acetic acid (IAA) is an independent predictor of cardiovascular events and mortality in patients with CKD (Dou et al. 2015). IAA is a uremic indolic toxin derived from the metabolization of dietary tryptophan by the gut micro-biota (Fernandez-Prado et al. 2017). Because of its protein-binding (Jourde-Chiche et al. 2009), IAA is poorly removed by dialysis (Neirynck et al. 2013). In cultured endothelial cells, IAA promotes the expression of a proinflammatory phenotype (Gondouin et al. 2013; Dou et al. 2015). IAA also increases the endothelial expression and procoagulant activity of TF (Gon-douin et al. 2013), the principal initiator of blood coagulation (Camerer et al. 1996).
Tissue factor expression is induced by various stimuli, such as pro-inflammatory cytokines, lipopolysaccharides (LPS), growth factors, or thromboxane A2, via different transcrip-tion factors: NF-κB, AP-1, NFAT or Egr-1 (Bode and Mack-man 2014). Interestingly, we have described that indolic toxins induce TF expression by a new pathway: the aryl hydrocar-bon receptor (AhR) pathway (Gondouin et al. 2013). AhR was initially described as a receptor of some environmental contaminants, especially 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (Hankinson 1995; Mandal 2005); and IAA is an endogenous agonist of AhR (Heath-Pagliuso et al. 1998). In resting cells, AhR forms a complex with HSP90, XAP2 and p23 in the cytoplasm (Heid et al. 2000; Petrulis and Perdew 2002). After ligand binding to AhR, the complex dissociates, resulting in AhR translocation into the nucleus and dimeriza-tion with the aryl hydrocarbon nuclear translocator (ARNT). The AHR/ARNT heterodimer binds to the XRE (Xenobiotic Response Element) sequences on the promoters of AhR target genes such as CYP1A1, CYP1A2, or CYP1B1 (Dolwick et al. 1993; Fujii-Kuriyama and Mimura 2005). In addition to this direct genomic pathway, a non-genomic inflammatory AhR pathway, independent of ARNT, has been described (Zhao et al. 2002; Sciullo et al. 2008; Matsumura 2009; Kim et al. 2012). AhR ligands, such as TCDD, induce the expression of proteins involved in inflammation such as IL-6, RANTES, TNF, and COX-2 (Zhao et al. 2002; Sciullo et al. 2008; Mat-sumura 2009; Kim et al. 2012). In the non-genomic pathway, AhR acts as a signaling molecules that interacts with multiple signaling pathways (Borlak and Jenke 2008; Henklová et al. 2008; Ma et al. 2009; Puga et al. 2009a). We recently reported that a non-genomic pathway of AhR involving p38MAPK/NF-κB signaling is crucial for the induction of endothelial COX-2 by IAA (Dou et al. 2015).
Until now, the mechanisms through which AhR controls TF expression in endothelial cells were poorly understood. The objective of the present work was, therefore, to deter-mine the signaling pathways and the transcriptions factors involved in AhR-mediated TF induction by IAA.
Methods
Endothelial cell culture
HUVEC were obtained from umbilical cord vein by colla-genase digestion as described (Jaffe et al. 1973) and grown to the fourth passage in EGM-2 medium (Lonza, France) (containing 2% fetal bovine serum), under standard cell culture conditions (humidified atmosphere at 37 °C, 5% CO2). Human aortic endothelial cells (HAoEC) and cardiac-derived microvascular endothelial cells (HMVEC-C) were obtained from Lonza. HMVEC-C were grown to the fifth passages in EGM-2 MV medium (Lonza, France) (contain-ing 5% fetal bovine serum) under standard cell culture con-ditions. HAoEC were grown to the fifth passage in EGM-2 medium under standard cell culture conditions.
Effect of the uremic toxin IAA
Cells were incubated in the presence of IAA (Sigma-Aldrich, France) at 50 µM, the highest concentration described in uremic patients (Vanholder et al. 2003). They were treated during indicated times, with or without the AhR Inhibitor CH-229131 at 10 µM (Sigma-Aldrich), the NF-κB inhibi-tor BAY 11-7082 at 10 µM (Merck Chemicals), the PKC inhibitor Bisindolymaleimide I at 5 µM (Merck Chemicals), the p38 inhibitor SB203580 at 10 µM (Sigma-Aldrich), the ERK1/2 inhibitor PD98059 at 10 µM (Sigma-Aldrich), and the transcription inhibitor Actinomycin D at 1 µg/ml (Sigma-Aldrich). Because IAA was diluted in ethanol, ethanol 1/1000 was used as control. In some experiments, human serum albumin (LFB, France) was added in the cul-ture medium, at the concentration found in human serum (4 g/dL).
SiRNA knockdown of AhR
HUVEC were transfected with siRNA control (Negative Universal Control, Stealth™ RNAi, Life Technologies, France) or a pool containing three Silencer® Select siRNA directed against AhR (1200, 1999 and 1998, Life Technolo-gies, France) by magnetofection using SilenceMag beads (OZ Biosciences, France), according to the manufacturer’s instructions. The knockdown of AhR was verified by western blot on cell extracts 48 h after transfection (Supplemental
Archives of Toxicology
1 3
Fig. 1). TF induction and p50 nuclear translocation were determined 48 h after transfection.
RNA extraction and quantitative RT‑PCR analysis of mRNA expression
Total RNA was extracted by an RNeasy mini-kit (Qia-gen, France). RT was performed on 500 ng of total RNA using the Takara PrimeScript™ RT reagent Kit (Ozyme, Saint Quentin en Yvelines, France) followed by qPCR on 25 ng of cDNA using the Takara SYBR qPCR Premix Ex Taq (Ozyme). We quantified the following target genes: TF, CYP1A1, and CYP1B1. The housekeeping gene HPRT was used for normalization of the target gene values. The sequences of primers were as follows: TF forward: 5′TGC AGT AGC TCC AAC AGT GC3’, TF reverse: 5′GAG TGT ATG GGC CAG GAG AA3’; CYP1A1 forward: 5′GAC AGA TCC CAT CTG CCC TA 3′, CYP1A1 reverse: 5′ATA GCA CCA TCA GGG GTG AG 3; CYP1B1 forward: 5′ TGA TGG ACG CCT TTA TCC TC 3′, CYP1B1 reverse: 5′ CCA CGA CCT GAT CCA ATT CT 3′; HPRT forward: 5′GGA TTA TAC TGC CTG ACC AAG GAA AGC 3′, HPRT reverse: 5′ GAG CTA TTG TAA TGA CCA GTC AAC AGG3′.
All PCR reaction efficiencies were determined with MxPro software (Agilent) and were always between 90 and 110%. The fusion curves were analyzed to assess the specificity of detected fluorescence. Fold change of mRNA expression vs. control condition (ethanol) was calculated using the 2− ΔΔCt method. The transcript for the housekeep-ing gene HPRT was used for data normalization.
Western blotting and densitometry analysis of Western blots
HUVEC were incubated with 50 µM IAA, or with etha-nol diluted 1/1000 (vehicle control) during 30 min, with or without the AhR Inhibitor CH-229131 at 10 µM (Sigma-Aldrich). Some experiments were also performed on HUVECs transfected with AhR siRNA or control siRNA, and cells were stimulated with IAA 50 µM 48 h after trans-fection. Nuclear extracts were prepared using Cayman Chemical’s Nuclear Extraction Kit (interchim, France). Cytosolic extracts were prepared using 1 ml of lysis buffer containing 20 mM MOPS, 50 mM β-glycerolphosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 5 mM EGTA, 2 mM EDTA, 1% NP40, 1 mM dithiothreitol (DTT), 1 mM benzamidine, 1 mM phenylmethanesulpho-nylfluoride (PMSF) and 10 µg/mL leupeptin and aprotinin. The cells were incubated 10 min on ice and then collected with a scraper. The cytosolic extracts were obtained after centrifugation of cell lysates at 18,000 g for 15 min. Protein
concentrations were measured with the Bicinchoninic Acid Kit (BCA1, Sigma-Aldrich).
Samples were mixed with LDS sample buffer and pro-teins were separated using 4–12% NuPAGE™ protein gel (Life technologies). Proteins were transferred to nitrocel-lulose membrane and blocked with 5% skim milk for 1 h at room temperature. The membrane was incubated over-night at 4 °C with antibodies directed against AhR (Santa Cruz, France), against NF-kB p50 (Cell Signaling, Ozyme, France), or actin (Cell Signaling, France), and then with the secondary peroxidase-conjugated antibody (Beckman-Coul-ter, France). Revelations were done by chemiluminescence (ECL Western blotting substrate, Pierce). Gel images were captured using the Syngene GBox (Ozyme) and analyzed with the software geneSys (Ozyme).
Study of NF‑κB and AP‑1 nuclear levels
After HUVEC incubation with 50 µM IAA during 30 min, with or without the AhR Inhibitor CH-229131 at 10 µM (Sigma-Aldrich), the NF-κB inhibitor BAY 11-7082 at 10 µM (Merck Chemicals), the PKC inhibitor Bisindoly-maleimide I at 5 µM, the p38 inhibitor SB203580 at 10 µM (Sigma-Aldrich), nuclear extracts were prepared using Cay-man Chemical’s Nuclear Extraction Kit (interchim, France). NF-κB p50 was detected in nuclear extracts by Cayman Chemical’s NF-κB (human p50) combo transcription factor assay kit (interchim). This kit is a 96-well ELISA with a spe-cific double stranded DNA sequence containing the NF-KB response element. NF-KB p50 contained in nuclear extracts is detected with a specific primary antibody and a second-ary antibody HRP-conjugated that provides a colorimetric readout à 450 nm.
Endothelial p65 expression in nuclear extracts was meas-ured after 30 min incubation of HUVEC with IAA 50 µM and detected in nuclear extracts by the Cayman Chemical’s NF-κB (human p50/p65) combo transcription factor assay kit (interchim).
AP-1 subunits c-Fos and c-Jun were detected in nuclear extracts by the AP1 (c-Fos/FosB/Fra1/c-Jun/JunB/JunD) transcription factor assay kit (Abcam, Paris, France).
Chromatin immunoprecipitation (ChIP) assay
HUVEC monolayers (6 × 106 cells) were treated with IAA (50 µM) or ethanol (vehicle) for 60 min. Cells were fixed by adding formaldehyde directly to the medium to a final con-centration of 1% and incubated for 10 min at room tempera-ture then 40 min at 4 °C. ChIP assay was performed using the EZ-Magna ChIP™ A/G Chromatin Immunoprecipitation Kit (Merck Millipore, France), according to the kit instruc-tions. Immunoprecipitations were performed overnight at
Archives of Toxicology
1 3
Archives of Toxicology
1 3
4 °C with 5 µg of rabbit IgG (control IgG) or rabbit poly-clonal antibody against AhR (Santa Cruz Biotechnology, Tebu-Bio, France). Real-time PCR quantification of ChIP enrichments was run on a MX3000P instrument (Strata-gene) using the Brilliant II SYBR Green QPCR Master Mix (Takara bio, France). Specific primer sequences for promot-ers were as follows: TF forward, 5′-GCC CTC CCT TTC CTG CCA TAGA-3′, TF reverse: 5′-CCT CCC GGT AGG AAA CTC CG-3′; CYP1A1 forward: 5′-ACG CAG ACC TAG ACC CTT TGC-3′, CYP1A1 reverse: 5′-CGG GTG CGC GAT TGAA-3′; CYP1B1 forward: 5′-ATA TGA CTG GAG CCG ACT TTCC-3′, CYP1B1 reverse: 5′-GGC GAA CTT TAT CGG GTT GA-3′. Fold enrichment was calculated using the 2− ΔΔCt method, where ΔΔCt represents the difference between threshold cycles of experimental rabbit polyclonal antibodies against AhR over rabbit control IgG.
Transient transfection of HUVEC and Luciferase Promoter Assay
The human TF wild-type promoter (− 227 hTF WT), the TF mutant AP-1 (− 227 hTF mAP1) and the TF-κB mutant (− 227 hTF mTF-κB) reporter plasmids in pGL2 basic were a gift from Nigel Mackman (Addgene plasmid # 15442, 15443, 15444 respectively).
HUVEC (1.5 × 105 cells) were plated into 6-well plates in EGM-2 medium 16 h before transfection. Cells were then incubated 1 h before transfection with Opti-MEM™ reduced-serum medium (Gibco, Life Technologies, France). Transfection was performed using Lipofectamine 2000 (Life Technologies, France) associated with magnetofec-tion using CombimagTMbeads (OZ Bioscience, Marseille, France) according to the manufacturer’s instructions. Briefly, reporter plasmids (1 µg) were mixed with 2 µl of Lipo-fectamine in 200 µl of Opti-MEM reduced serum medium for 20 min then 1 µl of Combimag™ beads was added to DNA-Lipofectamine complexes. The DNA-Lipofectamine-beads complexes were incubated for 20 min at room
temperature, incubated with HUVEC for 1 h at 37 °C on a magnetic plate in the 5% CO2 incubator and then replaced with growth medium. After 48 h, HUVEC were treated with IAA or ethanol (vehicle control) for 6 h. Cells were lysed in a reporter lysis buffer and lysates were assayed for lucif-erase activities using the luciferase assay system and the GloMax®-Multi detection system (Promega, France). The pSV-β-Galactosidase control vector (Promega) was cotrans-fected so that the transfection efficiencies could be normal-ized with the β-galactosidase activities determined using the b-Glo® assay system (Promega).
Patients
We performed a single center prospective study in 92 hemodialyzed patients, selected according to the follow-ing criteria: age > 18 years; no cardiovascular event (myo-cardial infarction, stroke, peripheral vascular disease with amputation or need for angioplasty), infection, or surgical intervention (except for vascular access angioplasty) in the last 3 months; no pregnancy; no recent history of malig-nancy; no intake of corticosteroids or immunosuppressive agents. Patients had been dialyzed at least 3 times a week for a minimum of 6 months. Patients’ blood samples were drawn before the mid-week hemodialysis session. Blood samples were drawn in BD Vacutainer → tubes containing lithium heparin for biochemical analyses, EDTA for hemo-globin measurement, citrate for TF measurement, and in BD Vacutainer → SST tubes for IS, IAA, p-cresylsulfate, and β2-microglobulin measurement. Standard laboratory proce-dures were used for blood chemistry evaluations. Total IS, IAA, and p-cresylsulfate were measured by HPLC, accord-ing to Calaf et al. (2011).
Informed consent was obtained from all individual par-ticipants included in the study. The study was approved by the local ethics committee and conforms to the principles outlined in the Declaration of Helsinki.
Measurement of TF by enzyme‑linked immunosorbent assay
TF was quantified in citrated human plasma and in cell lysates of HUVEC with the enzyme-linked immunosorbent assay (ELISA) kit Quantikine Human Coagulation Factor III/Tissue Factor (R&D Systems, Lille, France) according to the instructions of the manufacturer.
Statistical analyses
For in vitro studies, statistical analyses were performed with the Prism (GraphPad Software Inc, CA). Significant differ-ences were revealed by the Wilcoxon signed rank test or by
Fig. 1 IAA induces endothelial Tissue Factor transcription. a The induction of TF mRNA by IAA in different types of endothelial cells: HUVEC (umbilical vein), HAoEC (aortic), and HMVEC-C (car-diac-derived microvascular) were studied by comparative RT-qPCR and expressed in mRNA fold change vs. control. Data represent the mean ± SEM of 4 independent experiments. *p < 0.05, **p < 0.01. b TF protein level in HUVEC, HAoEC, and HMVEC-C after a 4-h incubation with 50 µM IAA was studied by ELISA. Data represent the mean ± SEM of 4 independent experiments. *p < 0.05. Effect of 50 µM IAA on Tissue Factor mRNA (C) and protein (D) induction in HUVEC, in medium containing 4% human serum albumin. Data represent the mean ± SEM of 5 independent experiments *p < 0.05. e Effect of the transcription inhibitor Actinomycin D (1 µg/mL) on Tissue Factor mRNA expression after a 4-h incubation with IAA at 50 µM. Data, expressed in mRNA fold change vs. control, represent the mean ± SEM of 4 independent experiments. *p < 0.05, **p < 0.01
◂
Archives of Toxicology
1 3
the Mann Whitney test. Data are expressed as mean ± SEM of independent experiments performed on different cell preparations.
In CKD patients, data are expressed as mean ± standard deviation (SD) for values with normal distribution or median (min; max) for non-normally distributed values. Numerical
variables were tested for normality by the Shapiro–Wilk test. Correlations between plasma TF and continuous variables were obtained using Spearman correlation coefficients; sta-tistical analyses were performed with the Prism (GraphPad Software Inc, CA) software. To identify factors indepen-dently associated with plasma TF, multiple linear regression
Archives of Toxicology
1 3
analyses were performed with the R software. A p value lower than 0.05 was considered significant.
Ethical approval
All procedures performed in studies involving human par-ticipants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.
Results
Study of IAA‑induced TF expression in endothelial cells
We previously demonstrated that IAA up-regulates TF expression in HUVEC (Gondouin et al. 2013). Here, we studied the effect of IAA on TF mRNA and protein expres-sion in other types of human endothelial cells that are rel-evant to the cardiovascular events observed in patients: arte-rial (HAoEC, aortic endothelial cells), and microvascular (HMVEC-C, cardiac-derived microvascular endothelial cells). In all human endothelial cells studied, IAA signifi-cantly increased the mRNA (Fig. 1a) and protein (Fig. 2b) expression of TF after 4 h of incubation.
We then added human serum albumin at 4 g/dL in the culture medium to increase the protein-bound fraction of IAA. After 4 h of incubation, the mRNA (Fig. 1c) and pro-tein (Fig. 1d) induction of TF by IAA was similar with or without the addition of albumin.
To test whether transcription was the main way control-ling TF expression after IAA stimulation in endothelial
cells, we added the transcription inhibitor Actinomycin D (Fig. 1e). Actinomycin D abolished the induction of TF mRNA expression by IAA, as well as the basal expression of TF mRNA. These findings suggest that the expression of TF induced by IAA in endothelial cells is controlled at the transcriptional level.
IAA induces TF expression via AhR activation but no AhR binding on TF promoter
We confirmed the involvement of AhR in IAA-mediated TF expression using an AhR pharmacological inhibitor CH223191, and AhR siRNA. The up-regulation by IAA of TF mRNA (Fig. 2a) and protein (Fig. 2b) expression was abolished by CH223191 and by AhR siRNA. CH223191 and AhR siRNA alone had no significant effect on basal TF mRNA and protein expression (Fig. 2a, b).
AhR can regulate transcription directly by binding on gene promoter in a so called genomic pathway, or indirectly by activating other transcription factors in a non-genomic pathway. We first studied by ChIP experiments whether AhR binds directly to the TF promoter to induce TF expression in HUVEC. ChIP experiments demonstrated no enrichment of AhR on the promoter of TF, showing that AhR was not directly recruited to the TF promoter in endothelial cells following IAA stimulation (Fig. 2c). As expected, AhR was recruited to the CYP1A1 and CYP1B1 promoters, known to contain XRE sequences, after HUVEC stimulation by IAA (Fig. 2c). This confirms that IAA induces AhR recruitment to the promoters of target genes known to be up-regulated by the genomic pathway. We next analyzed the nuclear trans-location of AhR by studying AhR expression in nuclear and cytoplasmic extracts after stimulation of HUVEC by IAA in presence of the AhR inhibitor CH223191. IAA increased the nuclear level of AhR, which was strongly decreased when cells were incubated with the AhR inhibitor CH223191 (Fig. 2d). In parallel, IAA caused a decrease in the cyto-plasmic level of AhR, which was prevented by CH223191. We next examined the effect of IAA on the up-regulation of CYP1A1 and CYP1B1 in HUVEC in presence of CH223191. IAA induced a marked increase in mRNA expression of CYP1A1 and CYP1B1, which was abolished by the pres-ence of CH223191 (Fig. 2e, f).
The NF‑κB site in TF promoter is necessary for TF induction by IAA
Because AhR did not directly bind to TF promoter after HUVEC stimulation by IAA, we studied the regulation of TF transcription using a TF promoter-luciferase reporter system, containing upstream binding sites for transcrip-tion factors known to up-regulate TF: AP-1, NF-κB, Egr-1, and Sp1 (Oeth et al. 1997; Li et al. 2009). We focused
Fig. 2 IAA induces AHR activation but no binding of AhR on TF promoter. Effect of the AhR inhibitor CH-223191 (10 μM) and of AhR siRNA on Tissue Factor mRNA (a) and protein (b) expres-sion after a 4-h incubation with 50 μM IAA. TF mRNA expression was studied by comparative RT-qPCR and expressed in mRNA fold change vs. control. TF protein expression was studied by ELISA. Data represent the mean ± SEM of at least 5 independent experi-ments. *p < 0.05, **p < 0.01, ***p < 0.0001. c AhR binding to the promoters of Tissue Factor, CYP1A1, and CYP1B1 was studied by chromatin immunoprecipitation (ChIP) after 1 h of HUVEC stimu-lation by 50 µM IAA. Data, expressed in fold enrichment, represent the mean ± SEM of n = 6 independent experiments. d AhR level in nuclear and cytoplasmic extracts was studied by Western blot after 30 min stimulation of HUVEC with 50 μM IAA in presence of the AhR inhibitor CH223191 (10 μM). Pictures are representative of 3 independent experiments. mRNA expression of AhR-target genes CYP1A1 (e) and CYP1B1 (f) after 4-h incubation with IAA (50 µM) was studied by comparative RT-qPCR in presence of the AhR inhibi-tor CH-223191 (10 µM). Data, expressed in mRNA fold change vs. control, represent the mean ± SEM of 10 independent experiments. **p < 0.01, ***p < 0.001
◂
Archives of Toxicology
1 3
here on transcription factors involved in TF up-regulation by inflammatory stimuli: AP-1 and NF-κB (Bode and Mack-man 2014). Luciferase plasmids containing either a wild-type TF promoter (− 227 WT), or one containing a NF-κB non-binding mutant (− 227 mNF-κB), or one containing
AP-1 non-binding sites (− 227 mAP1), were transfected into HUVEC. In cells transfected with the wild-type TF construct, the luciferase activity was 70% higher in IAA-stimulated cells that in control cells (Fig. 3a). The mutation of AP-1 sites in the TF promoter construct (− 227 mAP1)
Archives of Toxicology
1 3
significantly decreased the luciferase activity in both con-trol and IAA-stimulated cells (Fig. 3a). However, the − 227-mAP-1 promoter activity was 53% higher in IAA-treated cells than in ethanol-treated control cells. This led us to study the nuclear level of the AP-1 subunits c-Fos and c-Jun in IAA-stimulated HUVEC. The nuclear level of both c-fos and c-jun was not higher in IAA-treated cells than in control cells (Supplemental Fig. 2).
We next studied the role of NF-κB in the effect of IAA on TF transcription in using the NF-κB non-binding mutant (− 227 mNF-κB) construct. The induction of the promoter activity by IAA was significantly lower in the mutant NF-κB construct than in the wild-type. Interestingly, the activity of the TF promoter mutated for the NF-κB site was simi-lar in IAA-treated cells and in ethanol-treated control cells (Fig. 3a). In addition, in control cells, no difference in pro-moter activity was observed between cells transfected with the − 227WT and the − 227 mNF-κB. These data indicate that the NF-κB site is crucial for IAA-mediated TF gene transcription.
Cooperative role between AhR and NF‑κB in TF induction by IAA
Because the mutation of the NF-κB site resulted in decrease in TF promoter activity, we studied the involvement of NF-κB pathway in TF induction by IAA. We incubated HUVEC with IAA for 4 h in the presence of the pharmaco-logical inhibitor of IκB kinase (IκK) BAY 11-7082. BAY 11-7082 drastically decreased the induction of TF mRNA (Fig. 3b) and protein (Fig. 3c) by IAA. This suggests that NF-κB activation is involved in TF induction by IAA. Sub-sequently, we studied the level of the NF-κB p50 subunits in nuclear extracts of HUVEC stimulated during 30 min by IAA. IAA increased the nuclear level of NF-κB p50 (Fig. 3d) and p65 (Supplemental Fig. 3). We then analyzed the effect of pharmacological inhibitors of IκK (BAY 11-7082) and
AhR (CH223191). Nuclear translocation of p50 was inhib-ited by the IκK inhibitor BAY 11-7082 (Fig. 3d). Interest-ingly, the increase in p50 nuclear level was also inhibited by the AhR inhibitor CH223191 (Fig. 3d) and by AhR siRNA (Supplemental Fig. 4), showing that IAA activated NF-κB via AhR.
Involvement of p38 MAPK in IAA‑mediated TF induction
We studied the involvement of Protein Kinase C (PKC) and of p38 and ERK1/2 MAP Kinases in TF induction by IAA. HUVEC were stimulated by IAA for 4 h in presence of the PKC inhibitor Bisindolymaleimide I, the p38 inhibitor SB203580, and the ERK1/2 inhibitor PD98059. TF mRNA induction by IAA was significantly decreased by the p38 and PKC inhibitors, but not significantly modified by the ERK1/2 inhibitor (Fig. 4a). The p38 and PKC inhibitors also decreased TF protein induction by IAA (Fig. 4b). This suggests that the p38 and the PKC pathways are involved in IAA-mediated TF up-regulation.
We finally evaluated the effect of p38 and PKC inhibi-tors on IAA-induced NF-κB activation. The increase in nuclear p50 level caused by IAA (Fig. 4c) was inhibited by SB203580 but not by Bisindolymaleimide I, suggesting that p38 but not PKC is involved in IAA-induced NF-κB nuclear translocation.
Taken together, our data showed that IAA up-regulates TF expression by an inflammatory non genomic AhR/p38 MAPK/NF-κB pathway (Fig. 5).
Circulating TF levels are independently related to IAA levels in hemodialyzed patients
We studied a cohort of 92 hemodialyzed (HD) patients (Table 1) and measured the plasma levels of circulating TF (cTF). Mean cTF values were 133 ± 66 pg/mL (median 131 pg/mL) and ranged from 36 to 410 pg/mL. At baseline, cTF levels negatively correlated with residual renal function (r = − 0.27, p < 0.01), and positively correlated with serum cholesterol (r = 0.24 p < 0.05), HDL-cholesterol (r = 0.22, p < 0.05), and with the uremic toxins β2-microglobulin (r = 0.22 p < 0.05) and IAA (r = 0.32, p < 0.01) (Table 2). In multivariate linear regression analysis in HD patients, only serum IAA [estimate = 3.36, 95% CI (0.41–6.3), p < 0.05] was significantly associated with cTF level (Table 3).
Fig. 3 NF-κB is activated by IAA and is involved in Tissue Factor up-regulation. a The identification of the IAA-sensitive transcrip-tion factor binding site in the TF promoter was studied using TF promoter-luciferase reporter system. Luciferase plasmids containing either a wild-type TF promoter (− 227 WT), or NF-κB non-binding mutant (− 227 mNF-κB) or AP-1 non-binding site (− 227 mAP1) were transfected into HUVEC. After 6 h of HUVEC stimulation by 50 µM IAA, data expressed in fold induction normalized luciferase activity. After HUVEC incubation with IAA (50 µM) in presence of the I Kappa Kinase (IκK) inhibitor BAY 11-7082 (10 µM), Tissue Factor mRNA expression (b) was studied by comparative RT-qPCR and expressed in mRNA fold change vs. control; Tissue Factor pro-tein expression (c) was studied by ELISA. Endothelial p50 expression in nuclear extracts (d) was measured after 30 min incubation with IAA 50 µM, in presence of the AhR inhibitor CH223191 (10 µM) or the IκK inhibitor BAY 11-7082 (10 µM). Data represent the mean ± SEM of 6 (a) or 4 (b–d) independent experiments, *p < 0.05, **p < 0.01
◂
Archives of Toxicology
1 3
Discussion
In this study, we demonstrated that TF induction by IAA is mediated by an AhR non genomic pathway involving p38MAPK and NF-κB activation.
IAA is a protein-bound uremic toxin, mostly produced from tryptophan metabolism by intestinal bacteria (Fernan-dez-Prado et al. 2017). IAA is an endogenous AhR agonist, which has similar endothelial effects to those of exogenous AhR-activating pollutants like TCDD, benzo [a] pyrene,
Fig. 4 Study of MAPK and PKC involvement in Tissue Factor up-regulation by IAA. mRNA expression (a) of Tissue Factor was studied by com-parative RT-qPCR after 4-h incubation with IAA (50 µM) in presence of the PKC inhibitor (Bisindolymaleimide I, 5 µM), the p38 MAPK inhibitor (SB203580, 10 µM), and the ERK1/2 inhibitor (PD98059, 10 µM). Data are expressed in mRNA fold change vs. control. Protein expression (b) of Tissue Factor was studied by ELISA after incubation with IAA (50 µM) in presence of the PKC inhibitor (Bisindolymaleimide I, 5 µM), and the p38 MAPK inhibitor (SB203580, 10 µM). Endothelial p50 level (c) was measured in nuclear extracts after 30 min incubation with IAA 50 µM, in presence of the PKC inhibitor (Bisindolyma-leimide I, 5 µM), and the p38 MAPK inhibitor (SB203580, 10 µM). Data represent the mean ± SEM of at least 4 inde-pendent experiments, *p < 0.05
Archives of Toxicology
1 3
PCB126, and PCB77 (Sallée et al. 2014). It induces the pro-duction of reactive oxygen species, up-regulates the expres-sion of inflammatory molecules COX-2, IL-8, ICAM-1, and MCP-1 (Dou et al. 2015), and increases the expression and the procoagulant activity of TF in HUVEC (Gondouin et al. 2013). Here, we show that IAA increases TF expression in endothelial cells from other vessel types: arterial (aortic) and microvascular (cardiac-derived). We also observed that human serum albumin did not modify IAA effect on tis-sue factor induction, supporting that IAA, whether free or protein-bound, induces TF up-regulation.
TF is usually not expressed by endothelial cells under normal conditions. However, it could be expressed in some pathologic conditions in vivo (Bode and Mackman 2014). In vitro induction of TF expression in endothelial cells is mediated by various intracellular signaling pathways and by the transcription factors NF-κB, AP-1, NFAT, and Egr-1, depending on the stimulus (LPS, IL-1β, TNF-α, thrombin and VEGF) (Bode and Mackman 2014). Using AhR siRNA, we previously described a new pathway of TF induction by IAA that is mediated by AhR activation (Gondouin et al. 2013). We confirm here that an AhR-specific antagonist, CH223191, is able to reduce IAA-mediated TF expression.
The induction of TF in response to stimuli is mainly regu-lated at the transcriptional level; but some stimuli may also increase the stability of TF mRNA and/or protein (Crossman et al. 1990; Brand et al. 1991; Ahern et al. 1993; Reddy et al. 2004). The regulation of TF by IAA was well studied in vascular smooth muscle cells by the group of Chitalia. They showed that IAA prolongs the half-life of TF protein by decreasing its ubiquitination (Chitalia et al. 2013). They further demonstrated in vascular smooth muscle cells that
AhR directly interacts with TF and reduces the level of TF ubiquitination (Shivanna et al. 2016) and that the ubiquitin ligase STUB1 dynamically interacts with TF (Shashar et al. 2017). In our study in endothelial cells, TF mRNA up-reg-ulation by IAA was abolished in presence of the transcrip-tion inhibitor actinomycin D, supporting that transcription is the major mechanism of TF mRNA induction by IAA in endothelial cells. However, one cannot exclude that a post-translational regulation of TF exists, like in vascular smooth muscle cells.
Fig. 5 A diagram shows the AhR-related mechanisms underlying IAA-induced TF transcription in HUVEC. TF up-regulation by IAA in HUVEC is mediated by a non-genomic AhR/p38 MAPK/NF-κB pathway. This up-regulation does not involve AhR binding to the TF promoter; AhR activates p38 MAPK, which mediates NF-KB p50 nuclear translocation and binding to the TF promoter, leading to TF transcription
Table 1 Baseline characteristics of the HD population (n = 92)
Results are given as mean ± SD if distribution is Gaussian, or in median (min; max) if not*ADPKD autosomal dominant polycystic kidney disease
Age (years) 70 (23; 91)Gender ratio (W/M) 33/59Body Mass Index (kg/m2) 24.0 (14.3; 47)Kidney disease Glomerulonephritis 20 (22%) ADPKD* 7 (7%) Vascular 30 (33%) Interstitial 11 (12%) Other hereditary 2 (2%) Unknown 22 (24%)
Hypertension 82 (91%)Residual renal function 20 (21%)Systolic blood pressure (mmHg) 144 ± 24Diastolic blood pressure (mmHg) 73 ± 15Current smokers 27 (29%)History of cardiovascular diseases 37 (40%)Antihypertensive drugs 61 (66%)Statins 30 (32%)Antiplatelet drugs 49 (53%)Anticoagulant drugs 23 (25%)Erythropoietin therapy 71 (77%)Hemoglobin (g/dL) 11.6 ± 1.1Plasma TF (pg/mL) 131 (36; 410)Serum CRP level (mg/L) 7 (0; 78)Serum albumin level (g/L) 36.3 ± 4.4Serum calcium level (mmol/L) 2.34 ± 0.14Serum phosphate level (mmol/L) 1.53 (0.54; 3.17)Serum urea level (mmol/L) 19.9 ± 5.4Serum creatinine level (µmol/L) 759 (213; 1533)Serum cholesterol level (mmol/L) 4.3 ± 1.0Serum LDL-cholesterol level (mmol/L) 2.45 ± 0.87Serum HDL-cholesterol level (mmol/L) 1.05 (0.28; 2.57)Serum triglyceride level (mmol/L) 1.3 (0.6; 3.7)Serum β2microglobulin level (mg/L) 32.2 (17.4; 66.9)Serum p-cresylsulfate level (µM) 104 (4.3; 443.6)Serum Indole-3 acetic acid level (µM) 4.3 (1.0; 19.1)Serum indoxyl sulfate level (µM) 88.6 (0.2; 256.2)
Archives of Toxicology
1 3
The classical genomic pathway of AhR target genes up-regulation is based on dimers of ligand-activated AhR and AhR nuclear translocator (ARNT), which directly activate gene expression. Upon ligand binding to AhR, it is trans-located into the nucleus where it associates with its heter-odimerization partner ARNT. The AHR/ARNT heterodimer binds to DNA sequence motif, referred to as XRE, within the promoters of target genes. In the XRE (5′-TNGCGTG-3′), a minimum core sequence of 5′-GCGTG-3′ is required for AHR/ARNT binding (Swanson et al. 1995) and induc-tion of target genes like xenobiotic-metabolizing enzymes CYP1A1 and CYP1B1 (Dolwick et al. 1993; Fujii-Kuriyama and Mimura 2005). Recently, a genomic, ARNT-independ-ent pathway for AhR-mediated gene expression has been reported (Jackson et al. 2015), with a novel non-consensus XRE (NC-XRE) described in the promoter of PAI-1 (Huang and Elferink 2012) and in p21Cip1 promoter (Jackson et al. 2014). The AhR-dependent gene expression mediated through the NC-XRE does not involve the ARNT as a com-ponent of the NC-XRE bound AhR complex. We report here that IAA activates the classical genomic pathway of AhR in HUVEC. IAA induces AhR nuclear translocation and AhR binding to the promoters of its target genes CYP1A1 and CYP1B1, leading to upregulation of CYP1A1 and CYP1B1 mRNA. The AhR inhibitor CH223191 reduces AhR nuclear translocation mediated by IAA and abolishes IAA-induced expression of CYP1A1 and CYP1B1. CH223191 was ini-tially described as an inhibitor of TCDD binding to AhR, which inhibits AhR nuclear translocation induced by TCDD (Kim et al. 2006). One can suppose that CH223191 also inhibits IAA binding to AhR. Importantly, we showed that AhR does not directly bind to the TF promoter, support-ing that the classical genomic pathway of AhR activation is not involved in TF up-regulation by IAA. This result agrees with the absence of description in the literature of an XRE sequence in the TF promoter, excludes the presence of a NC-XRE in the TF promoter, and suggests the activation of the non-genomic pathway of AhR by IAA.
Once activated by ligand, AhR can also elicit inflam-mation through the non-genomic pathway, which does not require the participation of ARNT (Matsumura 2009). We supposed that AhR activation could initiate alterna-tive signaling pathways without direct DNA binding of AhR on TF gene promoter. It has been shown that AhR could activate others transcription factors such as AP-1 (Di Meglio et al. 2014; Ito et al. 2016) and NF-κB (Borlak and Jenke 2008; Vogel and Matsumura 2009; Vogel et al. 2011, 2013; Øvrevik et al. 2014) to drive expression of genes, by a protein kinase-dependent non-genomic route. We previously reported that IAA induces inflammatory endothelial COX-2 expression via non-genomic pathway of AhR involving NF-κB (Dou et al. 2015). To determine the transcription factors involved in TF up-regulation by
Table 2 Two-tailed Spearman correlations of baseline characteristics with TF plasma levels in the HD cohort (n = 92)
TF
r p
Age 0.08 0.4Gender − 0.19 0.08Body Mass Index 0.00 1Kidney disease − 0.18 0.08Residual renal function − 0.27 < 0.01Systolic Blood Pressure − 0.01 0.9Diastolic Blood Pressure − 0.08 0.4Current smoking − 0.05 0.6History of cardiovascular diseases − 0.05 0.6Antihypertensive drugs − 0.08 0.5Statins − 0.18 0.4Antiplatelet drugs − 0.18 0.08Anticoagulant drugs 0.12 0.3Erythropoietin therapy − 0.11 0.3Hemoglobin 0.17 0.1Serum CRP level 0.12 0.3Serum albumin level − 0.08 0.4Serum calcium level − 0.07 0.5Serum phosphate level − 0.15 0.2Serum urea level − 0.05 0.6Serum creatinine level 0.03 0.7Serum cholesterol level 0.24 < 0.05Serum LDL-cholesterol level 0.18 0.09Serum HDL-cholesterol level 0.22 < 0.05Serum triglyceride level 0.04 0.7Serum β2microglobulin level 0.22 < 0.05Serum p-cresylsulfate level 0.07 0.5Serum Indole-3 acetic acid level 0.32 < 0.01Serum indoxyl sulfate level − 0.1 0.3
Table 3 Multivariate linear regression analysis for evaluating the relation between independent variables and TF plasma levels in HD patients (n = 92)
TF
Estimate 95% CI p value
Age 0.18 [− 0.75 to 1.12] 0.7Gender 21.66 [− 7.36 to 50.69] 0.14Residual renal function − 23.81 [− 55.45 to 7.83] 0.14Serum Indole-3 acetic acid
level3.54 [0.66 to 6.43] < 0.05
Serum β2microglobulin 1.1 [− 0.4 to 2.61] 0.15Serum cholesterol level 11.21 [− 3.13 to 25.55] 0.12Serum HDL-cholesterol level 3.35 [− 30.86 to 37.56] 0.8
Archives of Toxicology
1 3
IAA, we studied IAA-induced TF transcription using a classic proximate TF promoter model, with binding sites for transcription factors AP-1, NF-κB, Egr-1, and Sp1. We clearly demonstrated the role of NF-κB in IAA-mediated TF expression. We showed that the NF-κB site is essential in TF promoter activity induced by IAA. In addition, an inhibitor of IκB Kinase, which avoids the phosphoryla-tion of IκB and the subsequent NF-κB activation, strongly inhibited TF mRNA and protein induction by IAA. Then, we showed that IAA increased the nuclear level of the NF-κB p50 and p65 subunits, which are critical regulators of TF (Li et al. 2009). This does not exclude that other NF-KB subunits could be activated by IAA. Interestingly, IAA-induced p50 nuclear translocation was decreased when AhR was inhibited; supporting that nuclear translo-cation of p50 was mediated by AhR activation. All these results demonstrated the crucial role of NF-κB in AhR-mediated TF induction by IAA. We also observed that the mutation of the AP-1 site significantly decreased TF promoter activity in both control and IAA-stimulated cells, but IAA still increased TF promoter activity when the AP-1 site was mutated. Furthermore, IAA did not increase nuclear level of c-Jun and c-fos subunits of AP-1. These results suggest than the AP-1 site is required for basal TF expression and is only partially involved in TF induction by IAA. One cannot exclude that other AP-1 subunits may be involved, or that AP-1 cooperates with NF-κB to induce TF expression as described in the literature for other ago-nists (Mackman et al. 1991; Parry and Mackman 1995; Armstead et al. 1999; Xia et al. 2013, 2016).
Studies show the cross-talk of AhR and multiple signal transduction pathways, notably MAP Kinases (Henklová et al. 2008; Puga et al. 2009a); and conventional AhR acti-vators such as TCDD and benzo [a] pyrene activate MAP kinases (Henklová et al. 2008; Puga et al. 2009a). In our previous study, we demonstrated that IAA induces p38 MAPK and ERK phosphorylation (Dou et al. 2015). We found here that p38 MAPK, but not ERK, is involved in TF up-regulation by IAA. We previously showed that AhR inhibition decreases IAA-induced p38 phosphorylation (Dou et al. 2015), supporting that AhR is the upstream regula-tor of p38. Here, we observed that p38 inhibition decreased TF up-regulation by IAA. Furthermore, IAA-induced p50 nuclear translocation was decreased by inhibitors of both AhR and p38 MAPK. Therefore, in addition to the activa-tion of the classical genomic pathway, the binding of IAA to AhR initiates a cytoplasmic signaling pathway that acti-vates p38 MAPK, which then activates NF-κB to induce TF expression.
We also observed the involvement of PKC in TF up-reg-ulation by IAA, but the absence of inhibition of p50 nuclear translocation by the PKC inhibitor suggests that PKC is not
involved in the AhR/p38 cytoplasmic signaling pathway that leads to p50 nuclear translocation. PKCs are usually known for their key role in cytoplasmic signal transduction; they can also directly regulate gene expression through signal transduction within the nucleus, a process distinct from the cytoplasmic signaling pathways (Lim et al. 2015). Within the nucleus, PKCs can directly regulate gene transcription through either phosphorylating specific histone residues or phosphorylating transcription factors (Lim et al. 2015). For example, PKCα can phosphorylate NF-κB p65 at S276, which is important for transcriptional activation of NF-κB (Lim et al. 2015). Our results allow to hypothesize that PKC could play a role in IAA-induced TF transcription as an epi-genetic regulator that could be involved in histone or NF-KB phosphorylation, rather than as a cytoplasmic signal trans-ducer involved in AhR/p38 signaling pathway.
TF upregulation induced by IAA has functional conse-quences on thrombogenicity. Indeed, the increase TF pro-tein abundance induced by IAA, such as uremic serum and the indolic uremic toxin indoxyl sulfate, is associated with increased procoagulant activity in endothelial cells and vascular smooth muscle cells (Chitalia et al. 2013; Gon-douin et al. 2013), and increases thrombogenicity in an ex-vivo model (Chitalia et al. 2013). An antibody against endothelial TF prevents platelet deposition on cultured endothelial cells induced by uremic serum (Serradell et al. 2001), suggesting that the presence of endothelial TF is responsible for the enhanced platelet deposition. Patients with CKD display high levels of cTF and increased TF-dependent procoagulant activity (Gondouin et al. 2013; Shivanna et al. 2016).
cTF levels in CKD patients are related to some ure-mic toxins that are AhR agonists. Kynurenine levels are associated with cTF levels and hypercoagulability in HD patients (Pawlak et al. 2009); cTF levels are correlated with indoxyl sulfate in CKD patients not on dialysis (Gon-douin et al. 2013). We found here that cTF level positively correlated with serum cholesterol, HDL-cholesterol, and with the uremic toxins β2-microglobulin and IAA in sim-ple correlation analysis. However, we did not found a posi-tive correlation between cTF and indoxyl sulfate in HD patients, as we had previously observed in not dialyzed CKD patients (Goundouin et al. 2013). In multivariate linear regression analysis, only serum IAA was signifi-cantly and independently associated with cTF level. We previously identified IAA as an independent predictor of cardiovascular events and mortality in CKD patients (Dou et al. 2015). TF up-regulation is part of the mechanisms by which IAA may induce atherothrombosis in patients with CKD. Furthermore, cTF negatively correlated with residual renal function (in simple analysis) in HD patients in the present study, and with estimated GFR in not
Archives of Toxicology
1 3
dialyzed CKD patients in our previous study (Gondouin et al. 2013). This suggests that the preservation of renal function in HD patients could be advantageous to prevent the increase in cTF levels.
In CKD patients, we recently showed high level of AhR agonists and an activation of the AhR pathway in cells from CKD patients (Dou et al. 2018). AhR has been proposed as a therapeutic target to reduce TF levels, for a better manage-ment of increased thrombosis in CKD (Shivanna et al. 2016). However, targeting AhR would also result in inhibition of the AhR genomic pathway that is crucial in detoxification processes. Therefore, it would be interesting to specifically target the thrombotic/inflammatory non genomic pathway of AhR activation, while preserving the AhR genomic pathway. Thus, understanding of signal transduction pathways related to AhR thrombotic/inflammatory non genomic pathway is of interest to find therapeutic targets.
In conclusion, we demonstrated that IAA induces TF expression via an AhR/ p38 MAPK/ NF-κB inflamma-tory pathway. A better understanding of the mechanisms involved in TF induction by uremia/uremic toxins could provide new therapeutic targets to reduce the thrombotic risk in patients with CKD.
Acknowledgements This work was supported by funding from the Aix-Marseille University, the Institut National de la santé et de la Recherche médicale (INSERM), the European Uremic Toxins (EUTox) Work Group, the University of Oran 1 Ahmed Benbella, and the Alge-rian Ministry of Higher Education and Scientific Research. We thank K. Fallague and C. Scagliarini for technical assistance.
Compliance with ethical standards
Conflict of interest The authors declare that they have no conflict of interest.
Ethical approval All procedures performed in studies involving human participants were in accordance with the ethical standards of the insti-tutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.
References
Ahern SM, Miyata T, Sadler JE (1993) Regulation of human tissue fac-tor expression by mRNA turnover. J Biol Chem 268:2154–2159
Armstead VE, Opentanova IL, Minchenko AG, Lefer AM (1999) Tis-sue factor expression in vital organs during murine traumatic shock: role of transcription factors AP-1 and NF-kappaB. Anes-thesiology 91:1844–1852. https ://doi.org/10.1097/00000 542-19991 2000-00039
Barreto FC, Barreto DV, Liabeuf S, Meert N, Glorieux G, Temmar M, Choukroun G, Vanholder R, Massy ZA, Group (EUTox) on behalf of the EUTW (2009) Serum indoxyl sulfate is associated with vascular disease and mortality in chronic kidney disease patients. CJASN 4:1551–1558. https ://doi.org/10.2215/CJN.03980 609
Bode M, Mackman N (2014) Regulation of tissue factor gene expres-sion in monocytes and endothelial cells: thromboxane A2 as a new player. Vascul Pharmacol 62:57–62. https ://doi.org/10.1016/j.vph.2014.05.005
Borlak J, Jenke HS (2008) Cross-talk between aryl hydrocarbon recep-tor and mitogen-activated protein kinase signaling pathway in liver cancer through c-raf transcriptional regulation. Mol Cancer Res 6:1326–1336. https ://doi.org/10.1158/1541-7786.MCR-08-0042
Brand K, Fowler BJ, Edgington TS, Mackman N (1991) Tissue factor mRNA in THP-1 monocytic cells is regulated at both transcrip-tional and posttranscriptional levels in response to lipopolysac-charide. Mol Cell Biol 11:4732–4738
Calaf R, Cerini C, Génovésio C, Verhaeghe P, Jourde-Chiche N, Bergé-Lefranc D, Gondouin B, Dou L, Morange S, Argilés A, Rathelot P, Dignat-George F, Brunet P, Charpiot P (2011) Deter-mination of uremic solutes in biological fluids of chronic kidney disease patients by HPLC assay. J Chromatogr B Anal Technol Biomed Life Sci 879:2281–2286. https ://doi.org/10.1016/j.jchro mb.2011.06.014
Camerer E, Kolstø AB, Prydz H (1996) Cell biology of tissue fac-tor, the principal initiator of blood coagulation. Thromb Res 81:1–41
Carney EF (2016) Thrombosis: new mechanism of thrombus forma-tion in CKD. Nat Rev Nephrol 12:715. https ://doi.org/10.1038/nrnep h.2016.155
Chitalia VC, Shivanna S, Martorell J, Balcells M, Bosch I, Kolan-daivelu K, Edelman ER (2013) Uremic serum and solutes increase post-vascular interventional thrombotic risk through altered stabil-ity of smooth muscle cell tissue factor. Circulation 127:365–376. https ://doi.org/10.1161/CIRCU LATIO NAHA.112.11817 4
Crossman DC, Carr DP, Tuddenham EG, Pearson JD, McVey JH (1990) The regulation of tissue factor mRNA in human endothe-lial cells in response to endotoxin or phorbol ester. J Biol Chem 265:9782–9787
Daneschvar HL, Seddighzadeh A, Piazza G, Goldhaber SZ (2008) Deep vein thrombosis in patients with chronic kidney disease. Thromb Haemost 99:1035–1039. https ://doi.org/10.1160/TH08-02-0107
Di Meglio P, Duarte JH, Ahlfors H, Owens NDL, Li Y, Villanova F, Tosi I, Hirota K, Nestle FO, Mrowietz U, Gilchrist MJ, Stockinger B (2014) Activation of the aryl hydrocarbon receptor dampens the severity of inflammatory skin conditions. Immunity 40:989–1001. https ://doi.org/10.1016/j.immun i.2014.04.019
Dolwick KM, Swanson HI, Bradfield CA (1993) In vitro analysis of Ah receptor domains involved in ligand-activated DNA recognition. Proc Natl Acad Sci USA 90:8566–8570
Dou L, Sallée M, Cerini C, Poitevin S, Gondouin B, Jourde-Chiche N, Fallague K, Brunet P, Calaf R, Dussol B, Mallet B, Dignat-George F, Burtey S (2015) The cardiovascular effect of the uremic solute indole-3 acetic acid. J Am Soc Nephrol 26:876–887. https ://doi.org/10.1681/ASN.20131 21283
Dou L, Poitevin S, Sallée M, Addi T, Gondouin B, McKay N, Deni-son MS, Jourde-Chiche N, Duval-Sabatier A, Cerini C, Brunet P, Dignat-George F, Burtey S (2018) Aryl hydrocarbon receptor is activated in patients and mice with chronic kidney disease. Kidney Int 93:986–999. https ://doi.org/10.1016/j.kint.2017.11.010
Fernandez-Prado R, Esteras R, Perez-Gomez MV, Gracia-Iguacel C, Gonzalez-Parra E, Sanz AB, Ortiz A, Sanchez-Niño MD (2017) Nutrients turned into toxins: microbiota modulation of nutri-ent properties in chronic kidney disease. Nutrients. https ://doi.org/10.3390/nu905 0489
Fujii-Kuriyama Y, Mimura J (2005) Molecular mechanisms of AhR functions in the regulation of cytochrome P450 genes. Biochem Biophys Res Commun 338:311–317. https ://doi.org/10.1016/j.bbrc.2005.08.162
Archives of Toxicology
1 3
Go AS, Chertow GM, Fan D, McCulloch CE, Hsu C (2004) Chronic kidney disease and the risks of death, cardiovascular events, and hospitalization. N Engl J Med 351:1296–1305. https ://doi.org/10.1056/NEJMo a0410 31
Gondouin B, Cerini C, Dou L, Sallée M, Duval-Sabatier A, Pletinck A, Calaf R, Lacroix R, Jourde-Chiche N, Poitevin S, Arnaud L, Van-holder R, Brunet P, Dignat-George F, Burtey S (2013) Indolic ure-mic solutes increase tissue factor production in endothelial cells by the aryl hydrocarbon receptor pathway. Kidney Int 84:733–744. https ://doi.org/10.1038/ki.2013.133
Han H, Zhu J, Zhu Z, Ni J, Du R, Dai Y, Chen Y, Wu Z, Lu L, Zhang R (2015) p-Cresyl sulfate aggravates cardiac dysfunction associated with chronic kidney disease by enhancing apoptosis of cardio-myocytes. J Am Heart Assoc 4:e001852. https ://doi.org/10.1161/JAHA.115.00185 2
Hankinson O (1995) The Aryl Hydrocarbon Receptor Complex. Annu Rev Pharmacol Toxicol 35:307–340. https ://doi.org/10.1146/annur ev.pa.35.04019 5.00151 5
Heath-Pagliuso S, Rogers WJ, Tullis K, Seidel SD, Cenijn PH, Brouwer A, Denison MS (1998) Activation of the Ah receptor by trypto-phan and tryptophan metabolites. Biochemistry 37:11508–11515. https ://doi.org/10.1021/bi980 087p
Heid SE, Pollenz RS, Swanson HI (2000) Role of heat shock protein 90 dissociation in mediating agonist-induced activation of the aryl hydrocarbon receptor. Mol Pharmacol 57:82–92
Henklová P, Vrzal R, Ulrichová J, Dvorák Z (2008) Role of mitogen-activated protein kinases in aryl hydrocarbon receptor signal-ing. Chem Biol Interact 172:93–104. https ://doi.org/10.1016/j.cbi.2007.12.005
Huang G, Elferink CJ (2012) A novel nonconsensus xenobiotic response element capable of mediating aryl hydrocarbon receptor-dependent gene expression. Mol Pharmacol 81:338–347. https ://doi.org/10.1124/mol.111.07595 2
Huang M-J, Wei R-B, Wang Y, Su T-Y, Di P, Li Q-P, Yang X, Li P, Chen X-M (2017) Blood coagulation system in patients with chronic kidney disease: a prospective observational study. BMJ Open 7:e014294. https ://doi.org/10.1136/bmjop en-2016-01429 4
Ito S, Osaka M, Edamatsu T, Itoh Y, Yoshida M (2016) Crucial role of the aryl hydrocarbon receptor (AhR) in indoxyl sulfate-induced vascular inflammation. J Atheroscler Thromb 23:960–975. https ://doi.org/10.5551/jat.34462
Jackson DP, Li H, Mitchell KA, Joshi AD, Elferink CJ (2014) Ah receptor-mediated suppression of liver regeneration through NC-XRE-driven p21Cip1 expression. Mol Pharmacol 85:533–541. https ://doi.org/10.1124/mol.113.08973 0
Jackson DP, Joshi AD, Elferink CJ (2015) Ah receptor pathway intrica-cies; signaling through diverse protein partners and DNA-motifs. Toxicol Res (Camb) 4:1143–1158
Jaffe EA, Nachman RL, Becker CG, Minick CR (1973) Culture of human endothelial cells derived from umbilical veins. Identifi-cation by morphologic and immunologic criteria. J Clin Invest 52:2745–2756. https ://doi.org/10.1172/JCI10 7470
Jalal DI, Chonchol M, Targher G (2010) Disorders of hemostasis associated with chronic kidney disease. Semin Thromb Hemost 36:34–40. https ://doi.org/10.1055/s-0030-12487 22
Jourde-Chiche N, Dou L, Cerini C, Dignat-George F, Vanholder R, Brunet P (2009) Protein-bound toxins–update 2009. Semin Dial 22:334–339. https ://doi.org/10.1111/j.1525-139X.2009.00576 .x
Kim S-H, Henry EC, Kim D-K, Kim Y-H, Shin KJ, Han MS, Lee TG, Kang J-K, Gasiewicz TA, Ryu SH, Suh P-G (2006) Novel compound 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazo-phenyl)-amide (CH-223191) prevents 2,3,7,8-TCDD-induced toxicity by antagonizing the aryl hydrocarbon recep-tor. Mol Pharmacol 69:1871–1878. https ://doi.org/10.1124/mol.105.02183 2
Kim MJ, Pelloux V, Guyot E, Tordjman J, Bui L-C, Chevallier A, Forest C, Benelli C, Clément K, Barouki R (2012) Inflammatory pathway genes belong to major targets of persistent organic pol-lutants in adipose cells. Environ Health Perspect 120:508–514. https ://doi.org/10.1289/ehp.11042 82
Li Y-D, Ye B-Q, Zheng S-X, Wang J-T, Wang J-G, Chen M, Liu J-G, Pei X-H, Wang L-J, Lin Z-X, Gupta K, Mackman N, Slungaard A, Key NS, Geng J-G (2009) NF-kappaB transcription factor p50 critically regulates tissue factor in deep vein thrombosis. J Biol Chem 284:4473–4483. https ://doi.org/10.1074/jbc.M8060 10200
Lim PS, Sutton CR, Rao S (2015) Protein kinase C in the immune system: from signalling to chromatin regulation. Immunology 146:508–522. https ://doi.org/10.1111/imm.12510
Ma C, Marlowe JL, Puga A (2009) The aryl hydrocarbon receptor at the crossroads of multiple signaling pathways. In: Molecular, clini-cal and environmental toxicology. Birkhäuser, Basel, pp 231–257
Mackman N, Brand K, Edgington TS (1991) Lipopolysaccharide-medi-ated transcriptional activation of the human tissue factor gene in THP-1 monocytic cells requires both activator protein 1 and nuclear factor kappa B binding sites. J Exp Med 174:1517–1526
Mandal PK (2005) Dioxin: a review of its environmental effects and its aryl hydrocarbon receptor biology. J Comp Physiol B 175:221–230. https ://doi.org/10.1007/s0036 0-005-0483-3
Matsumura F (2009) The significance of the nongenomic pathway in mediating inflammatory signaling of the dioxin-activated Ah receptor to cause toxic effects. Biochem Pharmacol 77:608–626. https ://doi.org/10.1016/j.bcp.2008.10.013
Moradi H, Sica DA, Kalantar-Zadeh K (2013) Cardiovascular burden associated with uremic toxins in patients with chronic kidney dis-ease. Am J Nephrol 38:136–148. https ://doi.org/10.1159/00035 1758
Neirynck N, Glorieux G, Schepers E, Pletinck A, Dhondt A, Vanholder R (2013) Review of protein-bound toxins, possibility for blood purification therapy. Blood Purif 35(Suppl 1):45–50. https ://doi.org/10.1159/00034 6223
Oeth P, Parry GC, Mackman N (1997) Regulation of the tissue factor gene in human monocytic cells. Role of AP-1, NF-kappa B/Rel, and Sp1 proteins in uninduced and lipopolysaccharide-induced expression. Arterioscler Thromb Vasc Biol 17:365–374
Øvrevik J, Låg M, Lecureur V, Gilot D, Lagadic-Gossmann D, Refsnes M, Schwarze PE, Skuland T, Becher R, Holme JA (2014) AhR and Arnt differentially regulate NF-κB signaling and chemokine responses in human bronchial epithelial cells. Cell Commun Sig-nal 12:48. https ://doi.org/10.1186/s1296 4-014-0048-8
Parry GC, Mackman N (1995) Transcriptional regulation of tissue fac-tor expression in human endothelial cells. Arterioscler Thromb Vasc Biol 15:612–621
Pawlak K, Mysliwiec M, Pawlak D (2009) Hypercoagulability is inde-pendently associated with kynurenine pathway activation in dia-lysed uraemic patients. Thromb Haemost 102:49–55. https ://doi.org/10.1160/TH08-10-0696
Petrulis JR, Perdew GH (2002) The role of chaperone proteins in the aryl hydrocarbon receptor core complex. Chem Biol Interact 141:25–40
Puga A, Ma C, Marlowe JL (2009a) The aryl hydrocarbon receptor cross-talks with multiple signal transduction pathways. Biochem Pharmacol 77:713–722. https ://doi.org/10.1016/j.bcp.2008.08.031
Puga A, Ma C, Marlowe JL (2009b) The aryl hydrocarbon receptor cross-talks with multiple signal transduction pathways. Biochem Pharmacol 77:713. https ://doi.org/10.1016/j.bcp.2008.08.031
Reddy KV, Bhattacharjee G, Schabbauer G, Hollis A, Kempf K, Ten-cati M, O’Connell M, Guha M, Mackman N (2004) Dexametha-sone enhances LPS induction of tissue factor expression in human monocytic cells by increasing tissue factor mRNA stability. J Leu-koc Biol 76:145–151. https ://doi.org/10.1189/jlb.02040 68
Archives of Toxicology
1 3
Sallée M, Dou L, Cerini C, Poitevin S, Brunet P, Burtey S (2014) The aryl hydrocarbon receptor-activating effect of uremic toxins from tryptophan metabolism: a new concept to understand cardiovas-cular complications of chronic kidney disease. Toxins 6:934–949. https ://doi.org/10.3390/toxin s6030 934
Sciullo EM, Vogel CF, Li W, Matsumura F (2008) Initial and extended inflammatory messages of the nongenomic signaling pathway of the TCDD-activated Ah receptor in U937 macrophages. Arch Biochem Biophys 480:143–155. https ://doi.org/10.1016/j.abb.2008.09.017
Serradell M, Díaz-Ricart M, Cases A, Zurbano MJ, Aznar-Salatti J, López-Pedret J, Ordinas A, Escolar G (2001) Uremic medium disturbs the hemostatic balance of cultured human endothelial cells. Thromb Haemost 86:1099–1105
Shashar M, Belghasem ME, Matsuura S, Walker J, Richards S, Alousi F, Rijal K, Kolachalama VB, Balcells M, Odagi M, Nagasawa K, Henderson JM, Gautam A, Rushmore R, Francis J, Kirchhofer D, Kolandaivelu K, Sherr DH, Edelman ER, Ravid K, Chitalia VC (2017) Targeting STUB1-tissue factor axis normalizes hyper-thrombotic uremic phenotype without increasing bleeding risk. Sci Transl Med. https ://doi.org/10.1126/scitr anslm ed.aam84 75
Shivanna S, Kolandaivelu K, Shashar M, Belghasim M, Al-Rabadi L, Balcells M, Zhang A, Weinberg J, Francis J, Pollastri MP, Edel-man ER, Sherr DH, Chitalia VC (2016) The aryl hydrocarbon receptor is a critical regulator of tissue factor stability and an antithrombotic target in Uremia. J Am Soc Nephrol 27:189–201. https ://doi.org/10.1681/ASN.20141 21241
Storino G, Moraes C, Saldanha J, Mafra D (2015) Cardiovascular mortality in chronic kidney patients: the role of uremic toxins. Int J Cardiovasc Sci 28:327–334. https ://doi.org/10.5935/2359-4802.20150 047
Swanson HI, Chan WK, Bradfield CA (1995) DNA binding specifici-ties and pairing rules of the Ah receptor, ARNT, and SIM pro-teins. J Biol Chem 270:26292–26302
Tonelli M, Wiebe N, Culleton B, House A, Rabbat C, Fok M, McAlis-ter F, Garg AX (2006) Chronic kidney disease and mortality risk:
a systematic review. JASN 17:2034–2047. https ://doi.org/10.1681/ASN.20051 01085
Vanholder R, De Smet R, Glorieux G, Argilés A, Baurmeister U, Bru-net P, Clark W, Cohen G, De Deyn PP, Deppisch R, Descamps-Latscha B, Henle T, Jörres A, Lemke HD, Massy ZA, Passlick-Deetjen J, Rodriguez M, Stegmayr B, Stenvinkel P, Tetta C, Wanner C, Zidek W, European Uremic Toxin Work Group (EUTox) (2003) Review on uremic toxins: classification, concen-tration, and interindividual variability. Kidney Int 63:1934–1943. https ://doi.org/10.1046/j.1523-1755.2003.00924 .x
Vogel CFA, Matsumura F (2009) A new cross-talk between the Aryl hydrocarbon receptor and RelB, a member of the NF-κB fam-ily. Biochem Pharmacol 77:734–745. https ://doi.org/10.1016/j.bcp.2008.09.036
Vogel CFA, Li W, Wu D, Miller JK, Sweeney C, Lazennec G, Fujisawa Y, Matsumura F (2011) Interaction of Aryl hydrocarbon recep-tor and NF-κB subunit RelB in breast cancer is associated with Interleukin-8 overexpression. Arch Biochem Biophys 512:78–86. https ://doi.org/10.1016/j.abb.2011.05.011
Wattanakit K, Cushman M (2009) Chronic kidney disease and venous thromboembolism: epidemiology and mechanisms. Curr Opin Pulm Med 15:408–412. https ://doi.org/10.1097/MCP.0b013 e3283 2ee37 1
Xia L, Zhou H, Hu L, Xie H, Wang T, Xu Y, Liu J, Zhang X, Yan J (2013) Both NF-κB and c-Jun/AP-1 involved in anti-β2GPI/β2GPI-induced tissue factor expression in monocytes. Thromb Haemost 109:643–651. https ://doi.org/10.1160/TH12-09-0655
Xia L, Xie H, Yu Y, Zhou H, Wang T, Yan J (2016) The effects of NF-κB and c-Jun/AP-1 on the expression of prothrombotic and proinflammatory molecules induced by anti-β2GPI in mouse. PLoS One 11:e0147958. https ://doi.org/10.1371/journ al.pone.01479 58
Zhao D, Pritts EA, Chao VA, Savouret J-F, Taylor RN (2002) Dioxin stimulates RANTES expression in an in-vitro model of endome-triosis. Mol Hum Reprod 8:849–854
toxins
Review
Tryptophan-Derived Uremic Toxins and Thrombosisin Chronic Kidney Disease
Tawfik Addi 1,2, Laetitia Dou 1 and Stéphane Burtey 1,3,*1 Aix Marseille University, INSERM, INRA, C2VN, 13005 Marseille, France; tawfik.addi@gmail.com (T.A.);
laetitia.dou@univ-amu.fr (L.D.)2 LPNSA, Département de Biologie, Université d’Oran 1 Ahmed Benbella, 31000 Oran, Algérie3 Centre de Néphrologie et Transplantation Rénale, AP-HM, 13005 Marseille, France* Correspondence: stephane.burtey@univ-amu.fr; Tel.: +33-491-835-531
Received: 20 September 2018; Accepted: 10 October 2018; Published: 12 October 2018�����������������
Abstract: Patients with chronic kidney disease (CKD) display an elevated risk of thrombosis.Thrombosis occurs in cardiovascular events, such as venous thromboembolism, stroke, and acutecoronary syndrome, and is a cause of hemodialysis vascular access dysfunction. CKD leads to theaccumulation of uremic toxins, which exerts toxic effects on blood and the vessel wall. Some uremictoxins result from tryptophan metabolization in the gut through the indolic and the kynureninepathways. An increasing number of studies are highlighting the link between such uremic toxinsand thrombosis in CKD. In this review, we describe the thrombotic mechanisms induced bytryptophan-derived uremic toxins (TDUT). These mechanisms include an increase in plasma levelsof procoagulant factors, induction of platelet hyperactivity, induction of endothelial dysfunction/impairment of endothelial healing, decrease in nitric oxide (NO) bioavailability, and production ofprocoagulant microparticles. We focus on one important prothrombotic mechanism: The inductionof tissue factor (TF), the initiator of the extrinsic pathway of the blood coagulation. This inductionoccurs via a new pathway, dependent on the transcription factor Aryl hydrocarbon receptor (AhR),the receptor of TDUT in cells. A better understanding of the prothrombotic mechanisms of uremictoxins could help to find novel therapeutic targets to prevent thrombosis in CKD.
Keywords: uremic toxins; thrombosis; chronic kidney disease; tryptophan
Key Contribution: This review summarizes the thrombotic effects of tryptophan-derived uremictoxins, and provides an insight into the mechanisms involved.
1. Introduction
Chronic kidney disease (CKD) is defined as the occurrence of abnormalities of kidney structureor function, present for >3 months [1]. A decreased glomerular filtration rate (GFR) to less than60 mL/min per 1.73 m2 is the commonest manifestation of CKD [2]. The decline of GFR is related to asubstantial risk of mortality and cardiovascular disease (CVD) [3–6]. CVDs such as congestive heartfailure, coronary artery disease, cerebrovascular disease, peripheral arterial diseases, atrial fibrillation,and sudden cardiac death represent cardiovascular pathologies that occur in patients with CKD [5,6].
Thrombosis is in the heart of the three major cardiovascular events: Ischemic stroke, ischemicheart disease, and venous thromboembolism [7]. CKD patients display an increased thromboticrisk, paradoxically associated with a bleeding tendency [8,9]. In CKD, thrombotic events occurin the cerebral, coronary, and retinal arteries, in the deep venous system, heart, and at sites ofvascular access in hemodialysis patients [10]. Thrombus formation in arteries is often associatedwith atherosclerosis [8]. The risk of pulmonary embolism and deep vein thrombosis is significantly
Toxins 2018, 10, 412; doi:10.3390/toxins10100412 www.mdpi.com/journal/toxins
Toxins 2018, 10, 412 2 of 11
increased in CKD patients [11]. Moderate decrease in kidney function (30 < eGFR < 60 mL/min per1.73 m2) and severe decrease in kidney function (eGFR < 30 mL/min per 1.73 m2) are respectivelyassociated with a 2.5-fold and a 5.5-fold increase in venous thrombosis risk [12]. CKD patients displaya higher mortality rate than patients with normal kidney function due to pulmonary embolism [8].In CKD patients, the atrial fibrillation risk is higher and associated with an increased neurovascularrisk [13]. In hemodialysis patients, thrombosis can complicate stenosis, leading to access failure [14].
2. Uremic Toxins from Tryptophan Metabolism
CKD leads to the accumulation of uremic toxins [15]. This accumulation exerts a deleterious effecton multiple organs/systems [15]. In 2003, the European Uremic Toxin Work Group (EUTOX) classified90 uremic compounds. The number of compounds has been extended since [15]. The classificationof uremic toxins includes three groups: Small water-soluble molecules (≤500 Da); middle molecules(>500 Da); and protein-bound molecules [15].
Some uremic toxins result from tryptophan metabolism through the indolic and the kynureninepathways [16]. Dietary tryptophan is metabolized by the gut microbiota via three major pathways,leading to serotonin, kynurenines, and indole derivatives [16]. The kynurenine pathway thatmetabolizes 95% of tryptophan is mediated by enzymes tryptophan 2,3-dioxygenase (TDO) andindoleamine 2,3-dioxygenase (IDO). The activity of IDO leads to kynurenine from tryptophan andis reflected by the kynurenine/tryptophan ratio (KTR). Then, various metabolites can derive fromkynurenine (KYN): 3-hydroxyanthranilic acid (3-HAA), 3-hydroxykynurenine (3-HKYN), kynurenicacid (KYNA), anthranilic acid (AA), and quinolinic acid (QA) [16]. The concentration of all kynureninemetabolites is increased in CKD patients, while tryptophan decreases. The indolic pathway leadsto the indolic uremic toxins indoxyl sulfate (IS), indoxyl-β-D-glucuronide, and indole-3-acetic acid(IAA) [16]. In this pathway, tryptophan is converted to indole by the gut microbiota and absorbedinto the blood circulation, then oxidized and sulfated in the liver by the microsomal p450 cytochromeCYP2E1 enzyme and sulfatase (SULT1A1) to form IS [17]. IAA is directly produced in the gut fromtryptophan metabolism, or endogenously in tissue via tryptamine [16]. Because they are protein-bound,IS and IAA are badly cleared by dialysis [18].
3. Tryptophan-Derived Uremic Toxins and Thrombotic Events
An increasing number of studies are highlighting the link between tryptophan metabolites andthrombotic events in CKD. Studies support a role of tryptophan-derived uremic toxins (TDUT) andvascular access thrombosis in hemodialysis patients. Using multivariate Cox regression analysis in306 patients undergoing endovascular interventions for dialysis access dysfunction, Wu et al. reportedthe amount of free IS predicts vascular access thrombosis, suggesting serum IS is a new risk factor forpost-angioplasty thrombosis [19]. In 473 patients with advanced CKD, Chitalia et al. also demonstratedthat patients with subsequent arteriovenous fistula (AVF) thrombosis had higher levels of IS, KYN,and KYNA than those without thrombosis [20]. Studies also showed the association of TDUT withcardiovascular events in CKD patients. KYN, 3-HKYN, KYNA, and KTR plasma concentrationsare associated with increased risk of myocardial infarction [21–23]. In a cohort of CKD patients,Barreto et al. have shown IS predicts cardiovascular mortality [24]. In 120 patients with CKD, wedemonstrated serum IAA predicts cardiovascular events and mortality, even after adjustment for CKDstage [25].
TDUT have an impact on thrombus formation. In Wistar rats, Karbowska et al. demonstratedthat IS increases the weight of thrombus after vascular injury [26]. In mice exposed to high doses of IS,greater thrombus formation was observed after laser-induced endothelial injury, compared to non-ISexposed mice [26]. Another study showed that KYN enhances thrombosis after vascular injury inmice [20]. Chitalia’s group demonstrated that treatment of vascular smooth muscle cells (vSMC) by ISor IAA increases their thrombogenicity [27]. An important clot formation was observed in primary
Toxins 2018, 10, 412 3 of 11
human vSMC pretreated with IS or IAA when exposed to coronary-like blood flow in an ex-vivo flowloop model [28].
4. Thrombotic Mechanisms Induced by Tryptophan-Derived Uremic Toxins
After an endothelial lesion or a blood vessel injury, subendothelial components are exposed to theblood and activate the process of hemostasis to initiate a blood clot formation [29]. The platelet plugformation involves platelet activation, adhesion to exposed subendothelial matrix components, andplatelet aggregation [29]. Several platelet receptors and adhesive proteins, like the von Willebrandfactor (vWF), fibrinogen, or collagen, as well as platelet-derived agonists, are involved in theinteractions that normally occur only in the case of a vessel injury [29]. At the site of injury, the tissuefactor (TF) from the vessel wall initiates the extrinsic pathway of the coagulation cascade. The complexTF/factor VIIa leads to the generation of factor Xa, which proteolytically cleaves prothrombin to formthrombin. Thrombin then mediates fibrin generation and platelet activation [29]. The coagulationcascade is also down-regulated by different factors, such as serine protease inhibitors antithrombinand tissue factor pathway inhibitor (TFPI) [29]. The deposition of insoluble fibrin and its incorporationinto and around the platelet plug strengthen and stabilize the blood clot [29]. The fibrinolysis pathway,which breaks down the fibrin clot, also plays a substantial role in hemostasis [29]. In this pathway,tissue plasminogen activator (t-PA) released by the injured endothelium, and urokinase (uPA) in thepresence of its receptor (uPAR) convert plasminogen to plasmin, which cleaves and destroys fibrin.Within the clot, t-PA activates plasminogen, which decomposes the fibrin mesh. t-PA and urokinaseare inhibited by plasminogen activator inhibitor-1 and -2 (PAI-1 and PAI-2) [29].
A controlled balance between procoagulant and anticoagulant systems is essential, and adysregulation can lead to pathological bleeding, or pathological thrombus formation, that is,thrombosis [29]. CKD, as well as TDUT, induce a profound deregulation of the mechanisms ofhemostasis that affects all the players involved.
4.1. Deregulation of Plasma Coagulation Factors
Several abnormalities in plasma factors of hemostasis are reported in CKD patients.These abnormalities are in favor of a hypercoagulable state, with enhanced levels of vWF, fibrinogen,thrombin, factor VII, TF, and PAI-1 [10,30], as well as reduced antithrombin activity [30]. In patientswith CKD, we found that the concentration of circulating TF positively correlates with plasma levelsof IS and IAA [31]. IS level also correlates with TF procoagulant activity [32] and with vWF in CKDpatients [33]. Kynurenine is positively associated with vWF [34] and with prothrombin fragmentsF(1+2), reflecting hypercoagulability in CKD patients [35]. AA is also significantly associated withTF and prothrombin fragments F(1+2) [35], and negatively correlated with the fibrinolytic systemuPA/uPAR in severe-to-end-stage CKD [36]. QA is positively associated with vWF [34], TF, andprothrombin fragments F(1+2) [35]. 3-hydroxykynurenine is positively associated with vWF [34] andwith the TF/TFPI system [37] in CKD patients.
4.2. Platelet Hyperactivity
CKD is associated with both platelet dysfunction and activation [38,39]. Platelet activity isincreased in CKD mice that display increased IS levels [40]. Ex vivo and in vitro, IS increases plateletactivity, including an enhanced response to collagen and thrombin, increase in platelet microparticleproduction, and increase in platelet–monocyte aggregates [40]. In addition, IS-mediated plateletactivation takes part in thrombus formation ex vivo and in vivo [40]. Reactive oxygen species(ROS)-induced p38MAPK signaling in platelets plays a crucial role in IS-induced platelet activation [40].The inhibition of the ROS/p38 activation pathway by the ROS scavenger N-acetylcysteine (NAC)suppresses IS-induced platelet hyperactivation and platelet–monocyte aggregates, and strikinglyattenuates IS-induced thrombus formation [40].
Toxins 2018, 10, 412 4 of 11
4.3. Endothelial Dysfunction
The vascular endothelium is essential for maintaining hemostasis and preventing thrombosis [41].Healthy endothelial cells maintain an anticoagulant surface by expressing molecules that preventplatelet aggregation and fibrin formation [41]. When dysfunctional or activated, the endothelium canbecome prothrombotic and proinflammatory [41].
In CKD patients, endothelium dysfunction begins in the early stages of CKD [42] and takes asubstantial part in thrombotic events [43]. In hemodialysis patients, endothelial injury is associatedwith an increased risk of AVF thrombosis [44–46]. The modifications of hemodynamic stress in vascularaccess and the accumulation of uremic toxins play a major role in endothelium dysfunction [45].Tryptophan-derived indolic toxins induce a profound endothelial dysfunction, characterized by aprocoagulant, pro-oxidant and proinflammatory phenotype [16,25]. In case of injury, these toxins couldimpair endothelial healing and vessel repair by inhibiting endothelial proliferation and migration,inducing endothelial senescence [16], and promoting progenitor cell apoptosis [44]. Another aspectof endothelial function is the generation of pro- and anticoagulant prostaglandins, which play animportant role in hemostasis. Notably, endothelial cells produce Prostaglandin E2 (PGE2), whichis generated by cyclooxygenases (COX) from arachidonic acid. PGE2 elicits platelet aggregationvia its binding on platelet EP3 receptors and promotes thrombosis [47,48]. We demonstratedthat IAA induces COX-2 expression in cultured endothelial cells via an aryl hydrocarbon receptor(AhR)/p38MAPK/Nuclear Factor kappa B (NF-κB) pathway [25]. Importantly, this increase in COX-2enhances endothelial PGE2 synthesis [25], suggesting that IAA could promote platelet aggregation viaendothelial synthesis of COX-2/PGE-2.
4.4. Decrease in NO Bioavailability
Nitric oxide (NO) released from endothelium and platelets prevents platelet adhesion to thevessel wall and inhibits platelet recruitment, aggregation, and activity [49]. NO supplies a negativefeedback mechanism for thrombus propagation, and bioactive NO deficiency is associated withplatelet dysfunction and arterial thrombosis [49]. CKD patients display NO deficiency, mainly tohigh concentration of the endogenous NO Synthase (NOS) inhibitor asymmetric dimethylarginine(ADMA), and defects in NOS activity [50]. Importantly, the increase in oxidative stress in CKDpatients further reduces NO bioavailability [50]. Reactive oxygen species (ROS) have many effects onNO bioavailability: ROS increase ADMA levels, the ROS superoxide can react with NO to produceperoxynitrite that depletes the bioactivity of NO, and ROS oxidize tetrahydrobiopterin (BH4), which iscrucial for eNOS activity [50]. Tryptophan-derived indolic toxins affect NO production: IS inhibits NOproduction in endothelial cells [51], but increases it in mononuclear cells [52]. In parallel, these toxinsincrease ROS production in blood mononuclear cells [52] and in vascular endothelial cells [25,53] byincreasing endothelial NAD(P)H oxidase activity and decreasing the cellular amount of the antioxidantglutathione [53]. Thus, by favoring a pro-oxidant environment, indolic toxins could decrease NObioavailability and thus contribute to increased platelet reactivity.
4.5. Production of Procoagulant Microparticles
CKD patients display high plasma levels of microparticles from platelet and endothelium [54,55].Microparticles are membrane fragments that result from the remodeling of plasma membrane inresponse to activation or apoptosis [55]. Microparticles expose on their surfaces both phosphatidylserine,which facilitates the transformation of prothrombin to thrombin; and TF, which leads to thrombingeneration, thus conferring a procoagulant potential [56,57]. Microparticles exhibiting TF are able toform a thrombus in vivo [58]. In vitro, we have shown that IS significantly enhances the release ofmicroparticles by the endothelium [54]. Importantly, microparticles from endothelial cells incubatedwith indolic toxins exhibit a higher procoagulant activity [31]. Gao et al. also reported that IS and IAA
Toxins 2018, 10, 412 5 of 11
enhance the procoagulant activity of red blood cells through releasing microparticles and exposingphosphatidyserine [59].
4.6. Overexpression of Cell Tissue Factor
TF induction in vascular cells by TDUT could be an important prothrombotic mechanism. TF isconstitutively expressed in vascular wall cells, like fibroblasts and vSMC, to reduce bleeding aftera vascular lesion [41]. TF is usually not expressed in endothelium, but activated endothelium andleukocytes could express active TF after a vascular lesion or inflammation [41]. Blood-borne TF comesmainly from leukocytes, platelets, and TF-bearing microparticles or circulates as a soluble protein [60].TF exists as an encrypted form, with little or no procoagulant activity, which becomes activated(decrypted) upon vascular stimulation or injury [41].
In human aortic smooth muscle cells (SMC) that constitutively express TF, IS and KYN, as wellas uremic serum, induce TF overexpression and increase its activity [20,27,61,62]. A prior treatmentwith an anti-TF neutralizing antibody reduces clot formation in vSMC exposed to coronary flow [27].We reported that indolic toxins IS and IAA also induce TF expression in various types of culturedhuman endothelial cells that usually not express TF [31,63], as well as in leukocytes [31]. IS and IAAexacerbates the procoagulant activity of TF in endothelial cells and in endothelial microparticles [31].In vivo, TF activity is greater in CKD patients with subsequent arteriovenous thrombosis than in thosewithout thrombosis [20].
We demonstrated that TF induction by IS and IAA in endothelial cells occurred via a new pathway,dependent on the transcription factor AhR [31]. AhR is a receptor of some environmental contaminants,like 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) [64]. Indolic toxins IS, IAA, as well as kynureninesare potent endogenous agonists of AhR [16,65]. In resting cells, AhR forms a complex in the cytoplasmwith HSP90, XAP2, and p23 [65]. Activation of the AhR genomic pathway by ligand binding causesAhR release from the heterodimeric complex and its interaction with its nuclear translocator ARNT(Aryl Hydrocarbon Nuclear Translocator) [65]. In the nucleus, the AhR/ARNT heterodimer recognizesspecific XRE (Xenobiotic Response Elements) sequences on the promoters of AhR target genes,like genes of the cytochrome P450 family: CYP1A1, CYP1A2, or CYP1B1 [65]. Once activated byligand, AhR can also cross-talk with multiple signaling pathways and elicit inflammation through anon-genomic pathway that does not require ARNT [66]. This non-genomic inflammatory pathway ofAhR is involved in the induction of inflammatory genes, such as IL-1, IL-8, MCP-1, and COX-2 [25,67].
In endothelial cells, AhR inhibitors and AhR si RNA completely inhibit TF induction by indolictoxins [31,63]. We further showed that IAA induces endothelial TF expression via a non-genomicinflammatory pathway of AhR that induces p38MAPK and NF-kB activation [63]. In vSMC, IS extendsTF half-life by reducing TF ubiquitination [27]. Shivanna et al. demonstrated that AhR activatedby IS directly interacts with and stabilizes functional TF [32]. AHR regulates TF through STUB1,an ubiquitin ligase, which interacts with TF and degrades it through ubiquitination [68]. Consequently,IS thrombogenicity is significantly abrogated by the AHR antagonist in a flow loop ex vivo model [32].KYN also increases TF expression via AhR in primary human aortic SMC [20] and regulates thrombosisafter a carotid lesion in mice in an AhR-dependent way [20]. We demonstrated that patients andmice with CKD have high amounts of AhR agonists associated with cellular activation of AhR [69].In 116 CKD patients, we further observed that cardiovascular events are more frequent in patients withhigh levels of AhR agonists [69]. In CKD patients, Shivanna et al. demonstrated IS levels correlate withAHR-inducing activity of serum and with TF activity [32]. CKD patients with arteriovenous thrombosishave a significant greater activity of AHR and TF than those without thrombosis [20]. AhR playsan important role in platelet production [70,71] and function [72]. The activation of the AhR/p38MAPK pathway was observed in platelets in response to AhR agonists and resulted in enhancedplatelet aggregation [73]. Therefore, AHR activation by TDUT could affect primary hemostasis, inaddition to activation of coagulation, and could be a new prothrombotic mechanism in CKD patients.
Toxins 2018, 10, 412 6 of 11
Clinical studies are now necessary to demonstrate that targeting AhR activation could be a newtherapeutic option for preventing thrombosis in CKD patients.
5. Modulation of Microbiota and Diet to Reduce TDUT Production
Considering that TDUT arise from the metabolization of dietary tryptophan by the gutmicrobiota [16] and that gut dysbiosis begins in the initial stages of CKD [74], modifications ofdiet and/or use of prebiotics, probiotics, and symbiotics is a tempting approach. Results on probiotictherapies in CKD are conflicting. In a recent study, probiotic supplementation failed to reduce plasmalevels of IS, IAA, and inflammatory markers in HD patients [75], whereas it decreased serum levelsof IS in another study [76]. In CKD patients, symbiotic therapy did not significantly reduce serumIS [77], but probiotics may be interesting to reduce inflammation [74]. Results from diet modificationsseem more promising. A low protein-diet reduces plasma levels of IS and urine levels of IS, indoxylglucuronide, KA, and QA in healthy subjects [78]. In hemodialyzed patients, an increase in dietaryfibers reduces the plasma levels of IS [79]. Finally, a diet with a higher proportion of protein fromplant sources is associated with lower levels of IS [80] and with lower mortality rates in patients withCKD [81].
6. Conclusions
TDUT accumulating in patients with CKD could induce thrombosis via several mechanisms:Activation of primary hemostasis and coagulation, endothelial dysfunction, decrease in NObioavailability, and production of procoagulant microparticles (Figure 1). One important prothromboticmechanism is the induction of tissue factor via AhR (Figure 1). This uremic toxins/AhR/TF axis mayoffer new therapeutic options to prevent thrombosis in CKD.
Toxins 2018, 10, x FOR PEER REVIEW 6 of 11
5. Modulation of Microbiota and Diet to Reduce TDUT Production
Considering that TDUT arise from the metabolization of dietary tryptophan by the gut microbiota [16] and that gut dysbiosis begins in the initial stages of CKD [74], modifications of diet and/or use of prebiotics, probiotics, and symbiotics is a tempting approach. Results on probiotic therapies in CKD are conflicting. In a recent study, probiotic supplementation failed to reduce plasma levels of IS, IAA, and inflammatory markers in HD patients [75], whereas it decreased serum levels of IS in another study [76]. In CKD patients, symbiotic therapy did not significantly reduce serum IS [77], but probiotics may be interesting to reduce inflammation [74]. Results from diet modifications seem more promising. A low protein-diet reduces plasma levels of IS and urine levels of IS, indoxyl glucuronide, KA, and QA in healthy subjects [78]. In hemodialyzed patients, an increase in dietary fibers reduces the plasma levels of IS [79]. Finally, a diet with a higher proportion of protein from plant sources is associated with lower levels of IS [80] and with lower mortality rates in patients with CKD [81].
6. Conclusions
TDUT accumulating in patients with CKD could induce thrombosis via several mechanisms: Activation of primary hemostasis and coagulation, endothelial dysfunction, decrease in NO bioavailability, and production of procoagulant microparticles (Figure 1). One important prothrombotic mechanism is the induction of tissue factor via AhR (Figure 1). This uremic toxins/AhR/TF axis may offer new therapeutic options to prevent thrombosis in CKD.
Figure 1. Mechanisms of tryptophan-derived uremic toxins promoting thrombosis. Tryptophan-derived uremic toxins promote thrombosis by inducing platelet hyperactivity, endothelial dysfunction, production of endothelial and platelet microparticles, and TF expression on monocytes, vSMC, and EC. TF induction is mediated by AhR activation. A decrease in NO bioavailability and an induction of ROS in platelets and endothelial cells participate in the thrombotic effects of tryptophan-derived uremic toxins. AhR: Aryl hydrocarbon Receptor; TF: Tissue Factor; EC: Endothelial cells, vSMC: Vascular smooth muscle cells; ROS: Reactive oxygen species; NO: Nitric Oxide.
Author Contributions: All authors participated in the redaction and review of the manuscript.
Funding: This research received no external funding.
Acknowledgments: We thank University of Oran 1 Ahmed Benbella for the PhD student granting of T.A.
Figure 1. Mechanisms of tryptophan-derived uremic toxins promoting thrombosis. Tryptophan-derived uremic toxins promote thrombosis by inducing platelet hyperactivity, endothelial dysfunction,production of endothelial and platelet microparticles, and TF expression on monocytes, vSMC, and EC.TF induction is mediated by AhR activation. A decrease in NO bioavailability and an induction of ROSin platelets and endothelial cells participate in the thrombotic effects of tryptophan-derived uremictoxins. AhR: Aryl hydrocarbon Receptor; TF: Tissue Factor; EC: Endothelial cells, vSMC: Vascularsmooth muscle cells; ROS: Reactive oxygen species; NO: Nitric Oxide.
Toxins 2018, 10, 412 7 of 11
Author Contributions: All authors participated in the redaction and review of the manuscript.
Funding: This research received no external funding.
Acknowledgments: We thank University of Oran 1 Ahmed Benbella for the PhD student granting of T.A.
Conflicts of Interest: The authors declare no conflicts of interest.
References
1. Levin, A.; Stevens, P.; Bilous, R.W.; Coresh, J.; De Francisco, A.L.; De Jong, P.E.; Griffi, K.E.; Hemmelgarn, B.R.;Isek, K.; Lamb, E.J.; et al. KDIGO clinical practice guideline for the evaluation and management of chronickidney disease. Chapter 1: Definition and classification of CKD. Kidney Int. Suppl. 2013, 3, 19–62. [CrossRef]
2. Stevens, P.E.; Levin, A. Kidney Disease: Improving Global Outcomes Chronic Kidney Disease GuidelineDevelopment Work Group Members Evaluation and management of chronic kidney disease: Synopsis ofthe kidney disease: Improving global outcomes 2012 clinical practice guideline. Ann. Intern. Med. 2013,158, 825–830. [CrossRef] [PubMed]
3. Coresh, J.; Turin, T.C.; Matsushita, K.; Sang, Y.; Ballew, S.H.; Appel, L.J.; Arima, H.; Chadban, S.J.; Cirillo, M.;Djurdjev, O.; et al. Decline in estimated glomerular filtration rate and subsequent risk of end-stage renaldisease and mortality. JAMA 2014, 311, 2518–2531. [CrossRef] [PubMed]
4. Di Angelantonio, E.; Danesh, J.; Eiriksdottir, G.; Gudnason, V. Renal function and risk of coronary heartdisease in general populations: New prospective study and systematic review. PLoS Med. 2007, 4, e270.[CrossRef] [PubMed]
5. Herzog, C.A.; Asinger, R.W.; Berger, A.K.; Charytan, D.M.; Díez, J.; Hart, R.G.; Eckardt, K.-U.; Kasiske, B.L.;McCullough, P.A.; Passman, R.S.; et al. Cardiovascular disease in chronic kidney disease. A clinical updatefrom Kidney Disease: Improving Global Outcomes (KDIGO). Kidney Int. 2011, 80, 572–586. [CrossRef][PubMed]
6. Go, A.S.; Chertow, G.M.; Fan, D.; McCulloch, C.E.; Hsu, C.Y. Chronic kidney disease and the risks of death,cardiovascular events, and hospitalization. N. Engl. J. Med. 2004, 351, 1296–1305. [CrossRef] [PubMed]
7. Raskob, G.E.; Angchaisuksiri, P.; Blanco, A.N.; Buller, H.; Galluse, A.; Hunt, B.J.; Hylek, E.M.; Kakkar, A.;Konstantinidesi, S.V.; McCumber, M.; et al. ISTH Steering Committee for World Thrombosis Day Thrombosis:A major contributor to global disease burden. Thromb. Res. 2014, 134, 931–938. [CrossRef] [PubMed]
8. Lutz, J.; Menke, J.; Sollinger, D.; Schinzel, H.; Thurmel, K. Haemostasis in chronic kidney disease.Nephrol. Dial. Transplant. 2014, 29, 29–40. [CrossRef] [PubMed]
9. Parikh, A.M.; Spencer, F.A.; Lessard, D.; Emery, C.; Baylin, A.; Linkletter, C.; Goldberg, R.J. Venousthromboembolism in patients with reduced estimated GFR: A population-based perspective. Am. J.Kidney Dis. 2011, 58, 746–755. [CrossRef] [PubMed]
10. Pavord, S.; Myers, B. Bleeding and thrombotic complications of kidney disease. Blood Rev. 2011, 25, 271–278.[CrossRef] [PubMed]
11. Wattanakit, K.; Cushman, M.; Stehman-Breen, C.; Heckbert, S.R.; Folsom, A.R. Chronic kidney diseaseincreases risk for venous thromboembolism. J. Am. Soc. Nephrol. 2008, 19, 135–140. [CrossRef] [PubMed]
12. Ocak, G.; Lijfering, W.M.; Verduijn, M.; Dekker, F.W.; Rosendaal, F.R.; Cannegieter, S.C.; Vossen, C.Y.Risk of venous thrombosis in patients with chronic kidney disease: Identification of high-risk groups.J. Thromb. Haemost. 2013, 11, 627–633. [CrossRef] [PubMed]
13. Carrero, J.J.; Trevisan, M.; Sood, M.M.; Bárány, P.; Xu, H.; Evans, M.; Friberg, L.; Szummer, K. Incident AtrialFibrillation and the Risk of Stroke in Adults with Chronic Kidney Disease: The Stockholm CREAtinineMeasurements (SCREAM) Project. Clin. J. Am. Soc. Nephrol. 2018, 13, 1314–1320. [CrossRef] [PubMed]
14. Viecelli, A.K.; Mori, T.A.; Roy-Chaudhury, P.; Polkinghorne, K.R.; Hawley, C.M.; Johnson, D.W.; Pascoe, E.M.;Irish, A.B. The pathogenesis of hemodialysis vascular access failure and systemic therapies for its prevention:Optimism unfulfilled. Semin. Dial. 2018, 31, 244–257. [CrossRef] [PubMed]
15. Vanholder, R.; Pletinck, A.; Schepers, E.; Glorieux, G. Biochemical and Clinical Impact of Organic UremicRetention Solutes: A Comprehensive Update. Toxins 2018, 10. [CrossRef] [PubMed]
16. Sallee, M.; Dou, L.; Cerini, C.; Poitevin, S.; Brunet, P.; Burtey, S. The aryl hydrocarbon receptor-activating effectof uremic toxins from tryptophan metabolism: A new concept to understand cardiovascular complicationsof chronic kidney disease. Toxins 2014, 6, 934–949. [CrossRef] [PubMed]
Toxins 2018, 10, 412 8 of 11
17. Meyer, T.W.; Hostetter, T.H. Uremic solutes from colon microbes. Kidney Int. 2012, 81, 949–954. [CrossRef][PubMed]
18. Neirynck, N.; Glorieux, G.; Schepers, E.; Pletinck, A.; Dhondt, A.; Vanholder, R. Review of protein-boundtoxins, possibility for blood purification therapy. Blood Purif. 2013, 35 (Suppl. 1), 45–50. [CrossRef]
19. Wu, C.-C.; Hsieh, M.-Y.; Hung, S.-C.; Kuo, K.-L.; Tsai, T.-H.; Lai, C.-L.; Chen, J.-W.; Lin, S.-J.; Huang, P.-H.;Tarng, D.-C. Serum Indoxyl Sulfate Associates with Postangioplasty Thrombosis of Dialysis Grafts. J. Am.Soc. Nephrol. 2016, 27, 1254–1264. [CrossRef] [PubMed]
20. Kolachalama, V.B.; Shashar, M.; Alousi, F.; Shivanna, S.; Rijal, K.; Belghasem, M.E.; Walker, J.; Matsuura, S.;Chang, G.H.; Gibson, C.M.; et al. Uremic Solute-Aryl Hydrocarbon Receptor-Tissue Factor Axis Associateswith Thrombosis after Vascular Injury in Humans. J. Am. Soc. Nephrol. 2018, 29, 1063–1072. [CrossRef][PubMed]
21. Eussen, S.J.P.M.; Ueland, P.M.; Vollset, S.E.; Nygård, O.; Midttun, Ø.; Sulo, G.; Ulvik, A.; Meyer, K.;Pedersen, E.R.; Tell, G.S. Kynurenines as predictors of acute coronary events in the Hordaland HealthStudy. Int. J. Cardiol. 2015, 189, 18–24. [CrossRef] [PubMed]
22. Sulo, G.; Vollset, S.E.; Nygård, O.; Midttun, Ø.; Ueland, P.M.; Eussen, S.J.P.M.; Pedersen, E.R.; Tell, G.S.Neopterin and kynurenine-tryptophan ratio as predictors of coronary events in older adults, the HordalandHealth Study. Int. J. Cardiol. 2013, 168, 1435–1440. [CrossRef] [PubMed]
23. Yu, E.; Ruiz-Canela, M.; Guasch-Ferré, M.; Zheng, Y.; Toledo, E.; Clish, C.B.; Salas-Salvadó, J.; Liang, L.;Wang, D.D.; Corella, D.; et al. Increases in Plasma Tryptophan Are Inversely Associated with IncidentCardiovascular Disease in the Prevención con Dieta Mediterránea (PREDIMED) Study. J. Nutr. 2017,147, 314–322. [CrossRef] [PubMed]
24. Barreto, F.C.; Barreto, D.V.; Liabeuf, S.; Meert, N.; Glorieux, G.; Temmar, M.; Choukroun, G.; Vanholder, R.;Massy, Z.A. Serum indoxyl sulfate is associated with vascular disease and mortality in chronic kidneydisease patients. Clin. J. Am. Soc. Nephrol. 2009, 4, 1551–1558. [CrossRef] [PubMed]
25. Dou, L.; Sallée, M.; Cerini, C.; Poitevin, S.; Gondouin, B.; Jourde-Chiche, N.; Fallague, K.; Brunet, P.; Calaf, R.;Dussol, B.; et al. The cardiovascular effect of the uremic solute indole-3 acetic acid. J. Am. Soc. Nephrol. 2015,26, 876–887. [CrossRef] [PubMed]
26. Karbowska, M.; Kaminski, T.W.; Marcinczyk, N.; Misztal, T.; Rusak, T.; Smyk, L.; Pawlak, D. The UremicToxin Indoxyl Sulfate Accelerates Thrombotic Response after Vascular Injury in Animal Models. Toxins 2017,9, 229. [CrossRef] [PubMed]
27. Chitalia, V.C.; Shivanna, S.; Martorell, J.; Balcells, M.; Bosch, I.; Kolandaivelu, K.; Edelman, E.R. Uremicserum and solutes increase post-vascular interventional thrombotic risk through altered stability of smoothmuscle cell tissue factor. Circulation 2013, 127, 365–376. [CrossRef] [PubMed]
28. Kolandaivelu, K.; Swaminathan, R.; Gibson, W.J.; Kolachalama, V.B.; Nguyen-Ehrenreich, K.-L.;Giddings, V.L.; Coleman, L.; Wong, G.K.; Edelman, E.R. Stent thrombogenicity early in high-riskinterventional settings is driven by stent design and deployment and protected by polymer-drug coatings.Circulation 2011, 123, 1400–1409. [CrossRef] [PubMed]
29. Gale, A.J. Current Understanding of Hemostasis. Toxicol. Pathol. 2011, 39, 273–280. [CrossRef] [PubMed]30. Jalal, D.I.; Chonchol, M.; Targher, G. Disorders of hemostasis associated with chronic kidney disease.
Semin. Thromb. Hemost. 2010, 36, 34–40. [CrossRef] [PubMed]31. Gondouin, B.; Cerini, C.; Dou, L.; Sallée, M.; Duval-Sabatier, A.; Pletinck, A.; Calaf, R.; Lacroix, R.;
Jourde-Chiche, N.; Poitevin, S.; et al. Indolic uremic solutes increase tissue factor production in endothelialcells by the aryl hydrocarbon receptor pathway. Kidney Int. 2013, 84, 733–744. [CrossRef] [PubMed]
32. Shivanna, S.; Kolandaivelu, K.; Shashar, M.; Belghasim, M.; Al-Rabadi, L.; Balcells, M.; Zhang, A.; Weinberg, J.;Francis, J.; Pollastri, M.P.; et al. The Aryl Hydrocarbon Receptor is a Critical Regulator of Tissue FactorStability and an Antithrombotic Target in Uremia. J. Am. Soc. Nephrol. 2016, 27, 189–201. [CrossRef][PubMed]
33. Kaminski, T.W.; Pawlak, K.; Karbowska, M.; Mysliwiec, M.; Pawlak, D. Indoxyl sulfate-the uremic toxinlinking hemostatic system disturbances with the prevalence of cardiovascular disease in patients withchronic kidney disease. BMC Nephrol. 2017, 18, 35. [CrossRef] [PubMed]
34. Pawlak, K.; Domaniewski, T.; Mysliwiec, M.; Pawlak, D. Kynurenines and oxidative status are independentlyassociated with thrombomodulin and von Willebrand factor levels in patients with end-stage renal disease.Thromb. Res. 2009, 124, 452–457. [CrossRef] [PubMed]
Toxins 2018, 10, 412 9 of 11
35. Pawlak, K.; Mysliwiec, M.; Pawlak, D. Hypercoagulability is independently associated with kynureninepathway activation in dialysed uraemic patients. Thromb. Haemost. 2009, 102, 49–55. [CrossRef] [PubMed]
36. Kaminski, T.W.; Pawlak, K.; Karbowska, M.; Mysliwiec, M.; Grzegorzewski, W.; Kuna, J.; Pawlak, D.Association between uremic toxin-anthranilic acid and fibrinolytic system activity in predialysis patients atdifferent stages of chronic kidney disease. Int. Urol. Nephrol. 2018, 50, 127–135. [CrossRef] [PubMed]
37. Pawlak, K.; Tankiewicz, J.; Mysliwiec, M.; Pawlak, D. Tissue factor/its pathway inhibitor system andkynurenines in chronic kidney disease patients on conservative treatment. Blood Coagul. Fibrin. 2009,20, 590–594. [CrossRef] [PubMed]
38. Thijs, A.; Nanayakkara, P.W.; Ter Wee, P.M.; Huijgens, P.C.; van Guldener, C.; Stehouwer, C.D.A.Mild-to-moderate renal impairment is associated with platelet activation: A cross-sectional study.Clin. Nephrol. 2008, 70, 325–331. [PubMed]
39. Boccardo, P.; Remuzzi, G.; Galbusera, M. Platelet dysfunction in renal failure. Semin. Thromb. Hemost. 2004,30, 579–589. [CrossRef] [PubMed]
40. Yang, K.; Du, C.; Wang, X.; Li, F.; Xu, Y.; Wang, S.; Chen, S.; Chen, F.; Shen, M.; Chen, M.; et al. Indoxylsulfate induces platelet hyperactivity and contributes to chronic kidney disease-associated thrombosis inmice. Blood 2017, 129, 2667–2679. [CrossRef] [PubMed]
41. Yau, J.W.; Teoh, H.; Verma, S. Endothelial cell control of thrombosis. BMC Cardiovasc. Disord. 2015, 15, 130.[CrossRef] [PubMed]
42. Stam, F.; van Guldener, C.; Becker, A.; Dekker, J.M.; Heine, R.J.; Bouter, L.M.; Stehouwer, C.D.A. Endothelialdysfunction contributes to renal function-associated cardiovascular mortality in a population with mildrenal insufficiency: The Hoorn study. J. Am. Soc. Nephrol. 2006, 17, 537–545. [CrossRef] [PubMed]
43. Malyszko, J. Mechanism of endothelial dysfunction in chronic kidney disease. Clin. Chim. Acta 2010,411, 1412–1420. [CrossRef] [PubMed]
44. Jourde-Chiche, N.; Dou, L.; Sabatier, F.; Calaf, R.; Cerini, C.; Robert, S.; Camoin-Jau, L.; Charpiot, P.;Argiles, A.; Dignat-George, F.; et al. Levels of circulating endothelial progenitor cells are related to uremictoxins and vascular injury in hemodialysis patients. J. Thromb. Haemost. 2009, 7, 1576–1584. [CrossRef][PubMed]
45. Roy-Chaudhury, P.; Sukhatme, V.P.; Cheung, A.K. Hemodialysis vascular access dysfunction: A cellular andmolecular viewpoint. J. Am. Soc. Nephrol. 2006, 17, 1112–1127. [CrossRef] [PubMed]
46. Chen, T.Y.; Lin, T.T.; Hsieh, M.Y.; Lin, L.; Yang, C.W.; Chuang, S.Y.; Huang, P.H.; Wu, C.C. CirculatingProgenitor Cells Affect Thrombosis of Dialysis Arteriovenous Fistulas. Am. J. Nephrol. 2016, 44, 428–438.[CrossRef] [PubMed]
47. Fabre, J.E.; Nguyen, M.; Athirakul, K.; Coggins, K.; McNeish, J.D.; Austin, S.; Parise, L.K.; FitzGerald, G.A.;Coffman, T.M.; Koller, B.H. Activation of the murine EP3 receptor for PGE2 inhibits cAMP production andpromotes platelet aggregation. J. Clin. Investig. 2001, 107, 603–610. [CrossRef] [PubMed]
48. Gross, S.; Tilly, P.; Hentsch, D.; Vonesch, J.L.; Fabre, J.E. Vascular wall–produced prostaglandin E2 exacerbatesarterial thrombosis and atherothrombosis through platelet EP3 receptors. J. Exp. Med. 2007, 204, 311–320.[CrossRef] [PubMed]
49. Loscalzo, J. Nitric oxide insufficiency, platelet activation, and arterial thrombosis. Circ. Res. 2001, 88, 756–762.[CrossRef] [PubMed]
50. Baylis, C. Nitric oxide synthase derangements and hypertension in kidney disease. Curr. Opin.Nephrol. Hypertens. 2012, 21, 1–6. [CrossRef] [PubMed]
51. Tumur, Z.; Niwa, T. Indoxyl sulfate inhibits nitric oxide production and cell viability by inducing oxidativestress in vascular endothelial cells. Am. J. Nephrol. 2009, 29, 551–557. [CrossRef] [PubMed]
52. Pieniazek, A.; Gwozdzinski, L.; Hikisz, P.; Gwozdzinski, K. Indoxyl sulfate generates free radicals, decreasesantioxidant defense and leads to damage to mononuclear blood cells. Chem. Res. Toxicol. 2018. [CrossRef][PubMed]
53. Dou, L.; Jourde-Chiche, N.; Faure, V.; Cerini, C.; Berland, Y.; Dignat-George, F.; Brunet, P. The uremicsolute indoxyl sulfate induces oxidative stress in endothelial cells. J. Thromb. Haemost. 2007, 5, 1302–1308.[CrossRef] [PubMed]
54. Faure, V.; Dou, L.; Sabatier, F.; Cerini, C.; Sampol, J.; Berland, Y.; Brunet, P.; Dignat-George, F. Elevationof circulating endothelial microparticles in patients with chronic renal failure. J. Thromb. Haemost. 2006,4, 566–573. [CrossRef] [PubMed]
Toxins 2018, 10, 412 10 of 11
55. Daniel, L.; Dou, L.; Berland, Y.; Lesavre, P.; Mecarelli-Halbwachs, L.; Dignat-George, F. Circulatingmicroparticles in renal diseases. Nephrol. Dial. Transplant. 2008, 23, 2129–2132. [CrossRef] [PubMed]
56. Freyssinet, J.M.; Toti, F. Formation of procoagulant microparticles and properties. Thromb. Res. 2010,125 (Suppl. 1), S46–S48. [CrossRef]
57. Connor, D.E.; Exner, T.; Ma, D.D.; Joseph, J.E. Detection of the procoagulant activity ofmicroparticle-associated phosphatidylserine using XACT. Blood Coagul. Fibrin. 2009, 20, 558–564. [CrossRef][PubMed]
58. Biró, E.; Sturk-Maquelin, K.N.; Vogel, G.M.; Meuleman, D.G.; Smit, M.J.; Hack, C.E.; Sturk, A.; Nieuwland, R.Human cell-derived microparticles promote thrombus formation in vivo in a tissue factor-dependent manner.J. Thromb. Haemost. 2003, 1, 2561–2568. [CrossRef] [PubMed]
59. Gao, C.; Ji, S.; Dong, W.; Qi, Y.; Song, W.; Cui, D.; Shi, J. Indolic uremic solutes enhance procoagulant activityof red blood cells through phosphatidylserine exposure and microparticle release. Toxins 2015, 7, 4390–4403.[CrossRef] [PubMed]
60. Chu, A.J. Tissue factor, blood coagulation, and beyond: An overview. Int. J. Inflam. 2011, 2011, 367284.[CrossRef] [PubMed]
61. Ng, H.Y.; Bolati, W.; Lee, C.T.; Chien, Y.S.; Yisireyili, M.; Saito, S.; Pei, S.N.; Nishijima, F.; Niwa, T. IndoxylSulfate Downregulates Mas Receptor via Aryl Hydrocarbon Receptor/Nuclear Factor-kappa B, and InducesCell Proliferation and Tissue Factor Expression in Vascular Smooth Muscle Cells. Nephron 2016, 133, 205–212.[CrossRef] [PubMed]
62. Yisireyili, M.; Saito, S.; Abudureyimu, S.; Adelibieke, Y.; Ng, H.Y.; Nishijima, F.; Takeshita, K.; Murohara, T.;Niwa, T. Indoxyl sulfate-induced activation of (pro)renin receptor promotes cell proliferation and tissuefactor expression in vascular smooth muscle cells. PLoS ONE 2014, 9, e109268. [CrossRef] [PubMed]
63. Addi, T.; Poitevin, S.; McKay, N.; El Mecherfi, K.E.; Kheroua, O.; Jourde-Chiche, N.; de Macedo, A.;Gondouin, B.; Cerini, C.; Brunet, P.; et al. Mechanisms of tissue factor induction by the uremic toxinindole-3 acetic acid through aryl hydrocarbon receptor/nuclear factor-kappa B signaling pathway in humanendothelial cells. Arch. Toxicol. In press.
64. Mandal, P.K. Dioxin: A review of its environmental effects and its aryl hydrocarbon receptor biology.J. Comp. Physiol. B 2005, 175, 221–230. [CrossRef] [PubMed]
65. Hubbard, T.D.; Murray, I.A.; Perdew, G.H. Indole and Tryptophan Metabolism: Endogenous and DietaryRoutes to Ah Receptor Activation. Drug Metab. Dispos. 2015, 43, 1522–1535. [CrossRef] [PubMed]
66. Matsumura, F. The significance of the nongenomic pathway in mediating inflammatory signaling of thedioxin-activated Ah receptor to cause toxic effects. Biochem. Pharmacol. 2009, 77, 608–626. [CrossRef][PubMed]
67. Puga, A.; Ma, C.; Marlowe, J.L. The aryl hydrocarbon receptor cross-talks with multiple signal transductionpathways. Biochem. Pharmacol. 2009, 77, 713–722. [CrossRef] [PubMed]
68. Shashar, M.; Belghasem, M.E.; Matsuura, S.; Walker, J.; Richards, S.; Alousi, F.; Rijal, K.; Kolachalama, V.B.;Balcells, M.; Odagi, M.; et al. Targeting STUB1-tissue factor axis normalizes hyperthrombotic uremicphenotype without increasing bleeding risk. Sci. Transl. Med. 2017, 9, eaam8475. [CrossRef] [PubMed]
69. Dou, L.; Poitevin, S.; Sallée, M.; Addi, T.; Gondouin, B.; McKay, N.; Denison, M.S.; Jourde-Chiche, N.;Duval-Sabatier, A.; Cerini, C.; et al. Aryl hydrocarbon receptor is activated in patients and mice with chronickidney disease. Kidney Int. 2018, 93, 986–999. [CrossRef] [PubMed]
70. Lindsey, S.; Papoutsakis, E.T. The aryl hydrocarbon receptor (AHR) transcription factor regulatesmegakaryocytic polyploidization. Br. J. Haematol. 2011, 152, 469–484. [CrossRef] [PubMed]
71. Strassel, C.; Brouard, N.; Mallo, L.; Receveur, N.; Mangin, P.; Eckly, A.; Bieche, I.; Tarte, K.; Gachet, C.;Lanza, F. Aryl hydrocarbon receptor-dependent enrichment of a megakaryocytic precursor with a highpotential to produce proplatelets. Blood 2016, 127, 2231–2240. [CrossRef] [PubMed]
72. Lindsey, S.; Jiang, J.; Woulfe, D.; Papoutsakis, E.T. Platelets from mice lacking the aryl hydrocarbon receptorexhibit defective collagen-dependent signaling. J. Thromb. Haemost. 2014, 12, 383–394. [CrossRef] [PubMed]
73. Pombo, M.; Lamé, M.W.; Walker, N.J.; Huynh, D.H.; Tablin, F. TCDD and omeprazole prime platelets throughthe aryl hydrocarbon receptor (AhR) non-genomic pathway. Toxicol. Lett. 2015, 235, 28–36. [CrossRef][PubMed]
Toxins 2018, 10, 412 11 of 11
74. Simeoni, M.; Citraro, M.L.; Deodato, F.; Provenzano, M.; Capria, M.; Comi, A.; Libri, E.; Andreucci, M.;Puja, A.; Abenavoli, L.; Cocchi, M.; Fuiano, G. An open-label, randomized, placebo-controlled study onthe effectiveness of a novel probiotics administration protocol (ProbiotiCKD) in patients with mild renalinsufficiency (stage 3a of CKD). Eur J. Nutr. 2018, 1–12. [CrossRef]
75. Borges, N.A.; Carmo, F.L.; Stockler-Pinto, M.B.; de Brito, J.S.; Dolenga, C.J.; Ferreira, D.C.; Nakao, L.S.;Rosado, A.; Fouque, D.; Mafra, D. Probiotic Supplementation in Chronic Kidney Disease: A Double-blind,Randomized, Placebo-controlled Trial. J. Ren Nutr. 2018, 28, 28–36. [CrossRef] [PubMed]
76. Takayama, F.; Taki, K.; Niwa, T. Bifidobacterium in gastro-resistant seamless capsule reduces serum levels ofindoxyl sulfate in patients on hemodialysis. Am. J. Kidney Dis. 2003, 41, S142–S145. [CrossRef] [PubMed]
77. Rossi, M.; Johnson, D.W.; Morrison, M.; Pascoe, E.M.; Coombes, J.S.; Forbes, J.M.; Szeto, C.C.;McWhinney, B.C.; Ungerer, J.P.; Campbell, K.L. Synbiotics Easing Renal Failure by Improving GutMicrobiology (SYNERGY): A Randomized Trial. Clin J. Am. Soc. Nephrol. 2016, 11, 223–231. [CrossRef][PubMed]
78. Poesen, R.; Mutsaers, H.A.; Windey, K.; van den Broek, P.H.; Verweij, V.; Augustijns, P.; Kuypers, D.; Jansen, J.;Evenepoel, P.; Verbeke, K.; et al. The Influence of Dietary Protein Intake on Mammalian Tryptophan andPhenolic Metabolites. PLoS ONE 2015, 10, e0140820. [CrossRef] [PubMed]
79. Sirich, T.L.; Plummer, N.S.; Gardner, C.D.; Hostetter, T.H.; Meyer, TW. Effect of increasing dietary fiber onplasma levels of colon-derived solutes in hemodialysis patients. Clin. J. Am. Soc. Nephrol. 2014, 9, 1603–1610.[CrossRef] [PubMed]
80. Kandouz, S.; Mohamed, A.S.; Zheng, Y.; Sandeman, S.; Davenport, A. Reduced protein bound uraemictoxins in vegetarian kidney failure patients treated by haemodiafiltration. Hemodial. Int. 2016, 20, 610–617.[CrossRef] [PubMed]
81. Chen, X.; Wei, G.; Jalili, T.; Metos, J.; Giri, A.; Cho, M.E.; Boucher, R.; Greene, T.; Beddhu, S. The Associationsof Plant Protein Intake with All-Cause Mortality in CKD. Am. J. Kidney Dis. 2016, 67, 423–430. [CrossRef][PubMed]
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open accessarticle distributed under the terms and conditions of the Creative Commons Attribution(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Résumé
La maladie rénale chronique a pour principale complication les maladies cardiovasculaires. L’accumulation des
toxines urémiques dérivées de la voie indolique du métabolisme du tryptophane, l’indole-3-acétique acide
(IAA) et l’Indoxyl sulfate (IS), sont impliquées dans un phénomène clé des événements cardiovasculaires ; la
thrombose. Ces toxines induisent l'expression et l'activité pro coagulante du facteur tissulaire (FT), principal
initiateur cellulaire de la coagulation sanguine. Le facteur de transcription, Aryl Hydrocarbon Receptor (AHR),
un récepteur cellulaire pour les toxines indoliques, est impliqué dans l'induction du FT endothélial. Les
mécanismes par lesquels AhR contrôle l’expression du FT dans les cellules endothéliales sont peu connus.
L’objectif principal de cette thèse était de déterminer les voies de signalisation et les facteurs de transcription
impliqués dans l'expression du FT médiée par AhR et induit par l’IAA et l’IS. L’expression du FT induite par l’IAA
et l’IS au niveau endothélial est contrôlée principalement par la transcription. L’IAA et l’IS activent la voie
génomique classique d’AhR. Cependant, l’expression du FT n'est pas médiée par cette voie. L’activation du FT
en réponse à l’IAA passe par une voie AhR-p38MAPK-NF-kB.En conclusion, l'IAA induit l’expression du FT
endothéliale via la voie non génomique d’AhR-p38MAPK/NF-KB. Cette voie pourrait être une cible
thérapeutique pour diminuer les effets pro thrombotiques chez les MRC.
Mots clés :
Maladie rénale chronique; Complication cardiovasculaire; Thrombose; Toxines urémique; Indole-3-acétique
acide; Indoxyl sulfate; Aryl Hydrocarbon Receptor; MAPKP38/NF-B; Facteur tissulaire; Cellule endothéliale
top related