contrôle et modulation de la réponse immunitaire par brucella … · 3 i. e. 2. les proprietes...
Post on 10-Nov-2020
0 Views
Preview:
TRANSCRIPT
AIX-MARSEILLE UNIVERSITE Faculté des sciences de Luminy
Ecole Doctorale des Sciences de la Vie et de la Santé
THESE DE DOCTORAT Biologie - Spécialité : Immunologie
En vue d'obtenir le titre de DOCTEUR DE L’UNIVERSITÉ D’AIX MARSEILLE
Présentée et soutenue publiquement par: Clara DEGOS
27 Novembre 2014
Contrôle et modulation de la réponse immunitaire par Brucella abortus
Directeur de thèse : Dr Jean-Pierre Gorvel
Thèse soutenue devant le jury composé de:
Prof Franck GALLAND Président
Dr David O’CALLAGHAN Rapporteur
Prof Jean-Jacques LETESSON Rapporteur
Dr Jean-Pierre GORVEL Directeur de thèse
Prof Jean-Louis MEGE Examinateur
Le travail réalisé dans cette thèse a été effectué au Centre d’Immunologie de Marseille-Luminy, UM 2 Aix Marseille Université, UMR_S 1104 CNRS, UMR 7280 Inserm
2
SOMMAIRE
REMERCIEMENTS 5
ABBREVIATIONS 7
TABLE DES FIGURES ET TABLEAUX 10
I. INTRODUCTION 12
I. A. LA BRUCELLOSE 13
I. A. 1. ORIGINE : BRUCELLA 13
I. A. 2. REPARTITION SUR LE GLOBE 13
I. A. 3. CONTAMINATION ET SYMPTOMES 13
I. A. 4. CONSEQUENCES ET PROBLEMES VACCINAUX 14
I. B. LES FACTEURS DE VIRULENCE 16
I. B. 1. LE LIPOPOLYSACCHARIDE (LPS) 16
I. B. 2. LE GLUCANE CYCLIQUE Β 1,2 (CΒG) 17
I. B. 3. LE SYSTEME DE SECRETION DE TYPE IV : VIRB 18
I. B. 4. LES PROTEINES DE MEMBRANE EXTERNE (OMP) 19
I. C. LA VIE INTRACELLULAIRE 21
I. C. 1. ENTREE DANS LES CELLULES 21
I. C. 2. TRAFIC INTRACELLULAIRE : LA BCV SUR LES TRACES DES ENDOSOMES 22
I. C. 3. LE RETICULUM ENDOPLASMIQUE, UN HAVRE DE PAIX 23
I. D. BRUCELLA ET LE SYSTEME IMMUNITAIRE 25
I. D. 1. UNE STRATEGIE D’EVITEMENT : REPONSES AUX TLR 25
I. D. 2. LA RESISTANCE AUX DEFENSES INNEES 27
I. D. 3. BRUCELLA ET LES DC 31
I. D. 4. L’IMMUNITE ADAPTATIVE CONTRE BRUCELLA 33
I. E. CD150, UN RECEPTEUR A LA SURFACE DES CELLULES IMMUNITAIRES 37
I. E. 1. CD150, UNE MOLECULE HOMOPHYLIQUE DE CO-STIMULATION 37
3
I. E. 2. LES PROPRIETES IMMUNOMODULATRICES DE CD150 38
I. E. 3. CD150 ET LES INFECTIONS 40
I. E. 4. CD150, UN RECEPTEUR BACTERIEN ? 42
II. RESULTATS 43
II. A. RESUME DES ACTIVITES 44
II. B. OMP25 SE LIE A CD150 POUR CONTROLER L’ACTIVATION DES DC
DURANT L’INFECTION PAR BRUCELLA 45
II. B. 1. INTRODUCTION 45
II. B. 2. RESULTATS – ARTICLE EN PREPARATION 46
II. C. LE CΒG DE BRUCELLA ACTIVE LES DC ET CONTROLE LE RECRUTEMENT
DES NEUTROPHILES 67
II. C. 1. INTRODUCTION 67
II. C. 2. MANUSCRIT SOUMIS 68
II. D. BTPB, UNE PROTEINE CAPABLE DE MODULER L’ACTIVATION DES DC 92
II. D. 1. INTRODUCTION 92
II. D. 2. ARTICLE 93
III. DISCUSSION ET CONCLUSION GENERALE 107
IV. MATERIEL ET METHODES 113
IV. A. MATERIEL VIVANT 114
IV. B. REACTIFS 115
IV. C. BACTÉRIOLOGIE 119
IV. D. BIOLOGIE CELLULAIRE 122
IV. E. BIOLOGIE MOLECULAIRE 123
IV. F. BIOCHIMIE 127
4
V. REFERENCES 129
VI. ANNEXE 141
VI. A. ARTICLE : LIPOPOLYSACCHARIDES WITH ACYLATION DEFECTS
POTENTIATE TLR4 SIGNALING AND SHAPE T CELL RESPONSES. 142
5
Remerciements La meilleure partie d’une thèse selon une autre doctorante… Je tenais donc à remercier tout d’abord mon directeur de thèse, Jean-Pierre, pour m’avoir permis de réaliser ma thèse dans le laboratoire. Aussi merci pour m’avoir laissée une certaine liberté que je n’aurais pas eu dans d’autres laboratoires. Il était aussi très rassurant qu’à chaque fois que j’entrais dans le bureau, dépitée par une énième expérience ratée, vous me disiez : « Non mais je suis sûr que tu vas réussir ! », et au final j’ai réussi à le faire ce blot (et à reproduire 3 fois mes manips ! I did it !) Et merci de m’avoir aidée pour la suite, j’apprécie énormément. Un grand merci à Stéphane pour m’avoir tout appris ou presque en biochimie et biologie moléculaire. J’ai bien compris que tu aimais ça, j’ai un peu plus de mal, cela dit je vois que ça peut quand même être super cool un blot réussi. Et tu sais que je n’aurais sans doute pas réussi les clonages, et prouver que slam interagit avec Omp25 sans toi ! Merci aussi pour toutes les discussions sur tout et rien qu’on a eu, ça faisait toujours du bien. Suzana, tu sais à quel point je t’adore, et je dois te dire un grand merci pour tant de choses. Merci pour m’avoir prise en M2, m’avoir fait découvrir Brucella (ou BruBru de son petit nom), m’avoir initiée à la recherche et m’avoir transmis ta vision de la science. Merci aussi pour un tas d’autres choses (le confocal le 31 décembre, les post it dans le labo, les coups de fil/mails qui remontent le moral, et plein de choses). Tu es ma chercheuse préférée en tout point tu sais :) Merci l’Equipe JPG (comme dirait Alexia) pour l’ambiance, les croissants du vendredi, les pots en tout genre (merci à Chantal et son fantastique gâteau au citron (le meilleur de la planète)), c’était vraiment cool. Et puis on a quand même le bureau le plus cool du CIML : Papa Hugues/Huggy/Oggy, Johnny (vive la nourriture gratuite et non on n’aime pas les gens), Clément, Aurélie, Raja et Alexia. Merci à tout plein de personnes aux CIML : à Olivier mon parrain de thèse, Sylvain, Marc et Atika de la cytométrie parce que vous avez toujours souri à mes blagues, et rien que pour ça, merci (et bravo. Je connais le niveau quand même). Merci à Lionel pour sa bonne humeur. Merci à Lydia (toujours vivante ?!), Toufik pour les blagues (je m’en suis toujours pas remise, meilleure blague du monde tu sais), Djélani pour m’avoir chouchouté niveau ordi et écran, même si tu aimes Internet Explorer, je sais qu’un jour tu abandonneras IE, j’ai foi en toi. Merci à Carole, Franck et Fred, pour notre semaine de cours qui chaque année me permettait de respirer un peu. Merci aux autres thésards pour les discussions pas scientifiques mais tellement mieux : Yannick, Clément C, Clément G, Yaya (you speak french too well you know). Merci à Mohammed mon copain du samedi/dimanche (au choix), à Voa et tous les gens du midi.
6
Merci à mes copines du P3/bureau/team BruBru (yes !) : Alexia et Aurélie (dans l’ordre alphabétique, je ne veux froisser personne hein !). Vous allez vraiment trop me manquer les filles. Bon je suis quand même heureuse de partir, maintenant je pourrais chanter quand/comme je veux et Alexia ne me menacera pas de couper la radio (super virulente (comme BruBru) la fille), et Aurélie ne fera pas de blagues plus que douteuses sur une phrase tout à fait innocente. Merci pour les fous rires, pour les coups de mains dans les manips, pour les pauses café, les quizz, danses, et autre choses bizarres (hein Aurélie) au P3 pour passer le temps. Merci à Aurélie pour ses dessins qui ornent à peu près tout (de l’agrafeuse aux post-it oui oui), pour avoir un petit côté nerveux (je me sens vachement moins seule du coup) et pour être aussi petite que moi, ouf ! Merci à Alexia d’avoir su me rassurer/consoler quand j’en avais besoin (et d’être tellement plus calme et maligne que moi sur plein de choses). Je vous aime. Merci à ceux qui sont partis trop tôt (je ne veux pas dire morts voyons ! juste partis vers d’autres labos !) : Sandra tu m’as manquée, Philippe (aka le Plombier), Irène, tes blagues (volontaires ou pas), ton rire, Aude-Agnès (heureusement que tu es revenue via Ciphe), Samira, Caroline, et tous les gens qui vont soutenir juste avant moi et ne seront pas présents (merci les gars du soutien !). Merci à Amélie d’être la fille la plus coool du monde, de ne pas m’en vouloir quand j’oublie de te répondre, d’avoir posé un jour exprès pour ma thèse, d’être toujours prête pour un thé/tisane, et d’être mon amie et ce depuis un bon nombre d’années (ça nous rajeunit pas cette histoire !). Et puis merci de m’avoir sauvé pour la bio mol. Merci à ma famille de penser que je suis hyper douée et super brillante, parce que je connais plein de mots bizarres terminant par -cytes, ça fait toujours du bien à l’égo. Bon et surtout merci du soutien. Et le meilleur à la fin (et forcément dans cet ordre-là…) : Rémi, merci, merci, merci et merci, pour tout. Merci de m’avoir accompagné certaines fois le week end au labo, ou m’avoir ramené parce, oups, j’ai oublié d’éteindre/ranger/blabla quelque chose. Merci de m’avoir rassurée et calmée quand j’en avais besoin. Et merci parce que sans toi je serais devenue plus folle que je ne le suis déjà, parce que ça fait toujours du bien de te retrouver le soir, et parce que je t’aime (bien plus que BruBru !). Pour résumer ma thèse… Il n’y a pas de réussite facile ni d’échecs définitifs. Marcel Proust (merci les papillotes et Johnny !)
7
ABBREVIATIONS
AP-1 : Activator protein 1
B. abortus : Brucella abortus
B. melitensis : Brucella melitensis
B. suis : Brucella suis
BAL : Lavages bronchoalvérolaires
BCR : B cell receptor
BCV : Brucella containing-vacuole
BLS : Brucella lumazine synthase
Brucella wt OM : Extraits de membrane de Brucella sauvage
Brucella ∆omp25 OM : Extraits de membrane de Brucella mutant pour Omp25
Bsp : Brucella secreted protein
Btp : Brucella tir protein
CβG : Glucane cyclique β 1,2
CDC : Center of disease control
CLR : Receptors lectines de type C
CMH : Complexe majeur d’histocompatibilité
COX : Cyclooxygénase
CPA : Cellule présentatrice d’antigène
CTL : LT cytotoxiques
DC : Cellules dendritiques
E. coli : Escherichia coli
EAT2 : EWS-Fli1-activated transcript-2
ERES : RE exit sites
HSC : Hematopoïetic stem cell
Ig : Immunoglobuline
IFN-γ : Interferon-γ
IL-1β : Interleukine-1β
IL-2 : Interleukine-2
IL-4 : Interleukine-4
IL-6 : Interleukine-6
IL-8 : Interleukine-8
8
IL-10 : Interleukine-10
IL-12 : Interleukine-12
IRAK : Interleukin-1 receptor-associated kinase
IRF : Interferon regulatory factor
IRF-1 : Interferon regulatory factor 1
IRF-8 : Interferon regulatory factor 8
ITAM : Immunoreceptor tyrosine-based activation motifs
ITSM : Immunoreceptor tyrosine-based switch motifs
LAMP-1 : Lysosomal-associated membrane protein 1
LB : Lymphocytes B
LBP : LPS binding proteins
LPS : Lipopolysaccharide
LT : Lymphocytes T
mAbs : Anticorps monoclonaux
ME : Membrane externe
MI : Membrane interne
MMP : Métallo-matrix protéases
NF-AT : Nuclear factor of activated T-cells
NF-κB : Nuclear factor-kappa B
NK : Natural Killer
NLR : Nod-like receptors
NO : Oxyde nitrique
NOS : Synthase de l’oxyde nitrique
NOX2 : NADPH Oxydase 2
OMV : Outer membrane vesicles
PAMP : Pathogen associated molecule pattern
PrpA : Proline racemase protein A
PRR : Pattern recognition receptor
PtdIns(3)P : Phosphatidylinositol-3-phosphate
RE : Réticulum endoplasmique
ROS : Réactifs oxygénés
SAP : SLAM-associated protein
Sbi : Ig -binding protéine A staphylococcale
SHP-2 : SH2 domain-containing protein
9
SLAM : Signaling lymphocyte activation molecule
SPA : Protéine staphylococale A
SR-A : Scavenger receptor A
S19 : Souche 19
TCR : T cell receptor
Th : LT helper
TIR : Toll/IL-1 receptor
TLR : Toll-like receptor
TNF-α : Tumor necrosis factor alpha
Treg : LT régulateurs
T4SS : Système de sécrétion de type IV
UPR : Unfolded protein response
10
TABLE DES FIGURES ET TABLEAUX
p.13 / Fig. 1 : Phylogénie des différentes espèces de Brucella et leurs hôtes naturels.
p.14 / Fig. 2 : Répartition mondiale des cas de brucellose en l’an 2000.
p.15 / Fig. 3 : Modes de contamination humain et animal.
p.16 / Fig. 4 : Structure du LPS de Brucella.
p.18 / Fig. 5 : Structure schématique d’un système de sécrétion de type IV.
p.19 / Fig. 6 : Structure de la membrane de Brucella.
p.22 / Fig. 7 : Schématisation du site d’entrée de Brucella et des protéines pouvant y
participer.
p.23 / Fig. 8 : Trafic intracellulaire de la BCV et les protéines eucaryotes ou bactériennes
requises.
p.25 / Fig. 9 : Les récepteurs TLR et leurs ligands.
p.26 / Fig. 10 : Voies de signalisation en aval des TLR.
p.27 / Fig. 11 : Différents mécanismes de détection de Brucella et les voies de signalisation
en aval des récepteurs.
p.31 / Fig. 12 : Différentes étapes de maturation des DC.
p.33 / Fig. 13 : Différentes populations de LT CD4+ et leurs réponses face aux infections.
p.37 / Fig. 14 : Récepteurs murins de la famille SLAMF.
p.48 / Fig. 15 : CD150 expression onto BMDC following stimulation with Brucella
membrane extracts.
p.48 / Fig. 16 : CD25 expression onto T CD4+ cells stimulated by differently activated
BMDC.
p.49 / Fig. 17 : Proliferation of T CD4+ cells stimulated by differently activated BMDC.
p.50 / Fig. 18 : Brucella ∆omp25 replicates as the wt strain within the ER in BMDC.
p.51 / Fig. 19 : Co-stimulatory molecules and MHC-II expression onto BMDC after Brucella
infection.
p.52 / Fig. 20 : NF-κB translocation within infected BMDC.
p.53 / Fig. 21 : mRNA expression of different pro-inflammatory genes in infected BMDC.
p.54 / Fig. 22 : Pro-inflammatory cytokines secretion upon BMDC infection.
p.55 / Fig. 23 : Brucella replication and intracellular localization in BMDC after CD150
blockade.
p.56 / Fig. 24 : NF-κB translocation within infected BMDC after CD150 blockade
11
p.57 / Fig. 25 : Pro-inflammatory cytokines secretion upon BMDC infection after CD150
blockade.
p.58 / Fig. 26 : NF-κB translocation within infected CD150 KO BMDC.
p.59 / Fig. 27 : Bacterial growth and weight organs in wt and ∆omp25 infected mice at 5 days
post-infection.
p.60 / Fig. 28 : Competitive index proliferation between Brucella wt and omp25 mutant
strains.
p.60 / Fig. 29 : Bacterial growth and weight organs in wt and ∆omp25 infected mice at 60
days post-infection.
p.61 / Fig. 30 : Survival curve of IFN-γ KO mice infected with Brucella wt or ∆omp25.
p.61 / Fig. 31 : Bacterial growth and weight organs in wt and ∆omp25 infected CD150 KO
mice at 8 days post-infection.
p.62 / Fig. 32 : Competitive index in CD150 KO mice.
p.62 / Fig. 33 : Brucella Omp25 binds CD150.
p.110 / Fig. 34 : Réplication de Brucella dans les souris CCR2 KO.
p.115 / Tableau 1 : Réactifs utilisés
p.116 / Tableau 2 : Anticorps
p.118 / Tableau 3 : Plasmides
p.119 / Tableau 4 : Souches bactériennes utilisées
p.124 / Tableau 5 : Amorces
12
I. Introduction
Figure 1 : Phylogénie des différentes espèces de Brucella et leurs hôtes naturels. Le phylum de Brucella compte dix espèces différentes : abortus, canis, ceti, inopinata, melintensis, microti, neotomae, ovis, pinnipidialis, suis. Différents isolats peuvent avoir différents hôtes et tropismes. Ainsi certaines souches de B. ceti infectent les mammifères marins tandis qu’une autre est propre à l’homme. Adapté de [3].
13
I. A. LA BRUCELLOSE
I. A. 1. Origine : Brucella
La brucellose ou « Fièvre de Malte » est une zoonose, maladie transmissible de l’animal à
l’homme. David Bruce a identifié en 1887 le pathogène responsable de cette infection,
Brucella. Cette bactérie semble être un pathogène très ancien et la brucellose pourrait sévir
depuis des millions d’années [1, 2].
Brucella est une bactérie pathogène à gram négatif appartenant au groupe α-2 des
protéobactéries. Ces bactéries sont décrites comme étant des bactéries intracellulaires
facultatives.
De nombreuses espèces appartiennent au genre Brucella et ont un tropisme particulier. A ce
jour, nous comptons près de 10 espèces différentes (Fig. 1) [3]. Parmi ces espèces Brucella
melitensis (B. melitensis), Brucella abortus (B. abortus) et Brucella suis (B. suis) sont celles
qui sont les plus pathogéniques pour l’homme [4].
I. A. 2. Répartition sur le globe
Avec plus de 500 000 nouveaux cas d’infection humaine par an, Brucella est l’un des agents
zoonotiques parmi les plus virulents et dont la répartition est très représentée au niveau du
globe terrestre. La brucellose est endémique dans de nombreux pays, en particulier dans les
pays du bassin Méditerranéen, de l’Amérique Latine et du Moyen Orient (Fig. 2) [4, 5]. De
nouveaux foyers apparaissent ou ré-émergent chaque année comme par exemple dans le nord
de la Chine ou la Mongolie. En France, les Alpes du Sud restent une zone où B. melitensis est
endémique chez les animaux sauvages comme les bouquetins [6, 7].
Récemment, Brucella a été classée par l’OMS dans le top 7 des zoonoses négligées,
responsables à la fois d’un problème de santé humain et économiques à cause de l’impact
négatif que la maladie cause aux animaux d’élevage [8].
I. A. 3. Contamination et symptômes
Les principaux hôtes naturels de Brucella sont les bovins, ovins, caprins ou encore les
mammifères marins. L’homme est un hôte secondaire. La contamination se fait par
Figure 2 : Répartition mondiale des cas de brucellose en l’an 2000. Répartition des cas déclarés de brucellose humaine en l’an 2000. Les pays les plus touchés sont la Mongolie et les pays du Moyen-Orient, et des Balkans. Certains pays d’Amérique Centrale et du Sud ainsi que les pays du bassin Méditerranéen comptent aussi de nombreux cas de brucellose humaine. Adapté de [4].
14
consommation de produits laitiers contaminés, par inhalation de poussières ou d’aérosols
contaminés, ou encore par contact direct avec des animaux infectés (Fig. 3) [9].
Du fait de la contamination possible par aérosol, Brucella est considérée et listée par le Center
of Disease Control (CDC) comme un agent du bioterrorisme de la liste B, les agents de
seconde priorité. B. suis fut même la première arme biologique développée par les Etats-Unis
dans les années 1950-1960 avant que le programme ne soit abandonné en 1969.
Brucella pénètre l’organisme par les voies aériennes et la voie orale, elle peut aussi pénétrer
par les lésions cutanées et les muqueuses. Chez les animaux, la bactérie va cibler le tractus
génital et provoquer des avortements chez les femelles et des infertilités chez les mâles [10].
L’infection chez l’homme conduit au bout de deux à quatre semaines à une infection aigüe
caractérisée par une fièvre ondulante et une asthénie générale. La bactérie se dissémine et peut
toucher différents organes. Chez 30 % des patients, cette phase évolue en maladie chronique.
Les foyers infectieux sont les os et articulations, le foie, et parfois le cœur ainsi que le système
nerveux, ces deux derniers cas provoquent des endocardites et neuro-brucelloses qui peuvent
être létales [11].
La transmission d’homme à homme étant très rare [12], les contaminations humaines sont très
étroitement liées à la présence d’un réservoir animal infecté. Le contrôle de la présence de la
bactérie dans ces réservoirs est donc critique pour la lutte contre la dissémination de la
maladie.
I. A. 4. Conséquences et problèmes vaccinaux
Les conséquences des infections à Brucella sont premièrement d’ordre économique. Des
campagnes de vaccinations concernant les animaux domestiques et d’élevage ont été
déployées pour éradiquer la bactérie dans plusieurs pays comme la France, grâce auxquelles
les contaminations humaines sont passées de 405 cas en 1983 à 44 cas en l’an 2000 [4].
Parmi les souches utilisées comme vaccins vivants, nous citerons la souche 19 (S19) de B.
abortus. Cette souche est éliminée plus rapidement que les souches virulentes chez les bovins
vaccinés [13]. De plus, elle induit une immunité protectrice. La souche avec un LPS
naturellement rugueux RB51 est aussi utilisée comme vaccin vivant chez les bovins. La
Figure 3 : Modes de contamination humain et animal. La contamination des hôtes naturels se produit pendant des avortements, par l’allaitement, ou encore par contact génital pendant la reproduction. Les contaminations humaines sont dues à la consommation de produits contaminés (lait, fromage), au contact direct avec des animaux infectés, ou l’inhalation de poussière. La plupart des cas concernent des fermiers, vétérinaires, ou des personnes travaillant en laboratoire. Adapté de [9].
15
protection induite est inférieure à celle induite par S19 [14]. Bien que cette souche soit moins
virulente que S19, il semble qu’elle provoque des avortements chez les animaux gravides
[15]. De plus, cette souche ayant été obtenue après plusieurs passages sur milieu contenant de
la rifampicine et de la pénicilline, elle est donc résistance à ces antibiotiques, ce qui pose un
problème de traitement.
Une des autres souches actuellement utilisée chez les moutons et chèvres est B. melitensis
Rev1. Cette souche porte une mutation dans le gène rpsL codant pour la protéine ribosomale
S12, qui confère la résistance à la streptomycine. A ce jour Rev1 est la souche la plus efficace
contre la brucellose ovine et caprine. Elle confère en effet 80 à 100 % d’efficacité [16]. S19 et
Rev1 sont des bactéries ayant un phénotype lisse (ou « smooth » en anglais, S). Cette
particularité vient de la composition de leur lipopolysaccharide (LPS) (voir partie I. B. 1).
Les vaccins utilisés actuellement chez les animaux, comme Rev1, S19 et RB51 ne sont
cependant pas efficaces à 100 % et ne protègent pas contre toutes les espèces de Brucella. Ils
induisent en outre des effets secondaires (avortements).
Une autre conséquence est l’obligation d’avoir une campagne de santé publique adéquate en
cas de situation endémique. La prophylaxie actuelle pour éradiquer la bactérie est, chez
l’homme, une combinaison de plusieurs antibiotiques : doxycycline et rifampicine ou
doxycycline et streptomycine pendant plusieurs semaines [17, 18].
L’élaboration de nouveaux vaccins efficaces chez l’homme notamment, reste donc toujours
un problème majeur dans la lutte contre la brucellose.
La pathogénicité de Brucella est liée à sa capacité à exprimer divers facteurs de virulence
agissant à la fois sur les étapes de la vie extracellulaire et intracellulaire de la bactérie.
Dans un premier temps, nous allons nous intéresser à décrire les principaux facteurs de
virulence importants pour la bactérie, puis nous décrirons sa vie intracellulaire.
Figure 4 : Structure du LPS de Brucella. Ancré dans la membrane externe de la bactérie, le LPS de Brucella est composé d’un lipide A relié au core lui-même relié à une chaîne O-polysaccharide (ou O-antigène). Le lipide A est composé de diaminoglucoses reliés à des chaînes de 18 à 28 carbones. Les LPS ne possédant pas de chaîne O-polysaccharide sont dits rugueux. Adapté de [19].
16
I. B. LES FACTEURS DE VIRULENCE
I. B. 1. Le lipopolysaccharide (LPS)
Composant majeur de la membrane externe des bactéries à gram négatif, le LPS est un motif
associé au pathogène ou PAMP (Pathogen Associated Molecule Pattern) reconnu par des
récepteurs immunitaires à la surface des cellules immunitaires tels que les Toll-Like Receptor
(TLR) et plus particulièrement TLR4 (voir partie I. D. 1).
Le LPS est composé du lipide A hydrophobe inséré dans la membrane bactérienne. Le lipide
A est relié à un core polysaccharide, lui-même généralement relié à une chaîne
oligosaccharide (chaîne O). On parle alors de LPS lisse. Si le core n’est pas relié à la chaîne
O, le LPS est défini comme étant rugueux (ou « rough » en anglais, R) (Fig. 4) [19]. Certaines
espèces de Brucella ont naturellement un LPS rugueux comme B. ovis ou B. canis, les autres
possèdent un LPS lisse. Le phénotype rugueux est quant à lui associé à une élimination des
bactéries durant l’infection chez la plupart des cas pour ces espèces [20].
Le LPS de Brucella est un LPS non canonique en raison de plusieurs changements au niveau
de sa structure comparé à des LPS canoniques plus classiques comme celui d’Escherichia coli
(E. coli). En effet, le lipide A de Brucella contient un squelette de diaminoglucose alors que
les LPS canoniques sont composés de glucosamine, et est relié à des groupes acyles plus
longs que pour les LPS classiques (18, 19 ou 28 carbones contre 12 ou 14). Les liaisons au
core sont aussi différentes. Dans le cas de Brucella, ce sont des liaisons amines
exclusivement, ce qui le différencie des autres LPS d’entérobactéries qui présentent des
liaisons esters.
Le LPS de Brucella a un rôle très important dans la pathogénicité en jouant à la fois sur la vie
intracellulaire et le trafic de la bactérie. Mais il a aussi un rôle prépondérant dans la réponse
du système immunitaire. Nous reviendrons sur cet aspect dans la partie I. D.
17
I. B. 2. Le glucane cyclique β 1,2 (CβG)
Les glucanes cycliques sont des composés de l’enveloppe de bactéries à gram négatif. Ils ont
des rôles divers selon les organismes : par exemple, la stabilité de la membrane des bactéries,
la motilité, la synthèse des exopolysaccharides.
Composé de 17 à 25 glucoses reliés par des liaisons en β (1,2), le CβG de Brucella est trouvé
en forte concentration (1 à 10 mM) dans le périplasme et constitue 1 à 5 % du poids sec de la
bactérie. Il a aussi été montré comme crucial pour la survie intracellulaire des bactéries en
contrôlant la maturation de la vacuole dans laquelle elle se trouve pour éviter qu’elle ne
fusionne avec les lysosomes. De plus, en interagissant avec les radeaux lipides et le
cholestérol, le CβG a un rôle dans les premières étapes de la vie intracellulaire de la bactérie
dans les cellules infectées [21].
Récemment, une étude menée au laboratoire a montré que ce composé avait des propriétés
activatrices des cellules dendritiques (DC) murines et humaines. En effet, après stimulation
avec le CβG, les DC acquièrent un phénotype mature, caractérisé par une surexpression des
molécules de co-stimulation et des molécules du complexe majeur d’histocompatibilité de
classe II (CMH-II) à la membrane, par une production de cytokines pro-inflammatoire et une
capacité à activer les lymphocytes T (LT). Cette activation est un mécanisme dépendant de
TLR-4, mais ne dépend pas de CD14, molécule co-réceptrice de TLR-4 [22].
Contrairement aux macrophages, un mutant pour le CβG (cgs-) n’a pas de défaut de
réplication dans les DC [21, 23].
De plus, cette molécule est non toxique et non immunogénique, ce qui lui vaut d’être
considérée comme un nouvel adjuvant potentiel [22].
Ce facteur de virulence est donc crucial à la fois pour établir une infection, une vie
intracellulaire au sein des cellules hôtes mais aussi pour déclencher une réponse immunitaire.
Les différentes réponses induites, selon les cellules ciblées restent inexpliquées. Aucun
récepteur reconnaissant le CβG n’a été encore identifié, et le fait que cette molécule soit
capable d’accéder à la BCV reste encore un mécanisme inconnu.
Figure 5 : Structure schématique d’un système de sécrétion de type IV. Différentes protéines composent le T4SS. Dans le cas d’Agrobacterium, le T4SS est composé de VirB5 et VirB2 dans le cytosol de la cellule, puis les protéines VirB7, VirB9 et VirB10 composent le cœur du T4SS qui transporte les molécules à transloquer. Les protéines VirB4 et VirB11 (des ATPases) permettent à l’appareil de sécrétion de fonctionner grâce notamment à l’utilisation de l’ATP. VirB6 et VirB8 forment le complexe entre le cytosol de la bactérie et sa membrane interne. Adapté de [29].
Outer e ra e
I er e ra e
18
I. B. 3. Le système de sécrétion de type IV : VirB
Les systèmes de sécrétion ont un rôle essentiel dans la pathogénicité des bactéries. A ce jour,
il y a 9 types de système de sécrétion connus [24, 25].
Ces composants sont essentiels à la translocation de protéines au sein de cellules hôtes.
Brucella possède un système de sécrétion de type IV (T4SS), tout comme Agrobacterium
tumefaciens, Helicobacter pylori, Bordetella pertussis, ou encore Legionella pneumophila
[26-29]. Etant donné que la structure T4SS de Brucella n’est pas encore complètement
caractérisée, les études sont souvent basées sur des analogies avec celui d’Agrobacterium.
La seringue moléculaire qui traverse la double membrane des bactéries permet la
translocation de protéines et d’ADN. Elle a donc des fonctions dans la conjugaison, la capture
d’ADN et la translocation de protéines depuis et vers l’environnement externe [30].
L’opéron virB est composé de plusieurs gènes : le complexe cytoplasmique-membrane interne
est composé de VirB6 et VirB8 qui fonctionne avec les ATPases VirB4, VirB11 [31] pour
déclencher les processus de sécrétion. Ce sont les protéines VirB7, VirB9 et VirB10 qui
interagissent pour former le cœur du complexe, un canal traversant la double membrane
bactérienne. Enfin les protéines VirB2 et VirB5 composent le pillus. D’autres protéines,
VirB3 et VirB12 semblent avoir un rôle dans l’assemblage du pillus (Fig. 5).
L’expression des gènes de cet opéron est étroitement régulée et dépend notamment de
l’acidité du milieu. Ainsi, lors d’une infection, l’expression du T4SS serait maximale après 5
heures d’infection et serait réprimée dès lors que les bactéries ont rejoint leur niche réplicative
[32, 33]. La régulation par le pH de cet opéron corrèle avec le fait que Brucella réside dans
une vacuole (appelée BCV pour Brucella Containing-Vacuole) qui va suivre un processus de
maturation au cours du temps. VjbR, un régulateur transcriptionnel liée au quorum sensing,
régule l’expression de l’opéron virB [34].
Le T4SS est essentiel à la survie intracellulaire en permettant la maturation de la BCV [27,
35]. Un mutant virB pour cet appareil de sécrétion ne parvient pas à établir des interactions
avec le réticulum endoplasmique (RE), la niche réplicative de Brucella. En absence de T4SS,
la bactérie n’est pas capable de sécréter les effecteurs permettant la maturation de la BCV.
Figure 6 : Structure de la membrane de Brucella .La double enveloppe de la bactérie est composée d’une membrane externe (ME) sur laquelle le LPS est ancré. Des protéines Omp (Outer membrane protein) sont enchâssées dans la ME et régulées par le système à deux composants BvrS/BvrR, situé dans la membrane interne (MI). Le périplasme, situé entre les deux membranes, contient différents composants dont le CβG. Le T4SS VirB traverse les deux membranes pour permettre la sécrétion d’effecteurs dans le cytosol
de la cellule hôte.
19
Certaines études in vivo montrent que pendant les premiers jours d’infection un mutant virB
n’est pas atténué, mais qu’à partir du 5ème jour sa réplication est deux fois plus faible que celle
de la souche sauvage [36]. VirB serait donc requis pour le maintien de la réplication après les
premiers temps d’infection et la survie de la bactérie.
I. B. 4. Les protéines de membrane externe (Omp)
Ces protéines/lipoprotéines sont insérées au niveau de la membrane externe bactérienne (Fig.
6).
Brucella spp compte 3 groupes d’Omp qui sont classées selon leur poids moléculaire : le
groupe 1 (43-94 kDa), le groupe 2 (36-38 kDa and 41-43 kDa) et le groupe 3 (25-27 kDa and
31-34 kDa). Les protéines du premier groupe sont des composantes mineures de la membrane
externe de la bactérie. Les protéines du groupe 2 quant à elles seraient pour la plupart des
porines [37, 38]. Les Omp du groupe 3 sont présentes en grande quantité dans les extraits
provenant des membranes externes et leurs fonctions ne sont pas toutes connues [39].
Dans le groupe 3, les deux premières protéines à avoir été identifiées sont Omp31 et Omp25
(ou Omp3a). Toutefois, Omp31 n’est pas exprimée par B. abortus [40, 41].
De nombreuses Omp semblent avoir des fonctions dans la réponse immunitaire. Ainsi, la
lipoprotéine Omp19 est connue pour diminuer la présentation antigénique et l’expression du
CMH-II dans les monocytes humains activés avec de l’interferon-γ (IFN-γ) [42].
Omp16 est reconnue par les DC via TLR-4 et induit une réponse immunitaire, notamment via
la sécrétion de cytokines pro-inflammatoires telles que le Tumor Necrosis Factor alpha (TNF-
α) et l’interleukine 12 (IL-12) et la surexpression de molécules de co-stimulation comme
CD80, CD86 et CD40. Cette réponse des DC va polariser la réponse immunitaire en une
réponse de type Th1 [43].
Omp25, dont l’expression est contrôlée par le système à deux composants BvrR/BvrS, joue
aussi un rôle dans la réponse immunitaire. Une souche mutante pour Omp25 (∆omp25) ne
présente pas de défaut de réplication dans les cellules épithéliales (HeLa), les macrophages
(Raw et THP-1), les DC humaines ou encore les polynucléaires neutrophiles [44, 45]. Il
semble que l’absence d’Omp25 dans des cellules HeLa induise une plus forte association des
bactéries avec les cellules [45]. Une autre étude propose que Omp25 et Omp22, une autre
20
protéine du groupe 3, sont essentielles à la survie de B. ovis au sein des cellules hôtes (des
cellules HeLa) [46].
La souche ∆omp25 chez B. suis induit une forte sécrétion de TNF-α et l’IL-12 dans les DC et
macrophages humains infectés [47, 48]. Omp25 semble donc réguler négativement la
production de cytokines pro-inflammatoires ainsi que l’activation de certaines cellules de
l’immunité innée pour réguler la réponse immunitaire adaptative via les LT [47].
Des études contradictoires ont montré in vivo que le mutant B. abortus ∆omp25 est atténué
dans des souris Balb/c à partir de 18 semaines d’infection [49]. Cependant, une autre étude ne
permet pas de distinguer une différence de réplication des bactéries dans la rate de souris
Balb/c infectées jusqu’à 24 semaines [45].
Les mécanismes liés au contrôle de l’activation par Omp25 ne sont pas connus. De même, les
processus à l’origine de l’atténuation de la virulence d’une souche déficiente en Omp25 dans
les infections in vivo ne sont pas encore élucidés.
Les vésicules de membrane externe ou « Outer Membrane Vesicles » (OMV) de Brucella,
contenant les protéines de la membrane externe, ont été très étudiées. Le processus
d’internalisation des OMV est dépendant de la clathrine dans les monocytes humains (THP-
1), une des voies d’endocytose classique des cellules mammifères [50].
Les OMV modulent la sécrétion de cytokines par ces cellules en la diminuant pendant
l’infection par Brucella ou pendant une stimulation avec des agonistes des TLR. Enfin, le
traitement de monocytes par les OMV précédant l’infection conduit à une augmentation de
l’adhésion et de l’internalisation de Brucella [50].
Les OMV de B. melintensis semblent avoir un effet protecteur contre l’infection in vivo [51].
L’ensemble de ces facteurs de virulence contribuent à établir un environnement favorable à
l’infection par Brucella. La caractérisation des différents facteurs influant à la fois sur la vie
extracellulaire, l’entrée dans les cellules, la vie intracellulaire et réplication de la bactérie sont
critiques pour la compréhension des mécanismes d’infection, ce qui pourra permettre de
développer de nouvelles cibles thérapeutiques.
21
I. C. LA VIE INTRACELLULAIRE
La capacité de Brucella à établir une infection chronique est à mettre en relation directe avec
sa capacité à envahir les cellules hôtes, à y survivre, se répliquer sans toutefois déclencher une
forte réponse cellulaire et immunitaire.
I. C. 1. Entrée dans les cellules
Le mode d’invasion ou d’entrée de Brucella dans les cellules hôtes n’est pas encore
complètement caractérisé.
Dans les cellules mammifères, trois voies majeures d’endocytose sont connues : la première
est une endocytose dépendante de la clathrine et de récepteurs endocytiques spécifiques [52] ;
la seconde voie est une invagination de la membrane des cellules (enrichie en cholestérol),
grâce aux radeaux lipidiques, qui peut être dépendante de la clathrine ou non. La troisième
voie est la formation d’une vacuole positive pour l’actine-F permettant la capture de particules
depuis l’espace extracellulaire. Ce phénomène est appelé phagocytose [52].
De nombreuses études ont été menées sur les voies d’entrée de Brucella dans les cellules
hôtes.
Dans le cadre des cellules non phagocytaires, une étude a montré que l’inhibition de la
clathrine conduisait à une abolition de l’entrée de Brucella dans les cellules HeLa [53]. De
plus, les radeaux lipidiques associés à la dynamine et à la clathrine sont aussi cruciaux pour
l’entrée et la survie intracellulaire de Brucella. L’interaction entre la clathrine et les radeaux
lipidiques permettent la polymérisation de l’actine, qui est requise pour l’entrée de la bactérie.
Par la suite, cette étude a montré que la clathrine est aussi requise pour l’association de
certaines protéines eucaryotes avec la BCV, comme Rab5 [53].
Ces découvertes laissent penser que le mode d’entrée de Brucella se déroule ainsi : la bactérie
entre dans les cellules selon un mécanisme dépendant des radeaux lipidiques et de l’actine-F.
La BCV interagit avec des protéines de la voie des endosomes précoces pour permettre à la
BCV de suivre le trafic intracellulaire jusqu’à sa niche réplicative [53].
Figure 7 : Schématisation du site d’entrée de Brucella et des protéines pouvant y participer.
Brucella est capable de pénétrer dans les cellules hôtes grâce à des radeaux lipidiques, mais aussi via la présence de récepteurs tels PrPc, SR-A. TLR4 pourrait aussi être impliqué dans l’entrée de la bactérie. SP-41, la HSP60 et le LPS de Brucella participerait à l’entrée au sein des cellules. L’actine, ainsi que des petites protéines G : Cdc42, Rho ou encore Rac sont
requises pour ce processus.Adapté de [62] .
22
Ces données ne sont pas très surprenantes sachant que d’autres bactéries telles que Listeria
[54, 55], E. coli [56], Chlamydia [57], ou encore Yersinia [58] utilisent des mécanismes
d’entrer dépendants de la clathrine, que ce soit d’une manière active ou non.
Dans le cas des phagocytes professionnels comme les macrophages, Brucella entre soit via les
radeaux lipidiques, soit par opsonisation [59]. L’entrée via les radeaux lipidiques est, dans ces
cellules, dépendante de la PI3-kinase et de TLR4 [60, 61]. Deux molécules semblent aussi
être importantes dans le mécanisme d’entrée : le scavenger récepteur de classe A (SR-A) et la
protéine PrPc. Ce récepteur pourrait être capable de lier la protéine heat-shock Hsp60 de
Brucella, même si ce rôle est controversé [62-64], tandis que SR-A pourrait lier le LPS [65]
(Fig. 7).
Récemment, une autre étude a montré que TLR4 semblait aussi être impliqué dans l’entrée de
la bactérie dans des cellules immunitaires comme les macrophages [66].
De nouvelles protéines bactériennes ont été identifiées comme ayant potentiellement un rôle
dans l’adhésion ou l’entrée de Brucella dans les cellules hôtes, parmi celles-ci, une adhésine
(Bab1_2009) [67] et la protéine SP-41 [68].
L’entrée de la bactérie semble étroitement liée à l’activité des GTPases Cdc42, Rho et Rac,
recrutées au niveau du site d’entrée, et qui interagissent avec le cytosquelette d’actine et le
réseau de microtubules pour faciliter l’internalisation [69].
I. C. 2. Trafic intracellulaire : la BCV sur les traces des endosomes
Une fois à l’intérieur des cellules, Brucella réside dans une vacuole, la BCV. Celle-ci suit la
voie endocytique et devient mature au cours du temps. Elle interagit avec les endosomes
précoces et acquiert certains de leurs marqueurs, comme EEA1 ou Rab5. Puis, la vacuole
s’acidifie, déclenchant ainsi la transcription de l’opéron virB, et son expression [30].
La BCV interagit ensuite avec les endosomes tardifs et les lysosomes. Elle acquiert en effet le
marqueur Lysosomal-associated membrane protein 1 (LAMP-1) ainsi que Rab-7 [70]. La
fusion de la BCV avec les lysosomes pourrait expliquer l’acidification de la BCV. Les auteurs
de cette étude [70] pensent que la durée de cette interaction serait limitée, pour éviter un
contact prolongé entre les composés antimicrobiens présents dans les lysosomes et la bactérie
[70].
Figure 8 : Trafic intracellulaire de la BCV et les protéines eucaryotes ou bactériennes requises.
Après l’entrée dans la cellule, Brucella réside dans une vacuole, la BCV. La BCV va suivre la voie endocytique et acquérir des marqueurs des différents compartiments endosomaux et lysosomaux. Le trafic de la BCV jusqu’au RE se fait grâce à l’action de différentes molécules bactériennes (en rouge) : le T4SS VirB, le LPS, RicA et le CβG. L’association de la BCV avec le RE et les ERES
est permise grâce à des protéines eucaryotes (en bleu).Adapté de [9] .
LPS
RicA Bsp
23
Certains facteurs de virulence de Brucella sont requis pour éviter une fusion prolongée et
permanente avec les lysosomes, dont le CβG et le LPS. En effet, un mutant cgs- n’est pas
capable d’éviter la fusion avec les lysosomes et est dégradé. En présence de CβG purifié,
ajouté avant l’infection, ce mutant est alors capable de se répliquer dans le RE comme la
souche sauvage dans les macrophages infectés [21, 71].
Différents effecteurs sont requis pour le trafic intracellulaire de la BCV et l’établissement
d’une niche réplicative dans le RE. Parmi ceux-ci RicA est transloqué pendant la phase
intracellulaire de l’infection et interagit avec Rab2 [72]. Cette interaction est nécessaire au
recrutement de Rab2 sur les BCVs. Le recrutement sur la BCV de Rab2 (ainsi que du
complexe GAPDH) permet le trafic intracellulaire de la vacuole jusqu’au RE et la survie de la
bactérie (Fig. 8) [73]. De plus, une infection avec un mutant RicA conduit à une
accélération du trafic intracellulaire qui induit une maturation plus rapide de la BCV quand on
la compare à une infection par une souche sauvage [72].
La translocation de protéines effectrices par virB pendant ces processus de trafic
intracellulaire a été décrite récemment dans la littérature [30, 62, 74-76]. Les protéines, BspA,
BspB, BspC, BspE, BspF (Bsp : Brucella secreted protein) font partie des effecteurs de virB
[74]. L’expression ectopique de BspA, BspB et BspF conduit à une inhibition générale de la
sécrétion de protéines dans les cellules. De façon intéressante, l’infection par Brucella conduit
à une diminution de sécrétion de protéines, via l’action de BspA, BspB et BspF. Cette
inhibition a lieu avant que la BCV ne devienne la niche réplicative de la bactérie grâce à BspB
et BspF. Ce mécanisme serait indispensable pour la persistance et réplication de Brucella
[74].
I. C. 3. Le Réticulum Endoplasmique, un havre de paix
Tous les phénomènes décrits ci-dessus ont pour but d’aboutir à l’arrivée de Brucella dans le
RE. Dans la plupart des types cellulaires, Brucella se réplique au sein du RE, à l’exception
notable des trophoblastes extravillaires infectés par B. abortus et B. suis dans lesquels la
bactérie se réplique dans des inclusions positives pour LAMP-1, ou des monocytes humains
dans lesquels Brucella réside dans des phagosomes positifs pour LAMP-1 [35, 77-80].
Les BCVs interagissent avec les ERES (endoplasmic reticulum exit sites), et acquièrent des
marqueurs Sec61, la calnexine, la calreticuline, probablement par des échanges de membranes
24
[35, 71, 77]. Ces mécanismes sont dépendants de protéines hôtes comme Sar1 et COPII [77].
On peut relier la présence de Bsp (BspA, BspB, BspF) et l’inhibition de la sécrétion de
protéines avec le fait que la bactérie réside au niveau du RE et interagit avec les ERES, qui se
situent au début des voies de sécrétion de la cellule.
Une fois que Brucella a atteint le RE, les bactéries commencent à se répliquer sans perturber
l’intégrité de la cellule, ni la tuer [62].
La réplication de la bactérie dans le RE est suivie par la conversion des BCVs en vacuoles
ayant des propriétés des autophagosomes [62, 77, 81]. Dans une étude récente, on note ainsi
que l’acquisition de certaines protéines de la voie autophagique (Beclin-1, ATG14L) sont
nécessaires à la formation de cette BCV particulière. Elle est requise pour le cycle
intracellulaire de Brucella et la sortie des bactéries de la cellule hôte avec pour conséquence
une infection des cellules environnantes [81].
Figure 9 : Les récepteurs TLR et leurs ligands.
Les TLR 1, 2, 4, 5 et 6 sont membranaires, tandis que les TLR 3, 7 et 9 endosomaux. Ils sont capables de reconnaître différents types de PAMP indiqués ici.
TLR2 fonctionne avec TLR1 ou TLR6 et reconnaît des ligands différents, tandis que TLR4 utilise MD-2, son co-récepteur CD14 et les LBP (LPS binding proteins) pour reconnaître le
LPS.Adapté de [87] .
25
I. D. BRUCELLA ET LE SYSTEME IMMUNITAIRE
Brucella, pour engendrer une maladie chronique et persister dans l’organisme va établir une
stratégie d’évitement du système immunitaire. En effet, elle contrôle l’inflammation trop
importante dès le début de l’infection, prévenant ainsi une destruction rapide de la bactérie
[82-85].
I. D. 1. Une stratégie d’évitement : réponses aux TLR
Un des piliers de cette stratégie d’évitement prônée par Brucella repose sur sa détection. En
effet, sans détection, ou induction de réponse après détection, le système immunitaire ne peut
réagir et monter une réponse immunitaire efficace contre le pathogène. Brucella agit donc sur
les récepteurs des cellules pouvant la détecter.
Ces récepteurs, appelés PRR pour « Pattern Recognition Receptor » sont les TLR, les nod-like
récepteurs (NLR) ou les récepteurs lectines de type C (CLR) [86]. Les TLR vont être capables
de reconnaître des PAMP de bactéries, de virus et de champignons (Fig. 9) et de déclencher
des voies de signalisation conduisant à la transcription de gènes cibles pour y répondre. Les
PRR sont exprimés par des cellules immunitaires telles que les macrophages, DC.
La reconnaissance de ces motifs va déclencher une cascade de signalisation passant par des
molécules adaptatrices comme TIRAP, Myd88, TRIF, TRAM puis par des MAPK. Ces
molécules ainsi que la partie cytoplasmique des TLR contiennent des domaines Toll/IL-1
receptor (TIR) qui permettent les interactions entre les récepteurs TLR et leurs molécules
adaptatrices [86, 87]. Les voies de signalisation aboutissent à la translocation dans le noyau
des cellules de facteurs de transcription comme nuclear factor-kappa B (NF-κB), activator
protein 1 (AP-1), interferon regulatory factor (IRF) ou nuclear factor of activated T-cells (NF-
AT) (Fig. 10). Ces différents facteurs sont responsables de la transcription de gènes cibles
comme les cytokines pro-inflammatoires TNF-α, l’IL-12, l’interleukine 6 (IL-6),
l’interleukine 1β (IL-1β) [88]. Des chimiokines, qui attirent les neutrophiles, comme CCL-2
(MCP-1), CXCL-12 (MIP-2), KC (analogue de l’interleukine 8 (IL-8) humain) sont aussi
sécrétées [89].
Figure 10 : Voies de signalisation en aval des TLR.La signalisation via les TLR requièrent la présence de molécules adaptatrices comme TIRAP, MyD88, TRIF ou encore TRAM. Après activation les molécules adaptatrices vont permettre l’activation de différentes kinases (IRAK (interleukin-1 receptor-associated kinase), et les MAP kinases). Après la cascade de signalisation, différents facteurs de transcription (AP-1, NF-κB) transloquent dans le noyau où ils permettent la transcription de gènes cibles pour répondre à la
détection d’un PAMP. Adapté d’Invivogen
26
Les TLR sont des récepteurs cruciaux pour la détection de Brucella, via la reconnaissance de
PAMP. Différentes études ont décrit l’importance des TLR dans les réponses contre la
bactérie, ainsi que dans la résistance conférée à l’hôte. TLR2 semble être important dans la
génération de cytokines comme TNF-α, l’IL-6, l’IL-12 et l’IL-10 par les macrophages
péritonéaux stimulés par les lipoprotéines Omp16 et Omp19 [90]. On peut donc supposer que
TLR2 est capable de reconnaître certains composants de la membrane externe de la bactérie.
Certaines études démontrent un rôle de Brucella sur la signalisation en aval de TLR2 et TLR4
et un rôle de TLR4 dans la résistance de l’hôte à l’infection [91, 92].
Un des ligands connus de TLR4 est le LPS. Dans le cadre de Brucella, nous avons vu
précédemment que son LPS est non canonique et présente une structure particulière.
Cette structure permet au LPS de Brucella d’être un faible inducteur de la signalisation en
aval de TLR4 [82, 93]. Alors que la liaison d’un LPS classique à TLR4 déclenche une forte
réponse immunitaire et inflammatoire, ici, la réponse est très atténuée. De plus, des DC
stimulées avec le LPS de Brucella purifié restent immatures [94]. Si on introduit une mutation
wadC dans le core oligosaccharidique (WadC est une glycosyltransferase qui transfère des
mannosides formant la partie du core oligosaccharidique externe) du LPS de Brucella on
augmente la liaison du LPS à MD2, co récepteur de TLR4, ce qui entraîne une forte réponse
immunitaire. La capacité du LPS de Brucella à induire une faible activation des DC est donc
conférée par son core [94]. Brucella utilise donc son LPS pour éviter une signalisation pro-
inflammatoire via TLR4.
Une autre étude a démontré que la lumazine synthase de Brucella spp (BLS) est reconnue par
TLR4 et est capable d’activer les DC après stimulation avec cette synthase [95]. De même, le
CβG est reconnu par TLR4 et va induire une activation des DC [22].
Cela conduit donc à avoir une balance entre des molécules aux propriétés activatrices et
d’autres aux propriétés inhibitrices des voies de signalisation en aval des TLR.
TLR9, récepteur endosomal, joue un rôle important dans l’initiation des réponses
immunitaires contre Brucella [96, 97]. L’ADN de Brucella est un ligand de ce récepteur et
déclenche une réponse de type Th1 [98]. Or, la production de cytokines pro-inflammatoires de
type Th1 comme l’IL-12 est réduite pendant l’infection des DC et macrophages TLR9 KO
[96, 98], suggérant un rôle protecteur de ce récepteur pour la cellule. Cependant, la production
de composés oxygénés (ici l’oxyde nitrique, NO) et de TNF-α n’est pas impactée, suggérant
Figure 11 : Différents mécanismes de détection de Brucella et les voies de signalisation en aval des récepteurs.
Divers composés de Brucella sont détectés via TLR4 (Omp16, LPS), TLR2 (Omp16, Omp19), ou encore TLR9 (ADN). La reconnaissance de ces molécules entraîne l’activation de voies de signalisation en aval de MyD88 et TRIF/TRAM. La reconnaissance de Brucella se fait aussi par les récepteurs NOD, ou d’autres récepteurs non connus qui activent RIP-2 et STING respectivement. Cela induit la translocation d’IRF-3, AP-1 et NF-κB dans le noyau des cellules, provoquant la
transcription de gènes pro-inflammatoires.Adapté de [97] .
27
qu’il y a d’autres voies d’activation telles que les voies de signalisation en aval de TLR2/6
[99].
TLR6 semble aussi important pour permettre de monter une réponse immunitaire efficace
contre Brucella [100]. En effet, dans un modèle de souris KO pour TLR6, il n’y a plus de
contrôle de l’infection et donc une réplication plus importante de Brucella. Au cours de
l’infection, TLR6 et TLR2 seraient requis pour l’activation de BMDC via la transduction de
signal des MAPK. TLR2 et TLR6 seraient de plus capables de reconnaître Brucella et activer
les DC [100].
Un modèle de souris KO pour MyD88, molécule adaptatrice présente dans les voies de
signalisation en aval de TLR1/6, TLR2, TLR9 et TLR4 notamment, a permis de démontrer le
rôle crucial de cette protéine dans les réponses immunitaires contre Brucella [92, 96]. En
effet, dans des souris KO pour MyD88, Brucella se réplique plus que dans des souris
contrôles. Ce défaut de contrôle de l’infection serait dû à une déficience de présentation
antigénique, et donc de production d’IFN-γ par les LT, ainsi qu’un manque de sécrétion de
cytokines pro-inflammatoires par les macrophages et les DC [92, 96].
Plusieurs TLR semblent donc être important à la fois dans la détection et reconnaissance de
Brucella, mais aussi dans leur rôle de molécules en amont de voies de signalisation, cruciales
pour monter une réponse immunitaire. Les molécules adaptatrices comme MyD88, ainsi que
les protéines de signalisation en aval de MyD88 sont aussi requises pour le contrôle de
l’infection (Fig. 11).
I. D. 2. La résistance aux défenses innées
L’une des grandes forces du système immunitaire inné repose sur la sécrétion de composants
capable d’éliminer les pathogènes : les ROS (réactifs oxygénés), les défensines, le
complément et peptides anti-microbiens. En cas d’infection, des protéines plasmatiques et des
polynucléaires neutrophiles sont attirés sur le site d’inflammation et s’y infiltrent. Les
neutrophiles s’activent dès leur arrivée dans le tissu soit via la détection du
pathogène/antigène, soit à travers l’action de cytokines sécrétées par les macrophages et
mastocytes.
28
Ils sécrètent alors des granules toxiques (phénomène appelé « dégranulation ») contenant des
ROS comme le NO produit par les NOS (nitric oxydase synthase) telle iNOS, des réactifs
azotés, de la cathepsine G, protéinase 3, de l’élastase [101]. La dégranulation vise à
l’élimination directe et rapide des pathogènes présents au site d’infection.
Cependant, Brucella est capable de limiter l’action des molécules anti-microbiennes. En effet,
des études ont permis de montrer qu’à la fois le LPS et la membrane externe de la bactérie
permettent d’éviter la lyse de Brucella par les peptides cationiques bactéricides. Les auteurs
de ces études ont testé une vingtaine de peptides, et systématiquement Brucella résiste mieux
à la mort induite par ces composés que les autres bactéries testées [102-104]. Brucella résiste
aussi à l’action de dégranulation des neutrophiles, ainsi qu’à l’activation du complément qui
permet l’opsonisation des pathogènes, leur phagocytose et leur dégradation [82, 105]. La
résistance au complément pourrait dépendre en partie d’une protéine de la bactérie, WboA,
qui inhiberait l’activation du complément via la voie des lectines du complément [106].
D’autres pathogènes ont déployé des moyens pour éviter l’élimination par le complément.
Ainsi, parmi les protéines de Staphylococcus aureus, la protéine staphylococcale A (SPA) et
l’immunoglobuline (Ig) -binding protéine A staphylococcale (Sbi) sont capables de lier les
fragments Fc des anticorps IgG, et ainsi de prévenir la phagocytose dépendante de
l’opsonisation [107]. De même, Neisseria meningitides exprime la protéine GNA1870
capable de se lier au Facteur H, une protéine requise pour le clivage permettant la formation
de C3b du complément [108].
Une explication possible à la résistance de Brucella aux molécules anti-microbiennes se
trouve dans la composition de la membrane de Brucella (LPS, lipoprotéines, phospholipides,
etc…). Ces éléments sont très hydrophobes et portent peu de charges négatives comparés à
d’autres bactéries [109].
Un autre mécanisme de résistance aux défenses innées est le contrôle et la manipulation du
trafic intracellulaire de la vacuole par les bactéries, via le LPS, le CβG, virB, etc… Cela
permet à Brucella de résister à la lyse par les lysosomes dans les cellules comme les
macrophages, qui sont l’une des premières lignes de défense immunitaire.
Les neutrophiles qui sont recrutés en cas d’infection font aussi partie de la stratégie de
Brucella pour minimiser l’inflammation causée par l’infection.
29
Brucella est capable d’échapper à la mort induite par ces cellules et les active faiblement
[110, 111]. De plus, le recrutement des neutrophiles dans les tissus à de temps précoces après
infection est relativement faible, ce qui est dû à la faible sécrétion de cytokines pro-
inflammatoires et de chimiokines par les cellules immunitaires résidentes comme les
macrophages [82]. Dans un modèle de souris neutropéniques (déplétés en neutrophiles, soit
par injection d’un anticorps (anti RB-6) soit un modèle KO, Genista) [82, 112], on constate
une plus forte activation des LT CD4+ et CD8+, signe d’activation de la réponse immunitaire
adaptative. De plus, un fort recrutement de monocytes dans le sang, ainsi qu’une diminution
de la réplication dans la rate ont été observés à des temps d’infection longs, correspondant à la
phase chronique de la maladie. La sécrétion de cytokines de type Th1 est aussi plus
importante en absence de neutrophiles. À des temps plus précoces (5 j après infection), la
présence de neutrophiles est critique pour éliminer la bactérie. Mais à des temps plus tardifs
(15 j) c’est la situation inverse, la présence de neutrophiles induit une réplication de Brucella
plus élevée et une réponse immunitaire plus faible [113]. Tout cela nous indique que la
présence de neutrophiles a un rôle double dans la réponse à l’infection, en phase aigüe elle est
bénéfique pour la réponse immunitaire, et en phase chronique elle est délétère pour l’hôte.
Cependant ces résultats sont différents chez l’homme, une étude a montré que les neutrophiles
infectés étaient activés. En effet, ils vont sur-exprimer des molécules d’activation comme
CD25, ou diminuer l’expression de CD62L (les cellules sont naïves quand elles l’expriment
fortement). L’infection par Brucella va aussi conduire à la sécrétion d’IL-8, une chimiokine
requise pour l’attraction et le recrutement de leucocytes dans le tissu. Les auteurs de cette
étude ont établi que la lipoprotéine Omp19 était responsable de l’activation des neutrophiles.
L’infection par des Brucella inactivées à la chaleur ou la stimulation avec Omp19 conduit les
neutrophiles à monter une réponse de stress oxydatif (relarguage de ROS, NO), à leur
migration, ainsi qu’à prolonger leur survie [114].
Les macrophages sont parmi les cellules ciblées préférentiellement par la bactérie. Capable de
phagocyter et dégrader des pathogènes, ces cellules sécrètent aussi des chimiokines pour
attirer les neutrophiles sur le site d’infection. Les granulomes, caractéristiques d’inflammation
prolongée sont souvent constitués de macrophages. Dans ce cas, les infiltrats de neutrophiles
sont remplacés par ceux de macrophages et des LT. C’est le cas lors d’infection par
Mycobacterium ou par Brucella [115, 116].
30
Les macrophages font partie des cellules les plus étudiées, notamment au niveau du cycle de
vie intracellulaire de Brucella. La capacité des macrophages à éliminer des pathogènes réside
dans leur capacité de phagocytose qui conduit à la fusion de la vacuole (phagosome) avec les
lysosomes et la destruction du pathogène. Dans le cas de Brucella, environ 90% des bactéries
sont détruites par fusion de la BCV avec les lysosomes, mais les 10 % restants sont capables
de rejoindre le RE et d’y établir une niche réplicative [62].
Pendant l’infection in vivo, les macrophages de la pulpe rouge de la rate (F4/80+) et ceux de la
zone marginale (MOMA+) sont les premières cellules spléniques à être infectées [116].
La bactérie va inhiber l’apoptose des macrophages murins et humains infectés pour garder sa
niche réplicative intacte [117, 118].
Les macrophages et les DC ne sont pas ou peu activés par l’infection [119, 120]. Une étude a
démontré que la sécrétion d’IL-10 par les LT CD4+ in vivo conduisait à cette non-activation
des macrophages et à la persistance de Brucella [121].
Les cellules NK (Natural Killer) sont des cellules de l’immunité innée, capables de
dégranulation, de lyse cytotoxique et de sécréter des cytokines pro-inflammatoires dont l’IFN-
γ. Ces cellules jouent un rôle critique dans beaucoup d’infections virales et bactériennes
[122].
Dans le modèle murin, les NK ne semblent pas avoir de rôle dans la réponse immunitaire
contre Brucella [123], alors qu’il était établi que les NK étaient affectés par l’infection et que
leurs fonctions (mais pas leur nombre) étaient altérées chez l’homme [124]. Différentes études
se sont donc penchées sur le rôle de ces cellules et leur pertinence dans l’infection. Ainsi, la
réplication de B. suis au sein de macrophages est diminuée en présence de NK [125]. Cette
diminution ne serait pas due à une sécrétion augmentée de cytokines comme l’IFN-γ mais à
un effet cytotoxique contact dépendent de la part des NK [125].
Une autre étude, menée avec des souris immunisées avec brucelles tuées à la chaleur suggère
que les NK sont importantes pour l’induction d’une réponse anticorps par les LB [126].
Brucella va donc essayer de limiter sa reconnaissance par les cellules immunitaires via une
modification de ses molécules membranaires. Elle résiste aux mécanismes classiques de
défense innée comme le complément et les peptides bactéricides. La bactérie va également
limiter l’activation, et donc la réponse, des premières cellules immunitaires présentes ou
recrutées au site d’infection comme les macrophages et neutrophiles.
Figure 12 : Différentes étapes de maturation des DC.Les DC naïves s’activent suite à la phagocytose d’un antigène. Elles apprêtent l’antigène pour présenter un peptide antigénique via les molécules de CMH-II aux LT. Elles augmentent leur expression de molécules de co-stimulation : CD40, CD80 et CD86. Ces molécules sont requises pour déclencher un signal d’activation aux LT. A la suite de leur activation, les DC migrent dans les organes lymphoïdes secondaires (rate, ganglions notamment) pour présenter l’antigène. Elles sécrètent différentes cytokines
qui polariseront la réponse immunitaire induite.Adapté de [129] .
31
I. D. 3. Brucella et les DC
Les DC sont les autres cellules immunitaires innées que Brucella va cibler et tenter de
contrôler. Ces cellules sont capables de s’activer après la détection d’un pathogène. Elles
expriment, en plus du marqueur CD11c, des molécules dites de co-stimulation qui vont
faciliter l’activation des LT. Ces molécules sont, chez la souris, CD80, CD86 et CD40, qui se
lient à CD28 et CD40L sur les LT. De même, le CMH-II est fortement surexprimé dans les
DC activées, pour aider à la présentation antigénique aux LT [127-129]. Les DC vont
dégrader les antigènes en peptides antigéniques qui seront ensuite présentés aux LT via le
CMH. Les DC sécrètent aussi des cytokines pro-inflammatoires comme TNF-α, IL-6, IL-12
[127-129]. Par la suite et après activation, elles migreront dans les organes lymphoïdes
secondaires comme la rate et les ganglions pour y trouver les cellules effectrices (Fig. 12).
Dans les DC humaines, B. suis est capable de se répliquer et va causer une inflammation
limitée. En effet, les molécules de co-stimulation et récepteurs aux chimiokines, CD40, CD83,
CD86, CCR7 et les molécules du CMH-II (HLA chez l’homme) sont plus exprimées dans des
DC infectées, mais restent néanmoins à un niveau d’expression intermédiaire comparé à une
infection par E. coli [44, 47]. Les DC humaines infectées par Brucella montrent une activation
limitée des LT comparées aux DC infectées avec E. coli [47]. Une autre étude renforce l’idée
de DC humaines peu activées. En effet, les auteurs constatent que B. abortus (tout comme
Coxiella) induit peu la voie des interférons de type I dans les DC humaines, et limiterait
l’activation de ces cellules [84].
Chez la souris, l’infection par Brucella induit, in vivo, l’activation et la migration des DC
spléniques (infectées ou non) dans la pulpe blanche de la rate, où les LT résident [116]. Des
DC inflammatoires participent aussi à la formation de granulomes, et serviraient de réservoir
pour la bactérie en phase chronique [116]. Dans un modèle d’infection nasal chez la souris,
les DC des poumons ne sont pas impactées en termes d’activation ou de localisation par
l’infection. En absence de macrophages, les DC inflammatoires des poumons migrent dans le
ganglion drainant les poumons et pourraient permettre la dissémination de la bactérie dans
l’organisme [130].
32
Une étude sur les DC bovines (dérivées à partir du sang avec du GM-CSF et de l’IL-4), a
montré que celles-ci éliminent rapidement Brucella et il n’y donc pas de réplication de la
bactérie. De plus, les DC ne semblent pas être activées par l’infection [131].
Dans le laboratoire, nous avons montré que BtpA (Brucella tir protein A, aussi appelé TcpB),
une protéine de Brucella contenant un domaine TIR est capable de réguler l’activation des DC
[23]. En effet, en interagissant avec les voies de signalisation en aval des TLR, BtpA est
capable de bloquer l’activation via TLR2 et TLR4. Il y a plusieurs hypothèses pour expliquer
l’effet de BtpA. BtpA interagirait avec TIRAP et/ou avec MyD88 [132-136]. L’action de
BtpA sur les DC contribue à limiter leur activation en termes de sécrétion de cytokines pro-
inflammatoires, de présence de DALIS (DC specific Aggresome Like Induced Structures)
dans les cellules [23].
Une autre étude, ainsi que des données non publiées du laboratoire montrent que lorsque
BtpA est exprimée ectopiquement, elle colocalise avec les microtubules et pourrait participer
à leur désorganisation [134].
L’interleukine-10 (IL-10) est une cytokine anti-inflammatoire sécrétée par un large panel de
cellules incluant les DC, monocytes, mastocytes et certaines populations de LT et LB. Cette
cytokine dite tolérogène va diminuer la réponse inflammatoire.
Dans la plupart des cas, la sécrétion d’IL-10 promeut la survie de l’hôte comme pour les
infections à Toxoplasma gondii [137], Trypanosoma cruzi [138], Plasmodium spp [139].
Cependant, dans le cadre des infections à mycobactéries, l’IL-10 semble avoir un rôle délétère
pour l’hôte et est associée à une susceptibilité accrue ainsi qu’à une réplication plus rapide des
bactéries [140]. D’autres pathogènes semblent aussi profiter du rôle anti-inflammatoire de
l’IL-10, comme Coxiella dont la virulence dépend d’une production importante d’IL-10 par
les cellules immunitaires [141].
Dans les infections à Brucella, il semblerait que la présence d’IL-10 favorise l’infection et la
survie de la bactérie. En effet, une absence d’IL-10 (souris KO IL-10) conduit à une
augmentation de la sécrétion de cytokines pro-inflammatoires et une élimination des bactéries
[85, 142].
Cependant, nous n’avons pas été en mesure de détecter la production d’IL-10 dans les BMDC
infectées par Brucella d’après les différentes études menées dans notre laboratoire
précédemment (données non publiées). Cela dit, il n’est pas à exclure qu’in vivo certaines
Figure 13 : Différentes populations de LT CD4+
et leurs réponses face aux infections.Lorsqu’un LT CD4
+ naïf reconnait un antigène présenté par une CPA via le CMH-II, celui-ci va se
différencier. Selon le cocktail de cytokines auquel il est soumis (via la CPA), il peut notamment devenir un Th1, Th2 ou Th17. En présence d’IL-12 et d’IFN, les LT deviendront des Th1, cytotoxiques, capables de sécréter de l’IFN-γ et du TNF- α. Les Th1 sont importants dans l’immunité contre les bactéries et parasites intracellulaires. Si le LT naïf est en présence d’IL-23 et d’IL-1, il se différenciera en Th17. Les Th17 sont pro-inflammatoires et jouent un rôle dans la résistance aux bactéries extracellulaires et champignons via la sécrétion d’IL-17, IL-22. Enfin, la présence d’IL-4 induira la différenciation des LT en Th2. Ces cellules sécrètent de l’IL-4 et de l’IL-5. Elles agissent dans
l’immunité parasitaire, et participent à la réponse humorale. Adapté de [143] .
33
populations de DC, ou de monocytes soient des sources d’IL-10 durant l’infection et
contribue à établir un contexte anti-inflammatoire propice à l’établissement d’une pathologie
chronique.
In vivo, l’infection par B. melitensis induit une production de TNF-α et d’iNOS dans les DC
inflammatoires (CD11b+ ; Ly6C+) de la cavité péritonéale et de la rate (pour l’iNOS
seulement) [92]. De plus, en utilisant des souris KO pour iNOS, on note que la réplication de
Brucella est augmentée comparée à des souris sauvages.
En utilisant des souris déficientes en MyD88, TLR4 et TLR9, les auteurs de cette étude ont pu
observer une diminution de la production d’IFN-γ et d’iNOS par les LT CD4+ et les DC
inflammatoires qui corrélait avec une croissance non contrôlée de la bactérie [92].
I. D. 4. L’immunité adaptative contre Brucella
La réponse immunitaire adaptative vise à développer une réponse spécifique contre un
antigène donné pour éliminer un pathogène, ainsi que développer des mécanismes de
mémoire immunologique.
Les LT CD4+ peuvent se différencier en différentes populations, parmi elles, Th1, Th2 ou
encore Th17 (Fig. 13). Les Th1 vont promouvoir une réponse de type cellulaire (même si ces
cellules participent aussi à la réponse humorale en promouvant la production d’anticorps), en
sécrétant des cytokines comme l’IFN-γ, le TNF-α mais aussi en activant les macrophages ou
en aidant au recrutement de cellules sur les sites d’infection [143]. Les Th2 vont quant à eux
promouvoir une immunité dite humorale. Ils sécrètent des cytokines comme l’IL-4, l’IL-10,
coopérant ainsi avec les LB ils régulent la production d’anticorps et notamment d’IgE et IgG1
par les LB [144]. Les Th17 ont un rôle inflammatoire via la sécrétion d’IL-17 et IL-22 dans la
réponse anti-microbienne [145]. Les LT CD8+ se différencient en CTL (LT cytotoxique) et
lysent les cellules infectées par l’induction de l’apoptose via les récepteurs Fas, mais aussi en
libérant des granules cytotoxiques contenant du Granzyme B et des perforines [146].
Les réponses immunitaires adaptatives à l’infection par Brucella ont été étudiées dans
différents modèles d’infection in vivo de souris [147].
34
Il a été montré que la réponse immunitaire de type Th1 est primordiale pour lutter contre
l’infection. Elle va consister en une sécrétion de cytokines pro-inflammatoires comme l’IFN-γ
et l’IL-12, ainsi qu’une réponse cytotoxique pour détruire les cellules infectées évitant ainsi la
réplication des bactéries. Différentes études ont montré le rôle critique de l’IFN-γ dans la
survie et l’élimination des bactéries [148-151].
Les gènes régulant la production d’IFN-γ comme irf-1 (interferon regulatory factor 1), irf-8
(aussi appelé ICSBP) ou l’IL-12 ont aussi été montré comme important dans l’induction d’une
réponse immunitaire efficace [150, 152] .
Ainsi, des souris déficientes pour l’IFN-γ ou IRF-1 sont des modèles létaux de brucellose. Ils
permettent d’étudier la virulence des souches bactériennes utilisées.
L’IFN-γ est une cytokine importante qui régule la production de d’iNOS et la synthèse de
réactifs oxygénés. Les souris IFN-γ KO présentent un manque de production d’iNOS et donc
de réactifs oxygénés pendant l’infection [92]. Cela peut conduire à une réponse immunitaire
précoce incomplète et permettre l’établissement d’une infection persistance plus facilement.
L’IFN-γ va aussi permettre l’activation des macrophages et de leur capacité à activer leur
machinerie bactéricide pour éliminer les pathogènes.
Une étude récente a démontré qu’en utilisant différents modèles de souris KO, les réponses
des LT CD8+, les Th17, Th2 et les LB ne sont pas requises pour le contrôle de l’infection par
Brucella contrairement aux LT CD4+ Th1 qui sécrètent de l’IFN-γ [92, 153]. Cependant, les
LT CD8+ ainsi que les LB sont plus importants dans la réponse immunitaire à l’infection par
Brucella en présence de Th1 que les Th2 et Th17 [153].
Il est important de préciser que la production d’IFN-γ par les LT CD4+ au cours de l’infection
est dépendante de la reconnaissance spécifique d’un antigène présenté par des molécules du
CMH-II.
Les LT γδ, n’ont pas besoin de la présentation antigénique pour s’activer et sont capables de
sécréter rapidement de fortes quantités d’IFN-γ. Ces cellules ont été montrées comme étant
importantes dans la réponse immunitaire à d’autres pathogènes intracellulaires comme
Listeria, Salmonella, Mycobacterium ou encore Francisella [154-157].
Il n’est pas exclu que cette population de LT particulière participe aussi à la sécrétion d’IFN-γ
requise pour la lutte contre Brucella.
35
Dans une étude récente, les auteurs ont remarqué que les LT γδ murins sont la première
source d’IL-17 durant l’infection et qu’ils participent aussi à la sécrétion d’IFN-γ [158]. Il
semblerait aussi qu’ils soient importants dans le contrôle de la réponse immunitaire précoce. 7
jours après infection, la réplication de Brucella est plus importante dans la rate des souris KO
pour le TCR γδ que dans celle des souris sauvages. En revanche, aucune différence n’est
détectée à 15 ou 30j après infection. [158]. Ce rôle protecteur des LT γδ est dépendant de la
sécrétion de TNF-α. Une partie de ces résultats a été confirmée dans des bovins, chez lesquels
les LT γδ sont une population de LT très importante et présente, contrairement au modèle
murin. Les LT γδ des bovins seraient capables d’empêcher la réplication intracellulaire au
sein des macrophages infectés, via notamment leur sécrétion d’IFN-γ [158].
Des résultats similaires d’activation de LT γδ humains par un peptide de B. suis ont été
obtenus. Dans ce modèle, les LT γδ activés permettaient aussi un contrôle de la réplication de
Brucella au sein de macrophages [159].
Pour finir, il est important de mentionner les lymphocytes B. Différentes études soulignent le
rôle de ces cellules dans la sécrétion d’anticorps et la réponse immunitaire au cours de
l’infection.
Dans un modèle de souris déficientes pour les LB matures (souris µMT), on observe une
élimination de Brucella plus rapide que dans les souris sauvages infectées, et cette élimination
n’est pas due à une absence d’anticorps puisque des souris µMT injectées avec des anticorps
étaient toujours capables d’éliminer les bactéries [160]. Il semblerait que ce phénotype soit
associé à une augmentation de la sécrétion d’IFN-γ ainsi qu’une production réduite d’IL-10
dans ces souris [160].
De plus, les LB sont une niche réplicative pour Brucella, capable de se répliquer dans ces
cellules, même si cela conduit probablement à l’activation des LB qui sécrètent alors du TGF-
β [161]. Le TFG-β est connu pour son rôle anti-inflammatoire, cela pourrait faire partie d’un
mécanisme déployé par la bactérie pour limiter l’activation des cellules immunitaires.
Brucella est capable d’exprimer une protéine appelée PrpA (pour proline racemase protein A)
qui induit la prolifération des LB [162]. Cette protéine se lie aux macrophages via la
nonmuscular myosin IIA, NMM-IIA ce qui va conduire à leur activation (augmentation de
l’expression de CD86), et à la sécrétion d’un facteur soluble conduisant à la prolifération des
LB [163].
36
La production d’anticorps est la fonction principale des LB dans le cadre des infections à
Brucella. Le rôle des anticorps semble être double : des anticorps anti-LPS permettrait de
protéger contre une infection [164] et des modèles de souris KO pour les LB (et donc
déficients en anticorps spécifiques contre la bactérie) seraient capables d’éliminer la bactérie
plus rapidement, suggérant un rôle moindre des anticorps dans la réponse immunitaire à
Brucella [160].
Dans le sérum des souris infectées, les deux isotypes d’anticorps les plus abondants sont les
IgG2a et les IgG3, qui sont souvent associées avec une réponse Th1 [165]. Dans les cas de
brucellose bovine, les anticorps ne semblent pas protecteurs et aideraient même à la
dissémination de la bactérie en empêchant la lyse des bactéries extracellulaires par le
complément [166].
En cas de réinfection, la réponse immunitaire est de type humorale et cellulaire (via les LT
CD4+ Th1). Ces deux types de réponses sont requises pour conférer une protection à l’hôte
[167].
Il ressort de toutes ces études que Brucella est une bactérie capable d’échapper au système
immunitaire en modulant la structure de ses molécules, mais aussi en produisant des protéines
qui interfèrent directement avec des récepteurs, molécules eucaryotes pour bloquer la réponse
immunitaire. On s’aperçoit que l’inflammation déclenchée par l’infection est relativement
faible puisque l’on observe peu de splénomégalie, de sécrétion de cytokines dans le sérum (et
donc de réponse systémique), de recrutement de cellules immunitaires. Brucella va induire la
sécrétion de facteurs anti-inflammatoires comme l’IL-10 et le TGF-β pour limiter
l’inflammation. La réponse immunitaire induite, qu’elle soit innée ou adaptative est tardive, et
donc peu efficace pour éliminer la bactérie qui se réplique déjà dans sa niche intracellulaire et
est capable de se disséminer.
Figure 14 : Récepteurs murins de la famille SLAMF.Les récepteurs de la famille SLAMF sont composés de domaines immunoglobulines IgV like en N-terminal (V). Ils possèdent tous un domaine C2 contenant un pont di-sulfure. Les différentes protéines SLAM contiennent dans leur partie cytoplasmique des tyrosines phosphorylables, appartenant à un ITSM (Immunoreceptor tyrosine-based switch motifs). C’est sur ces sites que SAP (SLAM-associated protein) et EAT-2 (EWS-Fli1-activated transcript-2) vont se lier. Ces molécules permettent de déclencher des cascades de
signalisation en aval des SLAM et induire la transcription de gènes cibles.Adapté de [170] .
37
I. E. CD150, UN RECEPTEUR A LA SURFACE DES CELLULES
IMMUNITAIRES
CD150 (aussi appelé SLAM (signaling lymphocyte activation molecule) ou Slamf1) est une
molécule exprimée à la surface des cellules immunitaires (DC, monocytes, LT, LB, cellules
souches hématopoïétiques (HSC), etc…). Décrite au milieu des années 90, CD150 permet
l’induction des réponses immunitaires, notamment dans les LT, LB et DC. Plus récemment,
certaines études soulignent son rôle dans l’inhibition de réponses immunitaires [168, 169].
Cette molécule appartient à une large famille de récepteurs membranaires aussi appelé SLAM
Family comprenant 9 membres (Slamf1 à Slamf9) tous jouant un rôle plus ou moins
important dans la réponse immunitaire (Fig. 14) [170]. Ces récepteurs appartiennent à la super
famille CD2 des molécules contenant domaines immunoglobulines.
I. E. 1. CD150, une molécule homophylique de co-stimulation
CD150 a tout d’abord été décrit comme un récepteur important dans l’activation des LT et LB
[171]. Son expression augmente à la surface des cellules activées (des LT dans cette étude), et
la liaison homophylique de CD150 conduit à une sécrétion de cytokines par les LT CD4+
d’IFN-γ notamment. Ces cellules vont aussi proliférer même en absence de co-stimulation via
CD28 et de manière indépendante de l’IL-2 [171, 172].
Ce récepteur est capable de former des homodimères entre deux cellules immunitaires comme
les LT, ou encore entre un LT et une DC [173, 174].
La production d’IFN-γ via les Th1 dépend de l’activation de CD150. En effet, l’ajout
d’anticorps anti-CD150 activateurs induit la production par les LT CD4+ Th1 du récepteur β2
à l’IL-12, qui est nécessaire à l’activation complète des LT, et donc à la production d’IFN-γ
par les Th1 [175].
L’activation de CD150 via son association avec une autre molécule de CD150, induit le
recrutement de la protéine tyrosine phosphatase SHP-2 (SH2 domain-containing protein)
mais pas de SHP-1 sur un immunoreceptor tyrosine-based switch motif (ITSM) situé dans la
partie intracellulaire de la molécule [176]. Une autre molécule, SAP (SLAM-associated
protein, aussi appelé SH2D1A) a été identifiée comme étant capable de lier les tyrosines
présentes sur la partie cytoplasmique de CD150 (humain et murin) [176, 177]. SAP interagit
38
avec FynT, une kinase, et bloque la liaison de SHP-2 à CD150 en s’associant avec les mêmes
motifs ITSM que SHP-2, ce qui conduit à une situation de compétition entre les deux
molécules [176-180]. SAP serait requis à la sécrétion de cytokines de type Th2 par les LT
CD4+ et à l’activation de la réponse humorale [181, 182]. En revanche, SAP inhibe la réponse
cytotoxique des CD8+, peut-être pour éviter des situations d’auto-immunité [179, 183].
L’association de CD150 sur les LT CD4+ conduit à la phosphorylation de Akt mais pas à celle
des MAPK ERK1/2 [175]. La phosphorylation d’Akt pourrait ainsi permettre aux LT
d’augmenter la production d’IL-2 et d’IFN-γ [175, 184].
L’arthrite rhumatoïde (RA) est caractérisée par une accumulation de LT, macrophages au
niveau des articulations enflammées et par la grande production de cytokines pro-
inflammatoires [185]. Une étude sur les LT de patients atteints de RA démontre une présence
accrue de LT CD150+ dans leurs fluides synoviaux [186]. De plus, une activation de CD150
via des anticorps monoclonaux (mAbs) conduit à une production plus élevée de cytokines
pro-inflammatoires, ici l’IFN-γ et le TNF-α mais aussi d’IL-10, suggérant une boucle de
rétro-contrôle négatif pour limiter l’inflammation.
Les auteurs concluent en suggérant que l’association CD150-CD150 des LT dans les zones
enflammées de ces patients conduit à l’activation de voies de signalisation inflammatoires
dans les articulations [186].
I. E. 2. Les propriétés immunomodulatrices de CD150
L’expression de CD150 ne se restreint pas uniquement aux LT, en effet les LB, DC, MO,
NKT, HSC et autres cellules immunitaires expriment aussi CD150 [171-173, 187, 188].
De ce fait, CD150 semble jouer un rôle dans différents aspects de la réponse immunitaire et
de l’activation des cellules.
La liaison de deux molécules de CD150 à la surface de LB va conduire à une hausse de la
sécrétion d’immunoglobulines et la prolifération des cellules [173]. En effet, on observe une
expression plus importante de CD150 après activation des LB. Cette expression accrue induit
une prolifération des LB après association homophylique de CD150 ainsi qu’une hausse de
39
sécrétion d’IgM quand les LB sont traités avec la partie soluble (extracellulaire) de CD150
[173].
CD150 a aussi été montré comme étant important dans la différenciation des cellules NKT.
En utilisant une souche de souris NOD déficiente en NKT, les auteurs ont identifié CD150
comme étant requis au bon développement de ces cellules. C’est via des interactions
homophyliques que CD150 participe à la différenciation des NKT. CD150 aiderait aussi au
maintien de la tolérance au sein du système immunitaire, ces souris étant promptes à
développer des maladies auto-immunes [189].
CD150 est aussi exprimé à la surface des DC et son expression augmente suite à l’activation
des DC via une stimulation à l’IL-1β, la liaison de CD40 à son ligand (CD40L), ou la
reconnaissance de divers signaux microbiens [187, 190].
En utilisant un anticorps monoclonal spécifique de CD150, Bleharski et coll. ont démontré
que des DC activées via CD40L et traitées avec cet anticorps étaient plus promptes à sécréter
de l’IL-12 et de l’IL-8, mais pas de l’IL-10 [187]. Cela suggère donc un effet pro-
inflammatoire de CD150.
Une autre étude a démontré que des interactions CD150/CD150 entre deux cellules (des DC
ici), ont en revanche un effet anti-inflammatoire en inhibant la sécrétion d’IL-12, IL-6 et
TNF-α dans des DC activées via CD40L [168].
Cela pourrait indiquer que selon la façon dont la signalisation en aval de CD150 est
déclenchée (un anticorps, des interactions entre deux molécules de CD150 sur des cellules, ou
un autre ligand propre à CD150), cela modifierait la réponse passant de pro-inflammatoire à
anti-inflammatoire selon le contexte.
Les macrophages expriment CD150. Dans un modèle de souris déficiente pour CD150
(CD150 KO), une stimulation (LPS et/ou IFN-γ) des macrophages aboutit à une sécrétion de
cytokines pro-inflammatoires (IL-12, IL-6, TNF-α) et du NO moins importantes
contrairement aux cellules provenant de souris contrôles [191]. CD150 ne semble pas
impliqué dans la phagocytose ou la réponse au CpG et au peptidoglycane [191].
Les auteurs de cette étude sont allés plus loin en étudiant les allergies pulmonaires pour
déterminer quelle pouvait être l’implication de CD150 dans ce phénomène. En utilisant des
souris KO pour CD150, ils ont établi un modèle d’allergie (avec de l’OVA) et des lavages
40
bronchoalvérolaires (BAL). Le BAL permet de récupérer toutes les cellules présentes dans les
bronches, et donc de témoigner d’un recrutement de cellules inflammatoires.
En mimant l’allergie par stimulation, le nombre d’éosinophiles récupérés par BAL est
diminué dans les souris CD150 KO comparé aux souris sauvages [192]. Des coupes de tissus
montrent clairement une inflammation moins importante dans les souris CD150 KO
stimulées. Les souris CD150 KO ne sont pas non plus capables de produire des cytokines de
type Th1 (TNF-α et IL12p70 ici) et Th2 (IL-10, IL-4 et IL-13) en réponse à un allergène à la
différence des souris sauvages.
Toutes ces données ont amené Wang et coll. à conclure que CD150 est nécessaire à la réponse
inflammatoire locale dans le cas des allergies pulmonaires, probablement à cause de ses
fonctions dans les réponses inflammatoires des macrophages, ou à cause de son impact sur
l’activation des LT et LB [191, 192].
I. E. 3. CD150 et les infections
Il a été caractérisé depuis le début des années 2000 que CD150 est le récepteur du virus de la
rougeole [193]. En effet, l’hémagglutinine du virus est capable d’interagir avec CD150 et
ainsi permettre l’entrée du virus dans les cellules infectées [193]. De nombreuses études se
sont donc intéressées à l’impact de la liaison du virus à CD150.
La liaison du virus à CD150 sur les DC va causer une immunosuppression et une incapacité
des DC à activer les LT [169]. Après infection par le virus de la rougeole de DC murines
exprimant le récepteur humain CD150, celles-ci ne sont plus capables de surexprimer des
molécules de co-stimulation comme CD86, CD80, CD40, le CMH-II, ni d’induire une
prolifération des LT. Ce mécanisme n’est pas dépendant de la présence de CD150 à la surface
des LT, suggérant que ce défaut vient directement des DC, et donc des voies de signalisation
pouvant être activées après liaison du virus à CD150 [169].
Une autre étude a démontré que la liaison de l’hémagglutinine du virus de la rougeole à
CD150 induit une inhibition de la sécrétion d’IL-12 après activation d’un signal TLR4 dans
les DC [194].
Dans le cas d’une infection à M. tuberculosis, il a été montré que CD150 semble promouvoir
la réponse immunitaire de type Th1 via la production d’IFN-γ [195]. L’augmentation de la
41
production d’IFN-γ est en fait dépendante de l’activation de CREB (un facteur de
transcription), elle-même dépendante de la liaison de l’hémagglutinine du virus à CD150
[196].
Dans un modèle d’infection par un parasite, Leishmania major, CD150 joue un rôle important
dans le contrôle de l’infection. Bien que des souris déficientes pour CD150 sur fond génétique
Balb/c ne sont pas plus susceptibles à l’infection que des souris contrôles, ce n’est pas le cas
pour des souris C57Bl/6 déficientes pour CD150. Les souris de type C57Bl/6 ont une réponse
immunitaire orientée Th1, au contraire des Balb/c, qui vont promouvoir une réponse Th2 via
la sécrétion d’IL-4 notamment [197].
Les souris CD150 KO sur fond C57Bl/6 sont en effet incapables d’éliminer L. major après
infection [191]. La déficience en CD150 induit une diminution de la production de NO, d’IL-
12 et de TNF-α. La diminution de l’expression de ces composés pro-inflammation participe à
la persistance de L. major dans les souris KO pour CD150. [191].
Plus récemment, une étude a étudié l’impact d’une déficience en CD150 au cours de
l’infection par le parasite Trypanosoma cruzi. En utilisant des souris KO pour CD150 (sur
fond Balb/c), les auteurs ont démontré que ces souris étaient capables de survivre à une phase
aigüe d’infection au cours de laquelle les souris sauvages succombent [198].
La meilleure survie des souris KO pour CD150 s’explique par une plus faible sécrétion
d’IFN-γ dans leur cœur. De plus, des macrophages infectés par T. cruzi provenant des souris
KO pour CD150 expriment plus faiblement les ARNm de Ptgs2, Nos2, et de l’arginase 1
[198]. Les DC provenant de ces mêmes souris produisent aussi moins d’IL-12 et d’IFN-γ
après infection que des DC provenant de souris sauvages. Il est intéressant de noter que dans
les macrophages et DC provenant des souris CD150 KO, le parasite se réplique moins
rapidement que dans des cellules provenant de souris sauvages [198].
CD150 est donc capable dans le cas d’infection virale, parasitaire, ou bactérienne de
promouvoir, ou au contraire inhiber la réponse immunitaire. Dans la plupart des cas, cela
concerne la réponse de type Th1 dépendante de l’IL-12 et de l’IFN-γ.
42
I. E. 4. CD150, un récepteur bactérien ?
Une dernière étude faite dans des macrophages provenant de souris CD150 KO (sur fond
C57BL/6) tend à prouver le rôle de CD150 dans les réponses aux infections. En utilisant des
macrophages déficients pour CD150 KO, après infection par E. coli, ceux-ci présentent un
défaut d’induction de NOX2 (NADPH Oxydase 2, nécessaire à la production de ROS) [199].
CD150 serait capable d’interagir avec le complexe Vps34–Vps15–beclin-1, ce qui lui
permettrait de contrôler la production de phosphatidylinositol-3-phosphate (PtdIns(3)P) dans
la membrane du phagosome. Le PtdIns(3)P régule l’activité de NOX2 dans le phagosome.
CD150 pourrait ainsi permettre le bon fonctionnement du phagolysosome via la production de
PtdIns(3)P et donc de ROS [199].
Le rôle de CD150 dans la maturation du phagosome est bien démontré dans des macrophages
déficients pour CD150, en effet ceux-ci ne sont plus capables de devenir matures et donc
d’éliminer E. coli. De façon intéressante, en infectant les macrophages par Staphylococcus
aureus, les auteurs n’ont vu aucun impact sur la sécrétion de NO des macrophages déficients
en CD150, ou sur la maturation du phagolysosome. Ces résultats suggèrent que le rôle de
CD150 pourrait être restreint à certains types de bactéries à gram négatif.
CD150 est aussi capable de reconnaître et lier deux protéines d’E. coli, OmpC et OmpF, ainsi
qu’une protéine (non identifiée pour le moment) de Salmonella. La liaison de OmpC et OmpF
à CD150 induit une augmentation de l’expression CD150 à la membrane des cellules [199,
200]. Cette fonction est étendue à toute la famille des récepteurs SLAM. En effet, d’après
certaines de leurs données non publiées SLAMF6 (ou Ly108) serait aussi capable de
reconnaitre E. coli (mais toujours aucune réponse à S. aureus). De plus SLAMF2, un autre
membre de cette famille, est un des récepteurs à FimH, une lectine présente sur le pili
d’entérobactérie. La conclusion est que les récepteurs SLAMF seraient une nouvelle famille
de récepteurs microbiens.
43
II. Résultats
44
II. A. RESUME DES ACTIVITES
Pendant mon master 2 effectué au sein du laboratoire de Jean-Pierre Gorvel, j’ai étudié les
interactions entre Brucella et les DC. En poursuivant en thèse, j’avais souhaité continuer à
m’intéresser à l’interaction entre des cellules hôtes et acteurs majeurs du système immunitaire
et une bactérie, Brucella.
J’ai travaillé sur trois projets différents pendant ma thèse :
Le premier d’entre eux commence avec un crible génétique qui nous a permis d’identifier
CD150 comme étant surexprimé dans des DC stimulées avec du CβG. En parcourant la
littérature, on s’est aperçu que CD150 pouvait être un récepteur bactérien, et nous avons donc
décidé d’étudier son rôle dans l’infection à Brucella.
Par la suite, j’ai travaillé sur le CβG, cette molécule capable d’activer les DC, de moduler le
contenu en cholestérol des membranes et permettre un trafic correct de la BCV dans les
cellules.
Le dernier projet est en continuation avec mon projet de master 2 pour lequel j’avais
commencé à travailler sur BtpB. Pendant ma thèse, j’ai pu finir des expériences sur ce projet
et démontrer que cette protéine participe au contrôle de l’activation des DC durant l’infection.
Le point commun et l’intérêt pour moi de ces projets est le lien entre les DC et comment la
bactérie, via ses facteurs de virulence (CβG), ou ses protéines (Omp25, BtpB) va moduler le
système immunitaire pour favoriser l’établissement d’une pathologie chronique et la survie de
Brucella.
45
II. B. OMP25 SE LIE A CD150 POUR CONTROLER L’ACTIVATION
DES DC DURANT L’INFECTION PAR BRUCELLA
II. B. 1. Introduction
Grâce à des études de transcriptomique faites sur des DC humaines stimulées avec du CβG,
nous avons identifié des gènes étant très exprimés, parmi lesquels, CD150.
La littérature nous a appris que ce gène avait un rôle dans la co-stimulation des LT, dans la
signalisation au sein de ces cellules et d’autres cellules du système immunitaire conduisant à
l’activation ou inhibition de leurs fonctions immunitaires [168, 171, 187, 191].
Par ailleurs, l’étude de Berger et coll. a démontré que CD150 était un récepteur pour des
protéines membranaires d’E. coli, potentiellement de Salmonella, mais pas des bactéries à
gram positif [199].
Différentes études menées sur des infections dans des modèles de souris déficientes pour
CD150 KO ont montré l’importance que ce récepteur peut avoir dans les réponses
immunitaires [191, 196, 199, 200].
Nous avons donc décidé d’étudier le rôle de CD150 dans l’infection à Brucella, et essayer
d’identifier une ou plusieurs protéines bactérienne qu’il serait capable de reconnaître.
46
II. B. 2. Résultats – Article en préparation
CD150 interacts with Brucella Omp25 and controls Brucella infection in vivo.
Clara Degos1,2,3, Alexia Papadopoulos1,2,3, Ignacio Moriyón4, Yusuke Yanagi5, Stéphane
Méresse1,2,3 and Jean-Pierre Gorvel1,2,3*
1: Aix-Marseille Université UM 2, Centre d'Immunologie de Marseille-Luminy, Marseille,
France
2: INSERM U 1104, Marseille, France
3: CNRS UMR 7280, Marseille, France
4: Departamento de Microbiología e Instituto de Salud Tropical, Universidad de Navarra,
31008 Pamplona, Spain
5: Department of Virology, Faculty of Medicine, Kyushu University, Fukuoka 812-8582,
Japan
Running title: CD150 controls Brucella infection
*Corresponding author: gorvel@ciml.univ-mrs.fr
Keywords: Brucella, Omp25, CD150, inflammation, dendritic cells, NF-κB
Abbreviations: dendritic cells (DC), endoplasmic reticulum (ER), interferon (IFN),
interleukine (IL), outer membrane protein (Omp), Escherichia coli (E. coli), Brucella abortus
(B. abortus), membrane extracts (OM), ovalbumin (OVA), post-infection (p.i),
intraperitoneal (IP), competitive index (CI), outer membrane fragments (OMF), SLAM-
adaptor protein (SAP), ITSM (Immunoreceptor tyrosine-based switch motif).
47
Abstract: Brucella is an intracellular pathogenic bacterium responsible for brucellosis. One
of the main strategies for establishing a chronic disease is based on the control of immune
response. CD150 is a receptor for Escherichia coli outer membrane proteins and is known to
regulate T cell, B cell, macrophage and dendritic cell (DC) activation. We identified CD150
in a transcriptomic assay of human DC treated with Brucella antigens and we studied the role
of CD150 in Brucella infection. Using a mouse model, we discovered that CD150 is required
to limit NF-κB translocation in infected DC. This membrane receptor is also involved in
controlling bacterial replication in vivo in mice. Finally, we demonstrate that CD150 is a
receptor for Omp25, a major Brucella outer membrane protein and we suggest that it
constitutes a new receptor for Brucella involved in the inhibition of immune response.
Introduction
Brucella is an intracellular bacterium responsible for brucellosis, one of the most common
zoonosis. In human it causes a debilitating febrile illness and in mammals it is responsible for
abortion and sterility leading to economic losses [3, 4, 11].
One of the main aspects of Brucella pathogenesis is its ability to evade the immune system
detection [10, 82]. DC have been widely studied in brucellosis and proven to be important for
the induction of immune responses and also for providing a safe replication niche for the
bacterium [23, 92, 96]. DC play a central role in the induction of both innate and adaptive
immune responses by activating T cells during the course of infection [23, 92, 96]. Brucella
controls DC maturation and TLR signaling by the action of at least two Brucella proteins
BtpA and BtpB, to counteract the immune response [23, 201]. In vitro, infection with
Brucella leads to a mild activation of DC regarding co-stimulatory molecules expression and
101
102
103
104
105
101
102
103
104
105
101
102
103
104
105
101
102
103
104
105
4 .7 3 % 1 8 .5 % 6 .5 3 % 1 7 .4 %
C D 2 5
0
1 0
2 0
3 0
%
of
CD
25
+ T
ce
lls
P B S
E .c o li L P S
B . a b o r tu s w t O M
B . a b o r tu s o m p 2 5 O M
*
*B
A
PBS LPS E. coli B. abortus wt OM
B. abortus
∆omp25 OM
Figure 16: CD25 expression in CD4+
T cells stimulated by differently activated BMDC. BMDC have been stimulated for 16 h with PBS (negative control – white bars), 100 ng/ml of E. coli LPS (activation control – light grey bars), 10 µg/ml of B. abortus wt OM (dark grey bars) or 10 µg/ml of B. abortus
∆omp25 OM (blanc bars). Cells were then incubated with OVA (50 µg/ml) for 4 h before co-culture with T cells at a ratio of 1 : 4 (DC : T) for 3 days. CD25 expression was analyzed by flow cytometry.
Results represent the percentage of CD25+ cells in graph (A) and in histogram (B ).
At least 20,000 CD3+ and CD4
+ (CD4
+ T cells markers) events were collected. This experiment has been repeated
4 times. p< 0,05: *.
0
1 0 0 0
2 0 0 0
3 0 0 0
CD
15
0 M
ed
ian
Flu
ore
sc
en
ce
* * ** * *
* *
CD
86
CD
40
MH
C II
0
1 0 0 0
2 0 0 0
3 0 0 0
Me
dia
n F
luo
re
sc
en
ce
P B S
E .c o li L P S
B . a b o r tu s w t O M
B . a b o r tu s o m p 2 5 O M
ns* * *
ns
ns ns
ns
ns
ns
*
A B
Figure 15: CD150 expression onto BMDC following stimulation with Brucella membrane extracts. A. BMDC have been stimulated for 16 h with PBS (negative control – white bars), 100 ng/ml of E. coli LPS (activation control – light grey bars), 10 µg/ml of B. abortus wt OM (dark grey bars) or 10 µg/ml of B. abortus
∆omp25 OM (blanc bars). CD150 expression was analyzed by flow cytometry and is represented here by its median fluorescence.
B. BMDC have been treated as described above and CD86, CD40 and MHC-II expression were analyzed. Their
expression is represented by the median fluorescence. At least 100,000 CD11c+ (DC marker) have been analyzed.
This experiment has been repeated 4 times independently. p<0,005 are denoted *, p<0,01: ** and p<0,005: ***, non significant data were denoted « ns ».
48
cytokine secretion [23, 44, 47]. In vivo, DC seems to help Brucella dissemination in the
absence of macrophages [202]. DC are also required to control bacterial growth through the
secretion of interferon-γ (IFN-γ), interleukin-12 (IL-12) and and i-NOS [92, 96].
Outer membrane proteins (Omp) are also Brucella components capable of modulating
immune responses. Omp16 is recognized by DC and triggers an immune response by the
secretion of cytokines such as tumor necrosis factor alpha (TNF-α) and IL-12, and the over-
expression of co-stimulatory molecules such as CD80, CD86 and CD40 [43]. Another
example is Omp19, a lipoprotein, which was shown to dampen antigen presentation and
MHC-II expression in IFN-γ-activated human monocytes [42]. Omp25 (or Omp3a) also
seems to play a role in the immune response against the bacterium. Indeed, a Brucella mutant
for this protein (∆omp25) seemed to induce human DC and macrophage activation, IL-12 and
TNF-α secretion [47, 48] although it is not attenuated in human DC, epithelial cells (HeLa),
macrophages (Raw, THP-1) and neutrophils [44, 45].
In vivo, the role of Omp25 needs further work to demonstrate its implication in immune
responses [45, 49] even though this membrane protein has been considered as a potential
vaccine candidate due to its immunogenic properties [203-206].
Recently, we identified CD150 (or signaling lymphocyte activation molecule (SLAM)) in a
transcriptomic analysis as an upregulated gene in human DC stimulated with Brucella cyclic
glucan [22]. CD150 belongs to a family receptor called SLAMF [207]. This receptor is a self-
ligand that triggers T cell activation [171, 172]. CD150 has been involved in immune
response to various infections. While it has been shown that this receptor is a ligand for
measles virus, CD150 can also control DC and T cell immune responses during the course of
the infection [169, 193]. It has also been shown to play a role as activator or inhibitory of the
C F S E
2 7 .2 %
101
102
103
104
105
0 .4 %
101
102
103
104
105
2 7 .9 %
101
102
103
104
1 7 .2 %
101
102
103
104
105
105
0
1 0
2 0
3 0
%
of
pro
life
ra
tin
g T
ce
lls
P B S
E .c o li L P S
B . a b o rtu s w t O M
B . a b o rtu s o m p 2 5 O M
p = 0 .0 6
A
B
PBS LPS E. coli B. abortus wt
OM B. abortus
∆omp25 OM
Figure 17: Proliferation of CD4+
T cells stimulated by differently activated BMDC. BMDC have been stimulated for 16 h with PBS (negative control – white bars), 100 ng/ml of E. coli LPS (activation control – light grey bars), 10 µg/ml of B. abortus wt OM (dark grey bars) or 10 µg/ml of B. abortus
∆omp25 OM (blanc bars). Cells were then incubated with OVA (50 µg/ml) for 4 h. T cells were stained with CFSE and then co-cultured with BMDC at a ratio of 1 : 4 (DC : T) for 3 days. CFSE fluorescence was
analyzed by flow cytometry. Each cell cycle division will lead to a decrease of CFSE fluorescence.
Results represent the percentage of CD4+ T cells proliferating in graph (A) and in histogram (B ).
At least 20,000 CD3+ and CD4
+ (CD4
+ T cells markers) events were collected. This experiment has been
repeated 4 times. p< 0,05: *.
49
immune system, in other infectious models [195, 197, 198]. Recent studies showed that
CD150 was involved in controlling the maturation of phagosome during Escherichia coli (E.
coli) infection [208] and that its expression was upregulated following the binding of two E.
coli Omp: OmpC and OmpF [200, 208].
Here, we demonstrate that CD150 expression was increased by interaction with the Brucella
Omp25 membrane protein and this led to an inhibition of T cell activation by BMDC. We
show a Brucella abortus omp25 mutant (∆omp25) strongly activates DC showing that this
outer membrane protein plays an important role in the control of immune responses. CD150
blockade by specific peptide or the use of CD150 KO leads to an increase of NF-κB
activation in wt Brucella-infected BMDC suggesting a role for this receptor in controlling the
immune response against Brucella infection. We also demonstrate that CD150 controls
Brucella replication in vivo. Finally we showed that Omp25 binds CD150 using a pull-down
assay.
Results
Brucella outer membrane extracts induce CD150 expression in BMDC through Omp25.
CD150 expression in macrophages was shown to increase by the binding of OmpC and OmpF
from E. coli [200]. We therefore investigated the impact of Brucella Omp onto CD150
expression. We used BMDC as a model since CD150 is expressed at the surface of activated
DC and these cells are known to play an important role in the Brucella immune response.
BMDC were incubated with Brucella wild type membrane extracts (B. abortus wt OM). 16 h
after exposure, CD150 expression was assessed by flow cytometry. We observed an
upregulation of CD150 expression following stimulation with B. abortus wt OM compared to
T im e p o s t-in fe c t io n
Lo
g
CF
U/m
l20h
40h
0
2
4
6B . a b o r tu s w t
B . a b o r tu s o m p 2 5
B . a b o r tu s v irB
60h
B
A
w t E R M erg e
o m p 2 5 E R M erg e
Figure 18: Brucella ∆omp25 replicates as the wt strain within the ER in BMDC. A. Replication of wt Brucella (square), ∆omp25 (triangle) and virB mutant (∆virB, circle) within BMDC
for 48 h. The mean of 5 independent experiments is represented here.B. Representatives pictures of confocal microscopy of Brucella intracellular trafficking at 24 h p.i. BMDC were stained with an anti-calnexin (ER, red), and anti-LPS (green). Scale: 10µm. This experiment
has been done 3 times independently.
50
non-stimulated cells (PBS) or cells stimulated with E. coli LPS (activation control) (Fig. 15A)
[209].
Interestingly, membrane extracts (OM) from a omp25 deletion mutant (B. abortus ∆omp25)
failed to induce CD150 expression, which was then expressed at basal level (Fig. 15A). The
decrease in CD150 expression between the OM from Brucella wt and ∆omp25 was related to
the absence of Omp25 rather than a BMDC activation defect (Fig. 15B).
Omp25 inhibits CD4+ T cell activation.
We then wonder whether the decrease in CD150 expression could impact the ability of DC to
stimulate T cell responses. We used CD4+ T cells from OTII mice. These mice carry CD4+ T
cells with a specific TCR for ovalbumine (OVA). In the presence of activated DC carrying
MHC-II presenting antigen (here OVA), these T cells produce IL-2 receptor (CD25) and
proliferate.
BMDC were stimulated with PBS (negative control), E. coli LPS, B. abortus wt OM or B.
abortus ∆omp25 OM. We show that in the presence of OVA non-stimulated BMDC (white
bar) and BMDC stimulated with B. abortus wt OM were poor inducers of CD25 expression in
CD4+ T cells. In contrast, LPS-stimulated or ∆omp25 OM-stimulated DC allowed 3 times
more expression of CD25 by T cells than B. abortus wt OM (Fig. 16). T cell proliferation was
stimulated by LPS-stimulated BMDC (27,9 % of proliferating T cells), B. abortus wt OM
(17,2 % of proliferating T cells) and B. abortus ∆omp25 OM (27,2 % of proliferating T cells).
CD4+ T cells co-cultivated with PBS-stimulated BMDC were not able to proliferate (Fig. 17).
Omp25 inhibited the up-regulation of CD25 expression in BMDC-stimulated CD4+ T cells
(about 3 times less expression) and in a lesser extent their proliferation (1.5 less proliferation)
(Fig. 17).
Ra
tio
Me
dia
n
Flu
ore
sc
en
ce
CD
40
CD
80
CD
86
MH
C II
CD
150
0 .0
0 .5
1 .0
1 .5
2 .0
2 .5
B . a b o rtu s w t/w t
B .a b o rtu s o m p 2 5 /w t
*
*
* *
* * *
Ra
tio
Me
dia
n
Flu
ore
sc
en
ce
CD
40
CD
80
CD
86
MH
C II
CD
150
0 .0
0 .5
1 .0
1 .5 *
**
A B
Figure 19: Co-stimulatory molecules and MHC-II expression onto BMDC after Brucella infection.
BMDC were infected with wt Brucella (white bars) or ∆omp25 (grey bars) for 8 h (A) or 24 h (B) with a MOI of 30.
Cells were harvested and stained for flow cytometry analysis. Ratio of median fluorescence were
shown here for the different molecules as indicated on the x axis. At least 100,000 CD11c+ events were
collected. This experiment has been done 3 times independently. p< 0,05: *, p< 0,01: **, p< 0,005: ***.
51
Brucella ∆omp25 replicates within the ER of BMDC.
We first analyzed ∆omp25 replication within BMDC in comparison with the wt strain (Fig.
18A). We observed that the mutant replicated as much as the wt strain while a virB mutant
was not able to persist for more than 48 h (Fig. 18A).
∆omp25 replicated within the ER as shown at 24 h post-infection (p.i) and as previously
described for the wt strain [23] (Fig. 18B). The mutant also followed the same intracellular
trafficking as the wt strain in BMDC at early time point after infection (data not shown).
Therefore, no difference in the intracellular trafficking was observed between the wt Brucella
strain and the ∆omp25 mutant.
Omp25 controls BMDC activation upon infection.
It has previously been published that Brucella infection in BMDC leads to an intermediate
level of activation compared to other bacterial pathogen infections [23].
Therefore, we checked ∆omp25-infected BMDC phenotype at both 8 h and 24 h p.i. Co-
stimulatory molecule expression (CD80, CD86, CD40 and CD150) and MHC-II expression
were analyzed by flow cytometry (Fig. 19).
At 8 h p.i, ∆omp25-infected BMDC exhibited a higher expression of CD80, CD40 and CD86
compared to wt-infected BMDC (Fig. 19A). This difference increased at 24 h p.i with almost
twice more expression of co-stimulatory molecules and CD150. However, MHC-II expression
was not statistically different between ∆omp25-infected BMDC and wt-infected BMDC (Fig.
19B).
Another aspect of BMDC activation is the ability of NF-κB to translocate within the nucleus
to engage pro-inflammatory gene transcription. At 2 h p.i., we observed twice more NF-κB
translocation in the nucleus of ∆omp25 infected BMDC than that of Brucella wt infected
0
1 0
2 0
3 0
4 0
5 0
6 0
7 0
% o
f B
MD
C w
ith
NF
-B
tra
ns
loc
ati
on
in
th
e n
uc
leu
s
U n in fe c te d
B . a b o r tu s w t
B .a b o r tu s o m p 2 5
*
N F - B C D 1 1 c
o m p 2 5
A
T O P R O -3
w t
B
Figure 20: NF-κB translocation within infected BMDC .A. Representatives pictures from confocal microscopy of infected BMDC with wt Brucella (upper panel) or ∆omp25 (lower panel) for 2 h with MOI of 30. Cells were fixed and labeled with TOPRO-3 for the nucleus (yellow), anti-p65 (NF-κB, red), anti-LPS (green) and anti-CD11c for DC (cyan ). Scale: 10 µm.B. Quantification of NF-κB translocation in the nucleus of infected cells. BMDC were treated as described above. The percentage of cells containing NF-κB within the nucleus is indicated on the graph. Uninfected cells are represented in white while wt infected cells are in light grey and mutant infected cells in dark grey.
At least 50 cells in 4 independent experiments were counted each time. p< 0,05: *.
52
BMDC or the non-infected cells (Fig. 20). As previously shown, Brucella wt infection did not
induce a high level of translocation of NF-κB within the nucleus (Fig. 20B) [201].
Considering the different levels of NF-κB translocation using the two strains we investigated
the gene expression profile induced by either the wt strain or the mutant strain (Fig. 21). We
showed that BMDC infection with wt Brucella induced at both 6 h and at 24 h the over-
expression of IL-6, IL-12β, CCL-2, IL-1β, TNF-α, KC, NOS-2, PTGS-2, and IFN-β mRNA
(Fig. 21). Interestingly, ∆omp25 infection induced the over-expression of IL-6, IL-12β, CCL-
2, IL-1β, NOS-2, PTGS-2 mRNA but in a higher amount than the wt strain.
We then analyzed the cytokine and chemokine secretion induced by wt Brucella and ∆omp25
mutant at 8 h, 24 h, and 32 h p.i (Fig. 22). ∆omp25- BMDC produced more IL-12, IL-1β,
TNF-α, CCL-2, IL-6 and IFN-γ than non-infected cells or wt-infected cells as shown at 32 h
p.i (Fig. 22).
In conclusion, we show that Omp25 controls BMDC activation during infection by inhibiting
co-stimulatory molecules expression, NF-κB translocation in the nucleus, pro-inflammatory
mRNA expression and pro-inflammatory cytokine secretion.
CD150 blockade does not affect replication, intracellular trafficking of Brucella within
BMDC and DC co-stimulatory molecule expression.
To characterize the role of CD150 in Brucella infection we used control and blocking
peptides prior to BMDC infection. CD150 blockade affected neither the ability of Brucella to
invade nor to replicate within BMDC (Fig. 23A) nor its ER intracellular localization (Fig.
23B). Bacteria (wt or ∆omp25) replicated with the same efficiency within the ER of infected
cells at 24 p.i (Fig. 23B).
6h
24h
0
1 0
2 0
3 0
4 0
5 0
IL 6
Fo
ld i
nc
re
as
e
6h
24h
0
2 5
5 0
7 5
1 0 0
1 2 5
IL 1 2
Fo
ld i
nc
re
as
e
6h
24h
0
2
4
6
8
T N F F
old
in
cre
as
e
6h
24h
0
2 5
5 0
7 5
1 0 0
1 2 5
1 5 0
1 7 5
2 0 0
N O S 2
Fo
ld i
nc
re
as
e
6h
24h
0
1 0
2 0
3 0
4 0
IL 1
Fo
ld i
nc
re
as
e
6h
24h
0
2 0
4 0
6 0
8 0
1 0 0
1 2 0
1 4 0
P tg s 2
Fo
ld i
nc
re
as
e
Figure 21: mRNA expression of different pro-inflammatory genes in infected BMDC. BMDC were infected (MOI: 30) with wt (black bars) or mutant for omp25 (grey bars) or with PBS as negative control for 6 h or 24 h. Cells were then harvested and RNA was extracted. mRNA expression of IL-6, IL-12β, CCL2, IL-1β, TNF-α, KC, NOS2, PTGS2, and IFN-β was assessed. Data were normalized onto housekeeping gene (HPRT) and fold increase was calculated with the uninfected cells. Basal expression level is indicated with a dashed line. An induction of 2 or more is considered as significant. Mean ± standard
deviation of 3 independent experiment is represented here.
6h
24h
0
1 0
2 0
3 0
4 0
5 0
K C
Fo
ld i
nc
re
as
e
6h
24h
0
5
1 0
1 5
C C L 2
Fo
ld i
nc
re
as
e
6h
24h
0
5 0
1 0 0
1 5 0
2 0 0
2 5 0
IF N
Fo
ld i
nc
re
as
e
B . a b o rtu s w t
B . a b o rtu s o m p 2 5
53
We also assessed the expression of co-stimulatory molecules and MHC-II by infected BMDC
stimulated with blocking or control peptides. No difference was observed between BMDC
stimulated with the control peptide or with the blocking peptide at 8 h and 24 h p.i (data not
shown).
CD150 blockade enhances NF-κB translocation in the nucleus of wt Brucella-infected
BMDC.
BMDC incubated with CD150 blocking peptide (Fig. 24A left panel – Fig. 24B hatched bars)
and infected with Brucella wt (Fig. 24A upper panel – Fig. 24B grey bars) were more prone to
induce NF-κB translocation than BMDC treated with control peptide (Fig. 24A right panel –
Fig. 24B full bars). Interestingly, the percentage of NF-κB translocation within the nucleus of
BMDC incubated with CD150 blocking peptide reached the level of BMDC infected with the
∆omp25 mutant (Fig. 24B). CD150 blockade did not affect NF-κB translocation within cells
infected with ∆omp25.
We also assessed the secretion of pro-inflammatory cytokines upon CD150 blockade.
Pro-inflammatory cytokine secretion was not impacted by the blockade of CD150 at 24 h or
48 h p.i in infected BMDC no matter what Brucella strain was used (Fig 25).
CD150 controls NF-κB translocation in the nucleus of Brucella wt-infected BMDC.
Using CD150 -/- mice (CD150 KO) we confirmed the results obtained above. Indeed, in
BMDC harvested from CD150 KO mice and infected by Brucella wt and ∆omp25, both
strains induced an efficient NF-κB translocation in the nucleus, which reached the same
percentage as the BMDC from normal mice infected with ∆omp25 showing that CD150
presence or absence did not affect NF-κB translocation in ∆omp25 infected DC (Fig. 26).
IL6
(p
g/m
l)
8h
24h
32h
0
5 0 0
1 0 0 0
1 5 0 0
2 0 0 0
*C
CL
-2 (
pg
/ml)
8h
24h
32h
0
5 0 0
1 0 0 0
1 5 0 0
2 0 0 0
2 5 0 0
3 0 0 0
U n in fe c te d
B . a b o r tu s w t
B .a b o rtu s o m p 2 5
* *
*
*
IFN
(p
g/m
l)
24h
32h
0
1 0
2 0
3 0
TN
F
(p
g/m
l)
8h
24h
32h
0
2 5 0
5 0 0
7 5 0
1 0 0 0*
Figure 22: Pro-inflammatory cytokine secretion upon BMDC infection. BMDC were infected at MOI of 30 with Brucella wt (light grey), ∆omp25 (dark grey) or PBS as negative control (white) for 8 h, 24 h or 32 h. Culture supernatants were harvested and cytokine secretion was assessed by cytometric bead assay (CBA, IL-6, TNF-α, CCL-2 et IFN-γ) or ELISA (IL-12 and IL-1β). Mean ±
standard deviation of 3 independent experiment is represented here. p< 0,05: *, p< 0,01: **, p<0,001: ***.
8h
24h
32h
0
2 0 0
4 0 0
6 0 0
IL1
2p
70
+p
40
(p
g/m
l)
***
**
**
8h
24h
32h
0
2 0 0
4 0 0
6 0 0
8 0 0
1 0 0 0
IL-1
(p
g/m
l)
***
54
Role of Omp25 during the infection process.
Considering the discrepancy in literature on Omp25 role in vivo [45, 49], we decided to study
the replication of this mutant strain in various mouse models such as C57BL/6 mice, known
the be brucellosis resistant and Balb/c mice, which are susceptible to the infection [147].
Mice were infected with 1.106 CFU intraperitoneally (IP). We measured bacteria growth in
the spleen and liver of infected animals and weight the organs at 5 days p.i (acute phase of
brucellosis) and at 60 days p.i corresponding to the chronic phase.
At 5 days p.i no statistically difference in the replication or organ weights were observed
between wt and ∆omp25 infected mice (Fig. 27). Bacterial growth and organ weights were
higher in Balb/c mice compared to C57BL/6 mice (Fig. 27), suggesting a less controlled
infection in Balb/c mice as previously published [92, 210].
We also performed a competitive index (CI) experiment to assess the virulence of Omp25
[211]. A CI below 1.0 means a slower and lesser growth of the mutant strain compared to the
wt. In both C57BL/6 and Balb/c mice, ∆omp25 strain was attenuated in the liver and
mesenteric lymph node after IP infection (Fig. 28). Interestingly, in resistant mice (C57BL/6),
∆omp25 was not attenuated in the spleen (Fig. 28).
We then assessed whether the ∆omp25 mutant would be attenuated in the chronic phase (at 60
days p.i.). Although we did not observe any difference in term of growth between wt and
∆omp25 strains (Fig. 29A), organs weight was increased in ∆omp25 infected Balb/c mice,
suggesting a high level of inflammation (Fig. 29B). No difference in replication between
C57BL/6 and Balb/c was observed, while organ weight was higher in Balb/c mice than
C57BL/6 (Fig. 29B).
0
2
4
6
8L
og
C
FU
/ml
B . a b o r tu s w t
B .a b o rtu s o m p 2 5
B . a b o r tu s w t
B .a b o rtu s o m p 2 5
2h 8h 2 4h 3 2h
B M D C tre a te d w ith
c o n tro l p e p tid e
B M D C tre a te d w ith
C D 1 5 0 b lo c k in g
p e p t id e
Figure 23: Brucella replication and intracellular localization in BMDC after CD150 blockade. A. BMDC were treated with 10 µg/ml of control peptide (full line) or the blocking peptide for CD150 (dashed line) for 3 h prior to infection with the wt strain (square) or ∆omp25 (triangle). CFU counts were
enumerated at 2 h, 8 h, 24 h and 32 h p.i. The mean of 2 independent experiments is represented. B. Representative pictures of confocal microscopy of infected BMDC with wt Brucella (upper panel) or ∆omp25 (lower panel) for 24 h and treated with a blocking peptide for CD150. Cells were stained for calnexin (ER, blue), Lamp-1 (lysosomes, red), Brucella (green). Scale: 10 µm. This experiment has been
repeated 3 times independently.
wt La p ER Merge
∆o p 5
A
B
55
We finally used IFN-γ KO mice as a lethal model to assess the virulence of the mutant. We
infected IP mice with 1.106 CFU and checked the survival of the mice. ∆omp25 infected mice
died faster than wt infected mice (25 days versus 31 days) (Fig. 30).
All these data suggest that omp25 induce a higher inflammation in vivo and could participate
in Brucella virulence, but not in its survival and replication.
CD150 controls Brucella replication in vivo.
To determine the role of CD150 in vivo infection, wt mice and CD150 KO mice were infected
and checked at 8 days p.i. In the spleen of CD150 KO mice infected with Brucella wt
bacterial replication was higher than in normal mice whereas no difference was observed in
the replication of Brucella within the liver. The spleen weight of CD150 KO mice Brucella wt
infected with Brucella wt strain was also higher than in control mice (Fig. 30B). No
difference in bacterial replication was detected when we infected C57BL/6 or CD150 KO
mice with the ∆omp25 mutant (Fig. 30A).
We also performed CI experiments using CD150 KO mice and observed that ∆omp25 strain
was not attenuated in the liver and in the spleen (Fig. 32). In contrast, the ratio was much
higher than 1.0 (respectively 3.5 and 2.5 for the spleen and liver), meaning that within the
organs the ∆omp25 mutant strain was more efficient to replicate inside CD150 KO mice
compared to the wt Brucella strain (Fig. 32).
Brucella Omp25 binds CD150.
In order to determine whether Omp25 was a ligand for CD150 we constructed a plasmid
coding for myc in N-terminal fused to the second and third exons of murine CD150 (which
represents the extracellular part of CD150). A plasmid containing a Salmonella protein (SifA)
fused to myc was used as a control. After transfection in COS-7, proteins were extracted and a
0
1 0
2 0
3 0
4 0
5 0
Ce
lls
wit
h N
F-
B
in
th
e n
uc
leu
s (
%) n s
*
*
n s
U n in fe c te d B . a b o r tu s
w t
B . a b o r tu s
o m p 2 5
T re a te d w ith
c o n tro l p e p tid e
T re a te d w ith
C D 1 5 0 b lo c k in g
p e p t id e
BMDC treated with o trol peptideBMDC treated with CD 5 lo ki g
peptide
TOPRO-3
wt
∆omp25
wt
∆omp25
NF-κB CD11c
A
B
Figure 24: NF-κB translocation within infected BMDC after CD150 blockade .A. Representatives pictures from confocal microscopy of infected BMDC with wt Brucella (upper panel) or ∆omp25 (lower panel) for 2 h with MOI of 30. Prior to infection cells were treated with 10 µg/ml of control peptide (left panel) or CD150 blocking peptide (right panel). Cells were fixed and labeled with TOPRO-3 for the nucleus (yellow), anti-p65 (NF-κB, red), anti-LPS (green) and anti-CD11c for DC (cyan ). Scale: 10 µm.B. Quantification of NF-κB translocation in the nucleus of infected cells. BMDC were treated as described above. The percentage of cells containing NF-κB within the nucleus is indicated on the graph. Uninfected cells are represented in white while wt infected cells are in light grey and mutant infected cells in dark grey. Cells treated with the control peptide are indicated in full bars. At least 50 cells in 4 independent experiments
are counted each time. p< 0,05: *.
56
pull-down was performed with an anti-myc antibody after incubation with Brucella wt OM or
Brucella ∆omp25.
We show that Omp25 could be specifically pulled-down by CD150 (Fig. 33). Therefore, we
concluded CD150 is a receptor able to interact with Brucella Omp25.
Discussion
Here we show for the first time the role of CD150 in Brucella infection and its association
with Omp25, a major outer membrane protein of the Brucella envelope.
A role of Omp25 regulating immune responses in monocyte-derived cells was previously
proposed [47, 48]. Here, we show that Omp25 inhibits co-stimulatory molecule expression in
Brucella-infected DC, NF-κB translocation within DC nucleus, pro-inflammatory gene
expression and cytokine and chemokine secretion in infected DC. Interestingly, Omp25 seems
to inhibit T cell activation induced by primed DC stimulated with Brucella membrane
extracts, supporting an anti-inflammatory role of Omp25 during the infection process. This is
in agreement with the fact that pro-inflammatory cytokines seem to be released in a higher
amount in ∆omp25-infected mice. Omp25 appears as a new antigen synthesized by Brucella
to control immune responses. Omp25 can be added to the list of already identified Brucella
proteins inhibiting DC immune response in addition to BtpA, BtpB, PrpA or wboA [23, 83,
106, 201].
For this reason we consider Omp25 as a virulence factor. Indeed, although we did not observe
any difference in term of bacterial replication in wt- or ∆omp25-infected mice, we show a
clear attenuation of the mutant strain in CI experiment using wild type mice, suggesting that
Omp25 plays a role in virulence in vivo in association with CD150. Indeed, co-infection with
both wt Brucella and ∆omp25 mutant in CD150 KO did not result in an attenuation of
Figure 25 : Pro-inflammatory cytokine secretion upon BMDC infection after CD150 blockade. BMDC were infected at MOI of 30 with Brucella wt (grey), ∆omp25 (black) or PBS as negative control (white) for 24 h (A) or 48 h (B). Prior to infection, cells were incubated with 10 µg/ml of control peptide (full bars) or CD150 blocking peptide (hatched bars). Culture supernatants were harvested and cytokine secretion
was assessed by cytometric bead assay (CBA, IL-6, TNF-α, CCL-2 et IFN-γ) or ELISA (IL-12). This experiment has been reproduced 4 times independently.
0
2 0 0 0
4 0 0 0
6 0 0 0
8 0 0 0
IL-6
(p
g/m
l)
U n in fe c te d B . a b o r tu s
w t
B . a b o r tu s
o m p 2 5
T re a te d w ith
c o n tro l p e p tid e
T re a te d w ith
C D 1 5 0 b lo c k in g
p e p t id e
0
2 0 0 0
4 0 0 0
6 0 0 0
8 0 0 0
1 0 0 0 0
IL-6
(p
g/m
l)
U n in fe c te d B . a b o r tu s
w t
B . a b o r tu s
o m p 2 5
T re a te d w ith
c o n tro l p e p tid e
T re a te d w ith
C D 1 5 0 b lo c k in g
p e p t id e
0
1 0 0 0
2 0 0 0
3 0 0 0
4 0 0 0
5 0 0 0
6 0 0 0
MC
P-1
(p
g/m
l)
U n in fe c te d B . a b o r tu s
w t
B . a b o r tu s
o m p 2 5
0
1 0 0 0
2 0 0 0
3 0 0 0
4 0 0 0
MC
P-1
(p
g/m
l)
U n in fe c te d B . a b o r tu s
w t
B . a b o r tu s
o m p 2 5
0
5 0 0
1 0 0 0
1 5 0 0
TN
F
(p
g/m
l)
U n in fe c te d B . a b o r tu s
w t
B . a b o r tu s
o m p 2 5
0
1 0 0 0
2 0 0 0
3 0 0 0
TN
F
(p
g/m
l)
U n in fe c te d B . a b o r tu s
w t
B . a b o r tu s
o m p 2 5
A
B
0
2 0 0
4 0 0
6 0 0
8 0 0
IL-1
2p
70
+p
40
(p
g/m
l)
U n in fe c te d B . a b o r tu s
w t
B . a b o r tu s
o m p 2 5
0
2 0 0
4 0 0
6 0 0
8 0 0
IL-1
2p
70
+p
40
(p
g/m
l)
U n in fe c te d B . a b o r tu s
w t
B . a b o r tu s
o m p 2 5
57
∆omp25 strain also suggesting a strong relationship between the bacterial and the host
protein. This hypothesis is confirmed by showing that Omp25 binds CD150 in a pull-down
assay.
CD150 acts as a co-stimulatory molecule between DC and T cells [171]. In the absence of
Omp25, Brucella outer membrane extracts were more potent in inducing T cell activation
through primed DC. A possible mechanism would be that the binding of Omp25 to CD150
would prevent CD150 to form dimers and to transduce danger signals to the host cell.
Therefore, Omp25 could be a tool expressed by the bacterium to control CD150 signaling and
consequently T cell activation.
Another question raised by this study is Omp25 accessibility to CD150. Omp25 is part of the
outer membrane of Brucella and so should not be free outside the bacterium. However,
release and shedding of outer membrane fragments (OMF) by Brucella are well described
[212, 213]. During the course of infection, OMF are likely to be released from infected cells
for CD150 encounter. Interestingly, Pollak et al. showed that OMF pre-treatment of human
macrophages (THP-1) inhibits pro-inflammatory cytokine secretion after TLR agonist
exposure or Brucella infection [50]. In addition, OMF are internalized by phagocytic and non-
phagocytic cells leading to a down-regulation of MHC-II expression in THP-1, thereby
impacting antigen presentation [50]. This mechanism could be used by the bacterium to both
limit the inflammation and antigen presentation, but also to deliver Brucella proteins
including Omps to surrounding cells.
In the context of Brucella infection, CD150 might play a dual role. While CD150 seems to
control in vivo bacterial replication, it also participates to the control and inhibition of
inflammation by DC through Omp25 binding. It has previously been reported that IFN-γ is
0
1 0
2 0
3 0
4 0
5 0
Ce
lls
wit
h N
F-
B
in
th
e n
uc
leu
s (
%)
*
*
ns
ns
U n in fe c te d B . a b o r tu s
w t
B . a b o r tu s
o m p 2 5
B M D C fro m
C 5 7 B L /6 m ic e
B M D C fro m
C D 1 5 0 -/- m ic e
T O P R O -3
w t
N F - B C D 1 1 c
A
B
o m p 2 5
Figure 26 : NF-κB translocation within infected CD150 KO BMDC .A. Representatives pictures from confocal microscopy of infected CD150 KO BMDC with wt Brucella (upper panel) or ∆omp25 (lower panel) for 2 h with MOI of 30. Cells were fixed and labeled with TOPRO-3 for the nucleus (yellow), anti-p65 (NF-κB, red), anti-LPS (green) and anti-CD11c for DC (cyan ). Scale: 10 µm.B. Quantification of NF-κB translocation in the nucleus of infected cells. BMDC were treated as described above. The percentage of cells containing NF-κB within the nucleus is indicated on the graph. Uninfected cells are represented in white while wt infected cells are in light grey and mutant infected cells in dark grey. BMDC coming from CD150 KO mice are represented with hatched bars. At least 50 cells in 3 independent experiments
are counted each time. p< 0,05: *.
58
crucial to control Brucella growth in vivo [149, 214]. Since CD150 regulates IFN-γ
production by T cells in various infectious models [196, 198], we hypothesize that the higher
bacterial replication observed in vivo in CD150 KO mice is due to a lack of IFN-γ production
leading to a lack of Brucella growth control.
It is known that CD150 binds several Omp from E. coli. Further work is necessary to
determine whether it is the case for Brucella. In addition, it has recently been described that
several receptors from the SLAM family are capable of binding and sensing various microbial
components: CD150 binds OmpC, OmpF and the measles virus, slamf6 binds E. coli and
Slamf2 binds FimH, a lectin from E. coli [207, 215]. Further investigations need to be done
regarding the role of other Slamf receptors in brucellosis. This could help us to better
understand the Brucella detection by the immune cells, the immune response to infection and
could provide new therapeutic targets.
CD150 and other SLAMF receptors are known to interact with SAP (SLAM adaptor protein).
Indeed, SLAMF receptor cytoplasmic tail contains ITSM (Immunoreceptor tyrosine-based
switch motif), which are used by both phosphatase (such as SHP-2) and kinase (as Fyn,
recruited through SAP to CD150 tail for example) to control T cell activation. SAP
association with Fyn would be required for the induction of a humoral response and cytokine
production by Th2 cells [216]. SAP would also lead to an inhibition of CD8+ T cells and NK
cytotoxicity by interacting with 2B4 (Slamf4) or CD150 [217-219]. Considering the role of
SLAM receptors and SAP in controlling the immune response, further studies need to assess
their potential role in brucellosis.
C57B
L/6
Balb
/C
C57B
L/6
Balb
/C
2
4
6
8
L iv e r
Lo
g C
FU
/org
an
*
C57B
L/6
Balb
/C
C57B
L/6
Balb
/C
3
4
5
6
7
8
S p le e n
Lo
g C
FU
/org
an
B . a b o rtu s w t
B . a b o rtu s o m p 2 5
**
C57B
L/6
Balb
/C
C57B
L/6
Balb
/C
8 0 0
1 0 0 0
1 2 0 0
1 4 0 0
1 6 0 0
1 8 0 0
L iv e r
mg
Liv
er
C57B
L/6
Balb
/C
C57B
L/6
Balb
/C
0
1 0 0
2 0 0
3 0 0
S p le e n
mg
Sp
lee
n
B . a b o rtu s w t
B . a b o rtu s o m p 2 5
Figure 27: Bacterial growth and weight organs in wt and ∆omp25 infected mice at 5 days post-infection. A. C57BL/6 and Balb/c mice (n=5) have been infected IP with 1.10
6 CFU. 5 days later organs are removed
and CFU are counted. B. abortus wt infected mice are indicated with a circle and the ones infected with ∆omp25 are indicated with a square. Mouse strain used is indicated in the x axis. B. Organs weight was measured for infected mice. Each symbol represents an animal and the median values are marked by horizontal bold lines. P < 0,05 : *.
A
B
59
The binding of OmpC and OmpF to CD150 leads to macrophage activation and efficient
killing of E. coli during infection, through phagolysosome maturation for example [199].
Studies have pointed out a versatile role of CD150 after various engagement signals therefore
leading to reverse effects either pro- or anti-inflammatory [168, 187]. This explains why E.
coli Omp binding to CD150 triggers an efficient immune response while Brucella Omp25-
CD150 interaction triggers an anti-inflammatory response. This may also have consequences
on intracellular trafficking: we show that CD150 deletion does not affect Brucella
intracellular trafficking and phagosome escape from endocytic pathway while intracellular
trafficking is affected upon E. coli infection in CD150 KO cells [199].
Despite its inhibitory and anti-inflammatory properties, Omp25 has also been studied for its
ability to induce a response against Brucella. Intradermal immunization of mice with the
recombinant protein leads to antibodies production against Omp25 [204, 205]. After infection
of immunized mice with Brucella, intradermal immunized mice are more potent in producing
pro-inflammatory cytokines such as IL-12 and IFN-γ than non-immunized mice [204, 205].
These studies underline the potential role of Omp25 as a target for the immune system.
Although in the context of infection with no prior immunization, Omp25 does not seem to
enhance immunity since a deletion mutant does not show any inflammation decrease.
We provide here the evidence that Brucella also target host cell membrane receptors to
dampen the immune response thereby contributing to the establishment of a chronic infection.
Sple
en
Liv
er
MLN
0 .0
0 .5
1 .0
1 .5
2 .0
CI
* * ** * * *
n s
Sple
en
Liv
er
MLN
0 .0
0 .5
1 .0
1 .5
2 .0
CI
* *
* * * * * * * *
Figure 28: Competitive index proliferation between Brucella wt and omp25 mutant strains. C57BL/6 (A) and Balb/C (B) mice have been infected IP with 1.10
6 CFU of a mixture containing 50 % of
Brucella wt and 50 % of ∆omp25. 5 days later organs are removed and CFU are enumerated. Each symbol represents an animal and data represent means ± standard deviations. CI statistically different from 1.0 was indicated as follow: P < 0,01: **, P<0,005: ***, P<0,001: ****.
A B
C57B
L/6
Balb
/C
C57B
L/6
Balb
/C
0
1
2
3
4
5
S p le e n
Lo
g
CF
U/o
rg
an
B . a b o r tu s w t
B . a b o r tu s o m p 2 5C
57B
L/6
Balb
/C
C57B
L/6
Balb
/C
0
1
2
3
4
L iv e r
Lo
g
CF
U/o
rg
an
C57B
L/6
Balb
/C
C57B
L/6
Balb
/C
C57B
L/6
Balb
/C
1 0 0 0
1 5 0 0
2 0 0 0
2 5 0 0
L iv e r
Liv
er w
eig
ht
(mg
)
p = 0 .0 6
**
****
C57B
L/6
Balb
/C
C57B
L/6
Balb
/C
C57B
L/6
Balb
/C
0
5 0 0
1 0 0 0
1 5 0 0
S p le e n
Sp
lee
n w
eig
ht
(mg
)
B . a b o rtu s w t
B . a b o rtu s o m p 2 5
P B S
*
****
****
A
B
Figure 29: Bacterial growth and weight organs in wt and ∆omp25 infected mice at 60 days post-infection. A. Mice have been infected IP with 1.10
6 CFU. 60 days later organs are removed and CFU are counted. B.
abortus wt infected mice are indicated with a circle and the ones infected with ∆omp25 are indicated with a square. Mouse strain used is indicated in the x axis. B. Organs were weighted for infected mice. Each symbol represents an animal and the median values are marked by horizontal bold lines. P < 0,05 : *, P< 0,01: **, P < 0,001: ****.
60
Material and Methods
Bacterial strains
In this study we used B. abortus smooth virulent strain 2308, ∆omp25 strain was a gift from
Ignacio Moriyón and has been described previously [45]. Brucella strains were grown onto
TSA plates (Sigma Aldrich) containing Kanamycin for ∆omp25. For infection, strains were
grown overnight at 16h, 37°C under shaking in TSB (Sigma Aldrich) with kanamycin for
∆omp25 until the OD (OD at 600nm) reached 1.8. All experiments with Brucella were carried
out in our BSL3 facility. E. coli DH5-α thermocompetent bacteria were used to amplify
CD150 constructs. Liquid cultures were done in LB during overnight incubation at 37°C
under shaking. Solid cultures were made onto LB-Agar.
Mice
Wild type Balb/c mice, wild type C57BL/6 mice, C57BL/6 OTII mice were obtained from
Charles River. IFN-γ KO mice were obtained from the Jackson Laboratory. CD150 KO (on
C57BL/6 background) mice were provided by Yusuke Yanagi and the method to obtain them
is described in the ref. [220]. Animal experimentation was conducted in strict accordance with
good animal practice as defined by the French animal welfare bodies (Law 87–848 dated 19
October 1987 modified by Decree 2001-464 and Decree 2001-131 relative to European
Convention, EEC Directive 86/609). INSERM guidelines have been followed regarding
animal experimentation (authorization No. 02875 for mouse experimentation). All animal
work was approved by the Direction Départementale Des Services Vétérinaires des Bouches
du Rhône (authorization number 13.118). All the in vivo work protocols have been submitted
to the Regional Ethic Committee for evaluation.
0 5 1 0 1 5 2 0 2 5 3 0 3 5
0
2 5
5 0
7 5
1 0 0
D a y s p o s t- in fe c t io n
Pe
rc
en
t s
urv
iva
l
B . a b o r tu s o m p 2 5
* *
B . a b o r tu s w t
Figure 30: Survival curve of IFN-γ KO mice infected with Brucella wt or ∆omp25. IFN-γ KO mice have been infected IP with 1.10
6 CFU. Mice weight was assessed each two days and after a
loss of more than 30 % of the original weight, mice were considered as dead. B. abortus wt infected mice are indicated in blue, and ∆omp25 infected mice are indicated in red. Each black dot represents an animal. P < 0,01 : **.
A
B
0
2 0 0
4 0 0
6 0 0
8 0 0
1 0 0 0
Sp
lee
n w
eig
ht
(mg
)
p = 0 .0 5 7
w t m ic e C D 1 5 0 K O
m ic e
0
1 0 0 0
2 0 0 0
3 0 0 0
Liv
er
we
igh
t (m
g)
B . a b o rtu s w t
B . a b o rtu s o m p 2 5
w t m ic e C D 1 5 0 K O
m ic e
3 .5
4 .0
4 .5
5 .0
5 .5
Lo
g C
FU
/org
an
*
w t m ic e C D 1 5 0 K O
m ic e
0
1
2
3
4
Lo
g C
FU
/org
an
B . a b o rtu s w t
B . a b o rtu s o m p 2 5
w t m ic e C D 1 5 0 K O
m ic e
Figure 31: Bacterial growth and weight organs in wt and ∆omp25 infected CD150 KO mice at 8 days post-infection. A. Mice have been infected IP with 1.10
6 CFU. 8 days later organs are removed and CFU are counted. B.
abortus wt infected mice are indicated with a circle and the ones infected with ∆omp25 are indicated with a triangle. Mouse strain used is indicated in the x axis. B. Organs were weighted for infected mice. Each symbol represents an animal, data represent means ± standard deviations. P < 0,05 : *.
61
Reagents
Antibodies used in flow cytometry are the following, CD11c-APC Cy7, CD80-PE Cy5,
CD40-Alexa 647, CD150-PE Cy7, MHC II (I-A/I-E) PE, CD25 FITC, CD86 FITC, CD62L
PE, CD4 and CD8-PE Cy5 were all purchased at BioLegend. CD3 eFluor450 was purchased
at eBioscience. CD44-Alexa700 was purchased at BD Biosciences. E. coli LPS used for this
study has been purchased at Sigma. Brucella membrane extracts are a gift of I. Moriyón.
Blocking and control peptides to CD150 were synthetized by Thermo Scientific and the
sequences used were described there [189].
Cell Culture
BMDCs were prepared from 6–8 week-old female C57BL/6 mice as previously described
[23]. OTII CD4+ T cells are prepared from OTII mice. Spleen and lymph nodes of mice were
harvested, and then cells were extracted and purified using magnetic beads (Dynal,
Invitrogen). T cells were cultivated in RPMI 1640 (Gibco, Life Technologies) supplemented
with 5% of FCS, 1% HEPES (Gibco, Life Technologies), Penicilline/Streptomycine, 1% of
Sodium Pyruvate. For co-culture of BMDC with OTII cells, we put a BMDC/T cell ratio of
1:4, and cells were co-cultivated for 3 days before labeling for flow cytometry.
Construction of myc-CD150 exon 2 – 3:
cDNA fragment of mouse CD150 was obtained from Origene and the two first exons were
amplified by PCR using the following primers CD150-Fw:
5’GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACAGGTGGAGGTGTGATGGAT-
3’ and CD150-Rv 5’-
GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACTGAGGAGGATTCCTGCTTGC-
3’and cloned into a pCMV-myc and using Gateway Technology (Invitrogen, Life
B . a b o rtu s w t O M
B . a b o rtu s o m p 2 5 O M + +- -
++ - -
my
c::
CD
15
0m
yc
::C
D1
50
my
c::
Sif
A
my
c::
Sif
A
-o m p 2 5P u ll do w n
-m y c
-m y cP u ll do w n
In p u t 1 0 0 % -o m p 2 5
wt
OM
o
mp
25
OM
B . a b o rtu s O M :
2 5 k D a
2 5 k D a
2 5 k D a
3 7 k D a
Sple
en
Liv
er
MLN
0
1
2
3
4
5
CI
*
* * *
ns
Figure 32: Competitive index in CD150 KO mice. CD150 KO mice have been infected IP with 1.10
6 CFU of a mixture containing 50 % of Brucella wt and 50
% of ∆omp25. 5 days later organs (as indicated on the x axis) are removed and CFU are enumerated. Each symbol represents an animal and data represent means ± standard deviations. CI statistically different from 1.0 was indicated as follow: P < 0,05: *, P<0,005: ***.
Figure 33: Brucella Omp25 binds CD150. COS-7 cells were transfected with 1,5 µg of plasmid containing myc::CD150(2-3) or myc::SifA. 48 h after transfection, cells were harvested and proteins extracted. After myc pull-down and incubation (+) with OM extracts (1µg) from either Brucella wt or ∆omp25, the binding of Omp25 to CD150 was assessed by western blot. Pulled myc tagged proteins were indicated as well as the input (100 %) for Brucella membrane extracts. One representative experiment out of 3 independent is shown here.
62
Technologies). Plasmids were transformed into E. coli thermocompetent strain DH5-α for
amplification and then purified with MaxiPrep Plasmid Kit (Qiagen).
Expression and purification of myc-CD150 exon 2 – 3:
1.5 µg of myc-CD150 was transfected into COS-7 cells using Fugene (Promega) technology
according to the manufacturer’s instructions. 48 h after transfection cells were harvested and
lysed into PBS, NP-40 0.5 % containing Proteases Inhibitor (Roche). Expression of the
protein was confirmed by western blot against myc. Myc-SifA plasmid was provided by
Stéphane Méresse.
Immunoprecipitation of myc-CD150 and myc-SifA
Protein G beads were coupled to 1 µg of myc (9E10) antibody during 1 h at 4°C and then
incubated with the whole cell extracts for 1 h at 4°C. After washes with PBS containing 0.1 %
NP-40 and proteases inhibitors, myc-CD150 and myc-SifA were incubated 1 h with 1 µg of
B. abortus wt OM or B. abortus ∆omp25 OM at 4°C. Washes with 0.5M NaCl and 0.001 %
SDS were then performed to eliminate all non-specific interactions. Samples were then boiled
at 95°C for 5 minutes, and centrifuge for 10 min at 14,000 g prior to supernatants analysis.
Western blot against Omp25 (antibody A595F1C9 was a gift from A. Cloeckaert) was then
perfom using Mouse IgG True Blot HRP (eBiosciences) as secondary antibody to avoid
unspecific bands.
Infection assays
BMDC infections were performed at a multiplicity of infection (MOI) of 30:1. Bacteria were
centrifuged onto cells at 400 g for 10 min at 4 ºC and then incubated for 30 min at 37 ºC with
5% CO2. Cells were washed twice with medium and then incubated for 1 h in medium
63
containing 100 µg/ml gentamicin (Sigma Aldrich) to kill extracellular bacteria. Thereafter, the
antibiotic concentration was decreased to 20 µg/ml. To monitor bacterial intracellular
survival, infected cells were washed 3 times in PBS and lysed with 0.1% Triton X-100 in H2O
and serial dilutions plated in triplicates onto TSB agar to enumerated CFUs after 3 days at
37°C.
RNA extraction and RT
Total RNAs were extracted from infected BMDC using RNeasy Mini Kit (Qiagen) and
following manufacturer’s instructions. cDNAs were generated by using Quantitech Reverse
Transcription Kit (Qiagen) following manufacturer’s instructions and using 300 ng of RNA as
matrix.
qPCR
2 µl of cDNA were used as matrix for qPCR, which was performed with SYBR Green
(Takara) following the manufacturer’s instructions in 7500 Fast Real-time PCR (Applied
Biosystem). Primers used are listed into Table 1. HPRT was used as a housekeeping gene to
determine ΔCt. Fold increase was compared between the control and the treated cells.
mRNAs which were expressed more than 2 fold more were considered as significantly
upregulated.
Cytokines measurement
Culture supernatants or sera from mice were analyzed to determine the cytokine profiles were
whether by cytometric beads assay (BD, Mouse Inflammation kit) or by Sandwich enzyme-
linked immunosorbent assays (ELISA) from eBiosciences for total IL12, and IL1β.
64
Flow cytometry
Cells were harvested and stained for 20 min at 4°C with the antibodies cited above. Cells
were then washed once in 2 % FCS in PBS and once in PBS. Infected cells were then fixed
for 20 min in 3 % PFA at room temperature (RT). Events were collected on flow cytometry
using a FACSCantoII (Becton Dickinson) or FACSLSRII UV and analysis was performed on
FlowJo software (TreeStar) and FACS DIVA (BD).
Immunofluorescence microscopy
Cells were fixed in 3 % paraformaldehyde, pH 7.4, at room temperature for 20 min. For NF-
κB studies, cells were then permeabilized for 10 min with 0.1 % saponin in PBS, followed by
a blocking for 1 h with 2 % BSA in PBS. Primary antibodies were incubated for 1 h followed
by 2 washes in PBS, 45 min incubation for secondary antibodies, 2 washes in PBS and 1 wash
in water before mounting with Prolong Gold (Life technologies). Primary antibodies used:
rabbit anti-p65 from Santa Cruz at 1/200, hamster anti-CD11c from BioLegend at 1/100 and
cow anti-Brucella LPS antibody at 1/2000. Secondary antibodies used: goat anti-hamster
Alexa 594, donkey anti-rabbit Alexa-546, goat anti-cow FITC, all from Jackson
Immunoresearch. Nuclei were stained with TOPRO-3. For all the others immunofluorescence
labelling, we used 2% BSA in PBS for 1 h to block non-specific interaction, then we incubate
the primary antibodies for 30 min in PBS containing 0,1 % saponine and of horse serum.
Coverslips with cells are then washed twice in PBS 0,1 % saponine before 30 min incubation
with secondary antibodies. Coverslips are then mounted in Prolong Gold. We used as primary
antibodies: Rabbit anti-mouse calnexin (Abcam) at 1/200, rat anti-mouse Lamp1 (clone
1D4B) from Santa Cruz at 1/200, phalloïdine coupled to Alexa 546 (Invitrogen) at 1/1000 and
a cow anti-Brucella LPS antibody at 1/2000. Secondary antibodies used were purchased at
Jackson Immunoresearch and Life Technologies (Invitrogen): anti-rabbit Pacific Blue, anti-
65
goat Alexa 546, anti-rat 647. Samples were examined on a Leica SP5 laser scanning confocal
microscope for image acquisition. Images of 1024x1024 pixels were then assembled using
Adobe Photoshop 7.0 or ImageJ. In all experiments we used an anti-CD11c antibody
confirming analysis of DCs only. Quantification was always done by counting at least 50 cells
in 5 independent experiments, for a total of at least 250 host cells analyzed.
Mice infection
Balb/c mice or C57BL/6 mice were infected in our BSL3 facility by intra peritoneal injection.
1x106 CFU were injected into 200 µl of sterile endotoxin-free PBS for each mouse. Organs
were harvested 5 or 60 days post-injection and then scratched into sterile Triton X-100 0.1 %
diluted in H2O, serial dilutions in sterile PBS were used to count CFU. Blood was collected
into EDTA tubes at 5 or 60 days post infection and spin at 3500 rpm for 5 min at RT to collect
sera. For histology studies, organs were harvested and placed into 10 % of formalin for 24 h at
RT before inclusion in paraffine. The slides were then stained with hematoxylin and eosin.
For competitive index experiment a mixture of 50 % of wt Brucella and 50 % of ∆omp25
were injected at a final concentration of 1.106 CFU per mouse.
Acknowledgements
CD and AP held fellowships from Aix-Marseille University. This work was supported by the
Centre National de la Recherche Scientifique, the Institut National de la Santé et de la
Recherche Médicale, Aix-Marseille University.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
66
Table 1: Primers used for cDNA amplification.
Gene Sens Sequence HPRT Fw 5'-3' AGCCCTCTGTGTGCTCAAGG HPRT Rv 5'-3' CTGATAAAATCTACAGTCATAGGAATGGA PTGS2 Fw 5'-3' ACCTCTGCGATGCTCTTCC PTGS2 Rv 5'-3' TCATACATTCCCCACGGTTT TNF-α Fw 5'-3' CATCTTCTCAAAATTCGAGTGACAA TNF-α Rv 5'-3' TGGGAGTAGACAAGGTACAACCC NOS-2 Fw 5'-3' CAGCTGGGCTGTACAAACCTT NOS-2 Rv 5'-3' CATTGGAAGTGAAGCGTTTCG IL-12b Fw 5'-3' AAATTACTCCGGACGGTTCA IL-12b Rv 5'-3' ACAGAGACGCCATTCCACAT IL-6 Fw 5'-3' GAGGATACCACTCCCAACAGACC IL-6 Rv 5'-3' AAGTGCATCATCGTTGTTCATACA
IFN-β Fw 5'-3' GAAAAGCAAGAGGAAAGATT IFN-β Rv 5'-3' AAGTCTTCGAATGATGAGAA IL1-β Fw 5'-3' TCCAGGATGAGGACATGAGCAC IL1-β Rv 5'-3' GAACGTCACACACCAGCAGGTTA KC Fw 5'-3' CAGCCACCCGCTCGCTTCTC KC Rv 5'-3' TCAAGGCAAGCCTCGCGACCAT
CCL-2 Fw 5'-3' GCCTGCTGTTCACAGTTGC CCL-2 Rv 5'-3' ATTGGGATCATCTTGCTGGT
67
II. C. LE CΒG DE BRUCELLA ACTIVE LES DC ET CONTROLE LE
RECRUTEMENT DES NEUTROPHILES
II. C. 1. Introduction
Le CβG est un facteur de virulence essentiel à Brucella pour permettre sa réplication au sein
des macrophages [21], mais pas des DC [23]. Il est capable de contrôler le niveau de
cholestérol au niveau de la BCV [21].
Le CβG est un activateur des DC humaines et murines. En effet, après ajout sur des DC de
CβG purifié, celles-ci vont s’activer, exprimer des molécules de co-stimulation comme CD86,
CD80, CD40, du CMH-II, sécréter des cytokines pro-inflammatoires comme l’IL-6, le TNF-α
ou encore l’IL-12. Ces DC sont aussi d’efficaces inducteurs de l’activation des LT [22].
Contrairement au LPS d’E. coli, cette molécule est non immunogénique et non toxique, ce qui
en fait un excellent candidat pour être un adjuvant.
Dans cet article nous décrivons le rôle du CβG dans l’induction de l’inflammation in vivo.
Grâce à des analyses transcriptomiques, nous montrons qu’en effet le CβG induit un profil
d’activation des DC, mais aussi des gènes liés à un rôle plus anti-inflammatoire comme les
SOCS ou TNFAIP6.
Nous avons étudié aussi le recrutement de cellules immunitaire au site d’injection in vivo du
CβG, pour essayer de déterminer comment cette molécule peut promouvoir une réponse
immunitaire innée et adaptative, mais ne pas être toxique comme le LPS.
68
II. C. 2. Manuscrit soumis
Title: Brucella cyclic glucan tunes up inflammation in human and mouse dendritic cells
Running title: Brucella cyclic glucan controls inflammation
Clara Degos 1,2,3, Aurélie Gagnaire 1,2,3, Romain Banchereau 4 Ignacio Moriyón 5 and Jean-
Pierre Gorvel 1,2,3*
1Centre d'Immunologie de Marseille-Luminy (CIML), Aix-Marseille University, UM2, Marseille, France, 2Institut National de la Santé et de la Recherche Médicale (INSERM), U1104, Marseille, France; 3Centre National de la Recherche Scientifique (CNRS), UMR7280, Marseille, France; 4Baylor Institute for Immunology Research, Dallas TX, USA ; 5Instituto de Salud Tropical y Depto. Microbiología y Parasitología, Universidad de Navarra, Pamplona, Spain.
*To whom correspondence should be addressed: gorvel@ciml.univ-mrs.fr
Keywords: Brucella, cyclic beta glucan, inflammation, neutrophil, lipopolysaccharide, SOCS,
PTGS2
Abbreviations:
Beta-1,2 cyclic glucan: CβG, lipopolysaccharide: LPS, dendritic cells: DC, outer membrane
protein: omp
69
Abstract
Brucella is the causing agent of a chronic zoonosis called brucellosis. Brucella follows a
stealthy strategy that relies on specific pathogen-associated molecular patterns and on
virulence factors that dampen immune responses. The Brucella beta-1,2 cyclic glucan (CβG)
has been described as a potent immune stimulator, albeit with no toxicity for cells and
animals. Here we used a genome-wide approach to characterize human mDC responses to
CβG and compared them to LPS. We found 34 differently regulated genes related to
inflammation (IL-6, IL2RA, PTGS2), chemokine (CXCR7, CXCL2) and anti-inflammatory
pathways (TNFAIP6, SOCS2). We validated these results in mouse BMDC and characterized
the inflammatory infiltrates at the level of mouse ear inflammatory sites when injected with
CβG or LPS. CβG yielded a lower and transient recruitment of neutrophils compared to LPS.
The consequence of these dual pro- and anti-inflammatory signals triggered by CβG is the
induction of local inflammation without alerting neutrophils.
Introduction
Brucellosis is a zoonosis affecting humans, farm animals and livestock, which represents a
significant economic burden in developing countries. Brucella, the agent of brucellosis, is a
pathogenic Gram-negative bacterium belonging to the alpha-2 proteobacteria group. The
World Health Organization (WHO) has classified brucellosis among the top seven “neglected
zoonoses”, a group of diseases that are simultaneously a threat to human health and a cause of
poverty.1 It is now recognized that in countries such as Mongolia and northern China,
brucellosis is becoming a threat for populations living in close contact with animals.
Pathogenic brucellae can efficiently replicate within the endoplasmic reticulum of infected
macrophages and dendritic cells, a safe intracellular niche located at the crossroad of many
vital host cell functions. The three main species leading to brucellosis in humans are B.
70
melitensis, B. suis and B. abortus. B melitensis is the most potent among the Brucella species,
since 1-5 bacteria are enough to cause disease. In addition, the existing vaccine against B.
melitensis (vaccine Rev 1) is virulent for humans, resistant to some antibiotics used to treat
human brucellosis, and not stable (spontaneous change from smooth (S) full potency to a
more attenuated rough (R) phenotype), which leads to reduced protection efficacy.
Over the last decade, most studies have focused on understanding the role of virulence factors
expressed by pathogenic brucellae. However, their role in virulence and the characterization
of the mechanisms involved, including their associated host cell counterparts, have only been
described in a few of them and reviewed in refs. 2, 3. In addition to their role in Brucella
replication and intracellular trafficking, some virulence factors were shown to play an
important role in dampening both innate and adaptive immunity. For example, BtpA and
BtpB act as inhibitors of TLR signaling 4, 5, while the products of the wadB and wadC genes
encoding mannosyl transferases are known to bring mannosyl residues in the core region of
LPS to avoid recognition via TLR4.6 Mutant strains lacking these proteins lead to enhanced
recognition by innate receptors, increased inflammation and a strong adaptive immune
response. WadC and wadB mutants can even induce protection in mice.6
Recently, we described the β-1,2 cyclic glucan (CβG), an additional virulence factor
synthesized by Brucella which is concentrated in the periplasm of the bacterium. This
polysaccharide is composed of a cyclic backbone of 17 to 25 glucose units in β-1,2 linkages
and can harbor substitutions such as succinyl, mevalonyl and methyl groups. Brucella CβG
was demonstrated to modulate lipid raft organization both at the plasma membrane of infected
cells and intracellularly at the site of the Brucella-containing vacuole.7 CβG is expressed in
large amounts, representing 1-5% of the bacteria dry weight. When bacteria are killed by the
host immune system, CβG is therefore released in the surrounding inflammatory environment
in µM concentrations. This may have important consequences for the modulation of
71
intracellular trafficking of the bacterium by shaping the lipid microdomain composition of the
Brucella-containing vacuole and by modulating host immune responses. Brucella CβG
signals through TLR4, without the contribution of CD14.8 In contrast to Btps and WadC
virulence factors, which are involved in the inhibition of immune responses, Brucella CβG is
a strong activator of both human and mouse dendritic cells, promoting pro-inflammatory
cytokine expression, antigen cross-priming and cross-presentation to specific CD8+ T cells.
However, unlike E. coli LPS and its derivatives, CβG does not display endotoxicity both in
vitro and in vivo, and has recently been referred as a new class of adjuvants.
We therefore asked how the lack of endotoxicity and the strong immune response generated
by CβG could be reconciled. Herein, we identify differential expression profiles between LPS
and CβG-stimulated mDC, highlighting specific anti-inflammatory networks in response to
CβG that may lead to dampening of neutrophil recruitment at the site of injection, thus
leading to a reduced inflammation.
Results
Brucella CβG differentially modulates transcriptomic responses in human blood mDC.
We previously described a number of immune pathways modulated by the Brucella CβG in
human blood mDC.8 Herein, we compared the transcriptional profiles of mDC stimulated
with CβG or LPS. We identified 34 genes that were expressed at a level at least 4.5-fold
higher in CβG-stimulated mDC than in LPS-stimulated cells (Table 1). As previously
described,8 some of these genes are related to inflammation (IL-6, BATF, IL2RA, PTGS2), or
chemokines pathways (CXCR7, CXCL2) while other are related to anti-inflammatory
pathways such as TNFAIP6, SOCS2.9
72
We show that Brucella CβG triggers the transcription of regulatory genes, particularly those
involved in the inhibition of pro-inflammatory cytokine secretion to stop the inflammatory
process (Fig. 1A). Several transcripts encoding chemokines were over-expressed in CβG-
stimulated mDC. CXCL2, IL8, CCL5, and CCL20 were highly expressed upon stimulation
with either Brucella CβG or E. coli LPS (Fig. 1B). These genes encode chemoattractants for
immune cells.10 E. coli LPS but to a larger extent CβG were capable of inducing the
transcription of SOCS genes known to encode regulatory elements that were described to
control inflammation (Fig. 1C).11 We focused on the expression levels of CXCL2, TNFAIP6,
PTGS2, SOCS3, and IL8 (Fig. 1C) since these transcripts were over-expressed in CbG-
stimulated compared to E. coli LPS-stimulated mDC. CXCL2 and IL8 are chemokines that
were previously described to promote neutrophil recruitment, while SOCS3 negatively
regulates pro-inflammatory cytokine secretion.12, 13 PTGS2 is involved in prostaglandins
metabolism and TNFAIP6 has been shown to be an anti-inflammatory molecule.14, 15
Whilst compared to E. coli LPS, Brucella CβG seems to enhance inflammatory pathways by
upregulating a selection of genes related to chemotaxis (Fig. 1) and pro-inflammatory
cytokines 8, it also preferentially induces anti-inflammatory genes such as SOCS, TNFAIP6,
LILRB and IDO2 (Figs. 1A,C).16-18
Over-expressed genes in Brucella CβG- stimulated human mDC are expressed in mouse
DC.
We confirmed the expression of CXCL2, KC, PTGS2, SOCS3 and TNFAIP6 mRNAs in
Brucella CβG or E. coli LPS-stimulated murine BMDC after stimulation by RT-PCR (Figs.
2A,B). We observed a strong induction of all these genes at 8 h post-stimulation, which
declined at 24 h post-stimulation. CβG- and E. coli LPS-treated BMDC expressed similar
levels of CXCL2 and TNFAIP6 transcripts at 8 h post-stimulation (Figs. 2A,B), in contrast to
73
human mDC, in which higher amounts of both transcripts were observed in CβG-treated cells
(Fig. 1C) thus reflecting differences between human and mouse DC subsets.
We then validated transcriptional profiles at the protein level. To this end, we measured the
expression level of the tsg-6 protein, the translated product of the TNFAIP6 gene (Fig. 2C).
tsg-6 was highly expressed in murine BMDC after 8 h stimulation and, as observed at the
transcriptional level, its expression was decreased at 24 h post-injection in all conditions
(Fig. 2C).
In murine DC, LPS and CβG both act on similar inflammatory pathways through the
modulation of chemokines and anti-inflammatory gene transcription. The induction of both
inflammatory and anti-inflammatory genes was higher at early post-stimulation time (8 h)
suggesting an early response to stimulation induced by both LPS and CβG.
Injection of Brucella CβG into mouse ear induces the recruitment of innate immune cells
in vivo.
Since we observed a high expression of chemokines transcripts in DC stimulated with E. coli
LPS and Brucella CβG, we measured the levels of inflammation triggered at the site of
injection in mice that had been intradermally immunized in the ear. At 48 h post-injection ear
tissue was recovered and stained for hematoxylin and eosin.
Injection with CβG or LPS led to the formation of an edema with cell infiltrates, which was
not observed in PBS-injected control mice (Fig. 3A). However, in CβG-injected ears, the
edema was significantly smaller than in LPS-injected ears, suggesting a lower level of
inflammation in response to CβG as compared to LPS.
To determine which cells were recruited at the inflammatory site, we immuno-stained ear
sections to detect monocytes (CD11b+, Gr1+) and neutrophils (CD11b+, Gr1+ and Ly6G+) by
confocal microscopy (Fig. 3B). Although these three markers were localized in both LPS- and
74
CβG-treated ears, LPS-injected ears showed a higher recruitment of neutrophils (white
labeling indicating the presence of neutrophils positive for CD11b+, Gr1+ Ly6G+) (Fig.3.B).
Brucella CβG induces a transient recruitment of neutrophils.
We then characterized the kinetics of neutrophil recruitment at the site of injection. To this
end, we injected PBS, LPS or CβG and harvested ears at 2 h, 6 h, 12 h, 24 h or 48 h post-
injection. Cells were stained for F4/80 and Ly6G and analyzed by flow cytometry (Fig. 4).
In LPS-injected ears, neutrophils (F4/80-, Ly6G+) were recruited as soon as 2 h post-injection
and increased in number until 24 h when almost 4,000 neutrophils were recruited to finally
reach about 2,000 cells at 48 h post-injection (Figs. 4A,C). In CβG-injected ears, neutrophil
recruitment was first detected at 6 h post-injection, reached a maximum at 12 h post-injection
with more than 2,000 neutrophils recruited (Fig. 4B), and then strongly decreased from 24 h
onwards (Figs. 4A,C), thereby corroborating histology experiments (Fig. 3B). In the case of
CβG, neutrophils were transiently recruited between 6 h and 12 h and disappeared at 24 h
post-injection, indicating a reduced inflammation in comparison to LPS treatment.
Discussion
Here, we show that CβG induced the transcription of both pro- and anti-inflammatory genes.
Injection of CβG into mouse ear led to a local inflammation characterized by an edema and a
fast and transient neutrophil recruitment. In LPS-injected ears, the edema was larger and
neutrophil stayed longer in the tissue suggesting a higher and prolonged inflammation.
Brucella is considered a stealthy pathogen that aims at keeping the host immune response
under control and avoiding inflammatory processes detrimental to the survival of the
bacterium. Up until now, most virulence factors expressed by pathogenic Brucella were found
75
to be involved in dampening host cell functions. At the entry site, different virulence factors
have been shown to be essential for the bacterium such as invA, BtaE, BtaF and BmaC 19-22 as
well as the LPS.23 When the bacterium enters in its Brucella-containing vacuole, other
proteins participate in the infection process to allow Brucella survival; Later on VirB 3 and
RicA 24 are required for establishing a safe replication niche. Finally, through evolution and
design, virulence factors have been selected to reduce its exposure with the host by interacting
with signaling pathways that may promote immune responses. For instance, while PrpA can
activate macrophages and this leads to the proliferation of B cells 25, 26, Brucella also
expresses Btps, DC inhibitory molecules that can serve to limit inflammation in infected DC.5,
8 WadC has been shown to protect Brucella LPS from detection and recognition by TLR4 and
so modulate the immune response.[94] Elsewhere, outer membrane proteins (Omps) seem to
also play a role either in the induction or inhibition of the immune response.23
Interestingly, CβG, which has been described as a virulence factor in macrophages but not in
dendritic cells, has recently been shown to be a strong activator of the immune system,
possibly by signaling through TLR4. The consequence of this interaction between DC and
CβG is the secretion of pro-inflammatory cytokines.4, 8 DC infected with null-mutants in the
cgs synthase does not show any sign of DC activation, 8 yielding a phenotype similar to PBS-
treated cells. In contrast, E. coli LPS has been shown to induce a strong activation and
maturation of DC.23, 27 A recent study has shown that upon infection with different
intracellular bacteria, including Brucella different intermediate levels of maturation can be
observed in human mDC. Brucella, in this case B. abortus, induced a significant but lower
activation profile compared to DC treated with LPS or infected with Coxiella burnetii and
Orienta tsutsugamushi infection, but at a higher level than when infections were performed
with T. whipplei.28 This intermediate level of activation has also been observed in mouse DC
76
4, 8 and may have consequences on further T and B cell activation. In vitro Brucella infections
of mouse DC have shown infected DC to exhibit impaired antigen presentation and T cell
activation properties.4 In another infection system, it has been demonstrated that intermediate
level of DC maturation give rise to Th1 response instead of Th2.29 Whereas most of virulence
factors act as inhibitors of host cell function, CβG may be bringing DC maturation to an
intermediate level. Moreover, CβG does not show any toxicity, a characteristic that fits very
well with Brucella and its goal to bring the host to a chronic disease state whereby the
pathogen can be present but silent, and better placed to survive and persist. In this context
therefore, Brucella may have adapted the CβG molecule to allow a limited activation of host
immune pathways in the absence of toxicity. As we demonstrate herein, when compared with
LPS, CβG induces a combination of inflammatory and anti-inflammatory pathways that
directs a transient inflammation to better facilitate the control of neutrophil recruitment,
corroborating previous studies on neutrophil/Brucella interactions.30 By inducing a
limited/controlled response, Brucella can better control disease progression in a manner that is
both tolerated by the host and amenable to the ensuring survival and persistence of the
pathogen/development of chronic disease.
Further work is necessary to understand at the level of the infected host, how CβG and other
virulence factors impact the activation status of Brucella-infected DC sub-types and their
subsequent role in developing chronic disease. Anyway our study provides evidence of a
better understanding of the complex interplay between inflammatory and anti-inflammatory
molecular networks in response to bacterial PAMPs.
77
Materials and Methods
Cell Culture
BMDCs were prepared from 6–10 week-old female C57BL/6 mice as previously described.4
Briefly, tibias and femur were removed from mice; bone marrow was harvested by flushing
with RPMI-1640 (Gibco, Life Technologies). Red blood cells are then lysed, and after three
washes cells were seeded onto 6 well plates at 0.6x106 cells/ml. Cells were grown in RPMI-
1640, 5% FCS, 50 µM β-mercaptoethanol. Human monocyte-derived DC were purified from
blood using Ficoll (Ge Healthcare), cells were cultivated in serum-free Cellgro DC culture
media supplemented with 100 ng/ml GM-CSF and 20 ng/ml IL-4.
Reagents and antibodies
Purified cyclic glucan was obtained from Brucella abortus 2308 as previously described.8 E.
coli LPS (055:B5) was purchased from Sigma Aldrich. Cells were stimulated with 10 µg/ml
of CβG or 100 ng/ml or LPS corresponding to the same molarity (0.25µM). Flow cytometry
antibodies were: anti Ly6G-V450 (clone 1A8), anti CD45.2-PerCP-Cy5.5 (clone 104), anti
Ly6C-PE-CF594 (clone AL-21), anti CD64-AF647 (clone X54-5/7.1) from BD Biosciences ;
anti CD24-AF488 (clone M1/69), anti F4/80-PE (clone CI :A3-1), anti CD11b-APC/Cy7
(clone M1/70), anti CD150-PECy7 (clone TC15-12F12.2) from BioLegend, anti I-A/I-E-
A700 (clone M5/114-15.2) from eBiosciences. Antibodies used for confocal microscopy
were: anti Gr1-PE (clone RB6-8C5), anti CD11b-AF647 (clone M1/70) from BioLegend;
anti-Ly6G (clone 1A8) from BD Biosciences; anti-rat AF555 (clone A21434) from
Invitrogen. Human/Mouse TSG-6 MAb (RD systems) was used to detect the tsg-6 protein in
western blots using anti-mouse HRP (Invitrogen) as a secondary antibody. Western blots were
revealed using Amersham ECL Detection system (GE Healthcare).
78
Mice Immunization
6-10 weeks old C57BL/6 females were intradermally injected into the internal face of the ear
with 200 µg of CβG, 10 µg of LPS (Sigma Aldrich) or PBS as a negative control. At 48 h
post-injection mice were sacrificed and ears recovered for further analyses.
mRNA extraction and hybridization for transcriptomic analysis
RNA was extracted and purified from purified blood human mDC. RNA hybridization
performed using Illumina HT12 v4 Beadchip arrays was performed as previously described.8
Bioinformatic analysis of microarrays was performed as previously described.8 Briefly,
pathway analysis was carried out using the Ingenuity Pathway Analysis (IPA) software. A
non-parametric test was applied to the different samples from 4 donors with a false discovery
rate of 0.01. Only significant transcripts were considered, transcripts presented were
normalized to their control, the transcripts showed here have an absolute fold changes equal
or superior to 2. Genespring 7.3 was used for analysis and generating heatmaps and GraphPad
Prism 5 was used for barcharts.
mRNA extraction and RT
Total RNAs were extracted from infected BMDC using RNeasy Mini Kit (Qiagen) following
the manufacturer’s instructions.cDNAs were generated by using Quantitech Reverse
Transcription Kit (Qiagen) following the manufacturer’s instructions and using 300 ng of
RNA as matrix.
qPCR
Recovered cDNA (2 µl) was used as template for qPCR, was performed with SYBR Green
(Takara) following the manufacturer’s instructions by 7500 Fast Real-time PCR (Applied
79
Biosystem). Primers used are listed into Table 2. HPRT was used as a housekeeping gene to
determine ∆Ct. Fold increases were determined by comparing control (non-treated) and
treated cells. mRNAs which were expressed more than 2 fold more were considered as
significantly upregulated.
Protein extraction
BMDC were harvested, washed once in PBS, and cell pellets frozen at - 80° C. To purify
protein, cell pellets were resuspended in lysis buffer (PBS containing 0.5 % of NP-40 and
proteases inhibitor (Roche Diagnosis)) and the resulting cell lysate was centrifuged at 10,000
g for 10 min at 4°C. The supernatants were recovered and analyzed by SDS-PAGE and
western blot.
Immunohistochemistry staining
Ear tissue was recovered and fixed with 10 % formalin for 48 h and embedded in paraffin. A
Leica RM2245 microtome was used to prepare 5 µm slides, which were then stained with
hematoxylin and eosin. Images were subsequently acquired using a Nikon Eclispe Ci.
Confocal microscopy
Ear tissues were embedded in tissue-tec OCT (Sakura Finetek). 15 µm cryosections were then
saturated in PBS containing 2 % BSA for 30 min, incubated overnight with primary
antibodies, and thereafter for 1 h with secondary antibodies. Slides were mounted with
ProLong Gold containing DAPI (Invitrogen). Images were acquired using a LSM 510
confocal microscope (Carl Zeiss, Inc.), before analyzed and assembled using ImageJ software
(ImageJ).
80
Ear mouse skin cell isolation
Ear skin tissues were split in two sheets (dorsal and ventral) and incubated overnight in PBS
containing 2.5 mg/ml dispase II (Roche) at 4°C to separate the dermal and epidermal sheets.
The separated epidermal and dermal sheets were then cut in to pieces and incubated for 90
min at 37°C with RPMI containing 1 mg/ml DNase (Sigma Aldrich) and 1 mg/ml collagenase
type IV (Worthington Biochemical) to obtain a homogeneous cell suspension.
Flow cytometry
Skin cells were incubated for 10 min with 2.4G2 antibody to block non-specific signal before
staining for 20 min at 4°C with the antibodies cited above. Cells were then washed once in
2% FCS in PBS and once in PBS before fixing in 3% PFA for 20 min at room temperature
(RT). At least 400,000 events were collected by flow cytometry using a FACSCantoII
(Becton Dickinson) or FACSLSRII UV. Analyses were performed using FlowJo software
(TreeStar) and FACS DIVA (BD).
Acknowledgements
CD and AG held fellowships from Aix-Marseille University. This work was supported by the
Centre National de la Recherche Scientifique, the Institut National de la Santé et de la
Recherche Médicale, Aix-Marseille University, the Baylor Institute for Immunology Research
(NIH/NIAID-U19 grant N°AI057234). We thank Sean Hanniffy for critical reading and
suggestions. We also thank the CIML histology core platform and especially Lionel Chasson.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
81
References
1. Ian Maudlin SW-M. The Control of Neglected Zoonotic Diseases - A route to poverty alleviation. Geneva: WHO, 2006. 2. de Jong MF, Tsolis RM. Brucellosis and type IV secretion. Future Microbiol 2012; 7:47-58. 3. Lacerda TL, Salcedo SP, Gorvel JP. Brucella T4SS: the VIP pass inside host cells. Current opinion in microbiology 2013; 16:45-51. 4. Salcedo SP, Marchesini MI, Lelouard H, Fugier E, Jolly G, Balor S, Muller A, Lapaque N, Demaria O, Alexopoulou L, et al. Brucella control of dendritic cell maturation is dependent on the TIR-containing protein Btp1. PLoS pathogens 2008; 4:e21. 5. Salcedo SP, Marchesini MI, Degos C, Terwagne M, Von Bargen K, Lepidi H, Herrmann CK, Santos Lacerda TL, Imbert PR, Pierre P, et al. BtpB, a novel Brucella TIR-containing effector protein with immune modulatory functions. Front Cell Infect Microbiol 2013; 3:28. 6. Conde-Alvarez R, Arce-Gorvel V, Iriarte M, Mancek-Keber M, Barquero-Calvo E, Palacios-Chaves L, Chacon-Diaz C, Chaves-Olarte E, Martirosyan A, von Bargen K, et al. The lipopolysaccharide core of Brucella abortus acts as a shield against innate immunity recognition. PLoS pathogens 2012; 8:e1002675. 7. Arellano-Reynoso B, Lapaque N, Salcedo S, Briones G, Ciocchini AE, Ugalde R, Moreno E, Moriyon I, Gorvel JP. Cyclic beta-1,2-glucan is a Brucella virulence factor required for intracellular survival. Nat Immunol 2005; 6:618-25. 8. Martirosyan A, Perez-Gutierrez C, Banchereau R, Dutartre H, Lecine P, Dullaers M, Mello M, Salcedo SP, Muller A, Leserman L, et al. Brucella beta 1,2 cyclic glucan is an activator of human and mouse dendritic cells. PLoS pathogens 2012; 8:e1002983. 9. Posselt G, Schwarz H, Duschl A, Horejs-Hoeck J. Suppressor of cytokine signaling 2 is a feedback inhibitor of TLR-induced activation in human monocyte-derived dendritic cells. Journal of immunology 2011; 187:2875-84. 10. McColl SR, Clark-Lewis I. Inhibition of murine neutrophil recruitment in vivo by CXC chemokine receptor antagonists. Journal of immunology 1999; 163:2829-35. 11. Krebs DL, Hilton DJ. SOCS: physiological suppressors of cytokine signaling. Journal of cell science 2000; 113 ( Pt 16):2813-9. 12. Carow B, Rottenberg ME. SOCS3, a Major Regulator of Infection and Inflammation. Front Immunol 2014; 5:58. 13. Babon JJ, Nicola NA. The biology and mechanism of action of suppressor of cytokine signaling 3. Growth Factors 2012; 30:207-19. 14. Danchuk S, Ylostalo JH, Hossain F, Sorge R, Ramsey A, Bonvillain RW, Lasky JA, Bunnell BA, Welsh DA, Prockop DJ, et al. Human multipotent stromal cells attenuate lipopolysaccharide-induced acute lung injury in mice via secretion of tumor necrosis factor-alpha-induced protein 6. Stem cell research & therapy 2011; 2:27. 15. Choi H, Lee RH, Bazhanov N, Oh JY, Prockop DJ. Anti-inflammatory protein TSG-6 secreted by activated MSCs attenuates zymosan-induced mouse peritonitis by decreasing TLR2/NF-kappaB signaling in resident macrophages. Blood 2011; 118:330-8.
82
16. Anderson KJ, Allen RL. Regulation of T-cell immunity by leucocyte immunoglobulin-like receptors: innate immune receptors for self on antigen-presenting cells. Immunology 2009; 127:8-17. 17. Katz HR. Inhibition of inflammatory responses by leukocyte Ig-like receptors. Advances in immunology 2006; 91:251-72. 18. Trabanelli S, Ocadlikova D, Ciciarello M, Salvestrini V, Lecciso M, Jandus C, Metz R, Evangelisti C, Laury-Kleintop L, Romero P, et al. The SOCS3-independent expression of IDO2 supports the homeostatic generation of T regulatory cells by human dendritic cells. Journal of immunology 2014; 192:1231-40. 19. Alva-Perez J, Arellano-Reynoso B, Hernandez-Castro R, Suarez-Guemes F. The invA gene of Brucella melitensis is involved in intracellular invasion and is required to establish infection in a mouse model. Virulence 2014; 5:563-74. 20. Ruiz-Ranwez V, Posadas DM, Estein SM, Abdian PL, Martin FA, Zorreguieta A. The BtaF trimeric autotransporter of Brucella suis is involved in attachment to various surfaces, resistance to serum and virulence. PLoS One 2013; 8:e79770. 21. Ruiz-Ranwez V, Posadas DM, Van der Henst C, Estein SM, Arocena GM, Abdian PL, Martin FA, Sieira R, De Bolle X, Zorreguieta A. BtaE, an adhesin that belongs to the trimeric autotransporter family, is required for full virulence and defines a specific adhesive pole of Brucella suis. Infection and immunity 2013; 81:996-1007. 22. Posadas DM, Ruiz-Ranwez V, Bonomi HR, Martin FA, Zorreguieta A. BmaC, a novel autotransporter of Brucella suis, is involved in bacterial adhesion to host cells. Cellular microbiology 2012; 14:965-82. 23. Martirosyan A, Moreno E, Gorvel JP. An evolutionary strategy for a stealthy intracellular Brucella pathogen. Immunol Rev 2011; 240:211-34. 24. de Barsy M, Jamet A, Filopon D, Nicolas C, Laloux G, Rual JF, Muller A, Twizere JC, Nkengfac B, Vandenhaute J, et al. Identification of a Brucella spp. secreted effector specifically interacting with human small GTPase Rab2. Cell Microbiol 2011; 13:1044-58. 25. Spera JM, Herrmann CK, Roset MS, Comerci DJ, Ugalde JE. A Brucella virulence factor targets macrophages to trigger B-cell proliferation. The Journal of biological chemistry 2013; 288:20208-16. 26. Spera JM, Ugalde JE, Mucci J, Comerci DJ, Ugalde RA. A B lymphocyte mitogen is a Brucella abortus virulence factor required for persistent infection. Proceedings of the National Academy of Sciences of the United States of America 2006; 103:16514-9. 27. Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature 1998; 392:245-52. 28. Gorvel L, Textoris J, Banchereau R, Ben Amara A, Tantibhedhyangkul W, von Bargen K, Ka MB, Capo C, Ghigo E, Gorvel JP, et al. Intracellular bacteria interfere with dendritic cell functions: role of the type I interferon pathway. PLoS One 2014; 9:e99420. 29. Dirix V, Mielcarek N, Debrie AS, Willery E, Alonso S, Versheure V, Mascart F, Locht C. Human dendritic cell maturation and cytokine secretion upon stimulation with Bordetella pertussis filamentous haemagglutinin. Microbes and infection / Institut Pasteur 2014; 16:562-70. 30. Barquero-Calvo E, Martirosyan A, Ordonez-Rueda D, Arce-Gorvel V, Alfaro-Alarcon A, Lepidi H, Malissen B, Malissen M, Gorvel JP, Moreno E. Neutrophils exert a suppressive
83
effect on Th1 responses to intracellular pathogen Brucella abortus. PLoS pathogens 2013; 9:e1003167.
Legends
Table 1: Fold changes in gene expression in CβG- versus LPS-treated human blood mDC.
Table 1 lists 34 genes over-expressed at least 4.5-fold higher in CβG-stimulated cells
compared to LPS-stimulated cells (at 6 h post-treatment). Data were normalized against cells
treated for 6 h with culture media only.
Table 2: Sequence of the qPCR primers used.
Figure 1: Transcriptional profiling of human blood mDC from healthy donors stimulated with
CβG (n=5) or LPS (n=4), respectively.
A. Heatmap representing the transcription expression levels of 15 regulatory genes
differentially expressed in mDC stimulated with either CβG, LPS or cell culture medium
(control) (Welch T-test, p<0.05). Data were normalized against cells from each donor that had
been treated for 6 h with cell culture medium alone. B. Heatmap representing the
transcriptional expression levels of 18 chemokines differentially expressed in mDc treated
with CβG, LPS or cell culture medium. C. Bar charts representing the mean raw expression
values of CXCL2, IL8, PTGS2, SOCS3 and TNFAIP6. Error bars represent the standard
deviation.
Figure 2: Induction of gene expression in murine DC stimulated with CβG or LPS.
A. Murine BMDC were stimulated for 8 h and 24 h with E. coli LPS (black bars) or Brucella
CβG (grey bars). mRNA was extracted from stimulated cells and qPCR performed to
determine transcript expression levels of CXCL2, KC and PTGS2. Fold-increases were
84
estimated by comparing with cells that had been stimulated with PBS as a negative control.
Basal expression levels for each gene are indicted by a dashed line. HPRT was used as a
housekeeping gene to normalize the data. Three independent experiments were carried out. B.
Expression levels of SOCS3 and TNFAIP6 mRNA were assessed. Experiments were
processed as described above. Three independent experiments were carried out. C. BMDC
stimulated for 8 h or 24 h with PBS (control), E. coli LPS or Brucella CβG were lysed and
protein purified. The expression of tsg-6 protein was assessed by western blot using 10 µg of
recombinant tsg-6 as a positive control. β-actin expression was used as control. At least 3
independent experiments were carried out and one representative is shown here.
Figure 3: Brucella CβG induces the recruitment of CD11b+, LyG6+, and Gr1+ cells at the site
on injection.
A. Mouse ears intradermally injected with PBS, E. coli LPS or Brucella CβG were recovered
at 48 h post-injection and stained for hematoxylin and eosin. B. Mouse ears injected with
PBS, E. coli LPS or Brucella CβG were recovered at 48 h post-injection, embedded in
tissueteck OCT compound and frozen in isopentan. 15 µm thick cryosections were then
stained with CD11b (blue), Gr1 (red), Ly6G (green) and DAPI (grey) before observation
under a Zeiss LSM 510. Bar: 0.25mm.
Figure 4: Brucella CβG induces a transient neutrophil recruitment at 12 h post-injection.
A. Cells were extracted from mouse ears at 2 h, 6 h, 12 h, 24 h and 48 h following injection
with PBS (white bars), E. coli LPS (black bars) or Brucella CβG (grey bars) (see figure 3) and
neutrophils were quantified by flow cytometry. Mean ± SD of 3 independent experiments is
represented here. B. Dot-plots of neutrophil recruitment to the ear at 12 h post-injection with
PBS, LPS or CβG. Cells were gated on CD45+, MHC II-, CD11b+, Ly6C+. Neutrophils
85
represented in blue population are negative for F4/80 and positive for Ly6G. C. Dot-plots of
neutrophil recruitment to the ear at 24 h post-injection with PBS, LPS or CβG. Cells were
gated on CD45+, MHC II-, CD11b+ and Ly6C+. Neutrophils (in blue) are negative for F4/80
and positive for Ly6G. Three independent experiments were carried out, and one
representative is shown here.
Figure 4: Brucella CβG induces a transient neutrophil recruitment at 12 h post-injection.
A. Cells were extracted from ears injected with PBS (white bars), E. coli LPS (black bars), or
Brucella CβG (grey bars) as shown in figure 3. Neutrophils were quantified by flow
cytometry at 2 h, 6 h, 12 h, 24 h and 48 h post-injection. Mean ± SD of 3 independent
experiments is represented here. B. Dot-plots of neutrophil recruitment into the ear at 12 h
PBS, LPS or CβG post-injection. Cells were gated onto CD45+, MHC II-, CD11b+, Ly6C+.
Neutrophils are the blue population negative for F4/80 and positive for Ly6G. C. Dot-plots of
neutrophil recruitment into the ear at 24 h PBS, LPS or CβG post-injection. Cells were gated
onto CD45+, MHC II-, CD11b+ and Ly6C+. Neutrophils are the blue population negative for
F4/80 and positive for Ly6G. Three independent experiments were carried out, and one
representative is shown here.
Table 1: 34 transcripts upregulated in CβG-stimulated DC versus LPS-stimulated DC
Fold change
Gene Symbol Gene Description Genbank number
16,2960457 DFNA5 deafness, autosomal dominant 5 NM_004403.2 14,0900781 CFB complement factor B NM_001710.4
13,60613 MAOA monoamine oxidase A, nuclear gene
encoding mitochondrial protein NM_000240.2
13,1097147 IL6 interleukin 6 NM_000600.1 12,580871 ITGA9 integrin, alpha 9 NM_002207.2
11,9337847 TNIP3 TNFAIP3 interacting protein 3 NM_024873.3 11,8534761 GJB2 gap junction protein, beta 2, 26kDa NM_004004.4
86
9,83164123 PTGS2 prostaglandin-endoperoxide synthase 2
(prostaglandin G/H synthase and cyclooxygenase)
NM_000963.1
9,7861406 BATF basic leucine zipper ion factor, ATF-like NM_006399.2 8,4711145 IL1F9 interleukin 1 family, member 9 NM_019618.2
8,45774549 IL2RA interleukin 2 receptor, alpha NM_000417.1 8,32768687 CXCR7 chemokine (C-X-C motif) receptor 7 NM_020311.2
8,239224 PLAT plasminogen activator, tissue NM_000930.2 8,18870443 ADARB1 adenosine deaminase, RNA-specific, B1 NM_001033049.1 7,96050487 CLGN calmegin NM_004362.1
6,77065691 KCNJ2 potassium inwardly-rectifying channel,
subfamily J, member 2 NM_000891.2
6,63411098 TNFAIP6 tumor necrosis factor, alpha-induced protein
6 NM_007115.2
6,56358736 HEY1 hairy/enhancer-of-split related with YRPW
motif 1 NM_001040708.1
6,22630244 PLAC8 placenta-specific 8 NM_016619.1 6,21326365 TFRC transferrin receptor (p90, CD71) NM_003234.1 5,7156289 UPB1 ureidopropionase, beta NM_016327.2 5,6420305 AQP9 aquaporin 9 NM_020980.2
5,63400352 ZP3 zona pellucida glycoprotein 3 (sperm
receptor) NM_007155.4
5,6153173 TNFRSF21 tumor necrosis factor receptor superfamily,
member 21 NM_014452.3
5,38003118 LILRA3 leukocyte immunoglobulin-like receptor,
subfamily A (without TM domain), member 3 NM_006865.2
5,29230455 ITM2C integral membrane protein 2C NM_001012516.1
5,22805328 SMPDL3A sphingomyelin phosphodiesterase, acid-like
3A NM_006714.2
5,16244294 RASGRP1 RAS guanyl releasing protein 1 (calcium and
DAG-regulated) NM_005739.2
5,0282775 CXCL2 chemokine (C-X-C motif) ligand 2 NM_002089.3
4,92399264 SLC11A1 solute carrier family 11 (proton-coupled
divalent metal ion transporters), member 1 NM_000578.3
4,89471027 TRAF3IP2 TRAF3 interacting protein 2 NM_147686.1 4,85717514 SOCS2 suppressor of cytokine signaling 2 NM_003877.3
4,84210367 PTX3 pentraxin-related gene, rapidly induced by
IL-1 beta NM_002852.2
4,50411755 ADAMDEC1 ADAM-like, decysin 1 NM_014479.2
Table 2: Primers used for qPCR experiments
Name Sens Sequence HPRT Forward 5'-3' AGCCCTCTGTGTGCTCAAGG HPRT Reverse 5'-3' CTGATAAAATCTACAGTCATAGGAATGGA Ptgs2 Forward 5'-3' ACCTCTGCGATGCTCTTCC
87
Ptgs2 Reverse 5'-3' TCATACATTCCCCACGGTTT SOCS3 Forward 5'-3' CCTTCAGCTCCAAAAGCGAGTAC SOCS3 Reverse 5'-3' GCTCTCCTGCAGCTTGCG CXCL2 Forward 5'-3' GCGGTCAAAAAGTTTGCCTTG CXCL2 Reverse 5'-3' CTCCTCCTTTCCAGGTCAGTT
KC Forward 5'-3' CAGCCACCCGCTCGCTTCTC KC Reverse 5'-3' TCAAGGCAAGCCTCGCGACCAT
tnfaip6 Forward 5'-3' TTCCATGTCTGTGCTGCTGGATGG tnfaip6 Reverse 5'-3' AGCCTGGATCATGTTCAAGGTCAAA
Figures
88
89
90
91
92
II. D. BTPB, UNE PROTEINE CAPABLE DE MODULER L’ACTIVATION
DES DC
II. D. 1. Introduction
Nous avons décrit précédemment dans le laboratoire une protéine de Brucella, BtpA, qui est
capable d’interférer avec les voies de signalisation en aval des TLR et de moduler l’activation
des DC. BtpA pourrait interagir avec des molécules adaptatrices de TLR comme TIRAP ou
MyD88 pour inhiber la réponse TLR [133, 134]. De plus, cette protéine pourrait jouer un rôle
dans la régulation de la réponse adaptative en jouant sur les LT CD8+.
Ces dernières années, de nombreuses études ont montré que les protéines bactériennes à
domaines TIR existent chez Salmonella, TlpA [221], un homologue à TlpA est PdTlp chez
Paracoccus denitrificans [222], chez E. coli TcpC [132] ou encore chez Yersinia pestis
YpTdp [223]. Certaines de ces protéines ont été montrées comme interagissant avec des
acteurs majeurs des voies de signalisation des TLR comme MyD88, TLR4 ou encore NF-κB
[221, 222].
Cependant, il n’est pas exclu que ces protéines à domaine TIR puissent jouer d’autres rôles au
sein des cellules que la régulation et le contrôle d’une partie du système immunitaire.
Ici, nous décrivons une seconde protéine de Brucella, BtpB, possédant aussi un domaine TIR.
Nous avons cherché à caractériser le rôle de cette nouvelle protéine dans la réponse
immunitaire à l’infection ainsi que dans la régulation de l’inflammation.
93
II. D. 2. Article
ORIGINAL RESEARCH ARTICLEpublished: 08 July 2013
doi: 10.3389/fcimb.2013.00028
BtpB, a novel Brucella TIR-containing effector protein withimmune modulatory functions
Suzana P. Salcedo1,2,3,4†, María I. Marchesini 5†, Clara Degos1,2,3, Matthieu Terwagne6,Kristine Von Bargen 1,2,3, Hubert Lepidi7, Claudia K. Herrmann5, Thais L. Santos Lacerda1,2,3,4,Paul R. C. Imbert 4, Philippe Pierre 1,2,3, Lena Alexopoulou1,2,3, Jean-Jacques Letesson6,Diego J. Comerci 5 and Jean-Pierre Gorvel 1,2,3*
1 Aix-Marseille Univ UM 2, Centre d’Immunologie de Marseille-Luminy, Marseille, France2 INSERM U 1104, Marseille, France3 CNRS UMR 7280, Marseille, France4 Bases Moléculaires et Structurales des Systèmes Infectieux, CNRS UMR 5086, Institute of Biology and Chemistry of Proteins, Université Lyon 1, Lyon, France5 Instituto de Investigaciones Biotecnológicas Dr. Rodolfo A. Ugalde (IIB-INTECH), Universidad Nacional de San Martín, Consejo Nacional de Investigaciones
Científicas y Técnicas, San Martín, Buenos Aires, Argentina6 URBM, NARILIS, University of Namur (FUNDP), Namur, Belgium7 Laboratoire d’anatomie pathologique-neuropathologique, Aix-Marseille Université, Marseille, France
Edited by:
Rey Carabeo, University of
Aberdeen, UK
Reviewed by:
Jean Celli, NIAID, NIH, USA
Renee M. Tsolis, University of
California-Davis, USA
Nelson Gekara, Umea University,
Sweden
*Correspondence:
Jean-Pierre Gorvel, Centre
d’Immunologie de Marseille-Luminy,
Parc Scientifique et Technologique
de Luminy, Case 906, 13288
Marseille Cedex 09, France
e-mail: gorvel@ciml.univ-mrs.fr
†Joint-first authors.
Several bacterial pathogens have TIR domain-containing proteins that contribute to their
pathogenesis. We identified a second TIR-containing protein in Brucella spp. that we have
designated BtpB. We show it is a potent inhibitor of TLR signaling, probably via MyD88.
BtpB is a novel Brucella effector that is translocated into host cells and interferes with
activation of dendritic cells. In vivo mouse studies revealed that BtpB is contributing to
virulence and control of local inflammatory responses with relevance in the establishment
of chronic brucellosis. Together, our results show that BtpB is a novel Brucella effector that
plays a major role in the modulation of host innate immune response during infection.
Keywords: Brucella, TIR domain, Btp1/BtpA, TLR, DC, NF-κB
INTRODUCTIONInnate immune recognition of microbial components is critical
for the onset of an appropriate immune response against invad-
ing pathogens. Key contributors include the toll-like receptor
(TLR)/IL-1R superfamily characterized by the presence of a con-
served region designated TIR domain located in the cytosolic part
of each TLR. The TIR domain is critical for protein-protein inter-
actions between TLRs with the corresponding TIR-containing
adaptors, which couple downstream protein kinases. This signal-
ing cascade ultimately leads to activation of specific transcription
factors such as nuclear factor-κB (NF-κB) and production of
inflammatory mediators. Although a variety of TLR receptors
have been described, in humans the most relevant for recognition
of bacterial molecules are TLR2, TLR4, TLR5, and TLR9.
In addition to TLRs and their adaptors, TIR domains are
present in plant resistance proteins that mediate hypersensi-
tive responses to pathogens, as well as in a variety of bac-
teria, including species present in the human gut microbiota,
soil bacteria and human pathogens (Spear et al., 2009; Zhang
et al., 2011). Their evolutionary history is complex and their
role in interaction with eukaryotic hosts remains mostly unchar-
acterized. Nevertheless, in a number of bacterial pathogens,
bacterial TIR-containing proteins have been implicated in viru-
lence or control of cellular responses. Salmonella enterica serovar
Enteritidis TlpA is capable of reducing NF-κB activation by TLR4,
IL-1R and MyD88-dependent pathways and to contribute to con-
trol of IL-1β secretion during infection (Newman et al., 2006).
In the case of uropathogenic E. coli CFT073, the TIR-containing
protein TcpC is able to interfere with TLR4 and TLR2 signal-
ing by targeting MyD88 (Cirl et al., 2008) but also to inhibit
TRIF- and IL-6/IL-1 dependent pathways (Yadav et al., 2010).
During infection, TcpC is implicated in the control of secre-
tion of TNF-α and IL-6 and tcpC mutants show a defect in
intracellular replication in a mouse model of pyelonephritis.
The Yersinia pestis TIR-containing protein YpTdp interacts with
MyD88 to reduce IL-1β- and LPS-dependent signaling and to
contribute to modulation of cytokine secretion during infection
(Spear et al., 2012).
In the case of Brucella spp. two groups independently reported
on the role of a TIR domain containing protein in control of TLR
signaling (Cirl et al., 2008; Salcedo et al., 2008). Naming of this
protein as Btp1 or TcpB, respectively, by two distinct laboratories
has led to some confusion in the literature and has been misinter-
preted by some as two independent proteins. Since neither Btp1
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 1
CELLULAR AND INFECTION MICROBIOLOGY
Salcedo et al. Brucella TIR protein B
nor TcpB conforms to the international guidelines for bacterial
nomenclature we will hereafter designate Btp1/TcpB as BtpA.
BtpA is present in B. abortus 2308 (BAB1_0279), B. abortus
9-941 (BruAb1_0274) and B. melitensis 16 M (BMEI1674) but
is absent from B. suis 1330. Cirl et al. described that ectopically
expressed BtpA cloned from B. melitensis 16 M is able to inter-
fere with TLR4 and TLR2 signaling by directly interacting with
MyD88. Several reports have proposed that BtpA targets the adap-
tor protein MAL/TIRAP (Radhakrishnan et al., 2009; Sengupta
et al., 2010). Direct comparison of the in vitro interaction between
BtpA and either MyD88 or TIRAP shows a stronger interaction
with MyD88 (Chaudhary et al., 2011). BtpA has been shown to
bind phosphoinositides at the plasma membrane (Radhakrishnan
et al., 2009) but also to induce ubiquitination of TIRAP (Sengupta
et al., 2010). In accordance to its modulation of TLR function,
previous work from our laboratory described the role of the BtpA
from B. abortus in the control of dendritic cell (DC) activation
during infection (Salcedo et al., 2008). Purified BtpA was also
shown to inhibit CD8+ T cell-mediated killing suggesting it may
also control adaptive immune responses (Durward et al., 2012).
Here we present a novel Brucella effector with a TIR domain
that we designated as BtpB. We show that BtpB efficiently
inhibits TLR signaling and contributes to control of DC activa-
tion. Together, Brucella TIR-containing proteins BtpA and BtpB
modulate host inflammatory responses during infection.
RESULTS
IDENTIFICATION OF A SECOND Brucella TIR DOMAIN-CONTAINING
PROTEIN
Analysis of the Brucella genome revealed the presence of a second
TIR domain-containing protein (BAB1_0756) that we have des-
ignated BtpB (Figure 1A). We choose to continue with the Btp
nomenclature to avoid any confusion with the tcpB gene neces-
sary for conjugative transfer in Clostridium perfringens (Parsons
et al., 2007). Search for conserved domains in BtpB revealed the
presence of a C terminal TIR domain (aa 144-256) that belongs
to the Pfam family TIR_2 (E value 1.9 e−11), a family of bac-
terial Toll-like receptors. TIR domains share conserved motifs
called box 1 (F/Y-DAFISY), box2 (GYKLC-RD-PG) and box 3 (W
residue surrounded by basic amino acids). Sequence comparison
of BtpB TIR domain with the human TIR-containing proteins
MAL, MyD88, TLR2 and TLR4 showed sequence similarity and
conservation of box 1, essential for signaling (Rana et al., 2013)
(Figure 1A).
Unlike BtpA, BtpB is present in all sequenced Brucella
strains, including B. suis 1330 (BR0735), B. abortus 2308
(BAB1_0756), B. abortus 9-941 (BruAb1_0752) and B. meliten-
sis 16 M (BME1216). Alignment of the btpB sequences derived
from different Brucella strains revealed 4 different annotations
for the start codon (highlighted in red in Figure 1B). Analysis of
the −18 to +18 nucleotides around the ATG/GTG (Kolaskar and
Reddy, 1985) predicted as the most likely start codon the second
methionine highlighted in Figure 1B. This open reading frame
has been annotated for B. abortus 9-941 and encodes a 292 amino
acid protein, BtpB (1-292). The additional annotated start codons
include the first highlighted methionine, the valine (GTG) and
the B. melitensis methionine resulting in proteins of either 325,
277 or 178 amino acids. None of them scored high enough to
be considered as likely start codons. Comparison of all Brucella
sequences available revealed only one BtpB (1-178), in B. meliten-
sis 16 M, whereas the majority correspond to BtpB (1-292). In
consequence, we decided to use in this study the BtpB (1-292).
We first investigated the ability of BtpB to interfere with TLR
signaling using an in vitro NF-κB-dependent luciferase reporter
system. BtpB was able to inhibit TLR2, TLR4 and TLR9 signal-
ing (Figure 2A) even more efficiently than BtpA (Salcedo et al.,
2008). This inhibition was independent on the first 114 amino
acids as both BtpB (1-178) (Figure 2A), as well as, BtpB (1-292)
(Figure 2B) strongly inhibited TLR signaling. BtpB was also able
to inhibit flagellin-induced TLR5 signaling (Figure 2B). These
results suggest that BtpB may interfere with a common molecule
of these TLR pathways, such as MyD88. Consistently, BtpB did
not reduce TLR3-dependent signaling which does not involve the
adaptor MyD88 (Figure 2C). In addition, we observed by directed
yeast two-hybrid that BtpB was able to interact with MyD88
(Figure 2D). BtpA was also able to interact with MyD88 by
yeast-two hybrid as previously shown by pull-down and protein-
fragment complementation assays (Cirl et al., 2008; Chaudhary
et al., 2011). Neither BtpA nor BtpB interacted with any of the
TLR1 to TLR10 TIR domains nor with the adaptors TIRAP or
TRAM. As BtpA was previously shown to reduce TLR2 and TLR4
signaling but not TLR9 (Cirl et al., 2008; Salcedo et al., 2008)
we investigated its ability to interfere with TLR5, which is also
dependent on MyD88. BtpA was able to significantly reduce TLR5
signaling, following stimulation with S. typhimurium flagellin
(Figure 2E).
Overall, our results show that BtpB is a potent inhibitor of TLR
signaling in vitro, which may result from binding to MyD88.
BtpB IS TRANSLOCATED INTO HOST CELLS
In order for BtpA and BtpB to target TLR pathways they would
have to be exported across the bacterial membranes and the vac-
uolar membrane into the host cell cytosol. To test this hypothesis
we analysed the translocation of BtpA and BtpB fused at their N-
terminus with the TEM-1 β-lactamase during infection of RAW
macrophage-like cells. This method has been successfully used to
establish translocation of several Brucella effectors, namely VceA,
VceC and RicA (de Jong et al., 2008; de Barsy et al., 2011) and
is traditionally carried out in live cells. RAW cells were used in
order to achieve high rates of infection. VceC and VceA were
included as positive controls. We could detect BtpA translocation
into host cells at 4 h and 24 h after inoculation (Figures 3A,B).
Translocated BtpB was detected in less than 0.5% of infected cells
at 4 h and did not significantly increase at 24 h. In an attempt to
try to enhance the sensitivity of this assay, we carried out the same
experiments in fixed samples with observation of FRET within
15 min of fixation, which enhances the shift to 450 nm (Nothelfer
et al., 2011). As in live cells, BtpA and to a lower extent BtpB were
translocated into host cells at 24 h after infection (Figures 3C,D).
Since the overall percentage of cells showing translocated effectors
is very low with this assay, even following fixation, we analysed
translocation of BtpA and BtpB fused to the adenylate cyclase
CyaA (Figure 3E). In addition, we used a constitutive promoter of
B. abortus bcsp31 gene to enhance expression, since this alternative
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 2
Salcedo et al. Brucella TIR protein B
FIGURE 1 | Identification of BtpB. (A) Identification of BtpB as bacterial
member of TLR/IL-1R (TIR) family. Comparison of the predicted amino acid
sequences of the TIR domain of BtpB with BtpA and the human members of
the TIR family: MAL, MyD88, TLR2 and TLR4. The alignment was
constructed with T-Coffee::advanced server from EMBnet
(http://www.ch.embnet.org) and coloring scheme corresponds to standard
ClustalX in which each residue in the alignment is assigned a color if the
amino acid profile at each position meets a minimum criteria specific for the
residue type. Box 1 corresponds to the signature sequence of the TLR family.
(B) Alignment of BtpB amino acid sequences for B. abortus 2308
(BAB1_0756), B. suis 1330 (BR0735), B. abortus 9-941 (BruAb1_0752) and
B. melitensis 16M (BME1216). The annotated starting codons
(Methionine/Valine) are highlighted in red. Amino acid differences are shaded
in red.
approach was successfully used with the Brucella effector protein
BPE123 (Marchesini et al., 2011), which was included as a positive
control in our experiments. In this system, any value of cAMP bel-
low 1500–2000 fmol/ml corresponds to background (dotted line
in Figure 3E) and is not indicative of translocation as determined
after performing an exhaustive screening for the identification
of Brucella abortus type IV secretion system (T4SS) substrates
(Marchesini et al., 2011). We found that at 4 h after infection both
BtpA and BtpB were translocated into J774.A1 macrophage-like
cells (Figure 3E). Interestingly, translocation of BtpA fused with
the CyaA seems to depend on the position of the tag as only BtpA
with C-terminal CyaA was efficiently translocated into host cells
at early stages of the infection. In contrast, for BtpB, the pres-
ence of the CyaA tag on the C-terminus reduced translocation
(Figure 3E).
To determine if the translocation of BtpA and BtpB was depen-
dent on the Brucella VirB T4SS, cells were infected with the
virB mutant carrying either TEM- or CyaA-fused Btp proteins.
We could not detect any differences between wild type and virB
mutant using the TEM-1 β-lactamase assay (Figures 3A–D). In
sharp contrast, translocation of BtpA-CyaA and CyaA-BtpB was
clearly reduced in a virB genetic background, indicating that
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 3
Salcedo et al. Brucella TIR protein B
FIGURE 2 | BtpB interferes with TLR signaling. (A) HEK293 cells were
transiently transfected for 24 h with the luciferase reporter vector and either
TLR2, TLR4 and TLR9, in the presence or the absence of the 178 amino acid
BtpB (50 ng). Cells were then stimulated with the appropriate ligand (PAM,
LPS and CpG) for 6 h before measurement of luciferase activity. White bars
correspond to negative control, black bars to cells stimulated with the
appropriate ligand and grey bars to cells transfected with BtpB and
stimulated with the ligand. Data represent the means ± standard errors of
relative luciferase activity obtained from triplicates of a representative
experiment. (B) Luciferase activity in the presence or absence of the BtpB
(1-292) (red bars). TLR5 was also included and stimulated with Flagellin from
S. typhimurium (Fl-ST) and (C) TLR3 following stimulation with poly(I:C).
(D) Yeast containing Gal4 BD- and Gal4 AD-fusion proteins were selected on
synthetic medium lacking leucine (Leu) and tryptophan (Trp) (left panel).
Protein interactions were identified on synthetic medium lacking histidine
(His) and supplemented with 20 mM 3AT (middle panel). Growth on this
medium indicates interaction between fusion proteins. The blue yeast
colonies observed in the β-galactosidase expression filter assay indicate
interaction between the fusion proteins (right panel). BD and AD indicate
empty vectors and were used as negative controls, while MyD88
homodimerization was used as positive control. (E) Luciferase activity in cells
transfected with TLR5 in the absence or presence of 100 ng and 50 ng of
BtpA (275 aa). P ≤ 0.001 are denoted with ∗∗∗; P ≤ 0.01 are denoted with ∗∗
and P between 0.01 and 0.05 are denoted with ∗ .
delivery of both proteins is dependent on the T4SS. We con-
clude that BtpA and BtpB are translocated into host cells and may
constitute substrates for the VirB T4SS.
BtpB REPLICATION WITHIN MURINE BONE MARROW-DERIVED DCs
To determine the role of BtpB during infection we infected
murine bone marrow-derived DCs with wild type Brucella, as well
as, with a btpA, btpB or btpAbtpB mutant strains. No attenuation
was observed as the btpAbtpB replicated to equivalent levels of the
wild type B. abortus strain (Figure 4A). The survival curves for
the single mutants overlap with that of the wild type (Figure 4A,
right panel).
As previously described for BtpA, murine DCs infected with
the btpB mutant showed higher level of MHC class II surface
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 4
Salcedo et al. Brucella TIR protein B
FIGURE 3 | BtpB is translocated into host cells during infection. (A) RAW
macrophages were infected with wild type (wt) or �virB9 B. abortus strains
carrying N-terminal TEM-1 fused VceA, VceC, BtpA, and BtpB for 4 h and
24 h. Data represents the means ± standard errors of the percentage of cells
with coumarin fluorescence from 5 independent experiments.
(B) Representative confocal images of RAW cells infected with either
wilt-type B. abortus (wt) or �virB9 mutant carrying TEM-fused BtpA, at 24 h
after inoculation. Appearance of blue cells is indicative of translocated TEM
lactamase. (C) and (D) Analysis of TEM-1 translocation assay for fixed
samples of VceA, VceC, BtpA, and BtpB 24 h after infection. (E) Intracellular
cAMP levels in J774.A1 cells infected for 4 h with isogenic strains with a
functional (wt) or non-functional VirB system (virB10) expressing Btp proteins
fused to CyaA. Non-infected cells and a wild type strain expressing the CyaA
domain alone (pCyaA) were included as negative controls. A wild type strain
expressing BPE123-CyaA was included as a positive control. Means and SD
are shown for one representative out of three independent experiments.
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 5
Salcedo et al. Brucella TIR protein B
FIGURE 4 | Role of BtpB in control of DC activation. (A) BMDCs
infected with wild type B. abortus or the btpAbtpB mutant (left panel) and
the single mutants (right panel) were lysed and intracellular CFUs
enumerated at different times after inoculation. (B) Representative images
of BMDCs infected with either the wild type, btpB or btpAbtpB mutants
for 24 h. Cells were labeled for MHC class II (red) and surface expression
is of a representative area is shown in zoom inlets. (C) Quantification of
the percentage of DCs containing DALIS after 24 h of infection with wild
type B. abortus (wt), btpB− or btpAbtpB mutant. (D) Flow cytometry of
the surface expression of MHC class II, CD40, CD80 and CD86 at 24 h
post-infection. Data are normalized to wt values. (E) Analysis of TNF-α and
(F) IL-12 (p40/p70) secretion measured by ELISA from the supernatant of
DCs 24 h after inoculation. All the results correspond to the means ±
standard errors of 4 independent experiments. P ≤ 0.001 are denoted with∗∗∗; P ≤ 0.01 are denoted with ∗∗ and P between 0.01 and 0.05 are
denoted with ∗ .
expression and higher percentage of formation of aggresome-
like induced structures (DALIS) that transiently appear during
the process of activation of these immune cells (Figures 4B,C)
(Lelouard et al., 2002). However, there was no additive effect of
depletion of both btpA and btpB as the btpAbtpB mutant did not
show an increased phenotype compared to single mutant.
Flow cytometry analysis of infected cells did not reveal a sta-
tistically significant increase in CD40, CD80 and CD86 surface
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 6
Salcedo et al. Brucella TIR protein B
expression in DCs infected with btpB mutant when compared
to the wild type at 8 h post-infection. At 24 h post-infection
there was a significant increase in MHC class II surface expres-
sion in DCs infected with btpB mutant relative to those infected
with the wild type (Figure 4D, white bars) consistent with our
microscopy observations (Figure 4B). In the case of DCs infected
with btpAbtpB mutant, CD40 and CD80 co-stimulation markers
were up-regulated (Figure 4D, black bars).
In terms of cytokine secretion, BtpB did not seem to be
involved in the control of TNF-α secretion during infection
of murine DCs (Figure 4E). The increase in TNF-α secretion
observed for btpAbtpB is probably due to a lack of BtpA, pre-
viously shown to be involved in the control of secretion of this
cytokine (Salcedo et al., 2008). However, an increase in the level
of total IL-12 (p40/p70) secreted during infection was observed in
the case of the btpB mutant compared to the wild type 24 h after
infection (Figure 4F). The difference between btpB and btpAbtpB
mutants is not significant. These results suggest that BtpB is
contributing to the control of the inflammatory response induced
in infected DCs in vitro.
BtpB CONTROLS NF-κB TRANSLOCATION IN DCs
In order to analyse the effect of the BtpB effector on the early
stages of DC activation, translocation of NF-κB was monitored by
immunofluorescence microscopy during the course of the infec-
tion. As early as 2 h post-infection, bone marrow-derived DCs
infected with the btpB mutant showed an increased translocation
of NF-κB into the nucleus compared to those infected with wild
type B. abortus (Figure 5). The btpB mutant phenotype was res-
cued by expression of BtpB from a plasmid confirming the role of
BtpB in the control of NF-κB translocation into the nucleus.
These results confirm that BtpB has an effect on the induction
of inflammatory responses during Brucella infection.
ROLE OF BtpB IN THE MOUSE MODEL OF BRUCELLOSIS
To further investigate the role of BtpB during infection we carried
out in vivo studies. BtpA B. melitensis mutants were previously
shown to have enhanced survival in immuno-compromised
Interferon Regulatory Factor-1 (IRF-1)−/− mice (Radhakrishnan
et al., 2009) inoculated intra-peritoneally (i.p.), a lethality model
that has been used for studying Brucella virulence (Ko et al.,
FIGURE 5 | Modulation of NF-κB translocation to the nucleus during
Brucella infection. Bone marrow-derived DCs were infected with wild
type (wt) B. abortus, btpA, btpB and btpAbtpB mutants as well as
btpB mutant carrying the complementing plasmid (pbtpB) for 2 h and
processed for immunofluorescence confocal microscopy. Cells were
labeled for CD11c (cyan) and p65 NF-κB (red). Bacteria were labeled
with anti-LPS antibody followed by FITC secondary and nuclei with
TOPRO3. Salmonella infected cells were used as a positive control. (A)
Data corresponds to means ± standard errors of 4 independent
experiments. (B) Representative images obtained by confocal
microscopy are shown for DCs infected with wild type, btpB mutant,
btpBpbtpB complemented strain and btpAbtpB mutant. Scale bars
correspond to 5 µm. P ≤ 0.001 are denoted with ∗∗∗; P ≤ 0.01 are
denoted with ∗∗ and P between 0.01 and 0.05 are denoted with ∗.
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 7
Salcedo et al. Brucella TIR protein B
2002). We therefore, inoculated IRF−/− i.p. with either btpA, btpB
or btpAbtpB B. abortus mutants. Although the btpB mutant had
no defect in intracellular replication in cultured cells in vitro,
it showed an attenuation phenotype in IRF-1−/− mice. Mice
infected with the btpB mutant survived longer than those infected
with the wild type B. abortus and synergistic effect was observed
for the double btpAbtpB mutant (Figure 6A, P < 0.005), despite
equivalent bacterial CFU counts in the spleen at each sampling
date after infection (median of 1.05 × 108 CFU/spleen for wild
type versus 6.5 × 107 CFU/spleen for the btpAbtpB mutant). To
better study the role of BtpB in brucellosis in vivo, we inocu-
lated wild type BALB/c mice i.p. and enumerated the bacterial
load at 30, 60, 90, and 130 days post-infection. No signifi-
cant differences in bacterial CFU counts between the wild type
Brucella and the btp mutants were observed at different stages
of the infection (30, 60, 90, and 130 days). Data at 60 days
post-infection is shown as an example (Figure 6B). We then
performed histological examination of spleens obtained from
wild type BALB/c mice infected with the btpA, btpB, btpAbtpB
mutants or the wild type B. abortus strains to quantify granu-
loma formation, which usually reflects the host’s ability to develop
a protective immune response. No granuloma was seen in the
spleen of non-infected mice. In infected mice, granulomas were
detected in splenic red pulp. A significantly higher number of
granulomas was observed following btpB and btpAbtpB infection
(after 60 days) compared to the wild type Brucella (Figure 6C).
Inflammatory granulomas showed a similar organization in
all populations of infected mice and were composed mainly
of macrophages and a few lymphocytes (Figure 6D). Bacteria
were detected by immunohistochemistry in the spleen of mice
infected with wild type B. abortus or with the btpAbtpB mutant
(Figure 6E). They were seen as coarse granular immune-positive
FIGURE 6 | Role of BtpB during Brucella infection in the mouse model
of brucellosis. (A) Susceptibility of IRF-1−/− to B. abortus 2308 (wt),
btpA−, btpB− and btpAbtpB mutant (n = 9 per group). Infected mice were
monitored daily for survival. Mice infected with btpB and tpAbtpB−
survived longer than wild type Brucella infected mice (P = 0.0433 and
P = 0.0152, respectively). (B) Persistence of B. abortus 2308 (wt), btpA,
btpB or btpAbtpB mutants in spleens of wild type BALB/c infected mice at
60 days p.i. Each symbol represents an animal and the median values are
marked by horizontal bold lines. (C) Analysis of granuloma formation in the
spleens of wild type BALB/c mice infected for 60 days with wild type
B. abortus, btpA, btpB or btpAbtpB mutants. Data represent means ±
standard deviations of 4 or 5 mice. (D) Representative image from the
spleen of a mouse infected with btpAbtpB mutant (hematoxylin-eosin,
original magnification ×400). (E) Bacteria were revealed by immunostaining
in the spleen of wild type BALB/c mice infected by btpAbtpB mutant of
B. abortus. Macrophages present in inflammatory granulomas in the red
pulp are packed with coarse immunopositive material (hemalun
counterstain, original magnification ×400). P ≤ 0.01 are denoted with ∗∗.
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 8
Salcedo et al. Brucella TIR protein B
material associated with cells, which had the morphology of
macrophages.
These results are consistent with a role for BtpB in the control
of inflammatory response during Brucella infection in vivo.
DISCUSSION
Previous work from our laboratory demonstrated a role for BtpA
in control of DC activation. Here we show that Brucella contains
a second TIR-domain protein called BtpB that is translocated into
host cells and which participates in the control of the inflamma-
tory response during Brucella infection. In vitro, BtpB is a potent
inhibitor of TLR2, TLR4, TLR5 and TLR9. Together with BtpA,
BtpB contributes to the control of DC activation during infection.
Using the TEM-1 lactamase and CyaA assays we were able
to detect BtpA and BtpB translocated into the cytosol as early
as 4 h after infection of RAW and J774 macrophages. This is an
essential step to enable BtpA and BtpB to cross the bacterial and
vacuolar membranes to reach their host cellular targets during
infection. It would be interesting to localize the translocated pro-
teins during infection. We have not been able to detect neither
2HA- nor 3FLAG-tagged BtpA and BtpB by immunofluores-
cence microscopy. It is possible that the amounts of translocated
BtpA and BtpB are too low or perhaps these proteins are quickly
degraded once they reach the host cytosol. It is important to note
that using the TEM-1 lactamase assay alone we were unable to
detect translocation of BtpB and any differences between wild
type and virB mutant in BtpA translocation. It is possible that
the low sensitivity of the TEM-1 lactamase compared to the
CyaA assay makes this methodology inappropriate to assess VirB
dependency in the case of effectors translocated at low levels. We
conclude from our results that BtpA and BtpB are likely substrates
of the VirB T4SS.
In this study, we found that B. abortus lacking btpA and
btpAbtpB mutants showed an increased survival time in the IRF-1−/− mouse model, highlighting the importance of these TIR-
containing proteins in virulence. Similar results were obtained for
B. melitensis lacking BtpA, which is defective in systemic spread at
early stages of infection (Radhakrishnan et al., 2009). However,
the use of such a severely immune-compromised mouse model
hampers detailed analysis of the role of these proteins in control
of inflammatory responses during infection. Therefore, we pro-
ceeded with our in vivo studies using immune-competent mice.
We found that absence of BtpA and/or BtpB leads to increased
granuloma formation in wild type mice, probably restricting
bacterial dissemination as a consequence of the inability of the
mutants to modulate the inflammatory response.
Infection of DCs with B. abortus lacking BtpB revealed that
this effector protein is contributing to the modulation of the
inflammatory response during infection. Interestingly, significant
differences were observed between BtpA and BtpB. For exam-
ple, BtpA had an impact on TNF-α secretion (Salcedo et al.,
2008) but not BtpB, which affected surface expression of MHC
class II and co-stimulatory molecules that we had not previ-
ously seen with BtpA. These differences may be due to different
kinetics of translocation and time of action of each effector or
perhaps the kinetics of the cellular processes affected. These dif-
ferences could also be explained by specific targeting of host
pathways. Interestingly, translocation of VceC results in enhanced
pro-inflammatory responses as a result of the induction of the
unfolded protein response by this T4SS effector (de Jong et al.,
2012). This suggests that VirB effectors can have opposing effects,
resulting in either activation of host immune responses or spe-
cific inhibition of inflammatory pathways. These differences may
represent host cell or tissue specificity or simply reflect different
stages of disease. It is now crucial to undertake a more global anal-
ysis of the specific contribution of these effectors during infection
and a better characterization of host immune responses elicited in
vivo. It is also possible that some of the phenotypes observed with
effectors are simply an indirect or secondary effect of their action
on eukaryotic cells during infection. Defining at the molecular
level the effector cellular targets and analysing their contribution
during infection will hopefully shed some light on these issues.
The host interacting partner of BtpA remains controversial.
BtpA has been shown to induce degradation of phosphory-
lated TIRAP by enhancing its poly-ubiquitination (Sengupta
et al., 2010) and to efficiently block TIRAP-induced NF-κB
activation (Radhakrishnan et al., 2009). Together, these studies
present TIRAP as the main target of BtpA whereas other groups
have shown a direct interaction with MyD88 (Cirl et al., 2008;
Chaudhary et al., 2011). Although comparison of the ability of
BtpA to interact with TIRAP and MyD88 revealed a stronger
binding to MyD88 (Chaudhary et al., 2011), surprisingly this
interaction was dependent on the Death Domain of MyD88 and
not the TIR domain. By yeast-two hybrid we found that both
BtpA and BtpB can interact with MyD88. In the case of BtpB
this result could explain its ability to block TLRs that are depen-
dent on MyD88 signaling but not TLR3, which is dependent on
the adaptor TRIF. Although inhibition of TLR2 and TLR4 by
BtpA has been described, we did not detect any inhibition of
TLR9 (Salcedo et al., 2008), which would be expected if BtpA
was blocking MyD88. It is possible that inhibition of TLR9 by
BtpA requires higher levels of expression of BtpA and could not be
detected with our assay. Consistently, BtpA interfered with TLR5
signaling which is dependent on MyD88. Further work is now
required to understand the molecular mechanism by which BtpA
controls TLR activation, which may involve interaction and/or
competition with both MyD88 and TIRAP.
In addition to control of inflammatory responses, BtpA has
been shown to interact with phosphoinositides at the plasma
membrane and modulate microtubule dynamics (Radhakrishnan
et al., 2009, 2011). Ectopically expressed BtpA localizes to micro-
tubules. These could constitute important activities that may also
have a consequence on control of the inflammatory response,
for example by misplacing specific adaptor molecules within the
cell. In addition, these data indicate that BtpA may have addi-
tional eukaryotic targets yet to be identified. It will be interesting
to evaluate during infection the contribution of these different
functions of BtpA described in vitro and determine if they are
dependent on the TIR domain or if other domains are con-
tributing to assigning multiple functions to this effector. Our
results strongly implicate BtpB in the control of host inflamma-
tory responses during Brucella infection. However, it is possible
BtpB has additional functions as it has been described for BtpA.
We are currently determining if multiple pathways are targeted by
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 9
Salcedo et al. Brucella TIR protein B
BtpB to better understand the role of this novel effector during
Brucella infection.
MATERIALS AND METHODS
BACTERIAL STRAINS
The bacterial strains used in this study were S. enterica serovar
Typhimurium strain 12023, smooth virulent B. abortus strain
2308 (Pizarro-Cerdá et al., 1998) and the isogenic mutants virB9−
(Celli et al., 2005), virB10− (Sieira et al., 2000), btpA− (Salcedo
et al., 2008), btpB− (this study) and btpA− btpB− (this study). In
the case of Brucella, green fluorescent protein (GFP)-expressing
derivatives contain a pBBR1MCS-2 (Kovach et al., 1995) deriva-
tive expressing the gfp-mut3 gene under the control of the lac
promoter. Brucella strains were grown in tryptic soy broth (TSB;
Sigma-Aldrich) and Salmonella in Luria Bertani (LB) medium.
For infection, we inoculated 2 ml of media for 16 h at 37◦C up
to an optical density (OD600 nm) of approximately 2.0 (Celli et al.,
2003). Salmonella strains were cultured 16 h at 37◦C with aeration
to obtain stationary phase cultures.
CONSTRUCTION OF btpB AND btpAbtpB MUTANTS
The btpB gene (BAB1_0756) was amplified from B. abortus
genomic DNA using primers 5’-acgcgacctttccggctccctt-3′ and
5′-ttcggctagacaggaatgcatg-3′ and ligated to pGem-T-Easy vector
(Promega) to generate pGem-TbtpB. The plasmid was linearized
with EcoRV. Linearized pGem-btpB was ligated to a fragment
containing a kanamycin resistance cassette to generate pGem-
TbtpB::Kan. This plasmid was electroporated into B. abortus 2308
where it is incapable of autonomous replication. Homologous
recombination events were selected using kanamycin resistance
(50 µg/ml) and carbenicillin sensitivity (50 µg/ml) in tryptic soy
agar plates. PCR and sequencing analyses showed that the btpB
wild type gene was replaced by the disrupted one. The mutant
strain obtained was called btpB−. btpAbtpB− double mutant was
obtained after electropration of pGem-TbtpB::Kan into btpA−
mutant (Salcedo et al., 2008). Homologous recombination events
were selected as previously described for btpB−single mutant.
PCR and sequencing analyses confirmed that btpA and btpB wild
type genes were replaced by the disrupted ones in the double
mutant strain.
CONSTRUCTION OF THE btpB COMPLEMENTED STRAIN
A DNA fragment coding for BtpB (325 aa) was amplified by
PCR using primers 5′-atggatccgtggcgaatgaaccaatccgc-3′ and 5′-
gcactagtctaggtgatgagggcgacgcg-3′ . The PCR product was inserted
by the flanking BamHI/SpeI sites (underlined) in the correspond-
ing sites of pBBR1 MCS-4 (Kovach et al., 1995). The integrity of
the construct was confirmed by sequence analysis. The plasmid
was introduced into btpB− mutant by biparental mating.
CONSTRUCTION OF TEM-1 AND CyaA FUSIONS
DNA fragments coding for VceC, VceA, BtpA (1-275), and
BtpB (1-292) were amplified by PCR, digested with XbaI
and PstI and cloned into pFlagTEM1 (Raffatellu et al., 2005).
Primers sequences with XbaI and PstI sites (underlined)
are: VceC-Fw: 5′-tcctctagagaacgttcagagcgtccagaa-3′ ; VceC-Rv:
5′-aaactgcagctaattgcgggtttctcccttg-3′ ; VceA-Fw: 5′-tcctctagaaaaat
catcatcacggcagca-3′; VceA-Rv: 5′-aaactgcagctagttcttgggcgcgtggcc-
3′; BtpA-Fw: 5′- tcctctagaagttcgtactcttctaatatt-3′ ; BtpA-Rv: 5′-
aaactgcagtcagataagggaatgcagttc-3′ ; BtpB-Fw: 5′- tcctctagatacaa
tttatttgtttcgggc-3′ ; BtpB-Rv: 5′- aaactgcagctaggtgatgagggcgacgcg-
3′. The integrity of all constructs was confirmed by sequence
analysis. Plasmids were introduced into B. abortus 2308 or
�virB9/virB9− by electroporation. pFlagTEM1 encodes a copy of
TEM1 β-lactamase, in which the Sec-dependent signal sequence
has been deleted and replaced with a 3 × FLAG tag at the
N-terminus (Raffatellu et al., 2005). Expression of the fusion pro-
teins in Brucella was confirmed by Western blot using a mouse
anti-FLAG M2 antibody (Sigma-Aldrich). To generate plasmids
coding for fusions to the N-terminus of CyaA, BamHI/SpeI
DNA fragments coding for BtpA (1-275) and BtpB (1-292)
were obtained by PCR amplification with primers carrying
BamHI/SpeI sites and ligated into the corresponding sites of
pCyaA (Marchesini et al., 2011). Primers sequences with BamHI
and SpeI sites (underlined) are: BtpA-Fw: 5′-atggatccatgagttc
gtactcttctaata-3′ ; BtpA-Rv: 5′-ggactagtgataagggaatgcagttcttt-3′ ;
BtpB-Fw 5′- atggatccatgtacaatttatttgtttcgggc-3′ ; BtpB-Rv: 5′-
ggactagtggtgatgagggcgacgcgctc-3. To generate plasmids coding for
fusions to the C-terminus of CyaA, the genes coding for BtpA (1-
275) and BtpB (1-292) with flanking XbaI and SacII sites (under-
lined) were amplified using primers BtpA-Fw: 5′-tatctagaatgagttc
gtactcttctaatattg-3′/BtpA-Rv: 5′-tccccgcggtcagataagggaatgcagttc-
3′ and BtpB-Fw: 5′-tatctagaatgtacaatttatttgtttcgggct-3′ /BtpB-Rv:
5′-tccccgcggctaggtgatgagggcgacgcg-3′ . The DNA fragment cod-
ing for CyaA was amplified with flanking BamHI and SpeI sites
(underlined) using primers 5′-cgggatccatgcagcaatcgcatcaggct-3′
and 5′-cgactagtaaggctgtcatagccggaatcctggc-3′ . DNA fragments
coding for CyaA and BtpA or BtpB were ligated in the corre-
sponding sites of pDK51 under bcsp31 gene promoter as described
in (Marchesini et al., 2011). The integrity of all constructs was
confirmed by sequence analysis. Plasmids expressing CyaA fusion
proteins were introduced in B. abortus strains by biparental mat-
ing. Expression of the fusion proteins in Brucella was confirmed
by Western blot using a mouse serum raised against CyaA.
BACTERIAL INFECTION AND REPLICATION ASSAYS
BMDCs were prepared from 6-8 week-old female C57BL/6 mice
(Lelouard et al., 2002). Infections were performed at a multiplic-
ity of infection of 30:1. Bacteria were centrifuged onto BMDCs at
400 g for 10 min at 4◦C and then incubated for 30 min at 37◦C
with 5% CO2 atmosphere. Cells were gently washed twice with
medium and then incubated for 1 h in medium supplemented
with 100 µg/ml streptomycin to kill extracellular bacteria (or gen-
tamicin for Salmonella). Thereafter, the antibiotic concentration
was decreased to 20 µg/ml. Control samples were always per-
formed by incubating cells with media only and following the
exact same procedure for infection. To monitor bacterial intra-
cellular survival, infected cells were lysed with 0.1% Triton X-100
in H2O and serial dilutions plated onto TSB agar to enumerated
CFUs.
IMMUNOFLUORESCENCE MICROSCOPY NF-kB
Cells were fixed in 3% paraformaldehyde, pH 7.4, at room tem-
perature for 20 min. Cells were then permeabilized for 10 min
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 10
Salcedo et al. Brucella TIR protein B
with 0.1% saponin in PBS, followed by a blocking for 1 h with
2% BSA in PBS. Primary antibodies were incubated for 1 h
followed by 3 washes in PBS, 1 h incubation for secondary anti-
bodies, 2 washes in PBS and 1 wash in water before mount-
ing with Prolong Gold (Life technologies). Primary antibod-
ies used: rabbit anti-p65 from Santa Cruz at 1/250, hamster
anti-CD11c from BioLegend at 1/100 and cow anti-Brucella
LPS antibody at 1/2000. Secondary antibodies used: goat anti-
hamster Alexa 594, donkey anti-rabbit Cy3, goat anti-cow FITC,
all from Jackson Immunoresearch. Nuclei were stained with
TOPRO-3.
Samples were examined on a Leica SP5 laser scanning confocal
microscope for image acquisition. Images of 1024 × 1024 pixels
were then assembled using Adobe Photoshop 7.0. In all exper-
iments we used an anti-CD11c antibody confirming analysis of
DCs only. Quantification was always done by counting at least
100 cells in 4 independent experiments, for a total of at least 400
host cells analysed.
FLOW CYTOMETRY OF INFECTED CELLS
BMDCs were harvested 8 h or 24 h after infection and stained
for 20 min at 4◦C with anti CD11c APC-Cy7, anti CD40 Alexa
647, anti CD80 Pe-Cy5, anti CD86 FITC and anti MHC class
II PE (all purchased at BioLegend). Cells were then washed
once in 1% FCS in PBS and once in PBS. Cells were fixed for
20 min in 3% PFA at room temperature. At least 100,000 CD11c+
events were collected on flow cytometry using a FACS Canto II
(Becton Dickinson) and analysis was done on FlowJo software
(TreeStar).
TEM TRANSLOCATION ASSAY
RAW cells were seeded in a 96 well plates at 1 × 104 cells/well
overnight. Cells were then infected with an MOI of 500:1 by cen-
trifugation at 4◦C, 400 g for 5 min and 20 min at 37◦C 5% CO2.
Cells were then washed twice with DMEM and 200 µl of com-
plete media, with gentamicin (50 µg/ml) and 1 mM of IPTG was
added for 1 h. Media was replaced by 200 µl of complete DMEM,
with gentamicin (10 µg/ml) and 1 mM of IPTG. At 4 or 24 h after
infection cells were washed with 100 µl HBSS. 20 µl of CFF2 mix
(as described by Life Technologies protocol) was then added to
each well, and plate incubated for 1.5 h at room temperature in
the dark. Cells were finally washed with 100 µl PBS and analysed
immediately by microscopy. A total of 5000 cells were counted
from 5 independent experiments in an automated manner using
imageJ.
CyaA ASSAYS
Translocation of BtpA and BtpB into host cells was assayed using
the CyaA fusion approach. After infection of J774.A1 cells (MOI
250:1) for 4 h in 96-wells plates (105 cells/well), cells were gently
washed five times with PBS and lysed. Intracellular cAMP lev-
els were determined by Direct cAMP Enzyme Immunoassay Kit
(Sigma, CA200) as described by the manufacturer.
CYTOKINE MEASUREMENT
Sandwich enzyme-linked immunosorbent assays (ELISA) from
ebioscience were used to detect IL-12 (p40/p70) and TNFα
from supernatants of BMDCs infected with different Brucella
strains.
LUCIFERASE ACTIVITY ASSAY
HEK 293 T cells were transiently transfected using Fugene
(Roche) for 24 h, according to manufacturer’s instructions, for
a total of 0.4 µg of DNA consisting of 50 ng TLR plasmids,
200 ng of pBIIXLuc reporter plasmid, 5 ng of control Renilla
luciferase (pRL-null, Promega) and 50 ng of myc-BtpA or myc-
BtpB expression vectors. The total amount of DNA was kept
constant by adding empty vector. Where indicated, cells were
treated with E. coli LPS (1 µg/ml), Pam2CSK4 (100 ng/ml),
CpG ODN1826 (1 µM), Flagellin Fl-ST (1 µg/ml) and poly(I:C)
(25 µg/ml), all obtained from Invivogen, for 6 h and then cells
were lysed and luciferase activity measured using Dual-Glo
Luciferase Assay System (Promega). The BtpB constructs were
obtained by cloning in the gateway (Life Technologies) entry vec-
tor and then cloned in pMyc. The following primers were used
for BtpB (178 aa) ggggacaagtttgtacaaaaaagcaggcttcatgaatcgtacgca
ctgggcg and as reverse primer ggggaccactttgtacaagaaagctgggtcc
taggtgatgagggcgacgcg. For BtpB (1-292) the forward primer was
ggggacaagtttgtacaaaaaagcaggcttctacaatttatttgtttcgggc. The BtpA
(1-275) primers were: ggggacaagtttgtacaaaaaagcaggcttcatgagttcgta
ctcttctaatatt and the reverse primer was ggggaccactttgtacaagaaa
gctgggtctcagataagggaatgcagttc.
YEAST TWO-HYBRID ASSAY
The plasmids used for the Y2H interaction test were obtained by
using the Gateway™ technique, except the pACT2 vector encod-
ing human MyD88-Gal4 activation domain (AD) fusion that was
provided by L. O’Neill. Briefly, human MyD88 and B. melitensis
16 M BtpA (BMEI1674) were amplified by PCR respectively
from the pACT2-MyD88 vector and from genomic DNA with
Gateway™ primers (GWMyD88F and GWMyD88R; GWbtpAF
and GWbtpAR). PCR products were then separately cloned
into the entry vector pDONR201 (Invitrogen Life-technologies)
as previously described (Dricot et al., 2004). For btpB, the
corresponding entry vector pDONR201-BMEI1216 from the
ORFeome was used (Dricot et al., 2004). LR reactions were then
performed as recommended by the manufacturer (Invitrogen
Life-technologies) in order to clone MyD88 into pVV212 (Van
Mullem et al., 2003) downstream of the Gal4 DNA-binding
domain (BD), and BtpA and BtpB into pVV213 (Van Mullem
et al., 2003) downstream of the Gal4 AD. Haploïd Saccharomyces
cerevisiae strains Mav103 and Mav203 (Walhout and Vidal, 2001)
were transformed with BD and AD fusion protein vectors respec-
tively. Diploid yeasts carrying both plasmids were obtained by
mating and selected on synthetic dextrose medium (SD) lacking
leucine (leu) and tryptophan (trp) as previously described (Hallez
et al., 2007). Protein interactions were assessed on medium lack-
ing histidine (his) supplemented with 20 mM triaminotriazole
(3AT). The β-galactosidase expression filter assay using the
LacZ reporter gene was performed as described previously
(Dozot et al., 2010). The primers used for two-hybrid constructs
were: GWMyD88Fggggacaagtttgtacaaaaaagcaggctcgcgatggctgcagg
aggtcccg ;GWMyD88Rggggaccactttgtacaagaaagctgggtaagggcaggga
caaggccttg ;GWbtpAFggggacaagtttgtacaaaaaagcaggctcgatgagttcgta
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 11
Salcedo et al. Brucella TIR protein B
ctcttctaat ;GWbtpARggggaccactttgtacaagaaagctgggtagataagggaatg
cagttc.
MOUSE INFECTION STUDIES
Groups of 7- to 9-week-old female IRF 1−/− or BALB/c mice were
intraperitoneally inoculated with 106 CFU of B. abortus strains
in 0.2 ml PBS. The infected mice were housed in cages within a
biosafety level 3 facility and IRF 1−/− mice were monitored daily
for survival. At the indicated times post-infection, spleens from
infected mice were removed and homogenized in 2 ml of PBS.
Tissue homogenates were serially diluted and plated in duplicate
on TSA with the appropriate antibiotic. CFU were counted after
3–4 days of incubation at 37◦C.
HISTOLOGICAL AND IMMUNOHISTOLOGICAL ANALYSIS
For each mouse, the spleen was removed, fixed with buffered
formalin 4%, and embedded in paraffin. Serial sections (3 µm)
of these specimens were obtained for routine hematoxylin-eosin
and immunohistochemical investigations to assess the presence of
granulomas and bacterial antigens, respectively.
Granulomas were defined as collections of ten or more
macrophages within the organs. The inflammatory granulomas
present in each tissue section of the spleens were counted dur-
ing microscopic examination, and the total area of tissue sections
was determined by quantitative image analysis as described previ-
ously (Stein et al., 2005). The results were expressed as the number
of granulomas found per surface unit (i.e., square centimeters).
Counts of granulomas were expressed as the mean ± the stan-
dard deviation per square centimeter and compared by using
the Student t test. Immunohistochemical analysis was performed
with a rabbit anti-B. abortus antibody used at a 1:1000 dilution
with hemalun counterstain. The immunohistological procedure,
in which an immunoperoxidase kit was used, has been described
elsewhere (Leone et al., 2004). For each section, a negative control
was performed with normal rabbit serum.
STATISTICAL ANALYSIS
Unpaired two-tailed Student’s t test was carried out to deter-
mine the statistical differences between experimental data sets.
P ≥ 0.05 were not considered significant; P ≤ 0.001 are denoted
with ∗ ∗ ∗; P ≤ 0.01 are denoted with ∗∗ and P between 0.01 and
0.05 are denoted with ∗. Statistical differences between IRF-1 −/−
mice survival curves were determined with Mantel-Cox test.
ACKNOWLEDGMENTS
We are grateful to R. Tsolis for the pFLAG-TEM1, L. O’Neill
for the pACT2 vector encoding human MyD88-Gal4 activa-
tion domain (AD) fusion and R. Jerala for the MD2 plasmid.
This work was supported by the Agence National Recherche
(ANR BruTir), the Centre National de la Recherche Scientifique,
the Institut National de la Santé et de la Recherche Médicale
and the Aix-Marseille Université. Matthieu Terwagne held a
Ph.D. fellowship from the Fonds National de la Recherche
Scientifique and his work was supported by an ARC con-
vention from the French-Speaking Community of Belgium
(N◦ 08/13–015). Paul Roger Claude Imbert held a Ph.D. fel-
lowship from FINOVI and TLSL was funded by the ANR
grant CELLPATH, awarded under the ERA-NET PathoGenoMics
scheme. Diego José Comerci and María Ines Marchesini are mem-
bers of the Scientific Research Career from Consejo Nacional
de Investigaciones Científicas y Técnicas (CONICET, Argentina);
Claudia Karina Herrmann is a Ph.D. fellow from CONICET
and this work was supported by ANPCyT PICT 2011-0253
and 2011-1485. Kristine Von Bargen was funded by the ANR
BruTir and Clara Degos held a fellowship from the Aix-Marseille
Université.
REFERENCESCelli, J., de Chastellier, C., Franchini,
D.-M., Pizarro-Cerda, J., Moreno,
E., and Gorvel, J.-P. (2003). Brucella
evades macrophage killing via
VirB-dependent sustained inter-
actions with the endoplasmic
reticulum. J. Exp. Med. 198,
545–556. doi: 10.1084/jem.2003
0088
Celli, J., Salcedo, S. P., and Gorvel,
J.-P. (2005). Brucella coopts the
small GTPase Sar1 for intracellu-
lar replication. Proc. Natl. Acad.
Sci. U.S.A. 102, 1673–1678. doi:
10.1073/pnas.0406873102
Chaudhary, A., Ganguly, K.,
Cabantous, S., Waldo, G. S.,
Micheva-Viteva, S. N., Nag, K.,
et al. (2011). The Brucella TIR-like
protein TcpB interacts with the
death domain of MyD88. Biochem.
Biophys. Res. Commun. 417,
1–6.
Cirl, C., Wieser, A., Yadav, M., Duerr,
S., Schubert, S., Fischer, H., et al.
(2008). Subversion of Toll-like
receptor signaling by a unique
family of bacterial Toll/interleukin-
1 receptor domain-containing
proteins. Nat. Med. 14, 399–406.
doi: 10.1038/nm1734
de Barsy, M., Jamet, A., Filopon, D.,
Nicolas, C., Laloux, G., Rual, J.-
F., et al. (2011). Identification of
a Brucella spp. secreted effector
specifically interacting with human
small GTPase Rab2. Cell Microbiol.
13, 1044–1058. doi: 10.1111/j.1462-
5822.2011.01601.x
de Jong, M. F., Starr, T., Winter, M.
G., den Hartigh, A. B., Child,
R., Knodler, L. A., et al. (2012).
Sensing of bacterial type IV secre-
tion via the unfolded protein
response. mBio 4:e00418-12. doi:
10.1128/mBio.e00418–12
de Jong, M. F., Sun, Y.-H., den Hartigh,
A. B., van Dijl, J. M., and Tsolis,
R. M. (2008). Identification of VceA
and VceC, two members of the VjbR
regulon that are translocated into
macrophages by the Brucella type
IV secretion system. Mol. Microbiol.
70, 1378–1396. doi: 10.1111/j.1365-
2958.2008.06487.x
Dozot, M., Poncet, S., Nicolas, C.,
Copin, R., Bouraoui, H., Mazé,
A., et al. (2010). Functional
characterization of the incomplete
phosphotransferase system (PTS) of
the intracellular pathogen Brucella
melitensis. PLoS ONE 5:e12679.
doi: 10.1371/journal.pone.0012679
Dricot, A., Rual, J.-F., Lamesch, P.,
Bertin, N., Dupuy, D., Hao, T., et al.
(2004). Generation of the Brucella
melitensis ORFeome version 1.1.
Genome Res. 14, 2201–2206. doi:
10.1101/gr.2456204
Durward, M., Radhakrishnan, G.,
Harms, J., Bareiss, C., Magnani, D.,
and Splitter, G. A. (2012). Active
evasion of CTL mediated killing
and low quality responding CD8+
T cells contribute to persistence of
brucellosis. PLoS ONE 7:e34925.
doi: 10.1371/journal.pone.0034925
Hallez, R., Letesson, J.-J., Vandenhaute,
J., and De Bolle, X. (2007). Gateway-
based destination vectors for
functional analyses of bacterial
ORFeomes: application to the Min
system in Brucella abortus. Appl.
Environ. Microbiol. 73, 1375–1379.
doi: 10.1128/AEM.01873-06
Ko, J., Gendron-Fitzpatrick, A.,
Ficht, T. A., and Splitter, G. A.
(2002). Virulence criteria for
Brucella abortus strains as deter-
mined by interferon regulatory
factor 1-deficient mice. Infect.
Immun. 70, 7004–7012. doi:
10.1128/IAI.70.12.7004-7012.2002
Kolaskar, A. S., and Reddy, B. V. (1985).
A method to locate protein cod-
ing sequences in DNA of prokary-
otic systems. Nucleic Acids Res.
13, 185–194. doi: 10.1093/nar/13.
1.185
Kovach, M. E., Elzer, P. H., Hill,
D. S., Robertson, G. T., Farris,
M. A., Roop, R. M. 2nd., et al.
(1995). Four new derivatives of
the broad-host-range cloning vec-
tor pBBR1MCS, carrying different
antibiotic-resistance cassettes. Gene
166, 175–176.
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 12
Salcedo et al. Brucella TIR protein B
Lelouard, H., Gatti, E., Cappello, F.,
Gresser, O., Camosseto, V., and
Pierre, P. (2002). Transient aggre-
gation of ubiquitinated proteins
during dendritic cell matura-
tion. Nature 417, 177–182. doi:
10.1038/417177a
Leone, M., Honstettre, A., Lepidi, H.,
Capo, C., Bayard, F., Raoult, D.,
et al. (2004). Effect of sex on Coxiella
burnetii infection: protective role of
17beta-estradiol. J. Infect Dis. 189,
339–345. doi: 10.1086/380798
Marchesini, M. I., Herrmann, C.
K., Salcedo, S. P., Gorvel, J.-P.,
and Comerci, D. J. (2011). In
search of Brucella abortus type
IV secretion substrates: screening
and identification of four pro-
teins translocated into host
cells through VirB system. Cell
Microbiol. 13, 1261–1274. doi:
10.1111/j.1462-5822.2011.01618.x
Newman, R. M., Salunkhe, P., Godzik,
A., and Reed, J. C. (2006).
Identification and characteriza-
tion of a novel bacterial virulence
factor that shares homology with
mammalian Toll/interleukin-
1 receptor family proteins.
Infect Immun. 74, 594–601. doi:
10.1128/IAI.74.1.594-601.2006
Nothelfer, K., Dias Rodrigues, C.,
Bobard, A., Phalipon, A., and
Enninga, J. (2011). Monitoring
Shigella flexnerivacuolar escape by
flow cytometry. Virulence 2, 54–57.
doi: 10.4161/viru.2.1.14666
Parsons, J. A., Bannam, T. L.,
Devenish, R. J., and Rood, J. I.
(2007). TcpA, an FtsK/SpoIIIE
homolog, is essential for trans-
fer of the conjugative plasmid
pCW3 in Clostridium perfringens.
J. Bacteriol. 189, 7782–7790. doi:
10.1128/JB.00783-07
Pizarro-Cerdá, J., Méresse, S., Parton,
R. G., van der Goot, G., Sola-Landa,
A., Lopez-Goñi, I., et al. (1998).
Brucella abortus transits through the
autophagic pathway and replicates
in the endoplasmic reticulum of
nonprofessional phagocytes. Infect
Immun. 66, 5711–5724.
Radhakrishnan, G. K., Harms, J. S., and
Splitter, G. A. (2011). Modulation
of microtubule dynamics by a TIR
domain protein from the intra-
cellular pathogen Brucella meliten-
sis. Biochem. J. 439, 79–83. doi:
10.1042/BJ20110577
Radhakrishnan, G. K., Yu, Q., Harms,
J. S., and Splitter, G. A. (2009).
Brucella TIR Domain-containing
protein mimics properties of
the toll-like receptor adap-
tor protein TIRAP. J. Biol.
Chem. 284, 9892–9898. doi:
10.1074/jbc.M805458200
Raffatellu, M., Sun, Y.-H., Wilson, R.
P., Tran, Q. T., Chessa, D., Andrews-
Polymenis, H. L., et al. (2005).
Host restriction of Salmonella
enterica serotype Typhi is not
caused by functional alteration
of SipA, SopB, or SopD. Infect
Immun. 73, 7817–7826. doi:
10.1128/IAI.73.12.7817-7826.
2005
Rana, R. R., Zhang, M., Spear, A. M.,
Atkins, H. S., and Byrne, B. (2013).
Bacterial TIR-containing proteins
and host innate immune system
evasion. Med. Microbiol. Immunol.
202, 1–10. doi: 10.1007/s00430-012-
0253-2
Salcedo, S. P., Marchesini, M. I.,
Lelouard, H., Fugier, E., Jolly, G.,
Balor, S., et al. (2008). Brucella
control of dendritic cell maturation
is dependent on the TIR-containing
protein Btp1. PLoS Pathog.
4:e21. doi: 10.1371/journal.ppat.
0040021
Sengupta, D., Koblansky, A., Gaines, J.,
Brown, T., West, A. P., Zhang, D.,
et al. (2010). Subversion of innate
immune responses by Brucella
through the targeted degradation
of the TLR signaling adapter, MAL.
J. Immunol. 184, 956–964. doi:
10.4049/jimmunol.0902008
Sieira, R., Comerci, D. J., Sánchez,
D. O., and Ugalde, R. A. (2000).
A homologue of an operon
required for DNA transfer in
Agrobacterium is required in
Brucella abortus for virulence
and intracellular multiplication.
J. Bacteriol. 182, 4849–4855. doi:
10.1128/JB.182.17.4849-4855.2000
Spear, A. M., Loman, N. J., Atkins,
H. S., and Pallen, M. J. (2009).
Microbial TIR domains: not nec-
essarily agents of subversion?
Trends Microbiol. 17, 393–398. doi:
10.1016/j.tim.2009.06.005
Spear, A. M., Rana, R. R., Jenner, D.
C., Flick-Smith, H. C., Oyston, P.
C. F., Simpson, P., et al. (2012).
A Toll/interleukin (IL)-1 receptor
domain protein from Yersinia
pestis interacts with mammalian
IL-1/Toll-like receptor pathways
but does not play a central role
in the virulence of Y. pestis in a
mouse model of bubonic plague.
Microbiology 158, 1593–1606. doi:
10.1099/mic.0.055012-0
Stein, A., Louveau, C., Lepidi, H.,
Ricci, F., Baylac, P., Davoust,
B., et al. (2005). Q fever pneu-
monia: virulence of Coxiella
burnetii pathovars in a murine
model of aerosol infection. Infect
Immun. 73, 2469–2477. doi:
10.1128/IAI.73.4.2469-2477.2005
Van Mullem, V., Wery, M., De
Bolle, X., and Vandenhaute, J.
(2003). Construction of a set of
Saccharomyces cerevisiae vectors
designed for recombinational
cloning. Yeast 20, 739–746. doi:
10.1002/yea.999
Walhout, A. J., and Vidal, M. (2001).
High-throughput yeast two-
hybrid assays for large-scale
protein interaction mapping.
Methods 24, 297–306. doi:
10.1006/meth.2001.1190
Yadav, M., Zhang, J., Fischer, H.,
Huang, W., Lutay, N., Cirl, C.,
et al. (2010). Inhibition of TIR
domain signaling by TcpC: MyD88-
dependent and independent effects
on Escherichia coli virulence.
PLoS Pathog. 6:e1001120. doi:
10.1371/journal.ppat.1001120
Zhang, Q., Zmasek, C. M., Cai,
X., and Godzik, A. (2011). TIR
domain-containing adaptor
SARM is a late addition to the
ongoing microbe-host dialog.
Developmental and Comparative
Immunology 35, 461–468. doi:
10.1016/j.dci.2010.11.013
Conflict of Interest Statement: The
authors declare that the research
was conducted in the absence of any
commercial or financial relationships
that could be construed as a potential
conflict of interest.
Received: 08 March 2013; accepted: 18
June 2013; published online: 08 July
2013.
Citation: Salcedo SP, Marchesini MI,
Degos C, Terwagne M, Von Bargen
K, Lepidi H, Herrmann CK, Santos
Lacerda TL, Imbert PRC, Pierre P,
Alexopoulou L, Letesson J-J, Comerci DJ
and Gorvel J-P (2013) BtpB, a novel
Brucella TIR-containing effector pro-
tein with immune modulatory functions.
Front. Cell. Infect. Microbiol. 3:28. doi:
10.3389/fcimb.2013.00028
Copyright © 2013 Salcedo, Marchesini,
Degos, Terwagne, Von Bargen, Lepidi,
Herrmann, Santos Lacerda, Imbert,
Pierre, Alexopoulou, Letesson, Comerci
and Gorvel. This is an open-access
article distributed under the terms of the
Creative Commons Attribution License,
which permits use, distribution and
reproduction in other forums, provided
the original authors and source are cred-
ited and subject to any copyright notices
concerning any third-party graphics etc.
Frontiers in Cellular and Infection Microbiology www.frontiersin.org July 2013 | Volume 3 | Article 28 | 13
107
III. Discussion et conclusion
générale
108
La survie de Brucella dépend de sa capacité à déployer des facteurs de virulence (virB, CβG,
LPS) tant pour assurer sa vie intracellulaire que pour limiter l’activation du système
immunitaire. Pendant ma thèse, je me suis attachée à essayer de comprendre la relation entre
les cellules immunitaires, particulièrement les DC, et Brucella.
Le CβG, qui a été montré comme étant un puissant activateur des DC, est aussi capable
d’induire des signaux anti-inflammatoires comme SOCS2, LILRA ou tsg-6 dans les DC
humaines. De plus, nous avons montré qu’une injection de CβG dans le derme de l’oreille
provoque un œdème moins important que dans le derme de souris injectées avec du LPS d’E.
coli. Cet œdème s’accompagne d’un recrutement de neutrophiles, qui est transitoire avec un
pic à 12 h et diminue ensuite jusqu’à 48h, alors que dans le cas d’une injection avec du LPS,
le recrutement persiste jusqu’à 24 h puis commence à diminuer.
La différence de cinétique entre les deux types d’injection (LPS versus CβG) est intéressante.
Les neutrophiles jouent un rôle dans les premières réponses à une infection grâce à leur
fonction de dégranulation notamment [224]. Le recrutement plus transitoire de ces cellules
indique une inflammation qui sera plus rapidement résolue, des dommages tissulaires moins
importants. Une étude récente d’immunisation de souris a démontré que le recrutement de
neutrophiles depuis le ganglion conduit à une compétition avec les DC et macrophages pour
présenter des peptides antigéniques aux LT, et donc le recrutement de neutrophiles aboutit,
dans ce cas, à une inhibition de la réponse des LT [225]. Une autre étude d’infection à
Mycobaterium indique un rôle inverse des neutrophiles : ils aideraient à l’activation des DC et
des LT CD4+, cruciaux pour induire une réponse immunitaire anti-mycobactéries [226].
Il est intéressant de constater qu’une molécule de Brucella comme le CβG impacte le
recrutement des neutrophiles dans le tissu. De plus, différentes études ont montré que les
neutrophiles avaient des rôles différents durant l’infection [82, 113]. Il serait intéressant de
voir en quoi la modulation du recrutement de neutrophiles au cours de la brucellose impacte la
présentation antigénique par les DC et macrophages.
La résolution rapide de l’inflammation en cas d’injection de CβG pourrait indiquer la
présence plus importante de molécules anti-inflammatoires.
Les protéines Btp sont aussi un formidable exemple de la capacité de la bactérie à s’adapter à
son hôte. En effet, les TLR et les DC permettent à la fois de détecter Brucella, et d’activer le
système immunitaire. Or, lors de sa vie intracellulaire, Brucella est capable de sécréter BtpA
et BtpB. Ces protéines vont alors interagir avec les molécules adaptatrices TIRAP et MyD88
109
en aval des TLR pour inhiber les voies de signalisation [132-136]. Ici, nous avons mis en
évidence le rôle de BtpB dans le contrôle de l’activation des DC, et son potentiel rôle dans la
virulence in vivo. Cependant de nombreux points sont à éclaircir quant à son rôle dans
l’inhibition de la signalisation en aval des TLR.
Nous ne pouvons exclure que BtpB soit impliquée dans la régulation d’autres fonctions
cellulaires au cours de l’infection. En effet, récemment, une étude a montré l’implication de
BtpA dans la réponse UPR (unfolded protein response, réponse au stress cellulaire) [227]. Au
vu des similitudes entre les voies de signalisation inhibées par BtpA et BtpB, il serait
intéressant de vérifier l’implication de BtpB dans l’induction de l’UPR ; et si comme c’est le
cas dans les macrophages, la réponse UPR est nécessaire à la réplication de Brucella dans les
DC [227].
BtpA semble aussi être impliquée dans la restructuration du RE, indépendamment de la
réponse UPR [227]. Deux autres études ont souligné l’association de BtpA avec les
microtubules, et son rôle de stabilisateur [134, 228]. Les auteurs expliquent que via la
modulation des microtubules et des phosphoinositides BtpA peut impacter les signaux en aval
de TLR (en plus de sa capacité à lier MyD88 et à provoquer la dégradation de TIRAP) [229].
Aucune étude semblable n’a été menée avec BtpB, et il serait intéressant de voir si c’est grâce
à un mécanisme semblable que BtpB inhibe les signaux TLR.
Dans le cas d’autres infections, les bactéries expriment des molécules leur permettant de
moduler le cytosquelette d’actine ou les microtubules pour envahir dans les cellules, ou
encore modifier le trafic intracellulaire des vacuoles et ainsi éviter une fusion avec les
lysosomes [230, 231]. Considérant le rôle de BtpA dans la modulation et stabilisation des
microtubules et du RE, il serait intéressant d’étudier le possible rôle de cette protéine, ainsi
que de BtpB dans ce processus et dans le maintien de la stabilité de la BCV.
Une autre question intéressante est celle du rôle joué par les DC au cours de l’infection. Ces
cellules peuvent clairement être infectées par Brucella, qui y survit en établissant sa niche
réplicative dans le RE [23, 232]. Brucella utilise des mécanismes pour limiter leur détection
via les TLR (LPS, Btp), pour diminuer l’activation en elle-même des DC (Btp, Omp25). On
peut donc se poser la question de l’importance des DC dans les réponses contre la bactérie au
vu des mécanismes déployés par Brucella pour limiter leur activation.
C57B
L/6
CC
R2 K
O
3
4
5
6
7
8
S p le e n
Lo
g C
FU
/org
an
B . a b o rtu s w t
B . a b o rtu s o m p 2 5
* *
*
C57B
L/6
CC
R2K
O
2
3
4
5
6
7
L iv e r
Lo
g C
FU
/org
an
Figure 34 : Réplication de Brucella dans la rate de souris sauvages ou CCR2 KO infectées durant 5 j.
Des souris sauvages (C57BL/6) ou CCR2 KO ont été infectées en IP avec 1.106 CFU/souris. 5 jours p.i les
organes sont prélevés et la réplication bactérienne est analysée par dénombrement de CFU. Les souris infectées par la souche sauvage sont indiquées par un cercle bleu, et celles infectées par le mutant Δomp25
par des carrés rouge.Chaque symbole représente un animal et la médiane des résultats est indiquée par une ligne horizontale. P <
0,05 : * et P < 0,01 : **.
110
Beaucoup d’études sur les DC, dont celles menées pendant ma thèse, proviennent de données
in vitro [23, 85, 100, 232, 233]. L’importance des DC in vivo reste à démontrer. Dans le cas
d’une infection nasale, l’immunité pulmonaire dépend des macrophages et non pas des DC
[202]. De plus, la localisation des DC et macrophages au sein de la rate ainsi que leur
activation ne sont pas impactées par l’infection. En revanche, en absence de macrophages, les
DC inflammatoires des poumons sont recrutées, et migrent dans le ganglion médiastinal, ce
qui pourrait permettre une dissémination de la bactérie [202]. Une autre étude d’infection in
vivo révèle que les DC spléniques (B220- CD11b+ LY-6C+ NK1.1- iNOS+) sont requises pour
l’induction d’une réponse immunitaire de type Th1 contre la bactérie. Cette étude renforce
l’hypothèse de l’importance des DC in vivo, et montre qu’il y a une différence de
comportement selon l’organe infecté et le type d’infection (aérosol/nasal ou en IP) [92, 202].
Au cours d’une infection in vivo, les DC spléniques s’activent et migrent dans la pulpe
blanche de la rate où se concentrent les LT [116]. Les DC inflammatoires qui sont recrutées
au cours de l’infection participent à la formation des granulomes au sein de la rate et du foie
[116]. Ces études montrent donc que les DC ont différents rôles et capacité à s’activer selon
qu’elles soient résidentes dans le tissu (DC spléniques ou pulmonaires) ou recrutées (DC
inflammatoires) au cours de l’infection.
Pour étudier le rôle des DC dans l’infection par Brucella, j’ai utilisé un modèle de souris KO
pour CCR2. CCR2 est un récepteur à la chimiokine CCL2. En plus de ses propriétés
chimioattractives, il permet la sortie des DC dérivées de monocytes, ainsi que des monocytes,
de la moelle osseuse vers le sang. Dans de nombreux modèles d’infection, les monocytes
CCR2+ ont été montrés comme étant critiques dans l’établissement d’une réponse immunitaire
[234]. Ces souris ont un défaut de recrutement des DC inflammatoires et monocytes dans les
tissus enflammés [235]. 5 j après infection (en IP) de ces souris, (Fig. 34). Ces résultats,
préliminaires, indiqueraient que le contrôle de la réplication de Brucella in vivo dépend des
monocytes ainsi que des DC inflammatoires. Le problème de ce genre de modèle est que la
délétion de CCR2 ne va pas impacter uniquement ces cellules. Il y a par exemple un manque
de production d’IFN-γ dans les splenocytes de ces souris activés d’une manière Th1
dépendante [236]. L’utilisation d’autres modèles (comme les modèles de délétion de CD11c
induit par la toxine diphtérique par exemple [237]), pourrait confirmer l’importance de ces
cellules in vivo.
111
D’après l’étude menée sur CD150 ici, nous pouvons affirmer que la liaison de Omp25 à
CD150 fait partie des mécanismes mis en place par Brucella pour inhiber l’activation des DC
et ainsi contrôler une partie de la réponse immunitaire. Il est probable que ce type de
mécanisme soit retrouvé dans différents types cellulaires au sein du système immunitaire pour
limiter l’inflammation. D’autres récepteurs inhibiteurs peuvent aussi jouer un rôle. CTLA-4,
PD-1 sont des récepteurs importants pour l’activation des LT. Parfois, dans les cancers par
exemple, ces récepteurs sont exprimés fortement et induisent une situation anti-inflammatoire
[238, 239]. Pourtant aucune étude à notre connaissance n’a été menée pour voir si ces
protéines jouaient un rôle dans la réponse immunitaire contre Brucella. Du fait de
l’importance des réponses des LT CD4+ IFN-γ pour éliminer la bactérie, et des mécanismes
déployés par Brucella pour diminuer la réponse immunitaire, il serait intéressant de d’étudier
ce type de récepteur [153].
Il est intéressant de constater que Brucella joue parfois un double rôle en produisant
également des facteurs qui activent le système immunitaire. En effet, PrpA est capable
d’activer la prolifération des LB et leur production d’anticorps anti-Brucella (via l’activation
de macrophages) [83, 162, 163]. Mais, ce facteur permet aussi d’inhiber la réponse
immunitaire. En effet, la production d’anticorps déclenchée par l’activation des LB permet
l’opsonisation de Brucella dans les macrophages et donc un taux d’infection plus important
[83]. La production de cytokines in vivo dans les souris infectées est aussi inhibée par PrpA
[83]. De plus, cette protéine de Brucella est requise pour la persistance bactérienne [162].
Cet exemple permet de constater que Brucella est à la fois capable d’activer et inhiber le
système immunitaire pour permettre sa survie. Cela donne un autre regard sur le fait que
CD150 puisse aussi jouer un double rôle dans l’activation ou l’inhibition du système
immunitaire lors de l’infection par Brucella.
Pour finir, les DC et macrophages sont activés par des composants de Brucella (CβG, PrpA,
Omp16, etc…). Considérant que les DC participeraient à la dissémination de la bactérie au
sein de l’organisme (en absence de macrophages) [130], on peut imaginer que cette balance
entre des composés pro-inflammatoires (CβG sur les DC) et anti-inflammatoires (Btp,
Omp25) a un rôle. En effet, pour migrer dans les organes lymphoïdes, les DC ont besoin
d’être activées, seulement trop d’activation est délétère pour Brucella. D’où cette balance
entre inflammation et anti-inflammation pour permettre à la fois aux DC de migrer et
112
disséminer la bactérie, mais limiter en même temps l’activation pour établir une niche
réplicative et éviter une réponse immunitaire trop forte.
Les études menées durant ma thèse permettent d’avoir une meilleure compréhension de
l’activation des DC au cours de l’infection par Brucella. Cela nous a notamment permis
d’identifier un nouveau mécanisme d’inhibition de l’activation des DC par Brucella via la
liaison de Omp25 à CD150.
113
IV. Matériel et Méthodes
114
IV. A. MATERIEL VIVANT
Souris
Des souris C57BL/6J ou Balb/c provenant de chez Charles River âgées de 6 à 12 semaines ont
été utilisées. Les souris CD150 KO sur fond C57BL/6 ont été générées dans le laboratoire de
l’Université de Kyushu en remplaçant l’exon 2 du gène CD150 par une cassette neo et sont
décrites dans l’article suivant [220]. Les souris IFN-γ sur fond C57BL/6 et proviennent du
Jackson Laboratory. Les souris OTII C57BL/6 proviennent de Charles River.
Cellules
BMDC : Les cellules dendritiques dérivées de moelle osseuse (BMDC) ont été produites à
partir de souris C57BL/6. Après sacrifice, les fémurs et tibias des souris sont prélevés, puis,
lavés dans de l’éthanol à 70 %, et ensuite disposés dans du RPMI (Gibco) contenant 5 % de
sérum de veau fœtal (FCS - Eurobio) et 50 µM de 2-mercaptoéthanol (Sigma Aldrich). Les os
sont coupés à leurs extrémités, avec une seringue contenant du milieu les os sont vidés de leur
moelle. Après homogénéisation et filtration sur un filtre 70µm, Une première centrifugation
est effectuée à 300g, 4°C durant 5 minutes. Le culot est resuspendu dans du RBC lysis Buffer
(eBiosciences) pour lyser les globules rouges durant 1 minute avant de compléter avec du
milieu et de centrifuger une nouvelle fois. Les cellules sont resuspendues dans du milieu puis
filtrées sur un filtre 70µm. Après une centrifugation, les cellules sons resuspendues dans du
milieu contenant du GM-CSF à 0. 6x 106 cellules / ml. Les BMDC sont cultivées 5 jours
avant utilisation à 37°C, 5% CO2. Le milieu est changé tous les 2 j.
JL558-GMCSF : Des hybridomes contenant sont cultivés pour produire du GM-CSF. Les
cellules une fois décongelées sont cultivées dans de l’IMDM (Gibco) contenant 20 % de FCS
durant 7 j. Le FCS est ensuite diminué à 5 % et l’ajout de G418 (Gibco) permet la sélection
du des cellules exprimant le GM-CSF. Les cellules sont ensuite cultivées jusqu’à confluence
et épuisement du milieu (environ 7 j). Le surnageant est filtré puis titré.
BMDM : Les macrophages dérivés de moelle osseuse (BMDM) sont produits de la même
façon que les cellules dendritiques exceptée concernant le milieu utilisé : DMEM (Gibco)
supplémenté avec 10 % de FCS, 1 % de L-Glutamine (Gibco), 10 % de L-CSF. Les cellules
sont diluées à 2 x 105 cellules / ml et cultivées 7 j avant utilisation et le milieu est changé le 5
ème et 6 ème jour de culture.
115
Cos-7 : Les cellules Cos-7 sont cultivées en DMEM supplémenté avec 10 % de FCS, 1 % de
L-Glutamine. Les cellules sont trypsinisées puis diluées tous les 2 jours.
Lymphocytes T : Les LT purifiés sont maintenus en culture en RPMI, 10 % FCS, 1 % L-
glutamine, 1 % HEPES, 1 % Sodium Pyruvate.
Souches bactériennes
Pour ces études nous avons utilisées différentes souches bactériennes, regroupées dans le
tableau X :
Toutes les expériences avec Brucella ont été réalisées dans notre laboratoire de niveau de
sécurité biologie 3 (BSL3).
Les souches de Brucella sont isolées à partir de stock en glycérol et cultivées sur du Tryptic
Soy Agar (TSA - Sigma Aldrich) durant 5 j avant utilisation. Pour les infections 4 à 6 colonies
sont mises en culture en Tryptic Soy Broth (TSB – Sigma Aldrich) 16 h à 37°C et 200 rpm
jusqu’à ce qu’elles atteignent environ 2.0 de densité optique (DO) à 600nm.
Salmonella et E. coli sont cultivés en LB-Agar et les sous-cultures sont faites en LB durant
16h à 37°C avec aération et sous 200 rpm agitation.
Extraction des lymphocytes T (LT) des organes de souris
Les rates et ganglions des souris OTI et OTII ont été extraits stérilement et placés dans des
tubes contenant du RPMI. Les organes sont écrasés à l’aide d’un piston d’une seringue sur un
tamis cellulaire 70µm (BD Biosciences) puis centrifugés à 350 g pendant 8 minutes à 4°C.
Les globules rouges sont ensuite lysés avec le RBC lysis Buffer durant 2 min à température
ambiante. Les cellules sont ensuite lavées une fois avec du RPMI.
La concentration cellulaire est ajustée à 1.108 cellules / ml et LT CD4 ou CD8 sont purifiés
avec les kits Dynabeads® Untouched™ Mouse CD4 Cells et Dynabeads® Untouched™
mouse CD8 Cells (Invitrogen, Life Technologies), selon les instructions du fabricant.
IV. B. REACTIFS
Tableau 1 : Réactifs Utilisés
Produit Utilisation Concentration finale Provenance
LPS E.coli 055:B5 Activation de BMDC 100ng/ml Sigma Aldrich
116
Extrait de membranes de Brucella abortus sauvage - ba183
Activation de BMDC 10µg/ml I. Moriyón
Extrait de membranes de Brucella abortus ∆omp25 - ba135
Activation de BMDC 10µg/ml I. Moriyón
Ovalbumine Activation LT (co-culture) spécifique des OTI et OTII
50µg/ml Hyglos
OVA 323-339 Activation LT (co-culture) Peptide spécifique des LT CD4 OTII
0,12µg/ml Tebu Bio
OVA 257-264 Activation LT (co-culture) Peptide spécifique des LT CD8 OTI
1µg/ml Invivogen
BrdU Proliferation BMDC 10µM BD Biosciences
Cell Trace Violet Proliferation LT 1µM Life Technologies
CFSE Proliferation LT 2,7µM Life Technologies
Peptide bloquant CD150
Blocage de CD150 100µg/ml Thermo Science
Peptide contrôle Blocage de CD150 : contrôle négatif
100 µg/ml Thermo Science
Tableau 2 : Anticorps
Antigène Couplage Fournisseur Dilution
Réactivité Hôte et Isotype Clône
Cytométrie de Flux
CD3 e-Fluor450 eBiosciences 1/200 Souris Rat IgG2b, κ 17A2
CD3 APC-Cy7 BioLegend 1/100 Souris Rat IgG2b, κ 17A2
CD4 Alexa 647 BioLegend 1/200 Souris Rat IgG2b, κ GK1.5
CD8 PE-Cy5 BioLegend 1/400 Souris Rat IgG2a, κ 53-6.7
CD11c APC BioLegend 1/200 Souris Hamster Arménien IgG
N418
CD11c APC-Cy7 BioLegend 1/200 Souris Hamster Arménien IgG
N418
CD25 FITC Biolegend 1/800 Souris Rat IgG1, λ PC61
CD40 PE-Cy5 BioLegend 1/400 Souris Hamster Arménien IgM
HM40-3
CD40 Alexa 647 BioLegend 1/200 Souris Hamster Arménien IgM
HM40-3
CD44 Alexa 700 BioLegend 1/200 Souris Rat IgG2b, κ IM7
117
CD62 L PE BD Biosciences 1/300 Souris Rat IgG2a, κ MEL-14
CD80 APC BioLegend 1/100 Souris Hamster Arménien IgG
16-10A1
CD80 PE-Cy5 BioLegend 1/200 Souris Hamster Arménien IgG
16-10A1
CD86 FITC BioLegend 1/500 Souris Rat IgG2a, κ GL-1
CD86 PE-Cy5 BioLegend 1/1500 Souris Rat IgG2a, κ GL-1
CD86 PE-Cy7 BioLegend 1/800 Souris Rat IgG2a, κ GL-1
CD150 PE-Cy7 BioLegend 1/400 Souris Rat IgG2a, λ TC15-12F12.2
CMH-II (I-A/I-E) PE BioLegend 1/4000 Souris Rat IgG2b, κ M5/114.15.2
BrdU FITC BD Biosciences 1/100
Microscopie
Anticorps primaires
Calnexin Non couplé Abcam 1/200 Souris Lapin
CD11c Non couplé BioLegend 1/100 Souris Hamster Arménien
N418
EEA-1 Non couplé 1/200 Souris Chèvre
Mono- and polyubiquitinylated conjugates FK2
Non couplé Enzo Life Science 1/1000 Souris Souris
I-A/I-E Non couplé BioLegend 1/300 Souris Rat IgG2b, κ M5/114.15.2
Lamp-1 Non couplé
Developmental Studies Hybridoma Bank, University of Iowa
1/100 Souris Rat 1D4B
NF-κB p65 Non couplé Santa Cruz 1/200 Souris Lapin
LPS lisse Non couplé Fait maison 1/2000 Brucella
abortus Vache 546
1E6 Non couplé Fait maison 1/2000 Salmonella Souris
Anticorps secondaires
IgG (chaines légères + lourdes)
FITC Jackson ImmunoResearch
1/100 Vache Chèvre
IgG (chaines légères + lourdes)
Alexa-488 Jackson ImmunoResearch
1/500 Vache Chèvre
IgG (chaines légères + lourdes)
Alexa-555 Jackson ImmunoResearch
1/500 Lapin Âne
118
IgG (chaines légères + lourdes)
Alexa-647 Jackson ImmunoResearch
1/500 Lapin Chèvre
IgG (chaines légères + lourdes)
Pacific Blue Invitrogen 1/500 Lapin Chèvre
IgG (chaines légères + lourdes)
Alexa-594 Jackson ImmunoResearch
1/500 Hamster Arménien
Chèvre
IgG (chaines légères + lourdes)
Alexa-647 Jackson ImmunoResearch
1/500 Rat Poulet
IgG (chaines légères + lourdes)
Alexa-546 Jackson ImmunoResearch
1/500 Chèvre Âne
IgG (chaines légères + lourdes)
Alexa-647 Jackson ImmunoResearch
1/500 Souris IgG1
Chèvre
Autres
Noyau : TOPRO-3 TOPRO-3 Invitrogen 1/1000
Phalloïdine Alexa-546 Invitrogen 1/1000
Biochimie
myc Fait maison 1/1000 Humain Souris 9E10
Omp25 A. Cloeckaert 1/3000 Brucella
abortus Souris
IgG (chaines légères + lourdes)
HRP Sigma Aldrich 1/10000
Souris
Mouse IgG TrueBlot
HRP Ebiosciences 1/1000 Souris
Tableau 3 : Plasmides
Plasmide Description Référence ou Source
pDONR Zeo Vecteur de clonage BP - Confère une résistance à la zéocine
Life Technologies
pDONR Zeo::CD150 (2-3)
Vecteur de clonage BP contant les exons 2 et 3 de CD150 - Confère une résistance à la zéocine
Cette étude
119
pCMV::mycCD150
Vecteur de destination de clonage Gateway contenant un tag myc en N-terminal et contenant les exons 2 et 3 de CD150 - Expression cellules eucaryotes - Confère une résistance à l'ampicilline
Cette étude
pGEM::omp25 Vecteur de clonage contenant omp25 - Confère une résistance à l'ampicilline
Cette étude
pBBR-MCS4::omp25
Vecteur de destination, replicatif dans Brucella contenant omp25 pour complémenter la souche mutante omp25 - Confère une résistance à l'ampicilline
Cette étude
Peptides bloquants et contrôles CD150
CD150 a été bloqué avec un peptide bloquant, ou avec un peptide contrôle (ne bloquant pas
CD150). Ces peptides ont été synthétisés par Thermo Science.
Les séquences des peptides sont les suivantes : FCKQLKLYEQVSPPE pour le peptide
bloquant, et pour le peptide non bloquant : DLSKGSYPDHLEDGY. Ils sont resuspendus en
PBS stérile sans endotoxine à 10mg/ml. A cause de la cystéine contenue dans le peptide
bloquant, les deux peptides sont traités au N-Ethylmaleimide (NEM) (Pierce, Thermo
Scientific). Une fois les peptides resuspendus à 10mg/ml, 10mg de NEM est ajouté, puis les
peptides sont incubés durant 2 h à température ambiante sous agitation. Les peptides sont
ensuite dialysés pour enlever le surplus de NEM dans le milieu.
IV. C. BACTÉRIOLOGIE
Tableau 4 : Souches bactériennes utilisées
Souche Description Résistance
Antibiotique Référence ou
Source
B.abortus
2308 souche sauvage Acide Nalidixique
(Nal) D. Comerci
btpA ∆btpA dans la souche 2308 Nal Gentamicine
(Gm) Salcedo et al 2008
btpB ∆btpB dans la souche 2308 Nal Kanamycine
(Km) Salcedo et al 2012
btpA/btpB ∆btpA∆btpB dans la souche 2308 Nal - Gm - Km Salcedo et al 2012
120
btpBpbtpB ∆btpB complémenté avec btpB dans le plasmide pBBR1MCS-4
dans la souche 2308
Nal - Ampicilline (Amp) - Km
Salcedo et al 2012
omp25 ∆omp25 dans la souche 2308 Nal - Km Manterola et al
2007
virB9 ∆virB9 dans la souche 2308
Celli et al 2005
omp25pomp25 ∆omp25 dans la souche 2308
complémenté avec un plasmide contenant omp25
Nal - Km - Amp Cette étude
E. coli
DH5α
DH5α pCMV myc::CD150
Souche E. coli permettant l’amplification de plasmide,
contenant un plasmide pCMV avec un tag myc en N terminal et les 2 premiers exons de CD150
Amp Cette étude
JMH109 pGEM::omp25
Souche E. coli pour le clonage du pGEM et permettant un screen bleu/blanc contenant le pGEM
avec omp25
Amp Cette étude
S17 λpir souche E. coli capable de conjugaison avec Brucella
X. De Bolle
S17 λpir pBBR-
MCS4::omp25
souche E. coli capable de conjugaison avec Brucella
contenant le plasmide pour complémenté omp25
Amp Cette étude
Salmonella enterica typhymurium
12023 souche sauvage
S. Méresse
Infection des cellules
Les cellules sont infectées à différents multiplicity of infection (MOI) : 30 pour les BMDC,
50 pour les BMDM, et 500 pour les HeLa.
Les bactéries sont ajoutées aux cellules dans du milieu cellulaire, puis les cellules sont
centrifugées à 400g 4°C pendant 10 min, les cellules sont ensuite placées à 37°C /5 % CO2
durant 10 min pour les BMDM et Raw, 30 min pour les BMDC, 1 h pour les HeLa. Les
cellules sont alors lavées 2 fois avec du milieu puis l’on rajoute du milieu contenant 50µg/ml
de gentamicine (ou 100µg/ml streptomycine quand il y a une bactérie résistante à la
gentamicine) pour tuer les bactéries extracellulaires et sont incubées durant 1 h à 37°C / 5 %
CO2, ensuite le milieu est remplacé par un milieu contenant seulement 10µg/ml de
gentamicine (ou 20µg/ml streptomycine). Les cellules sont incubées à 37°C / 5 % CO2 le
temps voulu.
121
Infection des souris
Des cultures liquides de Brucella sont faites sur 16 h, les bactéries sont ensuite diluées dans
du PBS stérile sans endotoxine à la concentration voulue. Les souris de 6 à 8 semaines sont
ensuite infectées par injection intra-péritonéale. 1.106 CFU/souris sont injectées dans 200 µl
de PBS stérile sans endotoxine.
Dénombrement des bactéries
Les cellules sont lavées 5 fois en PBS, puis lysées dans 1ml de 0.1 % Triton X-100 (Sigma-
Aldrich) en H2O stérile, le lysat est ensuite dilué en série dans du PBS stérile avant d’être
répartis sur des boîtes de TSA, laissées à 37°C 3 j avant le dénombrement.
Les organes sont écrasés avec le piston d’une seringue dans 1 ml (pour la rate, le MLN) ou 2
ml (pour le foie) de 0.1% Triton X-100 en H2O, le lysat est ensuite dilué en série dans du
PBS avant d’être répartis sur des boîtes de TSA, laissées à 37°C 3 j avant le dénombrement.
Préparation de stock glycérol
1 ml de culture de bactérie (phase stationnaire) est ajouté à 300µl de glycérol 80 %. Les tubes
sont ensuite congelés à -80°C.
Préparation de bactéries thermo-compétentes
Les bactéries thermo-compétentes sont faites à partir d’une culture liquide sur la nuit. 500µl
de cette culture est diluée dans 100 ml de LB et les bactéries sont laissées à 37°C sous
agitation jusqu’à atteindre une DO de 0.5 à 600 nm. Les bactéries sont alors centrifugées 15
min à 5000 rpm à 4°C. Elles sont ensuite lavées avec 10 ml de MgCl2 0.1M sur glace, re
centrifugées 15 min à 5000 rpm à 4°C, resuspendues et lavées en CaCl2 0.1 M sur glace.
Après une dernière centrifugation, les bactéries sont resuspendues dans 5 ml de 15 %
glycérol dans 0.1 M de CaCl2 et congelées à – 80°C.
Transformation des bactéries
Les bactéries thermo-compétentes sont décongelées sur glace, 50µl de bactéries sont ajoutées
à 2 µl à 5 µl d’ADN et incubées durant 30 minutes sur glace. Le mélange bactérie / ADN est
ensuite mis à 42°C durant 45 secondes, puis 2 min sur glace. 500µl de SOC (contenant du
glucose) sont ajoutées avant une incubation à 37°C sous agitation 1 h. Les bactéries sont
122
ensuite étalées sur boite LB agar contenant l’antibiotique approprié pour la sélection selon le
plasmide transformé.
IV. D. BIOLOGIE CELLULAIRE
Marquage pour cytométrie de flux
Les cellules sont récoltées puis centrifugées à 400 g durant 5 min, les culots cellulaires sont
resuspendus dans le mix d’anticorps et incubés pendant 20 min protégés de la lumière. Un
premier lavage en tampon FACS est réalisé, puis un second en PBS avant une fixation en
Paraformaldéhyde (PFA) 3.2 % (EMS) durant 20 min à température ambiante, protégé de la
lumière. Les échantillons sont ensuite dilués au 1/2 dans du PBS et stockés à 4°C avant le
passage au FACS. Pour les marquages BrdU, le protocole suivi est celui indiqués par les
fabricants dans le kit BD BrdU FITC Assay (BD Biosciences).
Les échantillons sont analysés soit sur un FACS CantoII (BD Biosciences) ou un FACS
LSRII (BD Biosciences). Les résultats sont analysés sur BD FACSDiva (BD Biosciences) et
FlowJO (TreeStar).
Marquage immunofluorescent
Les cellules sont réparties sur coverslips, infectées puis au temps voulu, les coverslips sont
lavés deux fois dans du PBS, puis fixés en PFA 3.2% pendant 20 min avant d’être lavés en
PBS deux fois.
Pour le marquage NF-κB les cellules sont perméabilisées en Saponine 0.1 % en PBS durant
10 min à température ambiante, puis les interactions non spécifiques sont bloquées pendant 1
h à température ambiante dans du PBS / 2% BSA. Les anticorps primaires sont incubés durant
1 h, les coverslips sont ensuite lavés deux fois en PBS avant l’incubation avec les anticorps
secondaires durant 45 min. Les coverslips sont montés sur lame avec du Prolong Gold (Life
Technologies).
Pour les autres marquages, les cellules sont incubées pendant 1 h dans un mélange de
Saponine 0.1 % / 1 % Sérum de Cheval / PBS pour perméabiliser les cellules et bloquer les
interactions spécifiques. Les anticorps primaires sont incubés 1 h à température ambiante, et
les anticorps secondaires sont incubés durant 30 minutes. Les lamelles sont ensuite montées
sur lame soit en Prolong Gold, soit en Prolong Gold + DAPI (Life Technologies).
123
Les marquages sont analysés sur un microscope confocal Leica SP5X avec le logiciel LAS de
Leica. Au moins 50 cellules sont comptées dans 4 expériences indépendantes pour les
quantifications, des images de 1024 x 1024 pixels sont ensuite assemblées dans Image J ou
Adobe Photoshop CS5 (Adobe).
Quantification de cytokines par Cytometric Beads Assay (CBA)
Les cytokines et sérum des souris sont analysés par CBA (BD Biosciences) soit avec le kit
Mouse Inflammation pour les cytokines TNF-α, IL-6, IL-12p70, IL-10, MCP-1, et IFN-γ soit
avec le kit Th1/Th2/Th17 pour les cytokines IL-2, IL-4 et IL-17A. Les échantillons sont
traités suivant le protocole fourni par le fabricant. Les échantillons sont acquis sur un FACS
CantoII (BD Biosciences).
Les résultats sont ensuite analysés sur le logiciel FCAP Array (BD Biosciences).
Co-culture lymphocytes T – BMDC
Les BMDC ont été préalablement réparties en plaque 96 puits à fond rond (BD Falcon) pour
un ratio DC : T de 1 : 4. Les cellules ont été soit stimulées avec les LPS et les extraits de
Brucella 16 h, soit infectées et incubées avec de l’ovalbumine ou les peptides correspondants
durant 4 h. Les cellules sont ensuite lavées pour se débarrasser de l’ovalbumine et des
peptides. Pour analyser la prolifération des LT dans les différentes conditions, ceux-ci sont
marqués, après purification, avec du CFSE (Life Technologies), selon les instructions du
fabricant. Après le marquage, les LT sont ajoutés aux BMDC dans du milieu LT contenant du
GM-CSF pour permettre la survie des BMDC, et sont cultivés durant 3 j à 37°C 5 % CO2.
IV. E. BIOLOGIE MOLECULAIRE
Purification de plasmides : « mini et maxi prep »
Les plasmides utilisés ont été amplifiés par mini et maxi prep selon les besoins avec les kits
« Wizard® Plus SV Minipreps DNA Purification » de Promega en suivant le protocole du
fabricant, « Plasmid Mini Kit » (Qiagen) pour le clonage de CD150 en gateway, en suivant le
protocole du fabricant, et le kit « Plasmid Maxi Kit » (Qiagen) pour les maxiprep de
plasmides, en suivant le protocole du fabricant.
124
Extraction d’ARN, rétro-transcription en cDNA et qPCR
Les cellules sont récoltées, lavées une fois en PBS puis lysées à l’aide de tampon RLT présent
dans le Rneasy Mini Kit (Qiagen), l’extraction est effectuée selon le protocole fourni par le
fabricant. Les rétro-transcription sont faites à partir de 300ng d’ARN, et avec le kit
QuantiTect Reverse Transcription (Qiagen) selon les instructions du fabricant. Les qPCR sont
faites avec du SYBR Green (Takara) selon le protocole fourni par le fabricant à partir de 2 µl
de cDNA. Les échantillons sont utilisés sur une machine à qPCR 7300 Real-
Time PCR System (Applied Biosystems). Les échantillons sont normalisés en fonction de
l’expression de l’HPRT.
Amorces
Les différentes amorces utilisées en qPCR et pour les clonages sont listées dans le tableau ci-
dessous :
Tableau 5 : Amorces
Nom Sens Séquence Utilisation
Pour qPCR HPRT sens 5'-3' AGCCCTCTGTGTGCTCAAGG qPCR
HPRT antisens 5'-3' CTGATAAAATCTACAGTCATAGGAA
TGGA qPCR ATF6 sens 5'-3' CCACCAGAAGTATGGGTTCG qPCR ATF6 antisens 5'-3' TGGCCTCCAGTCCTAGCATA qPCR IRE1 sens 5'-3' CGGCCTTTGCTGATAGTCTC qPCR IRE1 antisens 5'-3' GGCAGTGAGGCTGCATAGTC qPCR SLAM sens 5'-3' CGGGAGAGTGAAGGATGGTA qPCR SLAM antisens 5'-3' TCTCGTTCTCCTGGGTTTTG qPCR Mincle sens 5'-3' TGGCAATGGGTGGATGATA qPCR Mincle antisens 5'-3' AGTCCCTTATGGTGGCACAG qPCR Ptgs2 sens 5'-3' ACCTCTGCGATGCTCTTCC qPCR PTGS2 antisens 5'-3' TCATACATTCCCCACGGTTT qPCR IDO1 sens 5'-3' CCCTGGGGTACATCACCAT qPCR IDO1 antisens 5'-3' GAGAGCTCGCAGTAGGGAAC qPCR IL-4 sens 5'-3' ACTCTTTCGGGCTTTTCGAT qPCR IL-4 antisens 5'-3' TTGCATGATGCTCTTTAGGC qPCR SOCS1 sens 5'-3' CACCTTCTTGGTGCGCGAC qPCR SOCS1 antisens 5'-3' AAGCCATCTTCACGCTGAGC qPCR SOCS2 sens 5'-3' GTTGCCGGAGGAACAGTC qPCR SOCS2 antisens 5'-3' TCTCTTTGGCTTCATTAACAGTCA qPCR SOCS3 sens 5'-3' CCTTCAGCTCCAAAAGCGAGTAC qPCR SOCS3 antisens 5'-3' GCTCTCCTGCAGCTTGCG qPCR TNFα sens 5'-3' CATCTTCTCAAAATTCGAGTGACAA qPCR
125
TNFα antisens 5'-3' TGGGAGTAGACAAGGTACAACCC qPCR MIP2 sens 5'-3' GCGGTCAAAAAGTTTGCCTTG qPCR MIP2 antisens 5'-3' CTCCTCCTTTCCAGGTCAGTT qPCR IFNγ sens 5'-3' TCAAGTGGCATAGATGTGGAAGAA qPCR IFNγ antisens 5'-3' TGGCTCTGCAGGATTTTCATG qPCR NOS2 sens 5'-3' CAGCTGGGCTGTACAAACCTT qPCR NOS2 antisens 5'-3' CATTGGAAGTGAAGCGTTTCG qPCR IL-12b sens 5'-3' AAATTACTCCGGACGGTTCA qPCR IL-12b antisens 5'-3' ACAGAGACGCCATTCCACAT qPCR IL-6 sens 5'-3' GAGGATACCACTCCCAACAGACC qPCR IL-6 antisens 5'-3' AAGTGCATCATCGTTGTTCATACA qPCR IFNβ sens 5'-3' GAAAAGCAAGAGGAAAGATT qPCR IFNβ antisens 5'-3' AAGTCTTCGAATGATGAGAA qPCR IL1β sens 5'-3' TCCAGGATGAGGACATGAGCAC qPCR IL1β antisens 5'-3' GAACGTCACACACCAGCAGGTTA qPCR
IFN-α sens 5'-3' GAGGAAATACTTCCACAGGATCACT
GT qPCR
IFN-α antisens 5'-3' GACAGGGCTCTCCAGACTTCTGCTC
TG qPCR KC sens 5'-3' CAGCCACCCGCTCGCTTCTC qPCR KC antisens 5'-3' TCAAGGCAAGCCTCGCGACCAT qPCR Pour clonage
SLAM2-3 sens 5'-3' GGGGACAAGTTTGTACAAAAAAGC
AGGCTTCACAGGTGGAGGTGTGATGGAT
Clonage Gateway Tag en N terminal de CD150/SLAM
SLAM2-3 antisens
5'-3' GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACTGAGGAGGATTCCTGC
TTGC
Clonage Gateway Tag en N terminal de CD150/SLAM
Omp25 sens 5'-3' CCCGAATTCATGCGCACTCTTAAGT
CTCTCG
Clonage pour complémentation (site EcoRI
ajouté + codon initiation ATG)
Omp25 antisens 5'-3' CCCGGATCCTTAGAACTTGTAGCCG Clonage pour
complémentation (site BamHI ajouté + codon STOP)
Clonage de SLAM : Système Gateway
Nous avons voulu construire une protéine de fusion entre un tag (HA ou myc) et les exons 2
et 3 de SLAM (correspondant à l’ectodomaine de la protéine). Pour cela nous avons utilisé le
système Gateway
Complémentation de ∆omp25
Pour complémenter le mutant ∆omp25, le gène omp25 a été amplifié par PCR (25 cycles) à
partir d’un extrait de Brucella heat killed (1/10), avec de la HiFi Taq polymérase (invitrogen)
126
selon les instructions du fabricant. Après purification à partir du gel d’agarose 1 %, 7 µl du
produit de PCR, 2 µl de Taq Buffer (5X, Promega), 0,2mM de ATP, 5 unités de Taq
(Promega) sont incubés à 70°C durant 30 minutes pour du « A-tailing », permettant le clonage
dans le vecteur pGEM-T (Promega).
3 µl de cette réaction sont utilisés pour la ligation dans le pGEM-T selon les instructions du
fabricant. Après transformation dans des E. coli JMH109, les clones sélectionnés sont
séquencés, puis 1 µg de plasmide est digéré avec EcoRI HF et BamHI (NEB). 1 µg du vecteur
de destination, pBBR-MCS4 (Ampicilline résistant) a aussi été digéré par les mêmes
enzymes. Après la digestion enzymatique, les fragments sont chargés sur un gel, et purifiés à
partir du gel (en utilisant qiaquick gel extraction de Qiagen selon les instructions du fabricant.
7,5 µl d’insert (omp25 provenant du pGEM digéré) et 2,5 µl de pBBR-MCS4 sont utilisés
pour une ligation avec la T4 DNA ligase (Promega) sur la nuit à 16° C. 5 µl de la ligation est
transformé dans des DH5α. A partir de cette culture, des minipreps sont faites et le plasmide
pBBR-MCS4 omp25 est transformé dans des S17 λpir.
Conjugaison pour échange de plasmide
50µl de S17 λpir contenant le plasmide recombiné pBBR-MCS4 omp25 sont ajoutés à 1 ml
de culture liquide (phase stationnaire) de la souche ∆omp25. Après 2 lavages en TSB, le culot
est resuspendu dans 100µl de TSB et mis sur une boite durant 4h à 37°C ou 16h à température
ambiante. Les bactéries sont ensuite ré-isolées sur une boite contenant de l’ampicilline, de
l’acide nalidixique et de la kanamycine et mises à 37°C durant 3-4 jours.
Génotypage des souris Knock-Out (KO)
Les queues des souris à génotyper sont coupées puis digérées dans 500 µl de tampon de lyse à
55°C durant une nuit avec agitation (750rpm). Le lendemain, les échantillons sont centrifugés,
à vitesse maximale, 15 min pour éliminer les déchets, le surnageant est récupéré et dilué
volume à volume avec de l’isopropanol 100 %, une fois l’ADN précipité, les échantillons sont
centrifugés à vitesse maximale 5 min, puis les culots sont séchés, avant d’être resolubilisés en
H2O sans nucléases (Qiagen) à 55°C durant 1 h sous agitation.
La quantité d’ADN est mesurée au nanodrop (Applied Biosystem) 200 ng de cet ADN sera
utilisé pour la PCR. La PCR est effectuée avec un kit Taq Polymérase de Takara selon les
instructions du vendeur, les amorces utilisées pour détecter l’allèle sauvage sont : 5’ –
GAAGGATGGTACTTGGTG–3’ et 5’ –CTCAGAACCTCTGCTGTAGC–3’, pour détecter
l’allèle KO les amorces utilisées sont 5’ –CTCAGAACCTCTGCTGTAGC–3’ et 5’–
127
TCCGGCAGTTGGGAAGCAAAG–3’. Après migration sur gel d’agarose 1 % en TAE.
L’allèle sauvage migrera à 500 bp et l’allèle KO à 800 bp.
Transfection
Les cellules Cos-7 sont trypsinisées et diluées dans des boîtes de culture appropriées, 8 h
après les cellules sont transfectées comme décrit ci-dessous. Du Fugène (Promega) est ajouté
aux 4/5 du volume de DMEM final et incubé à température ambiante 5 min. Durant ce temps
l’ADN est dilué dans 1/5 volume de DMEM final. L’ADN est ensuite ajouté au Fugène et
incubé durant 15 min à température ambiante. Le mélange ADN / Fugène est ensuite ajouté
aux cellules. 1.5µg d’ADN est utilisé pour la transfection. Les cellules sont récoltées 48 h
post-transfection.
I. A. BIOCHIMIE
ELISA
Les cytokines et sérum quantifiés par ELISA l’ont été en utilisant les kits eBiosciences
correspondants : TNF-α, IFN-β, IL12p70, IL23/IL12p40 et IL1-β et selon les instructions du
fabricant.
Extraction de protéines
Les cellules sont récoltées, lavées une fois en PBS, puis lysées dans du tampon de lyse
composé de PBS 1X, Triton 0.1 %, et d’inhibiteur de protéases (PMSF 20 µg/ml, LECK 20
µg/ml, TPCK 20 µg/ml dilué en éthanol 100%). Le lysat est congelé à -80°C. Après
décongélation, le lysat est centrifugé à vitesse maximale durant 10 min à 4°C. Le surnageant
est récupéré et congelé à -80°C ou -20°C selon l’utilisation.
Pull-down myc::CD150(2-3) et myc::SifA
Les billes de protéines G (GE Healthcare) sont lavées en PBS, 0.1 % NP-40 et inhibiteur de
protéases (tampon A). 50 µl de billes est ajouté à 10 µl d’anticorps anti-myc 9E10 (à 10
mg/ml stock) dans 500 µl de tampon et incubé 1 h à 4°C sous agitation. Après des lavages, les
billes couplées à l’anticorps anti-myc (1/10) sont incubées durant 1 h à 4°C sous agitation
avec les extraits protéiques provenant des COS-7 transfectés avec myc::CD150(2-3) ou myc::
SifA. Après 3 lavages en tampon A, les billes, liées aux protéines tagguées myc sont incubées
128
durant 1 h à 4 °C sous agitation avec 1 µg d’extraits membranaires de Brucella sauvage ou
mutant pour omp25. Après 5 lavages en tampon A contenant du NaCl 0.5 M, et du SDS à
0.001 % les échantillons, resuspendus en tampon de charge SDS 5X (Bleu de bromophénol à
0.05 %, 50 % glycérol, 10 % SDS, 0.25 M de Tris-HCl pH 6.8, 0.5 M de DTT (ou 5% de β–
mercaptoéthanol)) sont bouillis à 95 °C durant 10 minutes, puis centrifugés 5 min à vitesse
maximale. Le surnageant est analysé par western blot pour détecter la présence de Omp25.
Gel SDS-PAGE et western blot
Les échantillons sont chargés sur un gel SDS-PAGE 12 %, après migration, les protéines sont
transférées sur une membrane PVDF (pore 0.45 µm, Millipore) durant 35 min. Après 1 h de
blocage dans du PBS / Tween 0.1 % / 4 % lait (tampon de blocage), la membrane est incubée
toute la nuit à 4° C avec l’anticorps primaire dilué dans du tampon de blocage. Après 3
lavages en PBS / Tween 0.1 %, la membrane est incubée durant 1 h à température ambiante
avec l’anticorps secondaire couplé à l’HRP (dans le cas du pull-down, un anticorps Mouse
IgG TrueBlot (eBioscience) est utilisé pour minimiser les bandes non spécifiques). Après 3
nouveaux lavages, la membrane est incubée 1 min en ECL (Pierce) avant d’être exposée au
film (ECL Amersham, Pierce).
129
V. Références
130
1. D'Anastasio, R., et al., Possible brucellosis in an early hominin skeleton from sterkfontein,
South Africa. PLoS One, 2009. 4(7): p. e6439. 2. D'Anastasio, R., et al., Origin, evolution and paleoepidemiology of brucellosis. Epidemiology
and infection, 2011. 139(1): p. 149-56. 3. Moreno, E., Retrospective and prospective perspectives on zoonotic brucellosis. Frontiers in
microbiology, 2014. 4. Pappas, G., et al., The new global map of human brucellosis. The Lancet infectious diseases,
2006. 6(2): p. 91-9. 5. Pappas, G., The changing Brucella ecology: novel reservoirs, new threats. International
journal of antimicrobial agents, 2010. 36 Suppl 1: p. S8-11. 6. Mick, V., et al., Brucella melitensis in France: persistence in wildlife and probable spillover
from Alpine ibex to domestic animals. PLoS One, 2014. 9(4): p. e94168. 7. Garin-Bastuji, B., et al., Reemergence of Brucella melitensis Infection in Wildlife, France.
Emerging infectious diseases, 2014. 20(9): p. 1570-1. 8. Ian Maudlin, S.W.-M., The Control of Neglected Zoonotic Diseases - A route to poverty
alleviation, 2006, WHO: Geneva. 9. Atluri, V.L., et al., Interactions of the Human Pathogenic Brucella Species with Their Hosts.
Annu Rev Microbiol, 2011. 65: p. 523-541. 10. Martirosyan, A., E. Moreno, and J.P. Gorvel, An evolutionary strategy for a stealthy
intracellular Brucella pathogen. Immunological reviews, 2011. 240(1): p. 211-34. 11. Corbel, M.J., Brucellosis: an overview. Emerging infectious diseases, 1997. 3(2): p. 213-21. 12. Kato, Y., et al., Brucellosis in a returned traveler and his wife: probable person-to-person
transmission of Brucella melitensis. Journal of travel medicine, 2007. 14(5): p. 343-5. 13. Godfroid, J., et al., Brucellosis at the animal/ecosystem/human interface at the beginning of
the 21st century. Preventive veterinary medicine, 2011. 102(2): p. 118-31. 14. Moriyon, I., et al., Rough vaccines in animal brucellosis: structural and genetic basis and
present status. Veterinary research, 2004. 35(1): p. 1-38. 15. Yazdi, H.S., et al., Abortions in pregnant dairy cows after vaccination with Brucella abortus
strain RB51. The Veterinary record, 2009. 165(19): p. 570-1. 16. Barrio, M.B., et al., Rough mutants defective in core and O-polysaccharide synthesis and
export induce antibodies reacting in an indirect ELISA with smooth lipopolysaccharide and
are less effective than Rev 1 vaccine against Brucella melitensis infection of sheep. Vaccine, 2009. 27(11): p. 1741-9.
17. Young, E.J., et al., Thrombocytopenic purpura associated with brucellosis: report of 2 cases
and literature review. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 2000. 31(4): p. 904-9.
18. Pappas, G., et al., Doxycycline-rifampicin: physicians' inferior choice in brucellosis or how
convenience reigns over science. The Journal of infection, 2007. 54(5): p. 459-62. 19. Cardoso, P.G., et al., Brucella spp noncanonical LPS: structure, biosynthesis, and interaction
with host immune system. Microbial cell factories, 2006. 5: p. 13. 20. Ferrero, M.C., C.A. Fossati, and P.C. Baldi, Smooth Brucella strains invade and replicate in
human lung epithelial cells without inducing cell death. Microbes and infection / Institut Pasteur, 2009. 11(4): p. 476-83.
21. Arellano-Reynoso, B., et al., Cyclic beta-1,2-glucan is a Brucella virulence factor required for
intracellular survival. Nat Immunol, 2005. 6(6): p. 618-25. 22. Martirosyan, A., et al., Brucella beta 1,2 cyclic glucan is an activator of human and mouse
dendritic cells. PLoS pathogens, 2012. 8(11): p. e1002983. 23. Salcedo, S.P., et al., Brucella control of dendritic cell maturation is dependent on the TIR-
containing protein Btp1. PLoS pathogens, 2008. 4(2): p. e21. 24. Desvaux, M., et al., Secretion and subcellular localizations of bacterial proteins: a semantic
awareness issue. Trends in microbiology, 2009. 17(4): p. 139-45. 25. McBride, M.J. and Y. Zhu, Gliding motility and Por secretion system genes are widespread
among members of the phylum bacteroidetes. Journal of bacteriology, 2013. 195(2): p. 270-8. 26. Burns, D.L., Type IV transporters of pathogenic bacteria. Current opinion in microbiology,
2003. 6(1): p. 29-34.
131
27. O'Callaghan, D., et al., A homologue of the Agrobacterium tumefaciens VirB and Bordetella
pertussis Ptl type IV secretion systems is essential for intracellular survival of Brucella suis. Molecular microbiology, 1999. 33(6): p. 1210-20.
28. Llosa, M., C. Roy, and C. Dehio, Bacterial type IV secretion systems in human disease. Mol Microbiol, 2009. 73(2): p. 141-51.
29. Fronzes, R., H. Remaut, and G. Waksman, Architectures and biogenesis of non-flagellar
protein appendages in Gram-negative bacteria. The EMBO journal, 2008. 27(17): p. 2271-80. 30. Lacerda, T.L., S.P. Salcedo, and J.P. Gorvel, Brucella T4SS: the VIP pass inside host cells.
Current opinion in microbiology, 2013. 16(1): p. 45-51. 31. Watarai, M., S. Makino, and T. Shirahata, An essential virulence protein of Brucella abortus,
VirB4, requires an intact nucleoside-triphosphate-binding domain. Microbiology, 2002. 148(Pt 5): p. 1439-46.
32. Sieira, R., et al., Integration host factor is involved in transcriptional regulation of the
Brucella abortus virB operon. Molecular microbiology, 2004. 54(3): p. 808-22. 33. Boschiroli, M.L., et al., The Brucella suis virB operon is induced intracellularly in
macrophages. Proceedings of the National Academy of Sciences of the United States of America, 2002. 99(3): p. 1544-9.
34. Delrue, R.M., et al., A quorum-sensing regulator controls expression of both the type IV
secretion system and the flagellar apparatus of Brucella melitensis. Cellular microbiology, 2005. 7(8): p. 1151-61.
35. Celli, J., et al., Brucella evades macrophage killing via VirB-dependent sustained interactions
with the endoplasmic reticulum. The Journal of experimental medicine, 2003. 198(4): p. 545-56.
36. Rolan, H.G. and R.M. Tsolis, Mice lacking components of adaptive immunity show increased
Brucella abortus virB mutant colonization. Infection and immunity, 2007. 75(6): p. 2965-73. 37. Verstreate, D.R., et al., Outer membrane proteins of Brucella abortus: isolation and
characterization. Infection and immunity, 1982. 35(3): p. 979-89. 38. Douglas, J.T., et al., Porins of Brucella species. Infection and immunity, 1984. 44(1): p. 16-
21. 39. Cloeckaert, A., et al., Major outer membrane proteins of Brucella spp.: past, present and
future. Veterinary microbiology, 2002. 90(1-4): p. 229-47. 40. Cloeckaert, A., et al., Molecular and immunological characterization of the major outer
membrane proteins of Brucella. FEMS microbiology letters, 1996. 145(1): p. 1-8. 41. Vizcaino, N., et al., Molecular characterization of a Brucella species large DNA fragment
deleted in Brucella abortus strains: evidence for a locus involved in the synthesis of a
polysaccharide. Infection and immunity, 1999. 67(6): p. 2700-12. 42. Barrionuevo, P., et al., Brucella abortus inhibits major histocompatibility complex class II
expression and antigen processing through interleukin-6 secretion via Toll-like receptor 2. Infection and immunity, 2008. 76(1): p. 250-62.
43. Pasquevich, K.A., et al., Immunization with recombinant Brucella species outer membrane
protein Omp16 or Omp19 in adjuvant induces specific CD4+ and CD8+ T cells as well as
systemic and oral protection against Brucella abortus infection. Infection and immunity, 2009. 77(1): p. 436-45.
44. Billard, E., J. Dornand, and A. Gross, Interaction of Brucella suis and Brucella abortus rough
strains with human dendritic cells. Infection and immunity, 2007. 75(12): p. 5916-23. 45. Manterola, L., et al., BvrR/BvrS-controlled outer membrane proteins Omp3a and Omp3b are
not essential for Brucella abortus virulence. Infection and immunity, 2007. 75(10): p. 4867-74.
46. Martin-Martin, A.I., et al., Importance of the Omp25/Omp31 family in the internalization and
intracellular replication of virulent B. ovis in murine macrophages and HeLa cells. Microbes and infection / Institut Pasteur, 2008. 10(6): p. 706-10.
47. Billard, E., J. Dornand, and A. Gross, Brucella suis prevents human dendritic cell maturation
and antigen presentation through regulation of tumor necrosis factor alpha secretion. Infection and immunity, 2007. 75(10): p. 4980-9.
132
48. Jubier-Maurin, V., et al., Major outer membrane protein Omp25 of Brucella suis is involved in
inhibition of tumor necrosis factor alpha production during infection of human macrophages. Infection and immunity, 2001. 69(8): p. 4823-30.
49. Edmonds, M.D., A. Cloeckaert, and P.H. Elzer, Brucella species lacking the major outer
membrane protein Omp25 are attenuated in mice and protect against Brucella melitensis and
Brucella ovis. Veterinary microbiology, 2002. 88(3): p. 205-21. 50. Pollak, C.N., et al., Outer membrane vesicles from Brucella abortus promote bacterial
internalization by human monocytes and modulate their innate immune response. PLoS One, 2012. 7(11): p. e50214.
51. Avila-Calderon, E.D., et al., Characterization of outer membrane vesicles from Brucella
melitensis and protection induced in mice. Clinical & developmental immunology, 2012. 2012: p. 352493.
52. Grant, B.D. and J.G. Donaldson, Pathways and mechanisms of endocytic recycling. Nature reviews. Molecular cell biology, 2009. 10(9): p. 597-608.
53. Lee, J.J., et al., Interplay between clathrin and Rab5 controls the early phagocytic trafficking
and intracellular survival of Brucella abortus within HeLa cells. The Journal of biological chemistry, 2013. 288(39): p. 28049-57.
54. Veiga, E., et al., Invasive and adherent bacterial pathogens co-Opt host clathrin for infection. Cell host & microbe, 2007. 2(5): p. 340-51.
55. Veiga, E. and P. Cossart, Listeria hijacks the clathrin-dependent endocytic machinery to
invade mammalian cells. Nature cell biology, 2005. 7(9): p. 894-900. 56. Van Nhieu, G.T., et al., Mutations in the cytoplasmic domain of the integrin beta1 chain
indicate a role for endocytosis factors in bacterial internalization. The Journal of biological chemistry, 1996. 271(13): p. 7665-72.
57. Wyrick, P.B., et al., Entry of genital Chlamydia trachomatis into polarized human epithelial
cells. Infection and immunity, 1989. 57(8): p. 2378-89. 58. Veiga, E. and P. Cossart, The role of clathrin-dependent endocytosis in bacterial
internalization. Trends in cell biology, 2006. 16(10): p. 499-504. 59. Baldwin, C.L. and R. Goenka, Host immune responses to the intracellular bacteria Brucella:
does the bacteria instruct the host to facilitate chronic infection? Critical reviews in immunology, 2006. 26(5): p. 407-42.
60. Guzman-Verri, C., et al., GTPases of the Rho subfamily are required for Brucella abortus
internalization in nonprofessional phagocytes: direct activation of Cdc42. The Journal of biological chemistry, 2001. 276(48): p. 44435-43.
61. Pei, J., J.E. Turse, and T.A. Ficht, Evidence of Brucella abortus OPS dictating uptake and
restricting NF-kappaB activation in murine macrophages. Microbes and infection / Institut Pasteur, 2008. 10(6): p. 582-90.
62. von Bargen, K., J.P. Gorvel, and S.P. Salcedo, Internal affairs: investigating the Brucella
intracellular lifestyle. FEMS microbiology reviews, 2012. 36(3): p. 533-62. 63. Watarai, M., et al., Cellular prion protein promotes Brucella infection into macrophages. The
Journal of experimental medicine, 2003. 198(1): p. 5-17. 64. Fontes, P., et al., Absence of evidence for the participation of the macrophage cellular prion
protein in infection with Brucella suis. Infect Immun, 2005. 73(10): p. 6229-36. 65. Kim, S., et al., Lipid raft microdomains mediate class A scavenger receptor-dependent
infection of Brucella abortus. Microb Pathog, 2004. 37(1): p. 11-9. 66. Lee, J.J., et al., Toll-like receptor 4-linked Janus kinase 2 signaling contributes to
internalization of Brucella abortus by macrophages. Infection and immunity, 2013. 81(7): p. 2448-58.
67. Czibener, C. and J.E. Ugalde, Identification of a unique gene cluster of Brucella spp. that
mediates adhesion to host cells. Microbes Infect, 2012. 14(1): p. 79-85. 68. Castaneda-Roldan, E.I., et al., Characterization of SP41, a surface protein of Brucella
associated with adherence and invasion of host epithelial cells. Cell Microbiol, 2006. 8(12): p. 1877-87.
133
69. Guzman-Verri, C., et al., GTPases of the Rho subfamily are required for Brucella abortus
internalization in nonprofessional phagocytes: direct activation of Cdc42. J Biol Chem, 2001. 276(48): p. 44435-43.
70. Starr, T., et al., Brucella intracellular replication requires trafficking through the late
endosomal/lysosomal compartment. Traffic, 2008. 9(5): p. 678-94. 71. Celli, J., Surviving inside a macrophage: the many ways of Brucella. Res Microbiol, 2006.
157(2): p. 93-8. 72. de Barsy, M., et al., Identification of a Brucella spp. secreted effector specifically interacting
with human small GTPase Rab2. Cell Microbiol, 2011. 13(7): p. 1044-58. 73. Fugier, E., et al., The glyceraldehyde-3-phosphate dehydrogenase and the small GTPase Rab
2 are crucial for Brucella replication. PLoS Pathog, 2009. 5(6): p. e1000487. 74. Myeni, S., et al., Brucella modulates secretory trafficking via multiple type IV secretion
effector proteins. PLoS pathogens, 2013. 9(8): p. e1003556. 75. Dohmer, P.H., et al., Identification of a type IV secretion substrate of Brucella abortus that
participates in the early stages of intracellular survival. Cellular microbiology, 2014. 16(3): p. 396-410.
76. de Jong, M.F., et al., Identification of VceA and VceC, two members of the VjbR regulon that
are translocated into macrophages by the Brucella type IV secretion system. Molecular microbiology, 2008. 70(6): p. 1378-96.
77. Celli, J., S.P. Salcedo, and J.P. Gorvel, Brucella coopts the small GTPase Sar1 for
intracellular replication. Proceedings of the National Academy of Sciences of the United States of America, 2005. 102(5): p. 1673-8.
78. Pizarro-Cerda, J., et al., Virulent Brucella abortus prevents lysosome fusion and is distributed
within autophagosome-like compartments. Infection and immunity, 1998. 66(5): p. 2387-92. 79. Pizarro-Cerda, J., et al., Brucella abortus transits through the autophagic pathway and
replicates in the endoplasmic reticulum of nonprofessional phagocytes. Infection and immunity, 1998. 66(12): p. 5711-24.
80. Bellaire, B.H., R.M. Roop, 2nd, and J.A. Cardelli, Opsonized virulent Brucella abortus
replicates within nonacidic, endoplasmic reticulum-negative, LAMP-1-positive phagosomes in
human monocytes. Infection and immunity, 2005. 73(6): p. 3702-13. 81. Starr, T., et al., Selective subversion of autophagy complexes facilitates completion of the
Brucella intracellular cycle. Cell host & microbe, 2012. 11(1): p. 33-45. 82. Barquero-Calvo, E., et al., Brucella abortus uses a stealthy strategy to avoid activation of the
innate immune system during the onset of infection. PLoS One, 2007. 2(7): p. e631. 83. Spera, J.M., D.J. Comerci, and J.E. Ugalde, Brucella alters the immune response in a prpA-
dependent manner. Microbial pathogenesis, 2014. 67-68: p. 8-13. 84. Gorvel, L., et al., Intracellular bacteria interfere with dendritic cell functions: role of the type
I interferon pathway. PLoS One, 2014. 9(6): p. e99420. 85. Corsetti, P.P., et al., Lack of endogenous IL-10 enhances production of proinflammatory
cytokines and leads to Brucella abortus clearance in mice. PLoS One, 2013. 8(9): p. e74729. 86. Takeuchi, O. and S. Akira, Pattern recognition receptors and inflammation. Cell, 2010.
140(6): p. 805-20. 87. Takeda, K. and S. Akira, TLR signaling pathways. Semin Immunol, 2004. 16(1): p. 3-9. 88. Dinarello, C.A., Proinflammatory cytokines. Chest, 2000. 118(2): p. 503-8. 89. Parkin, J. and B. Cohen, An overview of the immune system. Lancet, 2001. 357(9270): p.
1777-89. 90. Giambartolomei, G.H., et al., Lipoproteins, not lipopolysaccharide, are the key mediators of
the proinflammatory response elicited by heat-killed Brucella abortus. Journal of immunology, 2004. 173(7): p. 4635-42.
91. Campos, M.A., et al., Role of Toll-like receptor 4 in induction of cell-mediated immunity and
resistance to Brucella abortus infection in mice. Infection and immunity, 2004. 72(1): p. 176-86.
92. Copin, R., et al., MyD88-dependent activation of B220-CD11b+LY-6C+ dendritic cells during
Brucella melitensis infection. Journal of immunology, 2007. 178(8): p. 5182-91.
134
93. Lapaque, N., et al., Differential inductions of TNF-alpha and IGTP, IIGP by structurally
diverse classic and non-classic lipopolysaccharides. Cellular microbiology, 2006. 8(3): p. 401-13.
94. Conde-Alvarez, R., et al., The lipopolysaccharide core of Brucella abortus acts as a shield
against innate immunity recognition. PLoS pathogens, 2012. 8(5): p. e1002675. 95. Berguer, P.M., et al., A polymeric bacterial protein activates dendritic cells via TLR4. Journal
of immunology, 2006. 176(4): p. 2366-72. 96. Macedo, G.C., et al., Central role of MyD88-dependent dendritic cell maturation and
proinflammatory cytokine production to control Brucella abortus infection. Journal of immunology, 2008. 180(2): p. 1080-7.
97. Gomes, M.T., et al., The role of innate immune signals in immunity to Brucella abortus. Frontiers in cellular and infection microbiology, 2012. 2: p. 130.
98. Huang, L.Y., et al., Th1-like cytokine induction by heat-killed Brucella abortus is dependent
on triggering of TLR9. Journal of immunology, 2005. 175(6): p. 3964-70. 99. Macedo, G.C., et al., Central role of MyD88-dependent dendritic cell maturation and
proinflammatory cytokine production to control Brucella abortus infection. J Immunol, 2008. 180(2): p. 1080-7.
100. de Almeida, L.A., et al., Toll-like receptor 6 plays an important role in host innate resistance
to Brucella abortus infection in mice. Infection and immunity, 2013. 81(5): p. 1654-62. 101. Nathan, C., Neutrophils and immunity: challenges and opportunities. Nature reviews.
Immunology, 2006. 6(3): p. 173-82. 102. Martinez de Tejada, G., et al., The outer membranes of Brucella spp. are resistant to
bactericidal cationic peptides. Infection and immunity, 1995. 63(8): p. 3054-61. 103. Freer, E., et al., Brucella-Salmonella lipopolysaccharide chimeras are less permeable to
hydrophobic probes and more sensitive to cationic peptides and EDTA than are their native
Brucella sp. counterparts. Journal of bacteriology, 1996. 178(20): p. 5867-76. 104. Moreno, E., D.T. Berman, and L.A. Boettcher, Biological activities of Brucella abortus
lipopolysaccharides. Infection and immunity, 1981. 31(1): p. 362-70. 105. Sarma, J.V. and P.A. Ward, The complement system. Cell and tissue research, 2011. 343(1): p.
227-35. 106. Fernandez-Prada, C.M., et al., Deletion of wboA enhances activation of the lectin pathway of
complement in Brucella abortus and Brucella melitensis. Infection and immunity, 2001. 69(7): p. 4407-16.
107. Zhang, L., et al., A second IgG-binding protein in Staphylococcus aureus. Microbiology, 1998. 144 ( Pt 4): p. 985-91.
108. Blom, A.M., T. Hallstrom, and K. Riesbeck, Complement evasion strategies of pathogens-
acquisition of inhibitors and beyond. Molecular immunology, 2009. 46(14): p. 2808-17. 109. Maite Iriarte, D.G., Rose M.Delrue, Daniel Monreal, , I.L.-G. Raquel Conde, Jean-Jacques
Letesson, and , and I. Moriyón, Brucella Lipopolysaccharide: Structure, Biosynthesis and
Genetics - Brucella Molecular and Cellular Biology, I. López-Goñi and I. Moriyón, Editors. 2004: Norfolk.
110. Kreutzer, D.L., L.A. Dreyfus, and D.C. Robertson, Interaction of polymorphonuclear
leukocytes with smooth and rough strains of Brucella abortus. Infection and immunity, 1979. 23(3): p. 737-42.
111. Canning, P.C., et al., Isolation of components of Brucella abortus responsible for inhibition of
function in bovine neutrophils. The Journal of infectious diseases, 1985. 152(5): p. 913-21. 112. Jaeger, B.N., et al., Neutrophil depletion impairs natural killer cell maturation, function, and
homeostasis. The Journal of experimental medicine, 2012. 209(3): p. 565-80. 113. Barquero-Calvo, E., et al., Neutrophils exert a suppressive effect on Th1 responses to
intracellular pathogen Brucella abortus. PLoS pathogens, 2013. 9(2): p. e1003167. 114. Zwerdling, A., et al., Brucella abortus activates human neutrophils. Microbes and infection /
Institut Pasteur, 2009. 11(6-7): p. 689-97. 115. Co, D.O., et al., Mycobacterial granulomas: keys to a long-lasting host-pathogen relationship.
Clinical immunology, 2004. 113(2): p. 130-6.
135
116. Copin, R., et al., In situ microscopy analysis reveals local innate immune response developed
around Brucella infected cells in resistant and susceptible mice. PLoS pathogens, 2012. 8(3): p. e1002575.
117. Gross, A., et al., In vitro Brucella suis infection prevents the programmed cell death of human
monocytic cells. Infection and immunity, 2000. 68(1): p. 342-51. 118. Wang, M., et al., High levels of nitric oxide production decrease early but increase late
survival of Brucella abortus in macrophages. Microbial pathogenesis, 2001. 31(5): p. 221-30. 119. Caron, E., et al., Brucella species release a specific, protease-sensitive, inhibitor of TNF-
alpha expression, active on human macrophage-like cells. Journal of immunology, 1996. 156(8): p. 2885-93.
120. Barrionuevo, P., et al., Brucella abortus inhibits IFN-gamma-induced FcgammaRI expression
and FcgammaRI-restricted phagocytosis via toll-like receptor 2 on human
monocytes/macrophages. Microbes and infection / Institut Pasteur, 2011. 13(3): p. 239-50. 121. Xavier, M.N., et al., CD4+ T cell-derived IL-10 promotes Brucella abortus persistence via
modulation of macrophage function. PLoS pathogens, 2013. 9(6): p. e1003454. 122. Horowitz, A., K.A. Stegmann, and E.M. Riley, Activation of natural killer cells during
microbial infections. Frontiers in immunology, 2011. 2: p. 88. 123. Fernandes, D.M., R. Benson, and C.L. Baldwin, Lack of a role for natural killer cells in early
control of Brucella abortus 2308 infections in mice. Infection and immunity, 1995. 63(10): p. 4029-33.
124. Salmeron, I., et al., Impaired activity of natural killer cells in patients with acute brucellosis. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 1992. 15(5): p. 764-70.
125. Dornand, J., et al., Impairment of intramacrophagic Brucella suis multiplication by human
natural killer cells through a contact-dependent mechanism. Infection and immunity, 2004. 72(4): p. 2303-11.
126. Gao, N., et al., Regulatory role of natural killer (NK) cells on antibody responses to Brucella
abortus. Innate immunity, 2011. 17(2): p. 152-63. 127. Banchereau, J., et al., Immunobiology of dendritic cells. Annu Rev Immunol, 2000. 18: p. 767-
811. 128. Joffre, O., et al., Inflammatory signals in dendritic cell activation and the induction of
adaptive immunity. Immunol Rev, 2009. 227(1): p. 234-47. 129. Hackstein, H. and A.W. Thomson, Dendritic cells: emerging pharmacological targets of
immunosuppressive drugs. Nature reviews. Immunology, 2004. 4(1): p. 24-34. 130. Archambaud, C., et al., Contrasting roles of macrophages and dendritic cells in controlling
initial pulmonary Brucella infection. Eur J Immunol, 2010. 40(12): p. 3458-71. 131. Heller, M.C., et al., Characterization of Brucella abortus infection of bovine monocyte-
derived dendritic cells. Veterinary immunology and immunopathology, 2012. 149(3-4): p. 255-61.
132. Cirl, C., et al., Subversion of Toll-like receptor signaling by a unique family of bacterial
Toll/interleukin-1 receptor domain-containing proteins. Nature medicine, 2008. 14(4): p. 399-406.
133. Sengupta, D., et al., Subversion of innate immune responses by Brucella through the targeted
degradation of the TLR signaling adapter, MAL. Journal of immunology, 2010. 184(2): p. 956-64.
134. Radhakrishnan, G.K., et al., Brucella TIR Domain-containing Protein Mimics Properties of
the Toll-like Receptor Adaptor Protein TIRAP. The Journal of biological chemistry, 2009. 284(15): p. 9892-8.
135. Chaudhary, A., et al., The Brucella TIR-like protein TcpB interacts with the death domain of
MyD88. Biochemical and biophysical research communications, 2012. 417(1): p. 299-304. 136. Alaidarous, M., et al., Mechanism of bacterial interference with TLR4 signaling by Brucella
Toll/interleukin-1 receptor domain-containing protein TcpB. The Journal of biological chemistry, 2014. 289(2): p. 654-68.
137. Gazzinelli, R.T., et al., In the absence of endogenous IL-10, mice acutely infected with
Toxoplasma gondii succumb to a lethal immune response dependent on CD4+ T cells and
136
accompanied by overproduction of IL-12, IFN-gamma and TNF-alpha. Journal of immunology, 1996. 157(2): p. 798-805.
138. Hunter, C.A., et al., IL-10 is required to prevent immune hyperactivity during infection with
Trypanosoma cruzi. Journal of immunology, 1997. 158(7): p. 3311-6. 139. Li, C., I. Corraliza, and J. Langhorne, A defect in interleukin-10 leads to enhanced malarial
disease in Plasmodium chabaudi chabaudi infection in mice. Infection and immunity, 1999. 67(9): p. 4435-42.
140. Jacobs, M., et al., Increased resistance to mycobacterial infection in the absence of
interleukin-10. Immunology, 2000. 100(4): p. 494-501. 141. Capo, C., et al., Production of interleukin-10 and transforming growth factor beta by
peripheral blood mononuclear cells in Q fever endocarditis. Infection and immunity, 1996. 64(10): p. 4143-7.
142. Fernandes, D.M. and C.L. Baldwin, Interleukin-10 downregulates protective immunity to
Brucella abortus. Infection and immunity, 1995. 63(3): p. 1130-3. 143. D'Elios, M.M., et al., T-cell response to bacterial agents. Journal of infection in developing
countries, 2011. 5(9): p. 640-5. 144. Snapper, C.M., F.D. Finkelman, and W.E. Paul, Regulation of IgG1 and IgE production by
interleukin 4. Immunological reviews, 1988. 102: p. 51-75. 145. Ouyang, W., J.K. Kolls, and Y. Zheng, The biological functions of T helper 17 cell effector
cytokines in inflammation. Immunity, 2008. 28(4): p. 454-67. 146. Kagi, D., et al., Fas and perforin pathways as major mechanisms of T cell-mediated
cytotoxicity. Science, 1994. 265(5171): p. 528-30. 147. Grillo, M.J., et al., What have we learned from brucellosis in the mouse model? Veterinary
research, 2012. 43: p. 29. 148. Stevens, M.G., G.W. Pugh, Jr., and L.B. Tabatabai, Effects of gamma interferon and
indomethacin in preventing Brucella abortus infections in mice. Infection and immunity, 1992. 60(10): p. 4407-9.
149. Brandao, A.P., et al., Host susceptibility to Brucella abortus infection is more pronounced in
IFN-gamma knockout than IL-12/beta2-microglobulin double-deficient mice. Clinical & developmental immunology, 2012. 2012: p. 589494.
150. Ko, J., A. Gendron-Fitzpatrick, and G.A. Splitter, Susceptibility of IFN regulatory factor-1
and IFN consensus sequence binding protein-deficient mice to brucellosis. Journal of immunology, 2002. 168(5): p. 2433-40.
151. Murphy, E.A., et al., Interferon-gamma is crucial for surviving a Brucella abortus infection in
both resistant C57BL/6 and susceptible BALB/c mice. Immunology, 2001. 103(4): p. 511-8. 152. Ko, J. and G.A. Splitter, Molecular host-pathogen interaction in brucellosis: current
understanding and future approaches to vaccine development for mice and humans. Clinical microbiology reviews, 2003. 16(1): p. 65-78.
153. Vitry, M.A., et al., Crucial role of gamma interferon-producing CD4+ Th1 cells but
dispensable function of CD8+ T cell, B cell, Th2, and Th17 responses in the control of
Brucella melitensis infection in mice. Infection and immunity, 2012. 80(12): p. 4271-80. 154. Ladel, C.H., C. Blum, and S.H. Kaufmann, Control of natural killer cell-mediated innate
resistance against the intracellular pathogen Listeria monocytogenes by gamma/delta T
lymphocytes. Infection and immunity, 1996. 64(5): p. 1744-9. 155. Hara, T., et al., Predominant activation and expansion of V gamma 9-bearing gamma delta T
cells in vivo as well as in vitro in Salmonella infection. The Journal of clinical investigation, 1992. 90(1): p. 204-10.
156. Rojas, R.E., et al., Regulation of human CD4(+) alphabeta T-cell-receptor-positive (TCR(+))
and gammadelta TCR(+) T-cell responses to Mycobacterium tuberculosis by interleukin-10
and transforming growth factor beta. Infection and immunity, 1999. 67(12): p. 6461-72. 157. Poquet, Y., et al., Expansion of Vgamma9 Vdelta2 T cells is triggered by Francisella
tularensis-derived phosphoantigens in tularemia but not after tularemia vaccination. Infection and immunity, 1998. 66(5): p. 2107-14.
158. Skyberg, J.A., et al., Murine and bovine gammadelta T cells enhance innate immunity against
Brucella abortus infections. PLoS One, 2011. 6(7): p. e21978.
137
159. Ottones, F., et al., Activation of human Vgamma9Vdelta2 T cells by a Brucella suis non-
peptidic fraction impairs bacterial intracellular multiplication in monocytic infected cells. Immunology, 2000. 100(2): p. 252-8.
160. Goenka, R., et al., B cell-deficient mice display markedly enhanced resistance to the
intracellular bacterium Brucella abortus. The Journal of infectious diseases, 2011. 203(8): p. 1136-46.
161. Goenka, R., et al., B Lymphocytes provide an infection niche for intracellular bacterium
Brucella abortus. The Journal of infectious diseases, 2012. 206(1): p. 91-8. 162. Spera, J.M., et al., A B lymphocyte mitogen is a Brucella abortus virulence factor required for
persistent infection. Proceedings of the National Academy of Sciences of the United States of America, 2006. 103(44): p. 16514-9.
163. Spera, J.M., et al., A Brucella virulence factor targets macrophages to trigger B-cell
proliferation. The Journal of biological chemistry, 2013. 288(28): p. 20208-16. 164. Winter, A.J., et al., Capacity of passively administered antibody to prevent establishment of
Brucella abortus infection in mice. Infection and immunity, 1989. 57(11): p. 3438-44. 165. Elzer, P.H., et al., BALB/c mice infected with Brucella abortus express protracted polyclonal
responses of both IgG2a and IgG3 isotypes. Immunology letters, 1994. 42(3): p. 145-50. 166. Hoffmann, E.M. and J.J. Houle, Contradictory roles for antibody and complement in the
interaction of Brucella abortus with its host. Critical reviews in microbiology, 1995. 21(3): p. 153-63.
167. Vitry, M.A., et al., Humoral immunity and CD4+ Th1 cells are both necessary for a fully
protective immune response upon secondary infection with Brucella melitensis. Journal of immunology, 2014. 192(8): p. 3740-52.
168. Rethi, B., et al., SLAM/SLAM interactions inhibit CD40-induced production of inflammatory
cytokines in monocyte-derived dendritic cells. Blood, 2006. 107(7): p. 2821-9. 169. Hahm, B., N. Arbour, and M.B. Oldstone, Measles virus interacts with human SLAM receptor
on dendritic cells to cause immunosuppression. Virology, 2004. 323(2): p. 292-302. 170. Cannons, J.L., S.G. Tangye, and P.L. Schwartzberg, SLAM family receptors and SAP adaptors
in immunity. Annual review of immunology, 2011. 29: p. 665-705. 171. Cocks, B.G., et al., A novel receptor involved in T-cell activation. Nature, 1995. 376(6537): p.
260-3. 172. Aversa, G., et al., Engagement of the signaling lymphocytic activation molecule (SLAM) on
activated T cells results in IL-2-independent, cyclosporin A-sensitive T cell proliferation and
IFN-gamma production. Journal of immunology, 1997. 158(9): p. 4036-44. 173. Punnonen, J., et al., Soluble and membrane-bound forms of signaling lymphocytic activation
molecule (SLAM) induce proliferation and Ig synthesis by activated human B lymphocytes. The Journal of experimental medicine, 1997. 185(6): p. 993-1004.
174. Mavaddat, N., et al., Signaling lymphocytic activation molecule (CDw150) is homophilic but
self-associates with very low affinity. The Journal of biological chemistry, 2000. 275(36): p. 28100-9.
175. Howie, D., et al., The role of SAP in murine CD150 (SLAM)-mediated T-cell proliferation and
interferon gamma production. Blood, 2002. 100(8): p. 2899-907. 176. Castro, A.G., et al., Molecular and functional characterization of mouse signaling
lymphocytic activation molecule (SLAM): differential expression and responsiveness in Th1
and Th2 cells. Journal of immunology, 1999. 163(11): p. 5860-70. 177. Sayos, J., et al., The X-linked lymphoproliferative-disease gene product SAP regulates signals
induced through the co-receptor SLAM. Nature, 1998. 395(6701): p. 462-9. 178. Le Borgne, M. and A.S. Shaw, SAP signaling: a dual mechanism of action. Immunity, 2012.
36(6): p. 899-901. 179. Latour, S., et al., Regulation of SLAM-mediated signal transduction by SAP, the X-linked
lymphoproliferative gene product. Nature immunology, 2001. 2(8): p. 681-90. 180. Chan, B., et al., SAP couples Fyn to SLAM immune receptors. Nature cell biology, 2003. 5(2):
p. 155-60. 181. Cannons, J.L., et al., Biochemical and genetic evidence for a SAP-PKC-theta interaction
contributing to IL-4 regulation. Journal of immunology, 2010. 185(5): p. 2819-27.
138
182. Cannons, J.L., et al., SAP regulates T cell-mediated help for humoral immunity by a
mechanism distinct from cytokine regulation. The Journal of experimental medicine, 2006. 203(6): p. 1551-65.
183. Nichols, K.E., G.A. Koretzky, and C.H. June, SAP: natural inhibitor or grand SLAM of T cell
activation? Nature immunology, 2001. 2(8): p. 665-6. 184. Kane, L.P., et al., Akt provides the CD28 costimulatory signal for up-regulation of IL-2 and
IFN-gamma but not TH2 cytokines. Nature immunology, 2001. 2(1): p. 37-44. 185. McInnes, I.B. and G. Schett, The pathogenesis of rheumatoid arthritis. The New England
journal of medicine, 2011. 365(23): p. 2205-19. 186. Isomaki, P., et al., Increased expression of signaling lymphocytic activation molecule in
patients with rheumatoid arthritis and its role in the regulation of cytokine production in
rheumatoid synovium. Journal of immunology, 1997. 159(6): p. 2986-93. 187. Bleharski, J.R., et al., Signaling lymphocytic activation molecule is expressed on CD40
ligand-activated dendritic cells and directly augments production of inflammatory cytokines. Journal of immunology, 2001. 167(6): p. 3174-81.
188. Kiel, M.J., et al., SLAM family receptors distinguish hematopoietic stem and progenitor cells
and reveal endothelial niches for stem cells. Cell, 2005. 121(7): p. 1109-21. 189. Jordan, M.A., et al., Slamf1, the NKT cell control gene Nkt1. Journal of immunology, 2007.
178(3): p. 1618-27. 190. Kruse, M., et al., Signaling lymphocytic activation molecule is expressed on mature CD83+
dendritic cells and is up-regulated by IL-1 beta. Journal of immunology, 2001. 167(4): p. 1989-95.
191. Wang, N., et al., The cell surface receptor SLAM controls T cell and macrophage functions. The Journal of experimental medicine, 2004. 199(9): p. 1255-64.
192. Wang, N., et al., The costimulatory molecule SLAM is critical for pulmonary allergic
responses. American journal of respiratory cell and molecular biology, 2006. 35(2): p. 206-10. 193. Tatsuo, H., et al., SLAM (CDw150) is a cellular receptor for measles virus. Nature, 2000.
406(6798): p. 893-7. 194. Hahm, B., J.H. Cho, and M.B. Oldstone, Measles virus-dendritic cell interaction via SLAM
inhibits innate immunity: selective signaling through TLR4 but not other TLRs mediates
suppression of IL-12 synthesis. Virology, 2007. 358(2): p. 251-7. 195. Pasquinelli, V., et al., Expression of signaling lymphocytic activation molecule-associated
protein interrupts IFN-gamma production in human tuberculosis. Journal of immunology, 2004. 172(2): p. 1177-85.
196. Pasquinelli, V., et al., IFN-gamma production during active tuberculosis is regulated by
mechanisms that involve IL-17, SLAM, and CREB. The Journal of infectious diseases, 2009. 199(5): p. 661-5.
197. Watanabe, H., et al., Innate immune response in Th1- and Th2-dominant mouse strains. Shock, 2004. 22(5): p. 460-6.
198. Calderon, J., et al., The receptor Slamf1 on the surface of myeloid lineage cells controls
susceptibility to infection by Trypanosoma cruzi. PLoS pathogens, 2012. 8(7): p. e1002799. 199. Berger, S.B., et al., SLAM is a microbial sensor that regulates bacterial phagosome functions
in macrophages. Nature immunology, 2010. 11(10): p. 920-7. 200. Ma, C., et al., Receptor signaling lymphocyte-activation molecule family 1 (Slamf1) regulates
membrane fusion and NADPH oxidase 2 (NOX2) activity by recruiting a Beclin-
1/Vps34/ultraviolet radiation resistance-associated gene (UVRAG) complex. The Journal of biological chemistry, 2012. 287(22): p. 18359-65.
201. Salcedo, S.P., et al., BtpB, a novel Brucella TIR-containing effector protein with immune
modulatory functions. Frontiers in cellular and infection microbiology, 2013. 3: p. 28. 202. Archambaud, C., et al., Contrasting roles of macrophages and dendritic cells in controlling
initial pulmonary Brucella infection. European journal of immunology, 2010. 40(12): p. 3458-71.
203. Bowden, R.A., et al., Evaluation of immunogenicity and protective activity in BALB/c mice of
the 25-kDa major outer-membrane protein of Brucella melitensis (Omp25) expressed in
Escherichia coli. Journal of medical microbiology, 1998. 47(1): p. 39-48.
139
204. Goel, D., et al., Cell mediated immune response after challenge in Omp25 liposome
immunized mice contributes to protection against virulent Brucella abortus 544. Vaccine, 2013. 31(8): p. 1231-7.
205. Goel, D. and R. Bhatnagar, Intradermal immunization with outer membrane protein 25
protects Balb/c mice from virulent B. abortus 544. Molecular immunology, 2012. 51(2): p. 159-68.
206. Commander, N.J., et al., Liposomal delivery of p-ialB and p-omp25 DNA vaccines improves
immunogenicity but fails to provide full protection against B. melitensis challenge. Genetic vaccines and therapy, 2010. 8: p. 5.
207. Cannons, J.L., S.G. Tangye, and P.L. Schwartzberg, SLAM family receptors and SAP adaptors
in immunity. Annu Rev Immunol, 2011. 29: p. 665-705. 208. Berger, S.B., et al., SLAM is a microbial sensor that regulates bacterial phagosome functions
in macrophages. Nat Immunol, 2010. 11(10): p. 920-7. 209. Banchereau, J. and R.M. Steinman, Dendritic cells and the control of immunity. Nature, 1998.
392(6673): p. 245-52. 210. Fernandes, D.M., et al., Comparison of T cell cytokines in resistant and susceptible mice
infected with virulent Brucella abortus strain 2308. FEMS immunology and medical microbiology, 1996. 16(3-4): p. 193-203.
211. Beuzon, C.R. and D.W. Holden, Use of mixed infections with Salmonella strains to study
virulence genes and their interactions in vivo. Microbes and infection / Institut Pasteur, 2001. 3(14-15): p. 1345-52.
212. Lamontagne, J., et al., Extensive cell envelope modulation is associated with virulence in
Brucella abortus. Journal of proteome research, 2007. 6(4): p. 1519-29. 213. Gamazo, C. and I. Moriyon, Release of outer membrane fragments by exponentially growing
Brucella melitensis cells. Infection and immunity, 1987. 55(3): p. 609-15. 214. Ritchie, J.A., et al., Host interferon-gamma inducible protein contributes to Brucella survival.
Frontiers in cellular and infection microbiology, 2012. 2: p. 55. 215. Malaviya, R., et al., The mast cell tumor necrosis factor alpha response to FimH-expressing
Escherichia coli is mediated by the glycosylphosphatidylinositol-anchored molecule CD48. Proceedings of the National Academy of Sciences of the United States of America, 1999. 96(14): p. 8110-5.
216. Veillette, A., et al., SAP expression in T cells, not in B cells, is required for humoral immunity. Proceedings of the National Academy of Sciences of the United States of America, 2008. 105(4): p. 1273-8.
217. Henning, G., et al., Signaling lymphocytic activation molecule (SLAM) regulates T cellular
cytotoxicity. European journal of immunology, 2001. 31(9): p. 2741-50. 218. Mehrle, S., et al., Enhancement of anti-tumor activity in vitro and in vivo by CD150 and SAP.
Molecular immunology, 2008. 45(3): p. 796-804. 219. Kambayashi, T., et al., Cutting edge: Regulation of CD8(+) T cell proliferation by 2B4/CD48
interactions. Journal of immunology, 2001. 167(12): p. 6706-10. 220. Davidson, D., et al., Genetic evidence linking SAP, the X-linked lymphoproliferative gene
product, to Src-related kinase FynT in T(H)2 cytokine regulation. Immunity, 2004. 21(5): p. 707-17.
221. Newman, R.M., et al., Identification and characterization of a novel bacterial virulence factor
that shares homology with mammalian Toll/interleukin-1 receptor family proteins. Infection and immunity, 2006. 74(1): p. 594-601.
222. Low, L.Y., et al., Characterization of a TIR-like protein from Paracoccus denitrificans. Biochemical and biophysical research communications, 2007. 356(2): p. 481-6.
223. Spear, A.M., et al., A Toll/interleukin (IL)-1 receptor domain protein from Yersinia pestis
interacts with mammalian IL-1/Toll-like receptor pathways but does not play a central role in
the virulence of Y. pestis in a mouse model of bubonic plague. Microbiology, 2012. 158(Pt 6): p. 1593-606.
224. Amulic, B., et al., Neutrophil function: from mechanisms to disease. Annual review of immunology, 2012. 30: p. 459-89.
140
225. Yang, C.W., et al., Neutrophils influence the level of antigen presentation during the immune
response to protein antigens in adjuvants. Journal of immunology, 2010. 185(5): p. 2927-34. 226. Blomgran, R. and J.D. Ernst, Lung neutrophils facilitate activation of naive antigen-specific
CD4+ T cells during Mycobacterium tuberculosis infection. Journal of immunology, 2011. 186(12): p. 7110-9.
227. Smith, J.A., et al., Brucella induces an unfolded protein response via TcpB that supports
intracellular replication in macrophages. PLoS pathogens, 2013. 9(12): p. e1003785. 228. Radhakrishnan, G.K., J.S. Harms, and G.A. Splitter, Modulation of microtubule dynamics by a
TIR domain protein from the intracellular pathogen Brucella melitensis. The Biochemical journal, 2011. 439(1): p. 79-83.
229. Radhakrishnan, G.K. and G.A. Splitter, Biochemical and functional analysis of TIR domain
containing protein from Brucella melitensis. Biochemical and biophysical research communications, 2010. 397(1): p. 59-63.
230. Galan, J.E. and D. Zhou, Striking a balance: modulation of the actin cytoskeleton by
Salmonella. Proceedings of the National Academy of Sciences of the United States of America, 2000. 97(16): p. 8754-61.
231. Leone, P. and S. Meresse, Kinesin regulation by Salmonella. Virulence, 2011. 2(1): p. 63-6. 232. Billard, E., et al., High susceptibility of human dendritic cells to invasion by the intracellular
pathogens Brucella suis, B. abortus, and B. melitensis. Infection and immunity, 2005. 73(12): p. 8418-24.
233. Weinhold, M., et al., The Attenuated Strain 19 Invades, Persists in, and Activates Human
Dendritic Cells, and Induces the Secretion of IL-12p70 but Not IL-23. PLoS One, 2013. 8(6): p. e65934.
234. Serbina, N.V., et al., Monocyte-mediated defense against microbial pathogens. Annual review of immunology, 2008. 26: p. 421-52.
235. Serbina, N.V. and E.G. Pamer, Monocyte emigration from bone marrow during bacterial
infection requires signals mediated by chemokine receptor CCR2. Nature immunology, 2006. 7(3): p. 311-7.
236. Peters, W., M. Dupuis, and I.F. Charo, A mechanism for the impaired IFN-gamma production
in C-C chemokine receptor 2 (CCR2) knockout mice: role of CCR2 in linking the innate and
adaptive immune responses. Journal of immunology, 2000. 165(12): p. 7072-7. 237. Bar-On, L. and S. Jung, Defining in vivo dendritic cell functions using CD11c-DTR transgenic
mice. Methods in molecular biology, 2010. 595: p. 429-42. 238. Grosso, J.F. and M.N. Jure-Kunkel, CTLA-4 blockade in tumor models: an overview of
preclinical and translational research. Cancer immunity, 2013. 13: p. 5. 239. Callahan, M.K. and J.D. Wolchok, At the bedside: CTLA-4- and PD-1-blocking antibodies in
cancer immunotherapy. Journal of leukocyte biology, 2013. 94(1): p. 41-53.
141
VI. Annexe
142
VI. A. ARTICLE : LIPOPOLYSACCHARIDES WITH ACYLATION
DEFECTS POTENTIATE TLR4 SIGNALING AND SHAPE T CELL
RESPONSES.
Lipopolysaccharides with Acylation Defects PotentiateTLR4 Signaling and Shape T Cell Responses
Anna Martirosyan1,2,3, Yoichiro Ohne4, Clara Degos1,2,3, Laurent Gorvel1,2,3, Ignacio Moriyon5,
Sangkon Oh4, Jean-Pierre Gorvel1,2,3*
1Aix-Marseille University UM 2, Centre d’Immunologie de Marseille-Luminy, Marseille, France, 2 INSERM U 1104, Marseille, France, 3CNRS UMR 7280, Marseille, France,
4 Baylor Institute for Immunology Research, Dallas, Texas, United States of America, 5 Institute for Tropical Health and Departamento de Microbiologıa y Parasitologıa,
Universidad de Navarra, Pamplona, Spain
Abstract
Lipopolysaccharides or endotoxins are components of Gram-negative enterobacteria that cause septic shock in mammals.However, a LPS carrying hexa-acyl lipid A moieties is highly endotoxic compared to a tetra-acyl LPS and the latter has beenconsidered as an antagonist of hexa-acyl LPS-mediated TLR4 signaling. We investigated the relationship between thestructure and the function of bacterial LPS in the context of human and mouse dendritic cell activation. Strikingly, LPS withacylation defects were capable of triggering a strong and early TLR4-dependent DC activation, which in turn led to theactivation of the proteasome machinery dampening the pro-inflammatory cytokine secretion. Upon activation with tetra-acyl LPS both mouse and human dendritic cells triggered CD4+ T and CD8+ T cell responses and, importantly, humanmyeloid dendritic cells favored the induction of regulatory T cells. Altogether, our data suggest that LPS acylation controlledby pathogenic bacteria might be an important strategy to subvert adaptive immunity.
Citation: Martirosyan A, Ohne Y, Degos C, Gorvel L, Moriyon I, et al. (2013) Lipopolysaccharides with Acylation Defects Potentiate TLR4 Signaling and Shape T CellResponses. PLoS ONE 8(2): e55117. doi:10.1371/journal.pone.0055117
Editor: Edgardo Moreno, National University, Costa Rica
Received August 23, 2012; Accepted December 19, 2012; Published February 4, 2013
Copyright: � 2013 Martirosyan et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by the Centre National de la Recherche Scientifique and Institut National de la Sante et de la Recherche Medicale, France. AMwas a recipient of the Foundation de la Recherche Medicale (FRM), France. This work was also supported by National Institutes of Health (NIH)/National Instituteof Allergy and Infectious Diseases (NIAID) - U19 AI057234. The funders had no role in study design, data collection and analysis, decision to publish, or preparationof the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: gorvel@ciml.univ-mrs.fr
Introduction
Dendritic cells (DC) play a key role in initiating and controlling
the magnitude and the quality of adaptive immune responses
[1,2]. Upon exposure to microbial stimuli, DC undergo a matu-
ration process characterized by an increased formation of MHC–
peptide complexes, the up-regulation of co-stimulatory molecules,
chemokine receptors and cytokine production [1,2,3]. Cytokines
produced by DC play a key role in determining the type of
generated CD4+ helper T cell (TH) responses leading to TH1, TH2
or TH17 responses [1,2]. Moreover, DC play a pivotal role in the
control of central tolerance and the induction of immune tolerance
in the periphery. The ability of DC to induce tolerance depends on
several parameters such as their maturation stage, anti-inflamma-
tory and immunosuppressive agents, the nature of microbial
stimuli, and the tissue microenvironment. In addition to deleting T
cells, tolerogenic DC induce the differentiation and proliferation of
T cells with regulatory/suppressive functions known as regulatory
T cells (Treg) [4].
Lipopolysaccharide (LPS) is an important virulence factor of
Gram-negative bacteria responsible for septic shock in mammals.
LPS is the major molecule of the bacterial outer membrane and
can be massively released into the host during the course of
infection [5,6]. LPS consists of the O-polysaccharide chain, the
oligosaccharide core region and the lipid A. Typical LPS such as
those of E. coli and most enteric bacteria express a lipid A
composed of a bisphosphorylated glucosamine disaccharide
carrying two amide- and two ester-linked acyl and hydroxyacyl
chains. Additional acyloxyacyl chains are commonly present,
resulting in penta or hexa-acyl lipid A, the dominant molecular
lipid A species in most wild type enterobacteria [7,8]. It has been
shown that variations of structural arrangements of lipid A such as
a reduction in the number of charges or the number of acyl chains
or a change in their distribution or saturation degree result in
a dramatic reduction in endotoxicity. For instance, the synthetic
precursor tetracyl lipid IVa has been described as a non-endotoxic
molecule and proposed as an antagonist of hexa-acyl endotoxic
LPS [9,10]. Moreover, some pathogens like the yersiniae modulate
the degree of acylation of the lipid A depending upon the
environmental conditions. Most notably, growth at 37uC causes
Yersinia pestis to synthesize tri- and dominant tetra-acyl lipid A, with
no hexa-acyl and only small amounts of penta-acyl molecules.
Since these bacteria move from 20–25uC to 37uC when trans-
mitted from the flea to the mammal host, Y. pestis express tetra-acyl
lipid A which displays low immunostimulatory properties in
mammals. This change has been described as a mark of pathogen
adaptation to the host environment [7].
In this study, we investigated the relationship between lipid A
acylation and the immunostimulatory properties of LPS in the
context of mouse and human DC activation. We show that LPS
with acylation defects described as not endotoxic are capable of
inducing a strong and early TLR4-dependent cell activation. This
leads to the activation of the proteasome machinery and the
PLOS ONE | www.plosone.org 1 February 2013 | Volume 8 | Issue 2 | e55117
degradation of newly synthetized pro-inflammatory cytokines.
Mouse and human DC activated by tetra-acyl LPS trigger CD4+
and CD8+ T cell responses. Moreover, human DC activated by
LPS with acylation defects display a semi-mature phenotype and
induce high levels of regulatory T cells (Treg).
Materials and Methods
Ethics StatementAnimal experimentation was conducted in strict accordance
with good animal practice as defined by the French animal welfare
bodies (Law 87–848 dated 19 October 1987 modified by Decree
2001–464 and Decree 2001–131 relative to European Conven-
tion, EEC Directive 86/609). All animal work was approved by
the Direction Departmentale des Services Veterinaires des
Bouches du Rhone (authorization number 13.118). INSERM
guidelines have been followed regarding animal experimentation
(authorization No. 02875 for mouse experimentation).
Blood from healthy adult donors were collected at the Baylor
Hospital Liver Transplant Clinic (Dallas, TX) after obtaining
written informed consent. This study, including the consent form,
was approved by the Institutional Review Board (IRB) of the
Baylor Research Institute (BRI) (Dallas, TX). Any medical issue
during blood collection from healthy donors was written and
reported to the IRB at BRI.
LipopolysaccharidesThe methods used in the extraction, purification and charac-
terization of the LPS used in this study have been described
previously (Lapaque et al, 2006). Briefly, Y. pestis KIM6, E. coli
MLK3 and its lipid A mutants MLK53 htrB2 (lauroyl-transferase),
MLK 1067 msbB2 (miristoyl-transferase) and MLK
986 htrB2/msbB2 were grown at the appropriate temperature,
crude LPS obtained by the phenol-water method and then
purified to remove traces of contaminant lipids and lipoproteins.
The degree of lipid A acylation was determined by nano-
electrospray ionization time-of-flight mass spectrometry (ESI-
TOF-MS) (Lapaque et al, 2006). For all experiments, LPS variants
have been used at the concentration of 100 ng/ml. Lipid Iva was
purchased from PeptaNova.
Antibodies and ReagentsThe primary antibodies used for immunofluorecence micros-
copy were: mouse FK2 antibody (anti-mono- and polyubiquitiny-
lated conjugates) (Enzo Life Science), affinity purified rabbit
‘‘Rivoli’’ antibody against murine I-A, NF-kB subunit p65/ReiA
(Santa Cruz), CD11c (Bolegend). Pam2CSK4 was purchased from
InvivoGen to activate DC. Antibodies used for flow cytometry
included APC-CD11c (1 in 100), FITC-CD40 (1 in 50), FITC-
CD80 (1 in 50), PE-CD86 (1 in 400), PE-IA-IE (MHC class II)
(Pharmingen) (1 in 800), as well as PB-CD8 (1 in 200), A700-
CD45.2 (1 in 300), APC-CD44 (1 in 400), PE-Cy7-CD25 (1 in
1500), APC-CD62L (1 in 400) (BD Biosciences and eBiosciences).
For intracellular labeling of cytokines, IL-12 (p40/p70)-PE and
TNF-a PE monoclonal antibodies (1 in 100)(Pharmingen) were
used. The Aqua Dead Cell Stain (Invitrogen) was used to eliminate
dead cells. Ovalbumine (OVA) was purchased from EndoGrade
with purity.98% and endotoxin concentration ,1EU/mg.
SIINFEKL peptide was purchased from Schafer-N. Human
mDC were sorted from PBMC of blood from healthy donors
using lineage cocktail-FITC (BD Biosciences), CD123-PE (BD
Biosciences), CD11c-APC (Biolegend), HLA-DR-Quantum Red
(Sigma). Human mDC were stained with CD86-PE, CD83-FITC,
CD40-APC and HLA-DR-PB (eBiosciences or Biolegends). 7-
AAD was used to exclude dead cells. For intracellular labelling
IL13-APC, INF-c-PE-Cy7, IL-17-PE and Granzyme B-APC
antibodies were used. Isotype matched controls were used
appropriately. Alexa Fluor 647 conjugated phospho-specific
antibodies were used for Phospho flow experiments on human
IL-4 DC and were all from BD Biosciences. Akt(S478), Btk(Y557)/
Itk(Y511), CREB(S133)/ATF1(S63), ERK1/2(T202/Y204), IRF-
7(S477/S479), Lck(Y505), NF-kB p65(S529), PLC-c1 (Y783),
PLC-c2 (Y759), p38 MAPK(T180/Y182), b-Catenin (S45), SHP-
2(Y542), Src(Y418), SLP-76(Y128), S6(S235/S236),
STAT1(Y701), STAT1(S727), STAT3(Y705), STAT3(S727),
STAT4(S693), STAT5(S694), STAT6(Y641), 4EBP1(T36/T45),
Zap70(Y319)/Syk(Y352), JNK(T183/Y185).
Mice and CellsC57Bl/6 mice from Jackson Laboratory and OT-I, OT II TCR
transgenic mice on C57Bl/6 background were used. C57BL/6,
Tlr42/2 and Tlr22/2 mice were maintained at the CIML animal
house, France. Mouse bone marrow-derived DC (BMDC) and
macrophages (BMDM) were prepared from 7–8 week-old female
C57BL/6 mice as previously described (Lapaque et al, 2006).
Human DCHuman IL-4 monocyte-derived DC were generated from Ficoll-
separated PBMC from healthy volunteers. Monocytes were
enriched from the leukopheresis according to cellular density
and size by elutriation as per manufacturer’s recommendations.
For DC generation, monocytes were resuspended in serum-free
Cellgro DC culture supplemented with GM-CSF and IL-4. Blood
myeloid DC (HLA-DR+CD11c+CD1232Lin2) were sorted from
fresh PBMC using FACSAria (BD Biosciences). Naıve CD4+ and
CD8+ T cells (CD45RA+CD45RO2) (purity.99.2%) were
purified by FACS-sorting.
Immunofluorescence MicroscopyFor immunofluorescence microscopy, 26105 stimulated
BMDCs on coverslips were fixed in 3% paraformaldehyde at
RT for 15 min, washed twice in PBS 1X and processed for
immunofluorescence labelling. To stain NF-kB, mouse BMDCs
and BMDMs were permeabilized with PBS 1X 1% saponin (for
10 min at RT) and then saturated with PBS 1X 2% BSA (for 1 h
at RT). CD11c (1 in 100), NF-kB subunit p65/ReiA (1 in 250) and
MHC II (1 in 300) were used as primary antibodies. After staining,
samples were examined on a Zeiss LSM 510 laser scanning
confocal microscope for image acquisition. Images were then
assembled using Adobe Photoshop 7.0. Quantifications were done
by counting at least 300 cells in 3 independent experiments.
Flow CytometryTo analyse mouse BMDC maturation, 26105 cells were
stimulated and stained with antibodies for classical activation
markers. Appropriate isotype antibodies were used as controls.
After staining, cells were washed with PBS 2% FCS, then PBS 1X
and fixed in 1.5% paraformaldehyde before analysis on a FACS-
calibur cytometer (Becton Dickinson). Cells were always gated on
CD11c for analysis and 100,000 CD11c+ events were collected
from each sample. For the intracellular staining of IL-12 and
TNF-a in mouse BMDCs, BD Cytofix/Cytoperm and BD Perm/
Wash buffers were used. At least 100.000 events were collected on
FACSCanto II (BDBiosciences). For mouse CD4 and CD8 T cell
assays, viable cells were analyzed for the decrease of CFSE
(proliferation) and the expression of CD25, CD44 and CD62L
(diluted in PBS 1X EDTA 2 mM). Human mDC or IL4-DC
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 2 February 2013 | Volume 8 | Issue 2 | e55117
activation was analyzed by checking the surface expression of
maturation markers CD40, CD83, CD86, HLA-DR after 16 h or
72 h of cell treatment with LPS variants, respectively. Flow
cytometry analysis was performed using the FlowJo software.
Histograms were drawn from and median fluorescence intensity
values were determined on gated populations. At least 100,000
events were collected on FACSCanto II (BDBiosciences) or
FACSAria (BDBiosciences).
Cytokine MeasurementMurine IL-12 and TNF-a were quantified in culture super-
natants of stimulated DC by sandwich enzyme-linked immuno-
sorbent assays (ELISA) according to the manufacturer’s protocol
(Abcys). Human cytokine (IL-6, TNF-a, and IL-12p40) were
determined using the BeadLyte cytokine assay kit (Upstate, MA).
Immunoblotting30 mg of cell lysates were subjected to SDS-PAGE PAGE and,
after transfer to nitrocellulose, the membrane was probed with
a polyclonal antibody against phospho-S6 or S6 (Cell Signaling
Technology) or an anti-actin antibody. Blots were subjected to
enhanced chemiluminescence detection (ECL, PIERCE).
Quantitative RT-PCRTotal RNA was isolated with Trisol reagent, was reverse
transcribed and analyzed by real-time quantitative PCR using the
Power SYBR Green PCR Master Mix (Applied Biosystems). All
reactions were performed in triplets. Data were acquired on a 7500
Fast Real-Time PCR system (Applied Biosystems) and were
normalized to the expression of actin mRNA transcripts in
individual samples. For a given real-time qRT-PCR sample, the
RNA expression level was calculated from cycle threshold (Ct). In
our analysis, given gene expression is shown as mean normalized
expression (MNE) relative to the expression of b-actin. The
following primers were used for qPCR amplification:RT b-actin
(sense): GACGGCCAGGTCATCACTATTG, RT b-actin (anti-
sense): CAAGAAGGAAGGCTGGAAAAGA, p35 sense :
59ctcctgtgggagaagcagac39, p35 anti-sense: 59acagggtgatgggc-
tatctga39, p40 sense:59CACACTGGACCAAAGGGACT39p40
anti-sensereverse: 59ATTATTCTGCTGCCGTGCT39, TNF-
a sense: 59CATCTTCTCAAAATTCGAGTGACAA39TNF-a,
anti-sense : 59TGGGAGTAGACAAGGTACAACCC39. 3 in-
dependent experiments were done and one representative is
shown.
In vitro Antigen Presentation AssaysBMDC (3000 cells) were incubated overnight in 96-well culture
plates either with media or OVA. T cells obtained from the lymph
nodes and the spleen of OT-I and OT-II Rag-22/2 mice were
purified with the T cell enrichment kit from Dynal following
manufacturer’s instructions. For CD4 and CD8 T cell pro-
liferation assays, purified T cells were labeled with 10 mM
carboxyfluorescein diacetate succinimidyl ester (CFSE from
Invitrogen) for 10 min at 37uC. OT-II and OT-I cells (20000
cells) were added to BMDC that had been stimulated for 8 h with
different LPS and then washed. The proliferation of OT-I and
OT-II T cells was assessed after 3 days of co-culture by flow
cytometry. The cells were washed and stained with anti-CD4 and
anti-CD8 antibodies for identification. For CD4 and CD8 T cell
activation assays, purified T cells were co-cultured with BMDC
previously stimulated for 8 h with different LPS. After 3 days, the
expression of surface markers such as CD25, CD44 and CD62L
was analyzed by flow cytometry to study the cellular activation
level.
Co-culture of OT-II T cells with BMDCCD4+ T cells were isolated from the spleen of OT-II Rag-22/2
mice using a CD4+ T cell isolation kit (Dynal; Invitrogen). Purity
was determined by staining with CD4, CD5, and TCR Va2. A
total of 36103 BMDC stimulated for 8 h with different LPS were
co-cultured with 26104 OT-II Rag-22/2 T cells in the presence
of ovalbumin, ovalbumin (257–264) peptide (0.06 mg/mL) and of
TGF-b (1 ng/mL) as indicated. After 5 days of culture, the
expression of Foxp3 and CD25 was evaluated.
Human CD4+ and CD8+ T cell Responses56103 blood mDC were co-cultured with CFSE-labeled
allogeneic naıve CD4+ T and CD8+ T cells (1–26105). The
DC/T ratio was 1:1000 and 1:20, respectively. Cell proliferation
was tested by measuring CFSE-dilution on day 6. On day 7, the
production of intracellular cytokines (INF-c, IL-17, IL-13) and
Granzyme B were analyzed after 6 h of T cell stimulation by PMA
and Ionomycine, in the presence of Brefeldin A. Cells were stained
for analysis by flow cytometry using different fluorochrome-
conjugated antibodies.
Phospho-flow Analysis with Fluorescent Cell Barcoding(FCB)Monocyte-derived IL4 DC were generated as previously
described. Briefly, human monocyte were enriched with human
monocyte enrichment kit without CD16 depletion (Stemcell
Technologies, Canada) and suspended in CellGro DC medium
(CellGenix, Germany) with GM-CSF and IL-4. On day 6, cells
were washed and resuspended at 1 million/mL in RPMI
supplemented with 2 mM L-Glutamine, 1 mM Sodium pyruvate,
1X non essential amino acid, 50 mM b-ME, and 10 mM HEPES
+10% FBS, and then cultured for 2 h in a CO2 incubator. Cells
were stimulated with different LPS (100 ng/ml) for 2, 5, 10, 30,
60, and 180 min. Equal amount of medium was used for
stimulation control. All samples were immediately fixed by adding
PFA (final 1.6%) for 10 min at RT. Fixed cells were centrifuged
and washed once with PBS, and then permeabilized with ice-cold
Methanol (500 ml/1 million cells) for 10 min at 4uC. Two
dimension FCB was performed according to the previous report
[11]. Pacific Blue-NHS and Alexa Fluor 488-NHS (Invitrogen,
Carlsbad, CA) were added to each condition of cells at 0.02, 0.08,
0.32, 1.0, 3.0 mg/ml or 0.05, 0.2, 0.8, 3.0 mg/ml, respectively.
Each sample has a unique combination of dyes with different
concentrations. After 30 min on ice, barcoded cells were washed
three times with PBS+0.5% BSA and combined into one tube.
Combined barcorded cells were stained with Alexa Fluor 647
conjugated phospho-specific antibodies for 30 min at RT. Cells
were washed two times with PBS+0.5% BSA. For purified anti-
phospho-JNK antibody, cells were stained with secondary anti-
rabbit DyLight 649 (Jackson Immunoresearch, West Grove, PA)
for 30 min at RT and washed two times. Samples were
immediately analyzed with FACS CantoII (BD Biosciences, San
Jose, CA). Fold changes of phosphorylation were visualized as
a Heatmap. The MFI of LPS-stimulated samples were normalized
with medium-stimulated samples.
Statistical AnalysisAll experiments were carried out at least 3 independent times
and all the results correspond to the means 6 standard errors.
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 3 February 2013 | Volume 8 | Issue 2 | e55117
Statistical analysis was done using two-tailed unpaired Student’s t
test. Significance was defined when P values were ,0.05.
Results
Structural Modifications of LPS Affect Cytokine Secretionby DCWe used an array of LPS (Table 1) differing in lipid A acylation
to study their activation properties in mouse bone marrow-derived
dendritic cells (BMDC) and bone marrow-derived macrophages
(BMDM). In addition to the classical wild type hexa-acyl LPS
purified from E. coli MLK strain, we used LPS from E. coli MLK
mutants (msbB-, htrB- and msbB2/htrB- double mutant) that
produce mostly penta-acyl and tetra-acyl lipid A (Table 1) or LPS
purified from Y. pestis KIM grown at 37uC (mainly composed of
tri- and tetra-acyl lipid A with small amounts of penta-acyl and
hexa-acyl molecules, Table 1). All LPS variants induced a BMDC
maturation characterized by an up-regulation of the surface
expression of major histocompatibility complex MHC-II and co-
stimulatory molecules (CD40, CD86) (Figure 1A). However,
significant lower levels of secreted TNF-a and IL-12 were detected
in DC stimulated by tetra-acyl LPS purified from E. coli MLK
(msbB2/htrB-) double mutants or LPS purified from Y. pestis
compared to DC stimulated with wild type E. coli hexa-acyl LPS
(Figure 1B). Moreover, the LPS variants did not induce any IFN-
a secretion (not shown). While comparing the activities of LPS
variants, we have also performed a dose-response study (not
shown). Cell treatment by 1 ng/ml of LPS triggered DC
activation, which reached a plateau at the highest concentration
(100 ng/ml). The same differences in terms of cytokine secretion
were observed when cells were treated both with 100 ng/ml and
10 ng/ml of different LPS (not shown). Similarly, in BMDM
activated by tetra-acyl LPS, TNF-a secretion was strongly
decreased compared to BMDM incubated with hexa-acyl LPS
(Figure S1) as previously observed in macrophage cell lines
[8,9,10].
We then tested the ability of tetra-acyl LPS (referred as purified
either from E. coli MLK msbB2/htrB- double mutant or Y. pestis
grown at 37uC) to induce human blood myeloid DC (mDC)
activation (Figure 1C and D). Hexa-acyl and tetra-acyl LPS
induced a similar up-regulation of classical cell surface activation
markers (HLA-DR, CD40, CD86, and CD83) (Figure 1C).
However, mDC treated with tetra-acyl LPS secreted lower levels
of IL-12, IL-6 and TNF-a than those stimulated by hexa-acyl LPS
(Figure 1D). Tetra-acyl LPS from Y. pestis, which contains small
amounts of hexa-acyl LPS had a stronger capacity to trigger IL-12,
IL-6 and TNF-a secretion (p,0.01) than LPS purified from E. coli
(msbB-, htrB-) double mutant (devoid of hexa-acyl LPS) (Figure 1D,
Table 1). Together, our data show that structural modifications of
LPS induce an intermediate phenotype of maturation in mouse
and human DC characterized by high levels of MHC-II and co-
stimulatory molecule expression, but low levels of pro-inflamma-
tory cytokine secretion.
Tetra-acyl LPS Induce a TLR4-dependent DC ActivationLPS recognition by host cells is mediated through the Toll-like
receptor 4 (TLR4/MD2/CD14) receptor complex [12]. To
determine the contribution of TLR4 in the cell activation induced
by LPS with acylation defects, BMDC derived from Tlr42/2,
Tlr22/2 and wild type mice were treated with the LPS variants.
No activation was observed in Tlr42/2 mice-derived BMDC
stimulated either by hexa-acyl or tetra-acyl LPS (p,0.001), as
measured by the secretion of TNF-a (Figure S2A). In addition,
TLR2 was not implicated in DC activation induced by the
different LPS (Figure S2B), showing that LPS preparations were
not contaminated by lipoproteins.
The measurement of DC viability following treatment with
different LPS showed that both hexa-acyl and tetra-acyl LPS
induce a very low percentage of dead cells (0.93%) (not shown).
We next tried to understand if the decrease of pro-inflammatory
cytokine secretion in BMDC activated by tetra-acyl LPS was
related to a defect in signal transduction. It has been shown that
NF-kB translocation is a key event in LPS-induced TLR4
signalling [13]. Under unstimulated conditions, NF-kB is kept in
the cytosol as an inactive form. Under hexa-acyl LPS stimulation
NF-kB is translocated into the nucleus where it can bind to
several gene promoters [13,14]. After 15 and 30 min of cell
stimulation, tetra-acyl LPS induced a significant (p,0.01)
stronger NF-kB translocation than hexa-acyl LPS (Figure 2A
and B). Similar results were observed in macrophages (Figure
S3A and B).
Since the activation of the mammalian target of rapamycin
(mTOR) pathway has been implicated in DC maturation [16], we
then analyzed the phosphorylation of the ribosomal protein S6,
one of downstream elements of the TLR4 pathway. Compared to
hexa-acyl LPS, tetra-acyl LPS induced a stronger S6 phosphor-
ylation at 30 min post-cell activation (Figure 2C). No difference for
S6 phosphorylation was observed at later time points either by
hexa-acyl or tetra-acyl LPS (Figure 2C). These data show for the
first time that LPS with acylation defects induce an early and
strong activation of the TLR4-dependent signalling pathway in
mouse DC and macrophages.
We extended this study to human monocyte-derived IL-4 DC
(Figure 3) by using the phospho-flow technology. Fluorescent cell
barcoding (FCB) was applied to analyze many conditions
simultaneously, using a collection of several anti-phosphorylated
proteins [11]. All LPS variants LPS were equally able to increase
the phosphorylation levels of several signaling molecules in-
cluding MAPKs (ERK, p38, JNK), Akt-mTOR pathway
molecules (Akt, 4EBP1, S6), and some transcription factors
(CREB, NFkB p65) (Figure 3). Interestingly, although the
patterns of phosphorylated molecules were same between LPS
variants, the kinetics and strength of the phosphorylation changes
were slightly different with several molecules (Figure 3). Y. pestis
LPS could induce phosphorylation more rapidly, while LPS
mutant caused phosphorylation more slowly and weakly than E.
coli LPS in some molecules, especially in Akt, p38 and NFkB
(Figure 3). These results suggest that as E. coli hexaacyl LPS, Y.
pestis LPS and E. coli LPS mutant could act as an agonist to
TLR4 pathway. However, structural differences in lipid A region
may modify the LPS binding capacity to the receptor, leading to
changes in activation potential. It should be also noted, E. coli
LPS mutant enhanced tyrosine phosphorylation in STAT1, 3, 5
at later time point more potently than others (Figure 3). Taken
together, LPS variants seem to activate the same signaling
pathway with different activation potential that may affect the
output and quality of immune responses induced by DC.
Thus, LPS purified from E. coli MLK (msbB-, htrB-) double
mutant and Y. pestis were able to trigger TLR4-dependent
signalling in human DC, in agreement with data obtained on
mouse BMDC (Figure 2).
Altogether these data show that LPS with acylation defects act
as agonists to the TLR4 pathway and efficiently induce signal
transduction in mouse and human DC.
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 4 February 2013 | Volume 8 | Issue 2 | e55117
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 5 February 2013 | Volume 8 | Issue 2 | e55117
Tetra-acyl LPS Induce an Early Synthesis of Pro-inflammatory Cytokines followed by their Proteasome-dependent DegradationWe then investigated whether the decrease of pro-inflammatory
cytokine secretion in BMDC activated by tetra-acyl LPS was due
to a defect in cytokine synthesis (transcription/translation). BMDC
were activated with different LPS and quantitative RT-PCR used
to analyse gene expression. In BMDC treated by tetra-acyl LPS an
earlier and stronger transcription of tnf-a, p35 and p40 genes was
observed (Figure 4A) compared to BMDC treated by hexa-acyl
LPS. Therefore, the decrease of pro-inflammatory cytokine
secretion observed in Figure 4B cannot be attributed to
transcriptional defects.
We next investigated whether the defect in cytokine secretion by
DC stimulated with tetra-acyl LPS was due to a change in protein
translation (Figure 4C and D). BMDC were incubated with the
different LPS in the presence of brefeldin A to block the secretion
of newly synthesized cytokines. Intracellular levels of IL-12 and
TNF-a were analysed by flow cytometry. LPS with acylation
defects induced significant higher TNF-a and IL-12 synthesis at
2 h and 4 h post-stimulation compared to hexa-acyl LPS
(Figure 4C and D). However, at 8 h post-stimulation, the level
of intracellular cytokines was lower in DC treated with tetra-acyl
LPS than in DC treated by hexa-acyl LPS (Figure 4E). It has been
shown that glucose or energy deprivation, calcium homeostasis
perturbation or elevated synthesis of secretory proteins induce an
alteration of the Endoplasmic Reticulum (ER) homeostasis
[15,16]. This leads to the disruption of protein folding, the
accumulation of unfolded proteins and ER stress response or
unfolded protein response (UPR) to restore ER normal function.
One of the major components of UPR is the degradation of
misfolded proteins by the proteasome (ER associated degradation,
ERAD) [15,16]. We therefore determined if the decrease of
cytokine secretion observed in DC activated by tetra-acyl LPS
could be due to a proteasome-mediated degradation of newly
synthesized cytokines (Figure 5). Epoxomycine (Figure 5A) or
Mg132 (Figure 5B) proteasome inhibitors were used in BMDC
treated by the different LPS for 8 h and intracellular the IL-12
expression was analysed. As expected, in the absence of
proteasome inhibitors the level of intracellular IL-12 expression
was lower in tetra-acyl LPS-treated DC than in hexa-acyl LPS-
treated DC. However, in the presence of proteasome inhibitors
DC treated with tetra-acyl LPS levels of intracellular IL-12 were
similar to those expressed by DC treated with hexa-acyl LPS
(Figure 5A and B). We then studied the ubiquitinylation of
proteins following DC activation by different LPS. It has been
shown that upon inflammatory stimulation, DC accumulate newly
synthesized ubiquitinylated proteins in large cytosolic structures.
These DC aggresome-like induced structures (DALIS) are
transient and require continuous protein synthesis [16]. Mouse
DC treated with LPS variants underwent maturation and
displayed MHC II surface localization as well as DALIS formation
(Figure 5C). However, after 4 h of tetra-acyl LPS treatment, the
percentage of DALIS-containing cells was significantly higher as
compared to cell stimulated by hexa-acyl LPS (Figure 5C). At
24 h, the number of DALIS decreased, consistent with the
transient DALIS expression previously demonstrated in the
process of DC maturation (not shown) [16]. These data strongly
suggest that tetra-acyl LPS induce a degradation of IL-12 by the
proteasome machinery in DC. It is therefore tempting to
hypothesize that LPS with acylation defects could induce an ER
stress in DC activating the proteasome machinery. This will lead
to the down-regulation of cytokine intracellular levels and
consequently to a decrease of their secretion.
LPS with Acylation Defects Induce Antigen-specific CD8+
and CD4+ T cell ResponsesWe next studied the antigen presentation capacity of tetra-acyl
LPS-treated DC and their ability to promote T cell responses
(Figure 6). We used transgenic mice that express either a TCR
specific for the MHC class-I restricted OVA (OT-I Rag-22/2) or
a TCR specific for the MHC class-II restricted OVA (OT-II Rag-
22/2). BMDC incubated in either medium alone or medium
containing ovalbumin (OVA) were activated by different LPS and
co-cultured with OTI (CD8+) and OTII (CD4+) T cells for 3 days
(Figure 6A). Basal level of T cell responses was determined.
Figure 1. LPS with acylation defects induce semi-mature mouse and human dendritic cells. Mouse BMDC were stimulated for 8 h (ingrey) and 24 h (in black) with medium, E. coli LPS (either hexa-acyl, penta-acyl or tetra-acyl) and Y. pestis tetra-acyl LPS. All LPS were used at theconcentration of 100 ng/ml. MHC II and co-stimulatory molecules up-regulation on the cell surface was measured by flow cytometry (A) and cytokinesecretion was determined by ELISA (B). Data represent means 6 standard errors of at least 5 independent experiments, **p,0.01, *p = 0.01 to 0.05.Human blood mDC were stimulated overnight with medium (in grey), hexa-acyl E. coli LPS (in red), tetra-acyl E. coli LPS (in blue) and Y. pestis tetra-acylLPS (in orange). Surface expression of HLA-DR, CD83, CD40 and CD86 was analyzed by flow cytometry (C) and cytokine levels in the culturesupernatants were measured by Luminex (D). Experiments were performed on 4 different donors. The data for one representative are shown.***p,0.001, **p,0.01, *p = 0.01 to 0.05.doi:10.1371/journal.pone.0055117.g001
Table 1. Characteristics of LPS.
Bacterial strain (relevant genetic features) a Proportions of lipid A species (molecular mass)
E.coli MLK3 .90% hexaacyl (1823.3 Da); traces of penta and tetraacyl.
E.coli MLK53 (htrB-) rough-LPS; pentaacyl lipid A deficient in C12 oxyacyl of 3-OH-C14 acyl at GlcNC29 (1615.1 Da)
E.coli MLK 1067 (msbB-) rough-LPS; .90% pentaacyl (1587.0 Da); tetraacyl traces
E.coli MLK986 (msbB-, htrB-) rough-LPS; 29% pentaacyl (1643.0 Da); 54% tetraacyl (1404.8 Da); and 17%triacyl (1178.6 Da)
Y. pestis KIM rough-LPS, 9% hexaacyl (1797.2 Da); 10% pentaacyl; 40% tetraacyl (1404.8 Da);7% arabinosamine- tetraacyl (1535.9 Da); 30% triacyl (1178.6 Da)
aAll are rough-type LPSs.doi:10.1371/journal.pone.0055117.t001
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 6 February 2013 | Volume 8 | Issue 2 | e55117
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 7 February 2013 | Volume 8 | Issue 2 | e55117
BMDC incubated with LPS alone or OVA alone could not induce
any T cell response (data not shown). However, BMDC incubated
with OVA and activated by different LPS efficiently induced
antigen-specific CD8+ and CD4+ T cell responses (Figure 6A). DC
activated by tetra-acyl LPS induced a higher OTI and OTII T cell
proliferation than cells treated by hexa-acyl LPS (Figure 6A). DC
stimulated by tetra-acyl and hexa-acyl LPS were able to trigger T
cell activation characterized by a CD25 up-regulation and
a CD62L down-regulation. However hexa-acyl LPS-treated
BMDC led to a higher down-regulation of CD62L by OT II T
cells than those treated with tetra-acyl LPS (Figure 6A). Altogeth-
er, these data show that BMDC induced by LPS with acylation
defects are able to efficiently promote antigen presentation and
induce CD8+ and CD4+ T cell responses.
We then investigated the functional properties of human DC
stimulated with LPS variants (Figure 6B). Human blood myeloid
DC (mDC) activated by the different LPS were able to induce the
proliferation of allogeneic naıve CD4+ and CD8+ T cells, although
to a lower level for E. coli tetra-acyl LPS compared to other LPS
(Figure 6B). Tetra-acyl LPS from Y. pestis, which contains small
amounts of hexa-acyl LPS had a stronger capacity to trigger T cell
responses than LPS purified from E. coli (msbB-, htrB-) double
mutant (devoid of hexa-acyl LPS) (Figure 6B, Table 1). These
results show that tetra-acyl LPS-treated DC are able to promote
CD4+ and CD8+ T cell responses both in mouse and human
models.
We then characterized the effector T cells induced by LPS-
treated mDC (Figure 7). Cells were stimulated with PMA/
Ionomycin and stained for intracellular IFN-c (TH1 response), IL-
13 (TH2 response) and IL-17 (TH17 response). mDC stimulated
either by hexa- or tetra-acyl LPS polarized allogeneic naıve CD4+
T cells into IFN-c-expressing TH1 cells (Figure 7A). CD4+ T cells
co-cultured with either hexa-acyl LPS-activated mDC or tetra-
acyl-activated mDC did not express IL-13 or IL-17 (Figure 7A).
mDC stimulated by tetra-acyl LPS were also able to induce IFN-c
and Granzyme B synthesis in CD8+ T cells (Figure 7B). However,
we observed lower levels of IFN-c and Granzyme B production
with LPS purified from E. coli MLK (msbB-, htrB-) double mutant
compared to other LPS (Figure 7).
These data indicate that DC activated by either hexa-acyl or
tetra-acyl LPS induce TH1 responses and activate CD8+ T cells.
Figure 2. Tetra-acyl LPS induce the activation of TLR4-dependent molecular pathways involved in mouse DC maturation. BMDCwere activated with medium (grey), E. coli hexa-acyl LPS (dark blue), E. coli tetra-acyl LPS (purple) or Y. pestis tetra-acyl LPS (light blue) for 15 min,30 min, 1 h and 2 h. NF-kB translocation was analyzed by confocal microscopy(A). Cells were fixed and stained for CD11c (in blue), MHC-II (in green)and NF-kB subunit p65/RelA (in red). The percentage of BMDC with translocated NF-kB into the nucleus was quantified (B). BMDC were stimulated for30 min, 1 h, 4 h and 6 h with medium or different LPS. Cell lysates were subjected to SDS-PAGE and, after transfer to nitrocellulose, the membranewas probed with the antibodies against phospho-S6 (Ser235/236), S6 and an anti-actin antibody (C). Data represent means 6 standard errors of atleast 4 independent experiments, **p,0.01.doi:10.1371/journal.pone.0055117.g002
Figure 3. Phospho-flow analysis of human IL-4 DC stimulated by LPS. Human IL-4 DC were activated by different LPS for 2 min, 5 min,10 min, 30 min, 60 min and 180 min. A phospho-flow analysis using fluorescent cell barcoading was performed in order to assess thephosphorylation levels of molecules involved in TLR4 signaling. The heatmap visualization of phosphorylation changes is shown. The medianfluorescent intensity (MFI) of stimulated cells is normalized by MFI of medium stimulated cells. Colored bar on the right shows the levels of foldchanges. Experiments were performed on 4 different donors. The data for one representative are shown.doi:10.1371/journal.pone.0055117.g003
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 8 February 2013 | Volume 8 | Issue 2 | e55117
Figure 4. Kinetics of synthesis of pro-inflammatory cytokines. (A) BMDC were stimulated for 2 h, 4 h, 8 h or 24 h with medium (grey), E. colihexa-acyl LPS (dark blue), E. coli tetra-acyl LPS (purple) or Y. pestis tetra-acyl LPS (light blue). Total RNA was purified from cell lysates, reversetranscribed and the amount determined by real-time quantitative PCR. Primers were used for qPCR amplification of actin (control), p35, p40 and TNF-a genes. 3 independent experiments were done and one representative is shown, **p,0.01. (B) The secretion levels of IL-12p70, IL-12p40 and TNF-
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 9 February 2013 | Volume 8 | Issue 2 | e55117
In Contrast to Murine BMDC, Tetra-acyl LPS ActivateHuman DC to Induce Treg cellsDC with MHC IIhigh, co-stimulationhigh, pro-inflammatory
cytokines low phenotype are referred in the literature as semi-
mature. It has been shown that these cells are able to trigger the
differentiation of regulatory T cells (Treg) [17]. We thus evaluated
whether mouse BMDC activated by tetra-acyl LPS displaying
a semi-mature phenotype were capable of generating Treg cells
characterized by the expression of the transcriptional factor Foxp3
and a high CD25 expression at their cell surface. When
maintained on a Rag-22/2 background, transgenic mice that
express a TCR specific for I-Ab-OVA complexes (OT-II Rag-22/2
mice) contain only conventional (Foxp32) CD4+ T cells in their
periphery, a situation that facilitates the measurement of their
conversion into Treg cells [18]. Such conversion requires I-Ab+ DC
and the presence of the OVA-derived peptide specifically
recognized by OT-II CD4+ T cells (Figure S4). It also depends
on the secretion by the antigen-presenting DC of TGF-b [18].
Accordingly, BMDC stimulated with different LPS variants were
incubated with OT-II Rag-22/2 T cells in the presence of the
OVA or OVA257–264 peptide (0.06 mg/mL), with or without TGF-
b (Figure S4). We could observe that OVA and peptide-pulsed
BMDC were both capable of inducing the activation of OT-II
Rag-22/2 CD4+ T cells as measured by CD25 expression (Figure
S4). However, DC stimulation either by tetra-acyl or hexa-acyl
LPS did not trigger Treg responses in mouse BMDC (Figure S4A).
The addition of exogenous TGF-b to the culture did not confer to
LPS-activated DC the ability to generate Treg cells (Figure S4B).
We then studied the capacity of human mDC activated by tetra-
acyl LPS to induce Treg cells. Human DC activated by LPS
variants were co-cultured with allogeneic naıve CD4+ T cells and
Treg population was analysed by flow cytometry (Figure 8). We
could observe that mDC activated by tetra-acyl LPS induced
a higher Treg population characterized by the expression of Foxp3
and a high CD25 expression at the cell surface (Figure 8). This
activation profile could be due to the fact that human DC
activated by different forms of tetraacyl LPS, including the
synthetic Lipid IVa display an intermediate profile of DC
maturation (as shown here for IL-4 DC in Figure S5) then leading
to Treg proliferation.
Discussion
The innate immune system possesses various mechanisms to
detect and facilitate host responses to microbial components such
as LPS [19]. It has been described that each change in chemical
composition of LPS causes a dramatic decrease of its activity down
to a complete loss of endotoxicity [6]. Different cell types, mainly
human and mouse monocytes/macrophages have been used to
study LPS structural requirements for its immunostimulatory
properties. However, to determine the endotoxic activity of
enterobacterial LPS, previous studies have mainly concentrated
on cytokine production. Consequently, a decrease in IL-8, IL-6
and TNF-a secretion by cells stimulated with LPS harboring
acylation defects has been considered as a lack of immunogenicity
or a defect of pro-inflammatory signaling [9,10,20]. In contrast,
we show here that LPS with acylation defects efficiently induce
a potent activation of TLR4-dependent signaling in mouse and
human DC that leads to a strong cytokine synthesis, which in turn
triggers the activation of the proteasome machinery. The
consequence is the degradation of intracellular pro-inflammatory
cytokines and consequently the decrease of their secretion. This
hypothesis corroborates previous results, which showed a decrease
of cytokine secretion in tetra-acyl LPS-treated macrophages
[8,9,10,20].
The difference in the activation potential of LPS variants in
terms of cytokine secretion could affect the output of the DC
immune response. DC activated by tetra-acyl LPS triggered CD4+
T and CD8+ T cell responses both in mouse and human DC.
However, human DC activated by LPS with acylation defects
displayed a semi-mature phenotype and induced Treg responses.
There could be several mechanisms by which tetra-acyl LPS
interact with human DC to elicit distinct types of TH responses.
Functional differences between the different subsets of human
myeloid DC could be one possible explanation. Two main
populations of circulating DC termed myeloid (mDC) and
plasmacytoid (pDC) were identified in the blood of healthy
donors. Additional distinctions can be made within the mDC
subset with CD1c+CD1412 mDC1, CD1c2CD141+ mDC2 and
CD16+ mDC [21]. It has been shown that mDC1 and mDC2
differ for the expression of surface markers, cytokine production
profile and the differentiation of TH responses. When co-cultured
with purified human peripheral blood cells, mDC1 produce IL-12
and favor TH1 differentiation, while mDC2 produce high levels of
IL-10 and direct the differentiation of TH2. Moreover, the
identification of numerous phenotypic and functional differences
among pulmonary mDC1 and mDC2 suggests a possible prefer-
ential role for mDC2 in regulating immunity and disease
pathogenesis in the respiratory tract distinct from that of mDC1.
Distinct roles in host immunity for each human DC were
previously shown [21,22,23,24]. For instance, the human
CD1c2CD141+ mDC2 subset is the functional equivalent of
mouse CD8a+ DC, capable of cross presentation of exogenous
antigens. Regarding their capacity to secrete IL-10, mDC2 might
also induce Treg populations.
Treg are key players in the immune regulation, particularly in
tolerance. This cell population plays a crucial role in suppressing
immune responses to self-antigens and in preventing autoimmune
diseases [25,26]. Evidence is emerging that Treg can control
immune responses to pathogens. They are beneficial to the host
through limiting the immunopathology associated with anti-
pathogen immune responses and enabling the development of
immune memory. However, pathogens can exploit Treg to subvert
the protective immune responses of the host in order to survive
and establish a chronic infection [27,28]. Microbes have evolved
strategies for programming DC to induce Treg in order to maintain
immune homeostasis that controls unbridled host immunity
[4,27]. For example, filamentous hemagglutinin (FHA) from the
bacteria Bordetella pertusis induces DC to provide IL-10 and prime
Treg. Moreover, Yersinia pestis is known to activate DC by means of
the dimer of TLR2 and TLR6 to induce Treg [29].
There is growing evidence that the induction of tolerance is not
restricted to immature DC. Within the tolerogenic pool of DC,
a third population is proposed, called semi-mature [17]. This new
subset or developmental stage of DC is distinguished as mature by
their surface marker analysis (MHC IIhigh and co-stimulation high).
a were determined by ELISA. Data represent means6 standard errors of at least 4 independent experiments, **p,0.01. (C, D) BMDC were treated for2 h and 4 h with medium, E. coli LPS (either hexa-acyl or tetra-acyl LPS) and Y. pestis tetra-acyl LPS. The intracellular synthesis of IL-12 (p40+p70) in (C)and TNF-a in (D) was analysed by flow cytometry. (E) The intracellular IL-12 and TNF-a production was studied in BMDC activated for 8 h with LPSvariants. At least 3 independent experiments were performed and one representative is shown.doi:10.1371/journal.pone.0055117.g004
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 10 February 2013 | Volume 8 | Issue 2 | e55117
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 11 February 2013 | Volume 8 | Issue 2 | e55117
Figure 5. Tetra-acyl LPS induce a degradation of IL-12 by the proteasome machinery in DC. BMDC were activated for 8 h with LPSvariants in the presence or the absence of proteasome inhibitors such as epoxomycine (A) and Mg132 (B). The intracellular IL-12 (p40+p70) synthesiswas then analysed. At least 3 independent experiments were performed and one representative is shown. (C) BMDC were activated for 2 h, 4 h, 8 hand 24 h with LPS variants and labelled with anti-MHC II(green), anti-CD11c (blue) and FK2 (red) antibodies to detect DALIS (white arrows).Quantification of the percentage of DC with DALIS at 2 h, 4 h and 8 h post-incubation with medium or post-stimulation with the different LPS.Quantifications were done by counting at least 300 cells in 3 independent experiments. Data represent means 6 standard errors of at least 3independent experiments, *p = 0.01 to 0.05.doi:10.1371/journal.pone.0055117.g005
Figure 6. LPS with acylation defects induce functional mouse and human dendritic cells. BMDC were incubated overnight with OVA andactivated for 8 h with different LPS. Stimulated DC were co-cultured with T cells from OT-I and OT-II Rag-22/2 mice (A). The proliferation of OT-I andOT-II T cells was assessed after 3 days of co-culture by CFSE decrease. For T cell activation assays, the expression of surface markers such as CD25 andCD62L was analyzed by flow cytometry. At least 3 independent experiments were performed and one representative is shown. (B) CFSE-labeledallogeneic naıve CD4+ T and CD8+ T cells were co-cultured with activated mDC for 7 days. Cell division was tested by measuring CFSE-dilutionExperiments were performed on 4 different donors. Data for one representative experiment are shown.doi:10.1371/journal.pone.0055117.g006
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 12 February 2013 | Volume 8 | Issue 2 | e55117
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 13 February 2013 | Volume 8 | Issue 2 | e55117
Figure 7. Tetra-acyl LPS induce effector molecules synthesis by human T cells. Human blood mDC were activated overnight either bymedium or LPS variants and co-cultured with allogeneic naıve CD4+ T and CD8+ T cells. After 7 days, cells were incubated 6 h with PMA/Ionomycinein the presence of Brefeldin A. The intracellular levels of IFN-c, IL-13 and IL-17 in CD4+ T (A) and IFN-c and Granzyme B in CD8+ T cells (B) wereanalysed by flow cytometry. Experiments were performed on 4 different donors. Data for one representative experiment are shown.doi:10.1371/journal.pone.0055117.g007
Figure 8. LPS with acylation defects activate human mDC to induce regulatory T cells. Human blood mDC were activated overnight eitherby medium or different LPS and co-cultured with allogeneic naıve CD4+ T cells. After 7 days, cells were incubated 6 h with PMA/Ionomycine in thepresence of Brefeldin A. Foxp3 and CD25 expression was analysed in CD4+ T cell population. Experiments were performed on 4 different donors. Datafor 2 representatives are shown.doi:10.1371/journal.pone.0055117.g008
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 14 February 2013 | Volume 8 | Issue 2 | e55117
However, semi-mature DC do not release high level of pro-
inflammatory cytokines, such as IL-1b, IL-6, TNF-a or IL-12p40
or IL-12p70. IL-10 production by semi-mature DC has been
described, but it is not an absolute requirement for Treg
differentiation [17]. Inducers of DC semi-maturation can be
lactobacilli from the gut flora [30], intranasally applied OVA [31],
apoptotic cells [32], Bordetella pertussis FHA [33] or TNF-a [34].
Here we show that, structural modifications of LPS are able to
induce semi-mature human and mouse DC characterized by
MHC-IIhigh, co-stimulationhigh, pro-inflammatory cytokines low
phenotype. In the human model, these semi-mature DC induce
high levels of Treg cells.
In conclusion, we describe a new mechanism, which regulates
the pro-inflammatory cytokine decrease in cells activated by LPS
with acylation defects. We propose that cell stimulation by tetra-
acyl LPS trigger the activation of the proteasome machinery. This
leads to the degradation of intracellular pro-inflammatory cytokine
levels and consequently to a decrease of their secretion. Our results
provide new insights into the understanding of early steps of
endotoxin action and suggest that structural modifications of LPS
could represent an important strategy for pathogens to subvert
adaptive immunity by Treg cell induction in order to survive.
Supporting Information
Figure S1 LPS structure effect on mouse BMDM
activation. Mouse BMDM were incubated with medium, E. coli
hexa-acyl LPS (dark blue), E. coli tetra-acyl LPS (purple) or Y. pestis
tetra-acyl LPS (light blue). Secretion levels of TNF-a were
determined by ELISA after 8 h and 24 h of cell activation. Data
represent means 6 standard errors of at least 4 independent
experiments. **p,0.01.
(EPS)
Figure S2 Tetra-acyl LPS induce a TLR4-dependent DC
activation. BMDC from wild type and Tlr42/2 mice (A) or
Tlr22/2 mice (B) were stimulated for 8 h and 24 h with medium
(grey) or E. coli hexa-acyl LPS (dark blue), E. coli tetra-acyl LPS
(purple) or Y. pestis tetra-acyl LPS (light blue) or Pam2CSK4
(brown). TNF-a secretion was measured by ELISA. Data
represent means 6 standard errors of at least 3 independent
experiments, ***p,0.001, **p,0.01.
(EPS)
Figure S3 LPS effect on mouse NF-kB translocation in
mouse BMDM. Mouse BMDM were incubated with medium
(grey), E. coli hexa-acyl LPS (dark blue), E. coli tetra-acyl LPS
(purple) or Y. pestis tetra-acyl LPS (light blue). (A) NF-kBtranslocation was analyzed by confocal microscopy in cells
activated with different LPS for 15 min, 30 min, 1 h and 2 h.
Cells were fixed and stained for NF-kB subunit p65/RelA (in red).
The percentage of BMDM with translocated NF-kB into the
nucleus was quantified (B). Data represent means 6 standard
errors of at least 4 independent experiments, **p,0.01.
(EPS)
Figure S4 BMDC capacity to trigger Treg cell differen-
tiation. BMDC stimulated with different LPS variants were
incubated with OT-II Rag-22/2 T cells in the presence of the
OVA, OVA257–264 peptide (0.06 mg/mL) with or without TGF-b.After 5 days of culture, T cells were analyzed for the expression of
Foxp3 and of CD25. Numbers in outlined areas indicate
percentage of cells. Results for hexa-acyl and tetra-acyl E. coli
LPS are shown. Data similar to tetra-acyl E. coli LPS are observed
while BMDC are stimulated with tetra-acyl Y. pestis LPS. Data are
representative of 3 independent experiments.
(EPS)
Figure S5 Human IL-4 DC stimulation properties in the
presence of E. coli LPS analogs and Y. pestis LPS. IL-
4 DC were stimulated for 72 h with medium, hexa-acyl E. coli
LPS, tetra-acyl E. coli LPS, synthetic Lipid IVa and Y. pestis at
20 ng/ml. Cell culture supernatants were kept for cytokine
measurement (IL-6, IL-10 and TNFa) by Luminex (A). Surface
expression of HLA-DR, CD80 and CD86 was analyzed by flow
cytometry (B) Experiments were performed on 4 different donors.
Data for one representative donor are shown.
(TIF)
Acknowledgments
We thank Dr. Hugues Lelouard for critical advice on the manuscript.
Author Contributions
Conceived and designed the experiments: JPG AM SO. Performed the
experiments: AM YO CD LG. Analyzed the data: JPG AM YO CD SO
IM LG. Contributed reagents/materials/analysis tools: IM SO. Wrote the
paper: JPG AM SO IM.
References
1. Kapsenberg ML (2003) Dendritic-cell control of pathogen-driven T-cellpolarization. Nature reviews Immunology 3: 984–993.
2. Mellman I, Steinman RM (2001) Dendritic cells: specialized and regulatedantigen processing machines. Cell 106: 255–258.
3. Banchereau J, Steinman RM (1998) Dendritic cells and the control of immunity.Nature 392: 245–252.
4. Pulendran B, Tang H, Manicassamy S (2010) Programming dendritic cells toinduce T(H)2 and tolerogenic responses. Nature immunology 11: 647–655.
5. Seydel U, Hawkins L, Schromm AB, Heine H, Scheel O, et al. (2003) Thegeneralized endotoxic principle. European journal of immunology 33: 1586–1592.
6. Raetz CR, Reynolds CM, Trent MS, Bishop RE (2007) Lipid A modificationsystems in gram-negative bacteria. Annual review of biochemistry 76: 295–329.
7. Dixon DR, Darveau RP (2005) Lipopolysaccharide heterogeneity: innate hostresponses to bacterial modification of lipid a structure. Journal of dental research84: 584–595.
8. Lapaque N, Takeuchi O, Corrales F, Akira S, Moriyon I, et al. (2006)Differential inductions of TNF-alpha and IGTP, IIGP by structurally diverseclassic and non-classic lipopolysaccharides. Cellular microbiology 8: 401–413.
9. Schromm AB, Brandenburg K, Loppnow H, Moran AP, Koch MH, et al. (2000)Biological activities of lipopolysaccharides are determined by the shape of theirlipid A portion. European journal of biochemistry/FEBS 267: 2008–2013.
10. Mueller M, Lindner B, Kusumoto S, Fukase K, Schromm AB, et al. (2004)Aggregates are the biologically active units of endotoxin. The Journal ofbiological chemistry 279: 26307–26313.
11. Krutzik PO, Nolan GP (2006) Fluorescent cell barcoding in flow cytometry
allows high-throughput drug screening and signaling profiling. Nature methods
3: 361–368.
12. Ulevitch RJ, Tobias PS (1999) Recognition of gram-negative bacteria and
endotoxin by the innate immune system. Current opinion in immunology 11:
19–22.
13. Kawai T, Akira S (2006) TLR signaling. Cell death and differentiation 13: 816–
825.
14. Hayden MS, Ghosh S (2008) Shared principles in NF-kappaB signaling. Cell
132: 344–362.
15. Naidoo N (2009) ER and aging-Protein folding and the ER stress response.
Ageing research reviews 8: 150–159.
16. Pierre P (2009) Immunity and the regulation of protein synthesis: surprising
connections. Current opinion in immunology 21: 70–77.
17. Lutz MB, Schuler G (2002) Immature, semi-mature and fully mature dendritic
cells: which signals induce tolerance or immunity? Trends in immunology 23:
445–449.
18. Guilliams M, Crozat K, Henri S, Tamoutounour S, Grenot P, et al. (2010) Skin-
draining lymph nodes contain dermis-derived CD103(2) dendritic cells that
constitutively produce retinoic acid and induce Foxp3(+) regulatory T cells.
Blood 115: 1958–1968.
19. Kawai T, Akira S (2010) The role of pattern-recognition receptors in innate
immunity: update on Toll-like receptors. Nature immunology 11: 373–384.
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 15 February 2013 | Volume 8 | Issue 2 | e55117
20. Backhed F, Normark S, Schweda EK, Oscarson S, Richter-Dahlfors A (2003)Structural requirements for TLR4-mediated LPS signalling: a biological role forLPS modifications. Microbes and infection/Institut Pasteur 5: 1057–1063.
21. Piccioli D, Tavarini S, Borgogni E, Steri V, Nuti S, et al. (2007) Functionalspecialization of human circulating CD16 and CD1c myeloid dendritic-cellsubsets. Blood 109: 5371–5379.
22. Dzionek A, Fuchs A, Schmidt P, Cremer S, Zysk M, et al. (2000) BDCA-2,BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells inhuman peripheral blood. Journal of immunology 165: 6037–6046.
23. Jongbloed SL, Kassianos AJ, McDonald KJ, Clark GJ, Ju X, et al. (2010)Human CD141+ (BDCA-3)+ dendritic cells (DCs) represent a unique myeloidDC subset that cross-presents necrotic cell antigens. The Journal of experimentalmedicine 207: 1247–1260.
24. MacDonald KP, Munster DJ, Clark GJ, Dzionek A, Schmitz J, et al. (2002)Characterization of human blood dendritic cell subsets. Blood 100: 4512–4520.
25. Vignali DA, Collison LW, Workman CJ (2008) How regulatory T cells work.Nature reviews Immunology 8: 523–532.
26. Mills KH, McGuirk P (2004) Antigen-specific regulatory T cells–their inductionand role in infection. Seminars in immunology 16: 107–117.
27. Belkaid Y (2007) Regulatory T cells and infection: a dangerous necessity. Naturereviews Immunology 7: 875–888.
28. Josefowicz SZ, Rudensky A (2009) Control of regulatory T cell lineagecommitment and maintenance. Immunity 30: 616–625.
29. Depaolo RW, Tang F, Kim I, Han M, Levin N, et al. (2008) Toll-like receptor 6
drives differentiation of tolerogenic dendritic cells and contributes to LcrV-
mediated plague pathogenesis. Cell host & microbe 4: 350–361.
30. Christensen HR, Frokiaer H, Pestka JJ (2002) Lactobacilli differentially
modulate expression of cytokines and maturation surface markers in murine
dendritic cells. Journal of immunology 168: 171–178.
31. Akbari O, DeKruyff RH, Umetsu DT (2001) Pulmonary dendritic cells
producing IL-10 mediate tolerance induced by respiratory exposure to antigen.
Nature immunology 2: 725–731.
32. Menges M, Rossner S, Voigtlander C, Schindler H, Kukutsch NA, et al. (2002)
Repetitive injections of dendritic cells matured with tumor necrosis factor alpha
induce antigen-specific protection of mice from autoimmunity. The Journal of
experimental medicine 195: 15–21.
33. McGuirk P, McCann C, Mills KH (2002) Pathogen-specific T regulatory 1 cells
induced in the respiratory tract by a bacterial molecule that stimulates
interleukin 10 production by dendritic cells: a novel strategy for evasion of
protective T helper type 1 responses by Bordetella pertussis. The Journal of
experimental medicine 195: 221–231.
34. Huang FP, Platt N, Wykes M, Major JR, Powell TJ, et al. (2000) A discrete
subpopulation of dendritic cells transports apoptotic intestinal epithelial cells to
T cell areas of mesenteric lymph nodes. The Journal of experimental medicine
191: 435–444.
Tetraacyl LPS Potentiate Intracellular Signalling
PLOS ONE | www.plosone.org 16 February 2013 | Volume 8 | Issue 2 | e55117
top related