sobrevia & gonzalez 2009
Post on 02-Jun-2018
218 Views
Preview:
TRANSCRIPT
-
8/10/2019 Sobrevia & Gonzalez 2009
1/8
I
A Role for Insulin on L-Arginine Transport in Fetal Endothelial Dysfunc-tion in Hyperglycaemia
I Cellular and Molecular Physiology LaboratOl:r (CI"fPL) and Perinatology Research LaboratOlY (PRL), Department of
Obstetrics and Gynaecology, Medical Research Centre (Cn1), School o f M edicine, Faculty of Medicine, Pontificia Uni-
versidad Catolica de Chile, P.O. Box 114-D, Santiago, Chile; 1Department of Physiology, Faculty of Biological Sci-
ences, Universidad de Concepcion, Chile
Abstract: Endothelial cells are keyin the regulationofvascular tone throughthe release of vasoactive molecules,includ-
ingnitric oxide (NO). NO is a gassynthesized from thecationic amino acid L-arginine via the endothelial NO synthase
(eNOS). The semi-essentialamino acid L-arginine is a taken up byendothelial cells via systems y+ and y+L in primary
cultures of human umbilical vein endothelialcells (HUVEC). Systemy+isa familyof membranetransportersincluding at
least five transport systems for cationic amino acids (CAT) of which HUVEC express human CAT-I (hCAT-I) and
hCAT-2B. Exposure ofHUVECtohigh extracellularconcentrationsofD-glucose increasesL-argininetransport,hCAT-lmRNA expressionand eNOS activity.These phenomena are also relatedwith increased production of reactive oxygen
species (ROS), thus supporting the possibility that changes in L-argininelNO signalling pathway result from elevated
ROS. It has been shown that insulin blocks D-glucose-increased L-arginine transport and cGMP accumulation in
HUVEC,whereasin this cell type insulin alsomodulateshigh D-glucoseeffectsby activatingthetranscriptional factors
Spl andNFKB.Thesetranscriptionfactorshaveresponse elements in SLC7A] (for hCAT-I) genepromoterregion,thus
representing2 possible targetsforregulationoftheexpressionof thistransporter byD-glucose and/or insulin inthis cell
type. Recent evidencessuggest that insulin blocksthestimulatoryeffectof D-gJucoseon L-arginine transport byreducing
thetranscriptionalactivity ofSLC7A] via Spl-, NFKB-and ROS-dependent mechanisms. Thus, a role for these transcrip-
tionfactorsin responseto insulin is proposed infetalendothelialcellsexposed tohyperglycaemia.
Keywords: Glucose, hyperglycaemia, diabetes, L-arginine, transport, human, endothelium.
Endothelial cells are of mesenchymal ongm forming a
lane epithelium named endothelium. For decades the endo-
elium was considered as a simply barrier between the
lood and other body tissues. However, this early vision has
now radically changed and currently holds the endothelium
a real organ, made up of approximately ten trillion cells,
,-hich fulfils multiple roles in the physiology and patho-
.hysiology of vascular tone, with autocrine, paracrine and
c:J.docrine actions and involved in the processes of coagula-
:::on and fibrinolysis [1, 2]. Endothelial cells are involved in
:-egulation of vascular tone through the release of a number
f vasoactive substances, such as prostacyclin (PGlz) [3],
dotelin-l [4] and nitric oxide (NO) [3, 5]. Endothelium-
-=crived NO spreads to the underlying smooth muscle cell
~yer in vascular vessels where increases cGMP levels to
bsequently induce relaxation of the muscle leading to
odilatation [3,5,6]. Both in vivo and in vitro experiments
-c:w demonstrated that NO synthesis in endothelial cells is a
__cess that could be stimulated by various molecules, in-
~ding insulin [7-9], D-glucose [10] and adenosine [6].
~ilarly, NO synthesis and/or its bioavailability are lower
.".: ress correspondence to this author at the Cellular and M olecular
_"iology Laboratory (CMPL), Department of Obstetrics and Gynaecol
:..' 'vIedical Research Centre (CIM), School of Medicine, Faculty of Medi-
Pontificia Universidad Cat6lica de Chile, P.O. Box 114-D, Santiago,
- ~: Tel: 562-3548116; Fax: 562-6321924; E-mail: sobrevia@med.puc.c1
in pathological conditions such as intrauterine growth restric-
tion (IUGR) [11], diabetes mellitus [9,12] or atherosclerosis
[13].
The signalling mechanisms involved in NO synthesis
have been studied in several cell types including human um-
bilical vein endothelial cells (HUVEC). The gas NO is syn-
thesized from the cationic, semi-essential amino acid L-
arginine in a metabolic reaction leading to equimolar forma-
tion of L-citrulline and NO [6, 14]. This reaction requires the
activity of endothelial NO synthases (NOS), a group of en-
zymes conformed by at least three isoforms i.e. neuronal
NOS (nNOS or Type I), inducible NOS (iNOS or type II)
and endothelial NOS (eNOS or Type III) [15]. In fact, there
is evidence that NOS activity may depend on the ability of
endothelial cells to take up its specific substrate L-arginine
via a variety of membrane transport systems [6, 10, 11, 14-
16]. L-Arginine is taken up by endothelial cells via mem-
brane transport systems grouped as systems l,y+L, bO,+andBO.+[6, 16-18]. It is well known that system y+ conforms a
family of proteins known as cationic amino acid transporters
(CATs) family (hereafter referred as 'CATs family'), con-
formed by CAT-I, CAT-2A, CAT-2B, CAT-3 and CAT-4
[17, 19]. CAT-l is ubiquitously expressed, while CAT-2A
and CAT -3 are constitutively expressed in liver and brain,
respectively, and CAT-2B is induced in a variety of celltypes in response to bacterial endotoxins and pro-
inflammatory cytokines [6,17, 19-21]. CAT-4 derives from
-
8/10/2019 Sobrevia & Gonzalez 2009
2/8
a sequence of cDNA that is41-42% identical to other mem-
bers of CATs family, but no transport activity has been yet
described [6,17]. CAT-I, CAT-2B and CAT-3 are function-
ally characterized as high affinity (Km ~100-400 f.lM),Na+..
independent transporters, while CAT-2A has arelatively low
affinity for cationic amino acids (Km ~2-5 mM). Interest-
ingly, only 2 members of the CATs family have been func-tionally characterized in primary cultures of HUVEC i.e.
human CAT-l (hCAT-l) and hCAT-2B, while hCAT-2A
seems not to be expressed inthis cell type [6, 10, 11, 17, 18].
In addition, hCAT-l protein and mRNA, and only hCAT-2B
mRNA have been detected in this cell type [17].
Phylogenetically, the SLC7 ('solute carrier') family con-
sists of 2 subfamilies formed by CATs and the amino acid
transporters associated to glycoproteins (HATs, heterodi-
meric amino acid transporters). CATs family members are
encoded by genes SLC7Ai, 2, 3 and 4, whose protein prod-
ucts contain 14 tr ansmembrane domains [19]. Specifically,
the gene encoding hCAT-1 protein i.e. SLC7 Ai (located onchromosome 13q 12-q 14), consists of an open reading fr ame
with 11 exons and 10 introns. However, towards the 5'-end
two additional untr anslatable exons (-2 and -1) have been
described r..-:;.Th -.. ~. now suggested that SLC7Ai couldbe formed by I xo -. \yhere transcription start site (ATG)
is located in exon -_ [_ ]. \- e have recently cloned a fr ag-
ment of -6"0' u ~ the ATG of SLC7Ai in primary
cultures of HC\"EC and detected that this fragment of the
potential promo er of SCL Al contains several consensus
sequences for transcription factors that may be critical for theregulation of its expression by insulin and/or D-glucose [23,
24] (Fig. 1).
INSULIN AND D-GL 'COSE EFFECT ON ENDOTHE-
LIAL L-ARGININE/NO PATHWAY
L-Arginine Transport
Incubation of HUVEC primary cultures in an euglycae-
mic culture medium (i.e. containing -5 m M D-glucose) with
physiological r esting concentrations of insulin (-0.1 nM)
increased the maximal transport velocity (Vmax) without sig-
nificant changes in the apparent Km for L-arginine transport
[23]. This phenomenon was seen as a higher maximal tr ans-
port capacity (i.e. ~naJKm) [17, 20, 25, 26] of the involved
membrane transporters for cationic amino acids [23]. The
-650 GTTAAGGTGAACTGCGCTCCAGCCTGGGCAATAGAGTAACACCCTGTCTCTAAAATGAAAAGAAAACAG- - .-581 TTTAAACCTTTTAAGTGCATACCAAATCTTTTATTTTGGAGAAGGAAAACTGGTCTCGAGTTCCGTGTG
P53
-512 AGCTCCCTGGGGCCCGCCGGGAGGGGGTTGGCACGGCCGGACCTGCAGCACTAGTTCTGGCCAGGGCGC
-443 TGTGGGATCTGCAGGGGACCACAGGATGCTGTGGCGCGGTGCGCTCAGATTGGCGGAGAAACGGCCACA
EGR-1 NFKB (p50)
-374 CGCCTACGGAGCTACTGAGAAGGCGAGCGGAGGCGCAGCCCGCCCGCCCGCCGCGGGAACCCCAGGTTG
-305 GGGCGCTGGGCGCGCGAAGACTCAGCCGCCCCGCCCACCAAGGGCGCGTCGGTCCCCGGCCGCAGCCTC
CREB Sp1
-236 TGGGCTGGCAGCCGCCGCCGCGCCGCGCTCCCATTGGTGCCCGGCGGTGACGCGGCCGAGCGGGCCGGG
Sp1 Sp1 Sp1
-167 GCTGCCTGGTCCGGGGGCGGGCGTGGGGCGCGGGGCGCGGAGCGCGAGGGGCGGGGGCCGGGCGCACTG
Elk- 1
-98 CTGATGAAACCTGGCGCCGGAACCCGCCAGCCCTCGGCGCCCATTCAGTCCGCGCAGGCAGGTGTGAGC
*
+109 GAGCGCGTCCGACAGTCTGTCTGTTCGCGATCCTGCCGGAGCCCCGCCGCCGCCGGCTTG~
Fig. (1). Scheme of the -650 bp region from proposed transcription start site at SLC7AI. Thesequenceofthe region -650 bpfromthe
proposed transcriptionstartsite(*)ofthe potential promoter ofthe geneS LC7 A I (forhuman cationic amino acid transporter 1, hCAT-1) that
hasbeencloned is shown.Proposed firstexon ofthetranscript extendsbetween -650to+ 142bp. Thelocation ofprimersusedtoamplifYthi
region of thepromoter isindicatedbythe arrowsandcorrespondedto:sense ACGCGTTAA GGTGAA CTGCGC TCC, antisense CCATGGATC GCG AAC AGA CAG ACT.Underlinedare bindingsitesfor transcriptionfactors such asstimulatoryprotein 1(Spl), nuclear
factorkappaB (NFKB), p53 tumor repressor factor,early growth responsefactor1 (EGR-l), cyclic AMP responseelement-binding (CREB)
and the transcriptionfactorwith ETS domain (Elk- J) .
-
8/10/2019 Sobrevia & Gonzalez 2009
3/8
(NT1 ONOO.
L-Arginine
hCAT-1 protein
" heAT' mRNA
Insulin ~
! -- /..ROSj~.....
SplNF,B
Fig. (2). Proposed regulatory mechanisms of hCAT-I expression and activity by high D-glucose and insulin in HUVEC. Exposure of
HUVEC to an elevated extracellular level of D-glucose (High D-glucose) increases the intracellular level of reactive oxygen species (ROS)
likely derived from NAD(P)H oxidase. ROS formation may stimulate via Sp I and NFkB transcription factors the SLC7AI gene promoter
activity leading to increased hCAT-1 mRNA expression and protein abundance. These events result in an increased L-arginine tr ansport via
heAT-I and nitric oxide (NO) and L-citrulline synthesis via the endothelial NO synthase (eNOS). The NO could rapidly react with ROS to
fonn peroxynitrite (ONOO) contributing to endothelial dysfunction. Insulin isproposed to protect the endothelial cell by blocking the effect
of D-glucose on the generation of intracellular ROS, reducing the effect of these molecules on SLC7Al expression and L-arginine transport.
Insulin under hyperglycaemia could also act as a repressor of D-glucose activated ROS generation protecting the endothelial cells from this
abnormal environment.
reported magnitude of the insulin stimulatory effect on L-
arginine transport (~5 fold) was comparable to the trans-
-rimulatory effect of L-lysine on L-arginine transport meas-
ured under zero-trans conditions for L-lysine in this cell type
[II, 23] (see Fig. (2. These results are complemented and
supported by parallel studies showing that insulin increased
dlehCAT-I mRNA number of copies [23] and protein abun-
ance (Gonzalez M, Sobrevia L, unpublished data). These
-rudies suggest that insulin-induced L-arginine transport is
most likely due to increased expression and activity of
,CAT-! membrane transporters in HUVEC. In addition,
:l1Sulineffect on L-arginine transport was proposed as a phe-
:lOmenon resulting from a sequential activation of cell sig-
:1alling molecules, including phosphatidylinositol 3 kinase
PI3k), protein kinase C (PKC), NOS and mitogen-activated
rotein kinases p42 and p44 (p42/44mapk), which are known
to be involved also in the modulation of several other mem-
rane transport systems in mammalian cells [6, 17].
It has been reported that incubation ofprimary cultures of
~VEC with increasing concentrations of extracellular D-
glucose for a period of 2 minutes (acute effect) increased L-
c:rginine transport, reaching a maximal effect at 25 mM D-
_ucose [10]. The increase in L-arginine transport induced by
ute exposure of HUVEC to high D-glucose has been ex-
lained as an increase in the activity ofhCAT-! transporters.-;tis phenomenon is more likely due to plasma membrane
yperpolarization due to increased K+ efflux through ATP-
: nsitive K+ channels ([K +]ATP)[10]. It has also been re-
ported that longer incubation periods (24 h) with high con-
centrations of extracellular D-glucose (~25 mM) increases
the ~nax of the L-arginine transport, an effect blocked by
inhibition of protein synthesis or when cells are pre-
incubated with 1 nM insulin for 8h [16]. The increase of L-
arginine transport induced by chronic incubation with D-
glucose was also associated with increased hCAT-l mRNA
level and L_[3H] citrulline synthesis from L-eH] arginine
[24]. In preliminary assays, we have been able to detect a
potential effect of D-glucose at a transcriptional level modu-
lating hCAT-! expression, a phenomenon that is also
blocked by i nsulin (Gonzalez M, Sobrevia L, unpublished
data). Thus, it is feasible that insulin could be triggering sig-
nalling pathways that will potentially interfere with an in-
creased SLC7Ai transcriptional activity in response to a high
D-glucose environment.
eNOS Expression and Activity
In endothelial cells from human aorta, long incubation
periods (7 days) with 25 mM D-glucose decreases eNOS
activity, protein abundance and mRNA level, effects that
was associated with r educed activity of eNOS promoter [27].
In HUVEC, chronic incubation with 25 m M D-glucose (up
to 24 h) increases eNOS protein abundance, an effect that
seems involve P13k and protein kinase B (PKB)/Akt activity[24, 28]. Several studies report that in an early hyperglycae-
mic state, activation of these signalling molecules would lead
to cell survival, but after 2 4 h it will increase cell death by
-
8/10/2019 Sobrevia & Gonzalez 2009
4/8
apoptosis, 'an effect regulated by activation of the nuclear
factor kappa B (NFKB) [28]. This differential response of
cells to states of hyperglycaemia could result f rom accumu-
lation of reactive oxygen species (ROS), whose generation is
elevated in cells exposed to high extracellular concentrations
of D-glucose [28, 29]. On the other hand, in endothelial cells
from mouse lungs it has been reported that insulin could pro-tect in a NO-dependent manner against endothelial dysfunc-
tion (estimated by variations of the electrical trans-
endothelial resistance) induced by hydrogen peroxide (HzOz)
[30]. However, endothelial cells from bovine aorta (BAEC)
exhibit less NO synthesis induced by insulin when cells were
incubated with high concentrations of extracellular D-
glucose, an effect that appears to depend on a signalling
pathway involving insulin receptor type 1 (lR-I), PI3k and
the inhibitor of the kinase subunit of nuclear factor kappa 13
(IKKB) [31]. In studies performed in primary cultures of
HUVEC, high D-glucose (25 mM, 24 h) increased cGMP
synthesis, an effect blocked by 1 nM insulin (8 h) [17]. In the
same cell type it has been shown that at this concentrationand time of exposure to insulin is enough to block the high
D-glucose-dependent inhibition of the membrane transport
of adenosine, an endogenous nucleoside that induces NO-
depehdent vasodilatation in most vascular beds [32, 33]. All
together these results indicate that deleterious effects of
chronic exposure to high concentrations of extracellular D-
glucose could be mediated by increased NO synthesis in
human umbilical vein endothelium. Whether the effect of
high D-glucose and the potential role of insulin as a protec-
tive factor in this phenomenon is either at a transcriptional
and/or post-transcriptional level has not yet been described[9, 17,33].
INSULIN AND D-GLUCOSE EFFECT ON ROS
SYNTESIS
Cell death by apoptosis induced by high concentrations
of extracellular D-glucose has been linked to the increased
production of ROS. This is reflected as increased nitroty-
rosine formation and PKC activity in HUVEC incubated in
the presence of high concentrations of extracellular D-
glucose, either under permanent (20 mM, 14 days) or inter-
mittent (repeated periods of 24 hours with concentrations of
5 or 20 mM D-glucose for 14 days) incubation periods [34].
In BAEC, ithas been shown that incubation with 25 mM D-
glucose for 3 h increases ROS synthesis dependent of
NAD(P)H oxidase [35]. This study also shows that incuba-
tion with physiological concentrations of insulin for 3 h in-
duces an even greater increase in the synthesis of ROS, al-
though during the first hour of incubation with this hormone
is possible to detect a decline in the synthesis of ROS in-
duced by D-glucose [35]. Thus, it is likely that an acute ef-
fect of insulin could be acting to protect from the damage
induced by overproduction of ROS in response to high con-
centrations of extracellular D-glucose. This effect of insulin
could probably be due to activation of NOS and increased
NO bioavailability in the endothelium. The mechanisms by
which ROS induces its effect include regulation of gene ex-
pression and post-translational mod ifications [36]. One of
the most studied transcription factor regulated by ROS is
NFKB, which is found in most cells at rest, and that rapidly
translocates to the nucleus inducing gene transcription after
its a 'y ::0 ::1 . _'hBis also involved in the d evelopment of
insulin res' .one of the first events that occur before the
establ"-hm t 0 diabetes mellitus [37]. Although we know
that imer D-glu 0e or insulin increase L-arginine transport
and:\O . 'llth -is. a haracterization of the mechanisms be-
hind the r ulting in reased ROS production and activation
of transcription fac ors, including d1e zinc finger promoter-selectiYe transcription factor specific protein 1(Spl), in re-
sponse to these molecules is not well established. Unveiling
the intrinsic mechanisms behind modulation of gene tran-
scriptional activity will give us clues to understand a poten-
tial protective effect of insulin before endothelial damage is
triggered bypathological states of hyperglycaemia.
D-GLUCOSE AND I SULIN EFFECT ON Spl ACTI-
VI TY
Within aregion of~4000 bp upstream from the transcrip-
tion start site of SLC7AI, multiple consensus sites of various
transcription factors have been identified by insilica analysis
of sequence. Within d1ese factors, it is possible to identify
consensus sites for Smad-4, NFKB and Spl, among others,
which are regulated by insulin or D-glucose. Within this re-
gion d1ere are at least four consensus sites for Spl close to
the transcription start site ofSLC7 AI. These sites could play
key roles as regulators of the transcription of this gene since
it lacks of TATA box [22]. Also, there are 2 consensus sites
for NFKB around -3200 and -600 bp r egion from the tran-
scription start site, which are potentially regulated by ROS.
Since there is experimental evidence suggesting that Spl is
involved in gene-specific responses to a variety of cellular
signals independent of the interaction with other inducible
transcription factors, and since this transcription factor is
apparently involved in the regulation of membrane transport-
ers expression, such as SLC29AI for the human equilibrative
nucleoside transporters type 1(hENTl) in HUVEC [38], in
preliminary experiments we have studied a region of 650 bp
upstream of the transcription start site in SLC7AI [39]. Spl
is activated by phosphorylation of serine and threonine resi-
dues, a phenomenon altered in response to various stimuli
that activate different signalling pathways. The amino acid
sequence of Spl contains consensus phosphorylation sites
for numerous protein kinases, including calmodulin kinases
(CamKs), casein kinases (CK) 1 and 2, protein kinase A
(PKA), PKC, and p42/44mapk [40]. Interestingly, it has been
reported that increase in the tr anscriptional activity of plas-
minogen activator inhibitor-l (PAl-I) induced by insulin
(100 nM, 16 hours) in HepG2 cells transfected with PAI-l
promoter, involves activity of PI3k, PKC and p42/44map\
among other signalling molecules [41]. In PAI-I gene at
least three consensus sites for transcription factors induced
by insulin has been identified, all of which co-localize with
putative consensus sites for SpI [41]. Thus, a potential role
for Sp 1 as modulator of PAl-1 gene expression is suggested.
In addition, in the same cell type, D-glucose incubation (~23
mM, 24 and 48 h) decreases the level of apolipoprotein A 1
(apoA-I) mRNA, an effect that was blocked by insulin. This
phenomenon was dependent on a region of the promoter
where an insulin response core element (IRCE) is present
[42]. SpI binds to this element and the signallinp pathwaytriggered by insulin appears to involve p42/44map and PKC
activity, and Spl phosphorylation [43].
-
8/10/2019 Sobrevia & Gonzalez 2009
5/8
I
There is also evidence that SpI is essential for basal tran-
scription of calmodulin gene and for the increase of tran-
scriptional activity of this gene induced by insulin [44]. In
addition, insulin increases the o-glycosylation and phos-
phorylation of SpI in the HAllE hepatoma cell line, which
is reduced when cells are from streptozotocin-induced dia-betic rats [45]. Recently, it has been shown that insulin (100
) increases PKC8 expression, aphenomenon that is under
::cgulation by PKCa in the skeletal muscle cell line L6 via a
:;:nechanismrequiring Sp 1and NFKB activation [46]. Since in
rimary cultures of HUVEC it has been reported that insulin
srimulation of hCAT- I -mediated L-arginine transport de-
_ nds on PI3k, PKC and p42/44mapk activity [23], it is likely
:hat SpI would be acting as akey transcription factor modu-
~ -ng SLC7Ai expression by insulin or high extracellular
:uncentrations of D-glucose in HUVEC (Table 1).
Preliminary experiments performed inHUVEC incubated
'm 25 mM D-glucose (24 hours) and I nM insulin (for last
h of the 24 h period of incubation with high D-glucose)-' ow increased SpI protein abundance in nuclear protein
_ :::-acts(Gonzalez M, Sobrevia L, unpublished data). Co-
_ -ubation of HUVEC monolayers with D-glucose and insu-
lin produced a greater increase of S p I n uclear abundance,
which would possibly indicates that both insulin and D-
glucose activated diff erent signalling pathways to increase
Sp I activity in this cell type. Although ithas not been possi-
ble to determine whether it also leads to an increase in phos-
phorylation or glycosy lation of Sp 1,we found increased S p 1
binding to a region of the SLC7 Ai promoter containing four
consensus sites for SpI in tandem. This finding indicates that
at least part of the D-glucose- and insulin-increased hCAT-I
mRNA level could be due to increased expression and activ-
ity of Sp I on SLC7 Ai. Sp I activity seems to regulate not
only hCA T-1 expression, but could also participate in the
transcriptional regulation of eNOS. The promoter region of
eNOS has been characterized and is known to exhibit con-
sensus sites for transcription factors such as activator pro-
tein-I (AP-I), GATA binding protein 2 (GATA-2), ETS
binding domain (Ets) family members, and members of the
Sp family (Spl and Sp3), among others [47]. On this back-
ground it is tempting to propose that the signalling pathwaysinduced by D-glucose and insulin might include activation of
Spl inducing expression of genes relevant to the endothelial
L-arginine/NO pathway.
I I Stimuli Gene Blank Cell Type Promoter Mechanism ReferencesActivity
Insulin PAl-l Human hepatoblastoma Increased Increased Sp1binding to DNA [41]
HepG2
Insulin Apo-Al Human hepatoblastoma Increased Increased Spl binding to IRCE motifs [42]
HepG2
Insulin Apo-Al Human hepatoblastoma Increased Phpsphorylation of Sp 1 a nd increase of [43]
HepG2 IRCE binding
Insulin Calmodulin Rat hepatoma H-4 lIE Increased Promotor without Sp I binding sites, cannot [44]
I I be stimulated by insulin
Insulin PKC15 Skeletal muscle L6 Increased Inhibition of expression and activity of Sp I [46]
blocked the effect of insulin on PKCo
promoter
J-Glucose TGF-j3l PAl-l Rat mesangial cells Increased Inhibition of expression and activity of SpI [61]
blocked the effect of insulin on TGF-fil
and PAI-I promoter
J-Glucose lR-l Rat hepatocytes Increased Effect ofD-glucose on promoter was [62]
blocked when 3 or 4 binding sites of SpI
were mutated
._ ose Insulin Leptin Adipocytes and hepa- Increased Mutation ofSpl response element, blocked [63]
tocytes from rat the D-glucose/insulin effect
=>-Glucose Acetyl-CoA SL2 from Drosophila Increased Mutation of Sp 1binding sites, blocked the [64]
effect of D-glucose
H,O, Spl Nuclear extracts f rom n.d. H,O, decreased the Spl binding to DNA [65]
rat kidney
H,O, Aldolase Pyruvate Rat timocytes n.d. H,O, decreased the Sp I binding to DNA [66]
kinase
-
8/10/2019 Sobrevia & Gonzalez 2009
6/8
INSULIN ~D D-GLUCOSE EFFECT ON NFKB
Since it was described in 1986, the transcription f actor
NFKB has been the subject of many studies due to its impor-
tant role in inflammatory processes and other pathologies. In
the beginning NFKB was described as a specific protein of B
cells, but it is now known to be an ubiquitous transcription
factor [48]. NFKB activation is induced and independent of
protein synthesis, requiring post-translational changes for its
migration to the nucleus. Initially, NFKB was described as a
transcription factor that could be stimulated by several im-
munological stimuli, such as tumour necrosis factor (TN F),
lipopolysaccharide (LPS) [49, 50], interleukin-I (IL-I) [51],
or as a f actor that activates T cells [52]. However, more re-
cently it has been shown that the transcriptional activity of
several genes is increased via NFKB in response to a series of
stimuli that are unrelated with the immune response, such as
ultraviolet radiation, growth factors [53] or viral infections
[54]. The latent nature of NFKB is in relation with it associa-
tion with the inhibitory protein kappa B inhibitor (IKB). The
release of this complex allows the migration of NFKB to the
nucleus [55]. Interestingly, it has been reported that incuba-
tion of BAEC in culture medium containing 30 mM D-
glucose increases NFKB translocation toward the nucleus
[56]. In addition, in HUVEC it has been shown that hyper-
glycaemia also increased NFKB protein abundance in the
nucleus, and that this increase depends on the activity of
PI3kJAkt [57], signalling molecules that ar e determinant for
L-arginine transport and NO synthesis in response to insulin
in this cell type [17, 23]. Other studies also show that incuba-
tion of BAEC and human aortic endothelial cells (HAEC) in
30 mM D-glucose (16 hours) increases NFKB binding to the
DNA [58]. Thus, it seems clear that high D-glucose effect on
endothelial cells involves NFKB activation in a variety of
endothelia indicating that this phenomenon is not limited to a
specific type of endothelium. On the other side, insulin has
been shOKl1 to either reduce NFKB binding to the DNA in
HAEC [59] or increase )!FKB-induced transcriptional activ-
ity of genes in '-ascular smooth muscle cells from bovine
aorta (YSMC) transfected with a vector containing response
elements to NFKB [60]. Thus, literature regarding the poten-
tial involvement of NFKB in cell response to insulin is wide
open and specific mechanisms are not well understood (Ta-
ble 2).
CONCLUDING REMARKS
It is proposed that insulin modulates L-arginine transport
and NO synthesis in human fetal endothelium via cell signal-
ling mechanisms that respond to increased activity of Sp I
andNFKB transcription factors. The gene SLC7 Al coding for
hCAT -I membrane transporters express consensus se-
quences for binding of t hese transcription factors, particu-
larly S p I, suggesting that increased expression of hCA T-I in
response to elevated D-glucose and insulin could result from
increased expression ofSLC7 AI. Nothing is known regard-
ing ROS and the transcriptional activity of SLC7AI in re-sponse to elevated D-glucose or in response to insulin, even
when it is accepted that the pathological condition of hyper-
glycaemia leads to generation of abnormal levels of ROS in
HUVEC. These fmdings could be d eterminant in the dy-
namic of the regulation of expression and activity of L-
arginine membrane transporters (particularly hCA T-I) and
eNOS in human fetal endothelium d erived from pregnancies
where abnormally elevated plasma D-glucose levels could be
found such as in gestational diabetes.
Supported by Fondo Nacional de Desarrollo Cientifico y
Tecnol6gico (FONDECYT 1070865, 1080534, 7070249)
Stimuli Gene blank Cell type Effect on Mechanism References
mRNA level
D-Glucose NFJd3 BAEC n.d. Increased nuclear localization ofNFK.B [56]
D-Glucose COX-2 HUVEC n.d. Increased NFKB DNA binding [57]
D-Glucose NFKB HAEC n.d. Increased NFKB DNA binding [58]
D-Glucose Fibronectin HUVEC Increased Increased NFKB DNA binding [67]
D-Glucose VCAM-l HAEC Increased Increased NFKB DNA binding [68]
D-Glucose Fibronectin HUVEC Increased Increased NFKB DNA binding [69]
Insulin ?KCa L6 skeletal muscle Increased Inhibition ofNFKB activity blocked the [46]
increase ofmRNA
Insulin MC?-! HAEC Decreased Decreased NfKB DNA binding [59]
ROS NFKB HUVEC n.d. Inhibition ofROS synthesis blocked ROS- [70]
induced NFKB activity
ROS NFKB HMEC.l n.d. LPS-increased ROS increased NfKB DNA [71]
binding
BAEC: bovine artery endothelialcells, HUVEC: humanumbilicalvein endothelialcells, HAEC: human arteryendotbelialcells, HMEC.I: human dermal microvascularendotheli2l
cells,LPS: lipopolysaccharide,ROS: reactive oxygen species,n.d.: not determined.
-
8/10/2019 Sobrevia & Gonzalez 2009
7/8
#
dComisi6n Nacional de Ciencia y Tecnologia (CONICYT
-~070213), Chile. M. Gonzalez holds a CONICYT-PhD
~!Jowship (Chile). We thank the researchers at the Cellular
Molecular Physiology Laboratory (CMPL) and Perina-
_ogyResearch Laboratory (PRL) of the Pontificia Univer-
d Cat6lica de Chile (puq for their contribution in the__ duction of the experimental data that has been cited
:=oughout the text. Authors also thank the personnel of the
o pital Clinico Pontificia Universidad Cat6lica de Chile-,' urward for supply of umbilical cords.
Fishman AP. Endothelium: A distributed organ of diverse capabili-
ties. Ann NY Acad Sci 1982; 401: 1-8.
Galley H, Webster N. Physiology of the endothelium. Br J Anaesth
2004; 93: 105-13.
Moncada S, P almer R MJ, Higgs EA. The discovery of nitric oxide
as the endogenous nitrovasodilator. Hypertension 1988; 12: 365-
72.
Yanagisawa M, Kurihara H, Kimura S, Tomobe Y. A novel potent
vasoconstrictor peptide produced by vascular endotelial cells.
Nature 1988; 332: 411-5.
Ignarro LJ, Buga GM, Wood KS, Byrns RE, Chaudhuri G. Endo-
thelium-derived relaxing factor produced and released from artery
and vein is nitric oxide. Proc Natl Acad Sci 1987; 84: 9265-9.
Mann GE, Yudilevich DL, Sobrevia L. Rel,'Ulation of amino a cid
and glucose transporters in endothelial and smooth muscle cells.
Physiol Rev 2003; 83: 183-252.
Steinberg HO, Baron AD. Vascular function, insulin resistance and
fatty acids. Diabetologia 2002; 45: 623-34.
Kuboki K, Jiang ZY, Takahara N, Ha SW, Igarashi M, Yamauchi
T, et af. Regulation of endothelial constitutive nitric oxide synthase
geneexpression in endothelial cells and in vivo: a specific vascular
action of insulin. Circulation 2000; 101: 676-81.
Desoye G, Hauguel-de Mouzon S. The human placenta in gesta-
tional diabetes mellitus. The insulin and cytokine network. Diabe-
tes Care 2007; 30: 120-6.
Flores C, Rojas S, Aguayo C, Parodi J, Mann G, Pearson JD, et al.
Rapid stimulation of L-arginine transport by D-glucose involves
p42/44mapk and nitric oxide in human umbilical vein endothelium.
Cir Res 2003; 92: 64-72.
Casanello P, Sobrevia L. Intrauterine growth retardation is associ-
ated w ith reduced activity and expression of the cationic amino
acid transport systems y+/hCA T-l and y+/hCAT-2B and lower ac-
tivity of nitric oxide synthase in human umbilical vein endothelial
cells. Circ Res 2002; 91: 127-34.
Durante W, Sen AK, Sunahara FA. Impairment of endothelium-
dependent relaxation in aortae from spontaneously diabetic rats. Br
JPharmacol 1988; 94: 463-8.
Bossaller C, Habib GB, Yamamoto H, Williams C, Wells S, Henry
PD. Impaired muscarinic endothelium-dependent relaxation and
cyclic guanosine 5'-monophosphate formation in atherosclerotic
human coronary artery and rabbit aorta. J Clin Invest 1987; 79:
170-4.
Guyao W, Morris SM. Arginine metabolism: nitric oxide and be-
yond. Biochem J 1998336: 1-17.
Alderton WK, Cooper CE, Knowles RG. Nitric oxide synthases:
structure, function and inhibition. Biochem J200I; 357: 593-615.
Sobrevia L, Mann GE. Dysfunction of the nitric oxide signalling
pathway in diabetes and hyperglycaemia. Exp Physiol 1997; 82:
423-52.
Casanello P, Escudero C, Sobrevia L. Equilibrative Nucleoside
(ENTs) and Cationic Amino acid (CATs) Transporters: implica-
tions in foetal endothelial dysfunction in human pregnancy dis-
eases. Curr Vasc Pharmacol2007; 5: 6 9-84.
Arancibia-Garavilla Y, Toledo F, Casanello P, Sobrevia L. Nitric
oxide synthesis requires activity of the cationic and neutral amino
acid transport system y+L in human umbilical vein endothelium.
Exp Physiol2003; 88: 699-710.
Verrey F, Closs EI, Wagner CA, Palacin M, Endou H, Kanai Y.
CATs and HATs: the SLC7 family of amino acid transporters. Eur
J Physiol2003; 447: 532-42.
[20] Deves R, Boyd CAR. Transporters for cationic amino acids in
animal cells: Discovery, structure and function. Physiol Rev 1998;
78: 487-545.
[21] Palacin M, Estevez R, Bertran J, Zorzano A. Molecular biolog y of
mammalian plasma membrane amino acid transporters. Physiol
Rev 1998; 78: 969-1054.
[22] Hammermann R, Brunn G, R acke K. Analysis of the genomic
organization of the human cationic amino acid transporters CA T-l,
CAT-2 and CAT-4. Amino Acids 2001; 21: 211-9.
[23] Gonzalez M, Flores C, Pearson JD, Casanello P, Sobrevia L. Cell
signalling-mediating insulin increase ofmRNA expression for cati-
onic amino acid transporters-l and -2 and membrane hyperpolari-
zation in human umbilical vein endothelial cells. Eur J Physiol
2004; 448: 383-94.
[24] Vasquez R, Farias M, Lvis VJ, San MR, Vecchiola A, Casanello P,
et al. D-Glucose stimulation of L-arginine transport and nitric ox-
ide synthesis results from activation of mitogen-activated protein
kinases p42/44 and Smad2 requiring functional type II TGF- Re-
ceptors in human umbilical vein endothelium. J Cell Physiol 2007;
212: 626-32.
[25] Escudero C, Casanello P, Sobrevia L. Human equilibrative nucleo-
side transporters I and 2 may be differentially modulated by A2B
adenosine receptors in placenta microvascular endothelial cells
from preeclampsia. Placenta 2008; 29: 816-25.
[26] Vasquez G, Sanhueza F, Vasquez R, Gonzalez M, San Martin R,
Casanello P,et al. Role of adenosine transport in gestational diabe-
tes-induced L-arginine transport and nitric oxide synthesis in hu-
man umbilical vein endothelium. J Physiol2004; 560: 111-22.
[27] Srinivasan S, Hatley ME, Bolick DT, Palmer LA, Edelstein D,
Brownlee M, et al. Hyperglycaemia-induced superoxide production
decreases eNOS expression via AP-l activation in aortic endothe-
lial cells. Diabetologia 2004; 47: 1727-34.
[28] Ho FM, Lin WW, Chen BC, Chao CM, Yang CR, Lin LY, et al.
High glucose-induced apoptosis in hu man vascular endothelial
cells is mediated through NF-kappaB and c-Jun NH2-terminal
kinase pathway and prevented by PI3K/AktieNOS pathway. Cell
Signal 2006; 18:391-9.
[29] Hadi HA, Suwaidi JA. Endothelial dysfunction indiabetes mellitus.
Vasc Health Risk Manag. 2007; 3: 853-76.
[30] Rath S, Kalogeris T, Mai N, Zibari G, Alexander JS, Lefer D, et af.
Insulin prevents oxidant-induced endothelial cell barrier dysfunc-
tion via nitric oxide-dependent pathway. Surgery 2006; 139: 82-91.
[31] Kim F, T ysseling KA, Rice J, Gallis B, Haji L, Giachelli CM, et af.
Activation of IKKbeta by glucose isnecessary and sufficient to im-
pair insulin signaling and nitric oxide production in endothelial
cells. J Mol Cell Cardiol2005; 39: 327-34.
[32] Munoz G, San Martin R, Farias M, Cea L, Vecchiola A, Casanello
P, etal. Insulin r estores glucose inhibition of adenosine transport
by increasing the expression and activity of the equilibrative nu-
cleoside transporter 2 in human umbilical vein endothelium. J Cell
Physiol 2006; 209: 826-35.
[33] San Martin R, Sobrevia L. Gestational diabetes and t he adeno-
sinelL-arginine/nitric oxide (ALANO) pathway in human umbilical
vein endothelium. Placenta 2006; 27: 1-10.
[34] Quagliaro L, Piconi L, Assaloni R, Martinelli L, Motz E, Ceriello
A. Intermittent high glucose enhances apoptosis related to oxida-
tive stress in human umbilical vein endothelial cells: the role of
protein kinase C and NAD(P)H-oxidase activation. Diabetes 2003;
52: 2795-804.[35] Yano M, Hasegawa G, Ishii M, Yamasaki M, Fukui M, Nakamura
N, et al. Short-term exposure of high glucose concentration ind uces
generation of reactive oxygen species in endothelial cells: implica-
tIOn for the oxidative stress associated with postprandial hypergly-
cemia. Redox Rep 2004; 9: 111-6.
[36] Carnesecchi S, Carpentier JL, Foti M, Szanto 1. Insulin-induced
vascular endothelial growth factor expression is mediated by the
NADPH oxidase NOX3. Exp Cell Res 2006; 3 I 2: 3413-24.
[37] Rutledge AC, Adeli K. Fructose and the metabolic syndrome:
pathophysiology and molecular mechanisms. Nutr Rev 2007; 65:
SI3-S23.
[38] Puebla C, Farias M, Gonzalez M, Vecchiola A, Aguayo C, Krause
B, et al. High D-glucose reduces SL C29A1 promoter activity and
adenosine transport involving specific protein I in h uman umbilical
vein endothelium. J C ell Physiol2008; 215: 645-56.
[39] Gonzalez M, Vecchiola A, Farias M, Casanello P, Sobrevia LInsulin blockage of D-glucose-stimulation of L-arginine trans
-
8/10/2019 Sobrevia & Gonzalez 2009
8/8
does not involves Spl binding to SLC7Alpromoter region in hu -
man fetal endothelium. Physiol Mini-Rev 2006; I: 28 (Abstract).
Samson S, Wong NCW. Role of Spl in insulin regulation of gene
expression. J Mol Endocrinol 2 002; 29: 265-79.
Banfi C, Eriksson P, Giandomenico G, Mussoni L, Sironi L, Ham-
sten A, et al. Transcriptional regulation of plasminogen activator
inhibitor type I gene by insulin: insights into the signaling path-
way. Diabetes 2001; 50: 1522-30.
Murao K, Wada Y, Nakamura T, Taylor AH, Mooradian AD,
Wong NC. Effects of glucose and insulin on rat apolipoprotein A-Igene expression. J Bioi Chern 1998; 273: 18959-65.
Lam JK, Matsubara S, Mihara K, Zheng XL, Mooradian AD,
Wong Ne. Insulin induction of apolipoprotein AI, role of Spi.
Biochemistry 2003; 42: 2680-90.
Solomon SS, Palazzolo MR, Takahashi T, Raghow R. Transcrip-
tion factor SpI is necessary for basal calmodulin gene transcription
and for its selective stimulation by insulin. Endocrinology 1997;
138: 5052-64.
Majumdar G, Harrington A, Hungerford J, Martinez-Hernandez A,
Gerling IC, Raghow R, et at. Insulin dynamically regulates
calmodulin gene expression by sequential o-glycosylation and
phosphorylation of Spl and its subcellular compartmentalization in
liver cells. J Bioi Chern 2006; 281: 3642-50.
Horovitz-Fried M, Sampson SR. Involvement of PKCalpha in
insulin-induced PKCdelta expression: Importance of SP-I and
NFkappaB transcription factors. Biochem Biophys Res Commun
2007; 352: 78-83.
Fish JE, Marsden PA. Endothelial nitr ic oxide synthase: insight
into cell-specific gene regulation in the vascular endothelium. Cell
Mol Life Sci 2005; 63: 144-62.
Grimm S, Baeuerle PA. The inducible transcription factor NF-
kappa B: structure-function relationship of its protein subunits.
Biochem J 1993; 290: 297-308.
Crisostomo PR, Wang Y, Markel TA, Wang M, Lahm T, Meldrum
DR. Human mesenchymal stem cells stimulated by TNF-alpha,
LPS, or hypoxia produce growth factors by an NF kappa B- but not
JNK-dependent mechanism. Am J Physiol 2008; 294: C675-C682.
Nakao S, Oglata Y, Shimizu E, Yamazaki M, Furuyama S, Sugiya
H. Tumor necrosis factor alpha (TNF-alpha)-induced prostaglandin
E2 release is mediated by the activation of cyclooxygenase-2
(COX-2) transcription via NFkappaB in human gingival fibro-blasts. Mol Cell Biochem 2002; 238: 11-8.
Jung YJ, Isaacs JS, Lee S, Trepel J, Neckers L. IL-I bela-mediated
up-regulation of HIF-lalpha via an NFkappaB/COX-2 pathway
identifies HIF-I as a critical l ink between inflammation and onco-
genesis. FASEB J2003; 17:21 15-7.
Schaecher K, Goust JM, Banik NL. The effects of calpain inhibi-
tion on IkB alpha degradation after activation of PBMCs: identifi-
cation of the calpain cleavage sites. Neurochem Res 2004; 29:
1443-5 I.
Chetty A, Cao GJ, Nielsen He. Insulin-like growth factor-I signal-
ing mechanisms, type I collagen and alpha smooth muscle actin in
human fetal lung fibroblasts. Pediatr Res 2006; 60: 389-94.
Kuhnel F, Zender L, Paul Y, Tietze MK, Trautwein C, Manns M, et
al. NFkappaB mediates apoptosis through transcriptional activation
of Fas (CD95) in adenoviral hepatitis. J Bioi Chern 2000; 275:
6421-7.
Baldwin AS Jr. The NF-kappa B and I kappa B proteins: new di;-
coveries and insights. Annu Rev Immunol1996; 14: 649-83.
Nishikawa T, Edelstein D, Du XL, Yamagishi S, Matsumura -
Kaneda Y, et al. Normalizing mitochondrial superoxide pr oducti
blocks three pathways of hyperglycaemic damage. Nature 2000
404: 787-90.
Sheu ML, Ho FM, Yang RS, Chao KF, Lin WW, Lin-Shiau SY,
al. High glucose induces human endothelial cell apoptosis thro _
a phosphoinositide 3-kinase-regulated cyclooxygenase-2 pathwz;
Arterioscler Thromb Vasc BioI 2005; 25: 539-45.Mohan S, Hamuro M, Koyoma K, Sorescu GP, Jo H, Natarajan . l
High glucose induced NF-kappaB DNA-binding activity in HAEC
is maintained under low shear stress but inhibited u nd er high sh=
stress: role of nitric oxide. Atherosclerosis 2003; 171: 225-34.
Aljada A, Ghanim H, Saadeh R, Dandona P. Insulin inhibi-
NFkappaB and MCP-I expression in human aortic endothelia.
cells. J Clin Endocrinol Metab 2001; 86: 450-63.
Golovchenko I,Goalstone ML, Watson P, Brown lee M, Draznin B
Hyperinsulinemia enhances transcriptional activity of nuclear fa -
tor-kappaB induced by angiotensin II, hyperglycemia, and ad-
vanced glycosylation end products in vascular smooth muscle cells.
Circ Res 2000; 87: 722-4.
Chae YM, Park KK, Magae J, Lee IS, Kim CH, Kim HC, el a~
Sp I-decoy oligodeoxynucleotide inhibits high glucose-induced me-
sangial cell proliferation. Biochem Biophys Re s Commun 200!
319: 550-5.
Fukuda H, Noguchi T, Iritan i N. Transcriptional regulation of inS1..
lin receptor gene promoter in rat hepatocytes. Biochem Biophy:
Res Commun 2001; 280: 1274-8.
Fukuda H, Iritani N. Transcriptional regulation of leptin gene pro-
moterinrat. FEBSLett 1999;455: 165-9.
Daniel S, Kim KH. Spl mediates glucose activation of the acetyl-
CoA carboxylase promoter. JBioi Chern 1996; 271: 1385-92.
Ammendola R, Mesuraca M, Russo T, Cimino F. The DNA-
binding efficiency of Spl is affected by redox changes. Eu r J Bio-
chern 1994; 225: 483-9.
Schafer D, Hamm-Kunzelmann B, Herrnfisse U, Brand K. Differ-
ences in DNA-binding efficiency of SpI to aldolase and pyruva ~
kinase promoter correlate with altered redox states in resting ane
proliferating rat thymocytes. FEBS Lett 1996; 391: 35-8.
Xin X, Khan ZA, Chen S, Chakrabarti S. Glucose-induced AI..,:activation mediates fibronectin synthesis in endothelial cells. Dia-
betologia 2005; 48: 2428-36.
Kouroedov A, Eto M, Joch H, Volpe M, Luscher TF, Cosentino F
Selective inhibition of protein kinase Cbeta2 prevents acute effec
of high glucose on vascular cell adhesion molecule-I expression -
human endothelial cells. Circulation 2004; 110: 91-6.
Chen S, Mukherjee S, Chakraborty C, Chakrabarti S. High gluco-~-
induced, endothelin-dependent fibronectin synthesis is medial
via NF-kappa Band AP-l. Am J Physiol Cell Physiol 2003; 2
C263-72.
Matsunaga T, Hokari S, Koyama I, Harada T, Komoda T. 1\T-
kappa B activation in endothelial cells treated with oxidized hig
density lipoprotein. Biochem Biophys Res Commun 2003; 30:'
313-9.
Chan EL, Murphy JT. Reactive oxygen species mediate endotoxID-
induced human dermal endothelial NF-kappaB activation. J SUl1"
Res 2003; III: 120-6.
top related