biostimulant lotion anti-hair loss combined with hair...
Post on 17-May-2020
12 Views
Preview:
TRANSCRIPT
Biostimulant lotion Anti-hair loss Combined withHair repair shampoo
PrPrPPPPrPrPPrPPPPPPPPPrPPPrPPPP eveeveveveveevvvvvvvvvvvenenenenenennennt ttttttttttt ananananaanaa d dddd rererererrr duddud cecececees s shahahahaaahahahahahahahahhahahahahhahahahahhaahaahahahaaahhaaaaaahaairiririrrrrirrirriririrrririrririrrirrirrrririrririrrrrrrr lllllllll l oosososoosooooso sssssssssssss ReReReReReReReReReReReReRReRRRRReReReeRRRRRRRRRR gegegegegegegeegeegeeggeegggeeegeg nnenneneeneneneeneeeeen rararararararatetetttet s sssscacaccacccalppplpp
H A I R S
A brand of Sicobel laboratory – Expert in Phytodermatology since 1959
Biostimulant lotionAnti-hair loss
Hair repair shampooAll hair types
UsUsUUUsUssUsseeeeeee e eeeeee ::::ReReReReeeeeefrfffffffffff esseseseseseseessssh hhhhh ananananaaana d d d d d d rererererereegugugugugugug lalalaaaaaaaaaaarr r r rr cucucucc rereereeee:: : TwwTwwwwwicccccccce e e ee a yeyeyeyeyeyy araraaararar/ // ToToToToToTooToTo aaaaaapppplyly oonennen d osososose byy daday y yyyyyy dddddududddd ririririrrrrrrrr nggngggg 555 555555555555 dddayayaaayayayaaayayaayayys ssssss ss sss inininn m mmmmmmasasasassasasssassasaasaaaaaaagigiggigigigg ngngggng t thehehehehehhe sscacacaccc lplpppppp, , , , rerereepepepeeeatata t theheee a a ctctcc ioionn 22 wewwwwwwww ekkkkkkkkkkkks sssssss lalalalalalalaaaaaaateteteeeeeeer.r.rr.r.rAtAtAtAtAtAtAtAAtAttAtttackckckckckkckk ccccccururuuuuuure e e e ee spspssppspss ececeececececee ifiifiifiifiififiififiifi cccc h h hhaiaaiaaiaair rrrrrr lololololooooosssssss: : : ToToTT a apppppppplylylylyylyy o ooncncncn e e a aa dadadadad y yy dudududurirrrr nggggg one momoooontntntntnnnnn h.h.hh.h.hhh. RR RRRRepepeppeeaeeeeaeaeeeeat t t thththhhhhhhhhhhe ee cuccucucucuccuc rere i iiiif fffff nenenenenecececc sssssssssssss aaaaara y.yy
ACACACACACACACACACCCCCCTITITITITTITITITITIIIVEVEVEVEVEVEVEEEVEVEEVESSSSSSSSSSSSSS ACAA TITTIT ONONOOOOPlaPlaPlPllllPlPl nt ntntttntttnt tt PlaPlPlaPlaPlaPlPlPlPlaPPPPP cencencencecencencecencce tatatatatattt PPPrePPPP venvvv ts ts ts thettt hahh ir loslosososs is is is in sn sn sn stimimimimulatinttinting
thetheetheeee hah hahah ir ir rir folfoffofof liccccleleleleImprovovoovvovve ttttthehhh gennnneral hl hl hl hhealth of haiaaaa rsImpImImIm rovooo e te te ttttttthe hhh gengegege eral health of ff f haihaaaah rsGivGivGiGivGG e ve ve ve ve ve ve vvitaitataitaitatit lititttty, y, y, y, brib ght anand suppuu lenll esssssssssssss
GolGolGolGolGolGolGGoGG d cd cd cd cd cd cd cdd amoamoamomomoamoamomoammamamammmmmomilmilmilmilmilmilmilmileeeeeeee ProProProProProProtectectectectecttect at aaand ndndd repair thhhhe kerarar tintttReaReaReaReaReRRReactictcctc ve ve veve e ththethehh hahahahh irssss gr gr gr growtowtwtwowth ihhh n reinforcedthethethethehethethheht scscscscsscs alplal micro-ci-c-- rculatatatattionionionio
EFEFEFEFEFEFEFEFEFFFEEFFIFIFIFFIF CACAACACAC CYYYYYYYCYCYCY PPP RRORR VVVVVVVVEVEEVVVV DDThe hahahhh irir r reeeppee aaaiairr shshhamaama popoppop o o o ananaand d ddd d thththtthe e bibiibibiiibiooooosooooo timumum lalalaantnn lototioion n
ararara e e e 2 2 2 coccompmppppmpleemmmememmemm ntntttntararary yy prprrodododuccuctstssssstts w ww hhhihihihihihhiccchcch a actct i inn sysynergy*y . , IdIddeeae l in theh ttttttrereeaaatatata memementnt o of f f pspspp ororiaiaiaiaaaasisis s ss s ss (excepept seseverer cases)
prprururitit, sebubum m m rererereregggggugg lationn*.*Highh cutu ananeeoeoussss tolerance
*StStududy carried out by DDDrDr FaFa F yolle on 75 volunteers (44 womens and 31 menme s from 10 to 70 years)
TOLERANCE TESTED UNDER DERMATOLOGICAL CONTROLO C S O OG C CO O
UsUssse:e:e:e:e:ee:e:e apaaaapapaaaa plplplplplpp y y yyy onononononononnn w w w www eetee hhhhhairs, leleavvvvviininininninini gg ggg fefefefew www mimm nununnutetetteeees s ana d d too rininsee.ReReeeReeepepepepepp atatataaaat aa a ndndnnndnnd l eaaaae vevvvvv 22222 t ttt ililii l lll 333 3333 mimiinnunn tet s sss bbebbebeb fofff rerere t to o rirr nsse.ee
ACACACACAACTITITITTT VEVEVEVEVESSSSSS ACACACACTITITTIONONSofSofSofSSofS t ct ccct ct ct lealeaeaeaeee nsinsinssinsingngnnng n basasasbasbbb is EliEliE minminminm atetetateatee im im purrpupu itiitiitit esesese
SoySoySoySoySoyya pa pa pa pa pa protroteeineineinein RReegRegeR ulau te e andanddand gi ve brbribrib ghtghtt ananand sdd oftofof eneeneess shahaaiaiirs
AgAgeAgeAgent ntt tetexxxxturturtu eeee sGivvvvvvvee vee olululume andd eae sssies r to dddo oo one’ne’s hs hairairs
PoPolPoP yquyqyqyquyquyquyqyquateateaternirniumum-um-um 77777 AntttAn isisti atic agentt
Depigmentation creamAnti-brown patches
DS WHITE Body milk with active lightening ingredients
prprprprprprpp eveveveveveve enenenenntt ttttt ananananand dddddd rerereeredudududud cececees s sbrbrbbbbbrowwwowwwwnn nn papapapatctctt hehehehes ss dududududueeeetototototott tttttimmmmi e efefefeffefeefefeeectctcttctctccc s ananaand ddddssussuuuun n n exexexexpopopopopoppoopoppoooppopooooopopoooooooooosuusususussususussussssusussssusssss re lilliighghghghgghggg teteteteenininiiiinnngngnggggggggnnggnggnggggggggnnngggg cccc c cc cc comomomomomomomomomommmplplplplplplplpplplpppp exeexexexexexeeeexeexeeeeee ioon
DEPIGMENTATION / LIGHTENING
A brand of Sicobel laboratory – Expert in Phytodermatology since 1959
Depigmentation creamAnti-brown patches
UseUseUseUUseeeeeUU eeee::::: ::: AppAppAppAppppAppApppppp ly lylylylyy locooclococococallalalllalal y, yy,yyyyyyy mormormormmmmm ninninning ag ag ag ag ag ag and nd ndndnddnd eveeveeveeveeveeveevevee ninininng, g tototototo tototototo patpatpatpatpatppatatccccchees ooon the hehhe facfacfff e and ndndd body (ha(ha(ha(ha(haha(hahh(ha(hahhandsndsndsndsndsndsnnndssnds, nn, nn, n, n, n, nnneckeckeckeckececkeckececklininnne, ee andandandanaanann fo fo foooofoooorearereareareareaeareaar rm)rm)rm)rm)))). U. U. U. UUU. Use se s as aasaas an an anan a 8 tt8 t8 8 8 to 1o 1o 1ooo 0 w0 w0 w0 eekekekeke trtr trtr trt eatmentt ct ct ct ct ouro se.seseePrePrePP caucaucacacacacaacacaacaaacautiootiotioooooooons ininiininin iniininnininininininn useuseuseuseuusseuseeuseeuseeususeeeeu : : : : avoavavoavoavoavoavoavoaavovv id id id d expexpexpexposuosuosuosuosuosusuosuosuosurerere re reree to totottot thethetheththethetth su susu su sus n on on on oor ur urr se sese sses a sa sun un nnn scrscrs eeneenn wi w wi th hth hh a va veryery highighighihhihihihi h pppppprotrototototrototottttectecteeectectececteeecteectionononononnonnonnn fafafafaffafaactoctoctoctocctctcctccc r. r. r. r. AvoAvoAvovvvvvvAvov id id idid d dd d ddd connconconco tactactacacact ccctt wt wt wwwwwt withthhh thth th e ee eee eyesyesyes an anannnnnnnd md md md mmmuucoucou sa.sasa FoFoFoor eextxtextextt rnrnrnarr l use onlonlnnnnonlonllnnnn y. yyy NoNoNoNo NoN Not stt st st st uituituituituituituu ablablablbblbbbbb e fe fe fe fff ffe or or or ooooo chichichichchccccc ldrldrldd en.en.enenenenenenen.
ACTACTACTACTACTACTACTACTACTACTACTAC IVEIVEIVEIVEVVEVEIVVVVV SSSSSS ACTACTACTACTACTACACTACTACTAC IONIOIOIIIIBolBolBoBoBoBoBoBBoo do dddd tretreretretreetretrtrt eeeeeeeeeee RedReduceuces ms elaelaelanogogeneeneeneenesississs and dd d dd dd imiimiimiim nisnisnisn hes epidermal
pigpigmenmenntataa ionononon.p gpWheWhWhWhWhWheWhWhWWWWW at atatatatattatttt proproproproproproproproppprop teiteiteiiteiteiiin an an aaminminminminminnminnnoo ao aoooooo cidcidcidcidi LimLimLimLimLLLLL itsitststsssss exe exprerereereer ssion onon lines and haas as lololoong-ng-ng-ng terrrm vmmm olume-mmm
enhenenenenhnnhenhenenhenhnn ancancaancananaanann ing efeeffecccfect tttto fiooo ll deeeeep ep ep wri klnklnklklesegg ppWWhiWWhiWWWWW te te eee teateateateaeateat le lelelelee leeeeeeafafaf af af afaaaaaa extextextexte racracracracacaaaa tttt Can exfolliiate se se se se se se skininnnin im im imiimpereererfectiottt ns nsnsss by bybybyb reducing:
- RR--- ednd esseseses annnd id id id iddddd tchtchttt ingnng- The ee apppp earearaeareaeeeeaarea ancncncnce oe oe oeee f mf mf mf micricic o vesseee elsls innnn thhe skininin- P- P- Pigmg ententententenen spspssss otsotsottt rererelatttted to agegg ingnggg p g gg
WakWakWakW kWakkW kakameameamemame ex ex ex eee tratratratractctctct ActActActAAActs os ooon tn tn tn n the heheehe gengengengengenes esesee concconcoco trotrotrooollilll ng g g g thethethee thththreereereereereer ke y mechanisms of skiskiskiskks n pn pn pn pigmigmigmigmigmigmigmigmg ententententntntaatatiaa on:- R- R- RRR- R- RRRedueduedueduedueduduuee cescesceseseeses thththtthttt e ssize ofoo memmemelanosoomes thtthat at carry melanin- I- I- I- I-- I- Inhinnnnnn bits ts ts ttthe hehe he heh trtritrt ggegggggg r ffffactacac orsr ofoffofff meme meme m lanll ogenesnee is- R- - R edudducescescesce the qe qe e qee uanaa tity of melaeee ninn exxxxxporporrtedtedte into the epiepepepepp derererererrmismismismismismmmm- R- R- RRReduuuuuucesce thhe sssizeiziiziz ofoo the peee igment spotss and reduces pigpigigpigigpigmenmmm tatttt ionoononon of of off thtth th tht e see kininini thhhanknknnkn s ts to ao a lighthttenie ng effectp gpp g g
GlyGlyyyGG cococololoo icicicccc aciaciddGGlyGlyGGlycococololo ic ic aciacidyy Sugugar cana e eeeeeextrxtrxtrxtrxtxt actact geggggg tntlnt y eeeexfoliatesteseSugar cane eeeextrxtrxttxtract geggg ntly eeeexfoliatesesg g yChrCChrCCCCCCCCCCCC ysaysaysaysanthnthnththnthellellum m extextxtttracracracracractttt ProPrPPrPPP motmmm es eseeseses eses a saa ssa ootottttthinhinhinii g e eg eeffeff ct thatt nks to anti-t oxioxo dissing and anti-
rada icaiiiii l ell ffefeeff ctsttttPrePreeP evenvvv ts thethehehee ono setsetssse ofoo wrwww inkkkklesesesee an and ld ightent s bs bss rown ppatca hes.g p
DS WHITE Body milkwith active lightening ingredients
UseUsesesee:::: Ap Ap ApApplyplyplply morning ng ng ng andna eveveveniing ng on on n allall bo b dy dy durdududd ingng at atatataa lele astas 8 8888 weeweeweeweeweeks.kkTheTheThThh apapap appliliicatcatcacationnnn mu mumumust stst bebe regregulaulaaar (r (twitwice ce a da da day)ay)y , ttimeime to to aacac act aat t the melmelelelanoanoananan cytcytes es levlevlevllevel.el.eel.el. IdIddI I ealeaaeaa tooto usususususse de de de de deeee uriuriuriu ng ngngng allall ye year.a
ACTACTACTACTACTIIVEIVI SS ACTACTACTAC IONIOOLiqLiqLiquoruoro iceice anand BBBearearareeearbebberbererberbeb ry ry ry extxtextraccract t (ex(ex(ex( tratraract ctt highigighlyhlyhlyh co concencecncentrntrateated id id nn activeveiv mom lecleculeules)s)
DeeDeeDeDDD p depiepiepiep gmegmegmentintinting ng g actacac ionn byby by by tyrosinase inhibition lightens thethee sks in in and rerr duces spospotstststs
Allllantana oïnne GenGentlytlyyyyyyy ex ex exe ex exe foliati es ; keratolytiiiic effectyyyy yPlaPlant ntn squalane nenene olive oil extract FatFatFatFaF tty aciaciidesdesdesdesd ss wiwiwi wiwiwi w ththththth th a hha a a a ighhhhhh afaf affinfinfi nity and ssd simii littaryaryyyyary w wi w ww th the
essententtentialialialia fafa fattytyttytty ac acacc a idsidsidsidss nana nnn turally fy ound in the e epiepiepipp derderdererderdedererrmis.NouNourrirrish sh andand mo moisti tististuriuriuriuurizeezezeze theththethethethethe epepepepep epideideeideidedidermirmirmirmirmis bbs bbs bs by sy sttrengthening the hydro-liplipid fi lfi my p
Cara rot extract, soy oil and glycerin extracted from castor oil plantp
Moisturize and softens the epidermis
UVA/UVB Filters Protect from the sun
TOLERANCE TESTED UNDER DERMATOLOGICAL CONTROL
Stretch marksActive concentrate
e eeeeeCoCoCoCoCoCoCoCoCooCooCoCC ncncccccccennnnnnnntratataaaaaaa ededdddded cccccccararararaararararararareeeeeendndnnnnd whwhwhwhwhwhwwhwhwwww iccicicicich h h hhhh h prprprprprprprprpprprrrevevevevevevevevevvenenentststs aa annnnncccch hhhhhhrerereererererereeeduddududududd cecececececececes ththththththhthtttththt ee eee ststststststrererr tctcttcccdd maaaarkrkrkrkrkrrks s asasasasasasasssssspepepepepeeepectctcctcct a aaaaandndndndndnnrmrmrmmmmmmmisisisismomomomomomoomooisisisistututtutuririririzezezezeeeee e e eeeepipipippipipipidedededededdderrrrr
S T R E T C H M A R K S
A brand of Sicobel laboratory – Expert in Phytodermatology since 1959
Stretch marksActive concentrate
InInndidiiidiicaaaatitititititititititiitiiiionooononoonooonon: prprprprprprprprpregegegegegegeeeeee nannnnnnnnnnn nttnntnttttn wwwwwwwwwwommomomooo enenenenenenenee , , , pupupupupupupupupupp bebebeebeeebeeeeertrtrtrtrtrtrrrtty,y,y,,, w w weieieieieieieeieiighghggh ll losoosososoossssUsUsUsUsUsUsUsUsUsUsUsUsUsU e:: AAAAAAAAppppppppppppppplyyyyy m m mmmmmmm m mmoororrro nininninininin ngngngg aaandndnddndnddd ee e eeveeeveeeev nininnnnnn ngngngng i i n n cicicic rccccccululululularrr mmmmasaa saaagegege oon n nn ttthe e e e area riiiiiskskskskskskskssssk tttttto ooo ststststtrereeeetctctct hhhh hhhhhh mamamamamamamaaaarkrkrks ssssssssssss susususususssss chchchhchhh a a aaas s s ss s brbreaeaeaaststs s,s, bototoo tot m,,, belele lllly anddd t ttthihihihihighg .InInInInInInIntetetetetettetteensnsnsnsnsnsnsnsssssiviviiviviviviviviviii e e e e trtrtrtrtrtrtrtrtrt eaeaeatmtmtmttmtmtmtmtmttmtmenennnent:t:t:t:tt totot a appppplylyy t wiiiceee aaa dddday ddddddururururuu inininng g 2 2 till 3 mmmmonooo ththhhhhssToToToToToToToToToToToToT p pp p prerererererererererevevevvevvv ntnntntnnnnn : : : : tototototoooooo a a a pppppppppppp lylyylyyyyy o o oooooncnccce e e eeee a a a a daddaddddd y yyyy durirrrrr ng aaaall yeaaeae r lolololongngngg
EFEFEEEFEEFEFEFEFEFEEEFEEE FIFIFIFIFFFFFF CACACACCACYCYCYCYCYYCYYCYYYYCYCY PP P PPPPPROROOROROROOOVEVEVEVVEEEEDDDDmam rksThThThThhThhhThisissisisisisssssi c c cc coooonnooonnonnnnoonooooonoonoo cececcccentntntntttrararararararaarratetetetetetetted d dd cacacccacacaarererererrererr p p p p pp ppppprererererererer vevevevevveventntntntntnnts ss s ananannanana d dddd dddd rerreeerereduduuduuddducecececees ss thththththe e ststss reerettcttttt h m
asasasaspepepepepepep ctc wwwwwwwwwwwititittth h h h alallalalalallalsososososososs m mmm m mmmmoioioioioiooioiioooio ststststststtstts ururuurrrururrurrurizizizizizizizzzzzzininininniniiniii g ggggg thththththththtt e e eeeee epepepepepepeppididididdidididererererererere mimimimmimis.s.s.ssououblb e e ThThThTThThTTT anananaannkskskkskk t tttttto o o oooo o o oooo ooo ththththtththhthttt e ee e e eee ununununununununiqiqqiqiqiqqqqueueueueueueueueueue c cc cc cccomomomomomomomomomomomombibibibibibibiiinananananananananan titiitiiononoononononon o oooo o ooff f f fffff f plplplplplplpplpppp ananananantststststs a a aaactctcttctctc iviviviivi esesses,,, ,, tththththtt isss ddobbbirirthth.cacarereeee a actcttiioiioooooooooon nn n nn acacacacacactt tttt atatatatatatattat tt t t t tttt tttheheheheheheehehehehee oo o ooooriririiiriirrir gigigiggig n nnnnn ofofofoofoff ttt t ttthehehehehehehe s sssss strtrtrtrtrtttreteeteetetee chchchchch m m m mararaaaara ksksksk pp ppprorororoooorooroceceessss b
•• S SSSSStrtrtrtretetttchhh mmmmmmmmm mm arararararaaa kskskskssks a a a a aaarerererererer s s sssssigiggiggnininnnifi fifi fificacaccacac ntntttntnttlylylyylyylyyy rrr rededededde ucucuccu ededdd (1)(1))
skkskinin• S SSSigigigninininifi caaaaattitittt veve ssssssss smomomommmm ototothh h efefeffefffefefefff ctctctctct bbb bbbyyy yy y y rererererererredddududd cicingngg r rouououghghhhhhnenenennenenenennessssss o off ththe e ss (2) (2)
• F Firirmnmnm esesese s ss anna d dd ellllelelaasastittitittititititi iiciiiiciiiiciicic ttytytytytytyyy iiiiii iimmmmpmpmpprorororovveve (2)(2)(2)2)2)2) (2)
on • • ••••• S SSigigigninifi ficaaatitivee incccncrereasase e ofof t theheh tttoop llayer epideded rmiss hydratioraratete (3) (3)
(1) Clinical storage on 22 volunteers before and after 56 days of using(2) Satisfaction test on 22 volunteers during 56 days (3) Corneametry test
OLTOLERANCE TESTED UNDER DERMATOLOGICAL CONTRO
ACACACACAACACACACAACTITITITITITTTT FSFSFSFSFSFSFSFSFSFSFSFSS ACACCACCACACCTITITITIITITTITIONONONONOONONONNBBlaBlaBBBBBB ck cck ck kkck CamCamCamCamCamCamCamCammariariariariarararararaa neneneeeee s PrePrPrePrePrevenvenvenvevevvvvev tivtivtivtivtivivi e ae ae ae ae ctictctc on agaaaa insst sstrett tch markskskkkk
appappappappappeareaeeee ancaa epertiesImpmpImpmpmpmmm rovrovrovroo emeemeemeem nt ntntnnt of of of f thee bibiomeomeomeomem chachchch nical prop
skiskiskiskikiskikik n cn cn cccccontontontontrol; tonicitcitcitc y and ndd fi rfi rfi rfirfi mnemnemnn ss
ExtExtExttracracracracacct ot ot ot of Cf Cf Cfff Cffff entententententnnnenen ellllllla Aa Aa Aaa Aa AAsiasiasiasiasiass ticticticticiii a aaaaricricricricricrich ih ih ih ih ih ih n onn on on n rierierierieirierrierieeentantantantantntntntntnnnnn lislislislislisss an aaaa a a a d eeeeextrxtrxtrxtrx actactactactactactac offoff of SieSieSieSieSieSieiSieS gesgesgesgeseeseseseee becbecbecbecccckiakiakiakiakia oror orroroorienenienienienientaltta isisis
Riccicicicicich ih ihh iin an an an siaticictictictt osiss de ed andanaand exexexe traract of bs,s rich Siegesgeesbecckia orientalalalalalis sss (Sa(S(S intt Pa P ul Herb
in in ininii dardardardard utoutoutouut sidsss e)colour, RedRee uceuceuceuceucc thtttt e streetch marks appeaaarannce; c
sizss e aaaaand nndn numnumnumnu berbeeee
RuRuRutRutRutR tRR ineineneneeinneinineein co coooooommmmplmplmplpmpmp exexxxxxExtExtExExtEEEEEEEE racract ot oot f Pf PPhashash eoleoleoleoleolususus us lunlununlunnatuatuatataatttttt ssss sandandandndanda ma mammammatttritrit kinkink eseses
PrePrPP venenenenennts tstststt andanddnnd rerereducuu es strstrt etcch mmarks in e brbraaaaaaaab kinkinkikinnnk ng ttttttg the hehehee degdegdeedede radddation o anddd hehelpil ng g the
extextextextextextexttracracracracracraracracellelllee ulaulaulalaulal r mr mr atrix x reggr eneenn rationi
CalCCaCalCaCaCaCaCaaC endendenddendende ulaulaulaulaulaulla fl fl flowowowweweow rsrsssrs MoiMoMoiMoiMoiMoiMoiMoiMM stustustustutustst rizrizzzzzziinginininginin acacacacacacacttiotiott nnn
PlaPlaPlalaPlalPlalalPP nt nt nn plaplaplaplaplap cencencenenenntatatata ProPPProP tectectecececteccct ftt ft ft ft ft ft romromrommromr ex exe terterrnananalnaln aat attackkReiReiReiReReRe nfonfonfonfonfoforcercercercercerce th thhhhhe ce cee ce cccutautatt neoneoousus s barbbarb rier rr
hhe se skinkinImpImpppmpmprovrovrovovrove te tee he he sofsofsoso tnetneneeess s anannanddd fi fi firmnrmnessess of of th thStiStiStiSSS mulmulmulmmm ateateataa th thtt e ce collolllageageageen en en en exprxprprrp essessse ioion
Anti-redness cream
SoSoSoSoSoSoSoSoSoSoSoSoSooototooooooooooooo heheeeeee sssssssssenennnsissssss tiiiiveveeeeeee ss sssssssssskikikkikikik nReReRRRRRRR duceesssssssss reredndndndndnddd esesssReReReReReReRRReReReReReReReR dudududdududdd cececececeeees s s s ss ss s rerererererereereeeeeeedndndddndddd eseseessssPePePePeePePePeeP rffrfrfrfrfrrfrrrfrfummmmmmmmmme-e-e-eeeee frfrfrfrrfrfrfrfrfffrf eeeeeeeeeeeee – hyhhhhhhh popopooalaaaaaaa lelelleleellelll rgrgrgrgrgrgrgrggggggenenenenenenenne iciciccicic
A N T I - R E D N E S S
A brand of Sicobel laboratory – Expert in Phytodermatology since 1959
UsUsUsUsUsUsUssUUUUUU e:e:eAAAAAA ll iii dddd i fff k d l kkkliApApApApApApApApApApApAAAA plplplplppp y y y y yy yy momomomomomomomomornrnrnrnrnrnrrr inininini g g g g g g ggggg anananannnnd d d d d ddd eveveeeveve enneninnnng ggg ononononnnn f ffffffacaaaaa e,eee necck kkk and loooow www nenneneneneckckckc linee (o(oooor r rrrrr lolooololoooloolocacacacacacacacaalllllllly y y y y y y y ononononnnnnnnn a aa aaarerererereerererea a aa a trtrtrtrtttreaeaeeaeaateteteted foor coccccc mbmbmmbmbmbbinininaata ion nnn skkkinnnns))).
InInInInIInInInndicacacaccccccccc tititititiititttiionononononnonn::::::• • • CCCCCCCoCCCCC upupupupupupu erererereee osososoososoo issississ• ErErErErErErErEEEErytytytytyyythohohhhohhh sesessesese••••• •• RoRoRRoRoRoRRoRRoRosasasasasasasasaaaaccccececccececcccc a a aa a aaa a acacacaaaaaaaa neneneeeeeeeee b b bbegegeggegananaana
ACACACACACACACACACACTITITITITITITITITITTIT VEVEVVEVEVEVEVEEESSSSSSS ACAACACAAACACACACTITTTTTT ONNONON
CypCypCypypresresrresrr sssCypCypCypypresresresrrresresresssss Regulate the microc -circulattionRegReRe ulate ee the microccc -circucc latatata iono andandandandaandaa pupupurifrifriffri y tyyyy he skikikikskikk nn
MimmmMimMimmmmosaosaosaoss Te Te Te TeTeTeTeenuinuinuinuinn flflfl ofl rarr VVasVaVV culculcuucc o-po-po-protrorr ecteceee ive action an aand healing
LiLiqiqqquououoruoruooouu iceice exexexe tratrarararracttt DeDecDecDe ongongngngongongestest th th ththhe ee eee epidppp ermrmrmis,s antntntnntnntnn i-ii-iiii-i- nfl nflnfl nfl flflammammamammammam atoataa ry ryr actionnn
BorBorageaggegegegeagaggeg , s, s, s, s, s, s, sssoftoftoooo al alalmonmononmonmonnmonnd od od ood ooil ililil l ilil aaanda melmelmelmemeeme tintinintintinnninning ssg sg ssg g gg g g hhheaheaeaeaahheheahe butter
SofSofSofSofftnetntnnn ss,s, nonn urish s andanda avaa oido de hyddydratr ion
CinCinCinCininCinCini namnamnamnamnamnamnamamnammamonononononononnnnonononnnon PurPPPP ifyifyifyifyingininin actiotion
ArnArnArnArnAArArnAAAA icaicaicaicaicaicaiiciicaicaicacaa HeaHeaHeaH aaHeaHeaHeaHee linlinlininlinllinnggg ag ag aggg ag and nd nd dnnnddnd antantantaantaanantantnn i-iiii nfl flfl ammammammmatoatoryy
LécLécLécLécLécLécLécLécLLLécLLéécithththiththiththtthithtthhht ineineineneineiineninen ssssssssssss StrStStrtrStrStStrSS rS ongonongonggongongooongg mo mo moisttstististtturiuriuriuriuriiu zinzinzinzinzinzinzzzing ag ag g ag ag agg ctictictctctit veveveve
Anti-redness creamSensitive skins
Integral anti-ageing mask
Anti wrinknkkklesAnAAAAAAAAA ti-wriiiiiiinknknknkleleleees,sss,sstit ghghghgghghghgg teeeeeeeniniiiiiiniiniingngngngnggngngnggggg, fifififififififififififififirmrmrmrmrmrmrmrmrmneneneeessssssssfi fi fi fififififirrmrmrmmmmmmr nenessss
111111111111111111111111sttststtttttttttstttttstttttttttttttsttssss a aaaaa aaaaeseseeesesesesesssesessesesesessessseesesesssesese ththththththtttheteteteteteteteetetetetetetetetetetetetetettticiciccciciciciciccicciiiii d d d ddd ddddddddddddderereereeerererereereeeeeeeereeeee mamaamamaamammamamaamaamamaamaamamaamaam totototoooooolololooooololoooooooloogygygyygyyygygyyggygyggygggggygyygyyyggyyy t t t t t t ttttttrererererererereerereererer atatatatatataaaaaaaa memememememmmmmmmmmmem ntnnt prprprrprprprprprpprpprprprrprppprpp opopoppopopoppoppoppopopppopooppoppppoppopppppopoppopppoposooooooosssssssssoosssoooossooossososoooosooooooooooo edededededeeededddedededededdedeedeeeeeeeedeeeeeeee t t t ttttttttttttto o oooooooo o oooooooooooooooooooooooooo ththththhththhhhthhhhhththhhthhthththhhthee e e e gegegegegegegggggggggggggggeggggggggggggggggggggg nenenenennnen rarararrrrrarrrr l l l pupupupupupupupupupppppp blblblblblblblbblbblblbllblicicicicii v vvvv vvvvvvvvvvvvvvvvvvvviaiiaaaaaaiaaaaaaaaaiaa pp pp p pp rererereererrr scscscscscscssssss ririr ptp ioon
P R O - C A R E
A brand of Sicobel laboratory – Expert in Phytodermatology since 1959
Integral anti-ageing mask
UsUUUUUUUU e:::::::::ApApApApApApApApApApAppApApplly yyyyyyy onononnononono c c cc cleeleeleeanananaaaanaaaa s s ssssskikikkkikikikikiikin nn wiwww thththhththhthtt tt thehehehehhhhh r rrrigigiggghthth p pppososssssitititttttiooonininin ngnn , sppppacaca eseses ffffforr eyes annnnnnannnnnd dddddd nononnoooseseeeese....SaaaSaSaSaSaSaaSalvllvlllll agagaagagagggagaggggggge eeeeeee ththththththhthhhhhe e e ee gegegeeeeeeeeel ll llll whwhwhwhhicicicicch h hh ststilill l inini theeee bbboxoxoxox sssspreaeaeaeaaad d d d oovoveree the mmmmasaaa kkLeLeLeLeLeLeLeLeeLeLeL avavavavvavvavavvvvininininininning g g ggggg 202022020202202 m mmmmmmmmminininnnnnututututtteseseseseseses. ReReReReeeeRR momomomoooooveveeveeees s mammmmmm sk anddd dddo ooo nononon t t t t rinsssse e bububuut t to spspspspspsppspspspsppprererrrrr adadadddddddd a a aaaaaarorororounununund d d ddd eyeyeyeyeyeyeyeyeyeyee ee eee ee thththththththt e e e eee gegegegggegegegggelllllll ll exexexxxcececececec ssssssss.CCCCCCCuCuCuCuCuCuCuCuuCuCuCCCC rererreerer : :::: ddddd ddddddd i 6 t 12 ddddononononooooo cececececececececee a a a aa d d d d ayayayayayayayaaaa d dddddururururruruu ininininiiniing ggg 6 66 totototo 12 22 dadadaddddd ysysyyyyyyysClClClCllCC eaeaeaeaeaeaeaeansnsnsnsnsnsnsnsnsnn ininininiinii g/g/g/g/g/g/g/g//g mamamamamammmmmammm inininininninnintetetetetetett nananaan ncncncnccce:eee onceceeecee a wwwwweeeeeeek kkk durirrr nggg ttttheee yyyyeaeeee rFeFeFeFeFeFeFeeFeeatatatatatatatattaat:::: :: :: pupupupuncncncncncncncncnctutuututuutuaaalallyyylylyyyyy f f f f ff orooooo aaaaaaaaaaa r efeeeee rerrrererereerereshshshshshsssh l llloooooooo kkkk
EFEFEFEFEFEFEFEEFEFEE FIFIFIFFIFF CACAAAAAAACYCYCYCCCCCY P PP PPPROROORORRRRROOOOVEVEVVVEVVEVEVVED D D DDDDDBYBBBYYYBBBB D D DDDDERERRRERRMAMAMAAMAATOTOOTOTOOT LOLOLOLOOGIGGG STSSTSTSTSTSTSSS
IIImImImmmImmmmmemmedddididiididdiatatatatatatattaaaatttataaa ee ee eeeeeee efefefefefefefefe fi fifififificacacacacacacycycycyycyyy a aa aftfttfteerere aaaan n aea ststheheetittitic cc dedededededermrmrmmmatataaata olololo ogogyininnnnntetervrvvenennennentititititiitittttt onoononononononnoonnn ss s sssss sucuuuucucucuucucucuuchh hhhhhhhhhh asasasasassasasasss g g g g ggenenenenne tltltltltly yy yy y pepepepepp elelelele inininini g,g,g,gg, ll lllasasasasaserererer, , ,, ,, ppppuppp lsedd lligight,
ininininnininnnjejejejejejejejejeeectctctctcttctctcctctioioioioiooioioioii n,n,n,,n,,nn,n m m esesesololololololoo ifififififttttt.t.
TheThehehe ss studyddd wawawaw s cs errieeeeededee ou ououuo t bt bbbbbby 1y 1y 1y 1y 11 d1 d1 d1 d1 d1 d1 d1 d11 d11 ermermmmmmmmmmmatoatooatoaa oa logogoooo istists/as/aestestthethetic ic docdoctortttors os os os n 2nn 222237 patpatiene ts in nFerrrbrubrubrub aryra and d Md Mdd arcarch 2h 222200700700 . C. CCo-oo-oo-oo-o-o-- rdirdinatnatnattattnnnna e be beeeeee bby Ey Ey y ffi fi f carcarc e.e.
UsU inng ggg ininn c cccccababaa inin aa aas s sss popopop ststststt-o-o-o-opepepepeperararaatitititit ngngngngg c c cccarararareeeeAsAs r relelayay a aaftftf erer t trereatatatatatatatmememememememememmemmemm ntntntntnt t tttto o o oo opopopopoptittitit mimimimimizezezzez r r rresesesese ululullltstststsss a a aaaaattt tt home
SYSSYSSYSSYMPMPMPMPMPMPMPMM TOTOTOTOTOTTOTOTOTOTOTOTT MSMSMSMSMSMSMSSSSYYMPMPMMMPMPMMMMMMM TOTOTOMSMSSSSMSS ACACACA TITTIT VEVEEV SSACAACAA TITIITITIVEVESSPosPosPosososPosost-tt-ttt tttt reareae tmetmetmemetmetmeent ntntntntnn redrererererrerr ness ssssandananddda in inin ininnfl afl aflaflflaammammammmammmmmatiotttt n dnn ue ueueueu to totoootoaeaeesssesthethethethethh tictic deddede dermarmrmmmmm toltototootoo ogyogogyg
CamCamCCamomiomiomomiomomile l anddd organic orangeee extract
DehDehDehDDDehDDDDDDDD ydrdydrydrydratiatatiat o oo oo f ttf ttthe he hehe he epiepiepiep derderderdermismisimimissss toptopt la laaayery sss
Plaaaaaaaant nt nt ntn PlaPlalalalal cencencencecencenntatt
LosLosLosLoosoLoss os os os ooooos of fif fif fif fif fif fif fi rmrmrmmmm nness, sss loose ssss skikiiiskiiskiskiskinnnnnnnn VegVegVegVegVee etaetetee l dddddddermmmmmo-to ensor r(ex(e(( tratratraract ct ctct of KigKiKigelie a aa aa aa nd Quillaja)a)
WriWriWrWriWr nklnklnklnklnklnknklkn eseses esesesesesese andanandndnddandddand ssms smmmm llllallall wrwrrrrrrrinkinknkinkinkki kkkleslesleslesesseees SeaeSeaeSeaSeaSeaSeaSea co cococoo cooocollallallallallllaal genenenennen
DulDulDulDuDuDDD l sssssssskinkkkink OrgOrgOrggOrganianinininnn c oc oranrannnge gge ggee exexextxtexexextracracttt
H Y D R A T I O N
Regenerating and moisturizing cream
MoMoMMMMMMoMMMMMMM isi tutututututututttutututuririririririzezezezeeeeeee aaaaaaaaaandndndndndndndnndnd nonnnnn urisississiii hhhhhhh drdd y skinnononononononononononononononoooononooourururururrrurrururrrurisiisiisiiish hhhhhhhhhh drdrdrdrdrdrdrdrdrdrrddrddddddrd y yyyyyyyyyyyy skss in CaCaCCaCaCaCaCaCaCaCaCaCaCCaCCCCCaCCaCaCaCCalmlmlmlmlmlmlmlmmlmlmmlmlmlml andndndnnnnnnnnnnnn ssssoooooooooooooooooo thhhhhh seseseseeseeeeeeeeseensnsnsnnsnsnnsnsnsnsnnsnn ititititttittitttiviviviviiiii e e eee eee sksksskskskskskskskskkkkinininininininininini
UsUsUsUUsUsUsUsUsedededeeeed b b bbby y y y thththththhttt e bubububuuurnrnnrnr s ss s ssssunununuunuunuunnnnununuuunuuuunuuuuunuuuunununitititiitiii s ss atatatataaaaa A A AAAAntntntnttaavavavavavililililililiiii leleleeeee H HHHHHHHHosooososooosoospipipippipip tatattatatataaalllllll lininininininnn t ttheh 9999999999990’0’0’’0 s.s.sssssssssss
ReReRRRRRR papapapaapapap iriririiririninininii g g ggggg skskskskskskskskkskss inininnnnn
frfrfrrfrf omomomomomomomoomooooo 222222222222 dd dddddayayyayayyyayssssssss*****
A brand of Sicobel laboratory – Expert in Phytodermatology since 1959
Regenerating and moisturizing cream
Dry, sensitive skin
InInInInIInInInndicacacaccccccccc tititititiititttiionononononnonn::::::- HHHHHHHyHHHHHHH drdrdrrdrratatatataaa ioioiioionnnnnnn- TTT TTT TTTTTreeeeeeeeeattattatmemeeeementntntntntn a a aaaaaaaaftftttererererrrerer a a a rrrrrrrrrrrrrepepepepepepeepe aiaiiiriririririrr ngngngngngngn o or r plplplplplpp asasa tiic susurgere y, xxxx-rays trtrtrtreaeaeaeeatmenent,
cacacacacaccaccacanccccccccerererererereerereeeeee ololololololo ogogogogogogogogogoggy,y,y,yy e e ecccczczczczcccczemememema a aaa prprp oboblelemsmsms, ettc.UsUsUsUsUsUsUsUsUsUsUsU e:e:e:e:e:::e:::: ApApApApApApAppApApApAA plplp y y momomomomomomomom rnrnrnrninininiini g g g gg anananananananananand/d/d/d/d/d/d/d//ororoorooroor eeeeeeeeevevevevveveveveveninnininggggggg o oooon nnn fafafafaaceecee aaaandndndnd nnnnececee k whwhwhwhich hahhas beeen
ii llllllll lll iiprprprprprprprprprprprppprrp eveveveveveveve ioioioioioooususususussuususlylylyyyyyyyy c c c ccc ccccleleleeeanananana sisisisisiisissss ngngngng....
EFFEFEFEFFFEFFFIFFFIFF CACCCACACACACACCCACACACCAC CYCYCYCYCYCYCYCYCC PPP PRORRORORRORR VEVEEVEVV DDDDDDDIn-vittttttttttrororororororororoo aa aaaaandddndnddd II III II Inn-n-n-nnnn viviiivivivvv vovovovooovov CCCCCliilinininin cacacccc ll l ststtuduudududuuu yyyyyyy
InnnnnnInnInnnnIn-v---v---vititittiitittroroooroooooooo o o oooobjbjbjbbjbjbjjbjbjjbbbbjeeeceececceeeeeeeee tititt fi fi fifififi fi fificacacacaacaaaaaatititttttt ononononnInInInInInInInnnInnnInn pp p pppprereeeeerereereseseesesesesencncccnnnn e eee ofofoffofofofoff p pp ppppppppppppllalalalaaaaaaantnttnnnn p ppppppppplalalalacececceentntntta a a aa ththhhtt e e e e cececceceeeeeceelllllllls s arararre e e ststststss immimmmmmmmuuuulululuuluu atatte::••• • ++ ++++++++2222222222222222222222222222%% % %%%%%%%%%%% inininininininincrcrrcccccrreaeaaaaeeeeeeeaaasesesesesessesessee I I IIn n n n ththththththhttt eee e oxoxoxoxoxoxoxoxoxxoxxyygyy ennn c c ccconononononoo susuuusuussuuss mpmpmpmppttitititttionononnoonnonononnn oo o oooooooo of f f f f sssskskssskinnn c celelelelellslslssl• •••• •• ++++ +++++44242424424244244422% %%% %%%%%%%%% ininiii crcrrrrreeeaeaeaseseseseeseeseeseseee i ii iii in n nnnn ththththtttt e e ee e ee syntheheheheheheh susususussssus s s s offofofof sssss kkkikkiikikikiikk nnn nnnn n nn n prprprprprprprprprppprpp otttttttototototteieieeieieeeeieee nsnss
RReReReeeesususs lttlttttts:ss:ss:s• •••• EEEEE E EEEEEEEEEEpppippiipiiiipipipiiiip dedededdeddd rmrmrmrrrmrr issssss regegegegegegegenenenennerererereratatattaaa ioioioioonnnnn• • • • • LL L L LLononononnnnnonononnnoooooooonngg-g-gg-gg-gggg-ggg titittttt mmeeeeee mmmmmmmmmoioioioioioioioistststststststs urururururu izizzzzatatatatatatattioioioioonnnnnnn• •• •• • R R RR Redededeedddddduccucucuuuuuu esesses aaa aandnnddnd p ppppprererer vevevevvevevventntntntn ss s s wrwwrwrwrwrw ininini klkklesesesse aaaaandnndnd ssssmmmamallllll w wwwwwrrririririririnkles s appearranance,
scscscscscscararaaraaa ss ss sssssss anannnanaannaand d dd dd ststttstss rereererettcttctt h h mamammamam rkkkrkkss s ss alalalaa rerererererer adadaaa y y yyy y y prprpp esesesesenennnenntststststststsTestTest on on oo cellcells cs ccccucuuuucucc lturlturlturlturltulturltultures bes bes bbes eee y Dey Dey Dey DeD rmscrmscmrmm an lan laboraboraborratoratororatoratory 922y 9yy 92929229292y -933-93-939393999
InInnInI -v-vvvivivivivivo oo o o ooooboboobobooo jejejeectctc ifiifii ccattion•••• •• AfAffAfteteeteteer r 3 3 33 dadaadaaysysysys, ,, , ththhtht erereerereeree e ee e isisisiss a a a 2 222 21%1%%1%1%%% ddddd dececcccececrerererrerrr asasase ee iniin ttraransnsepepididerermamal l wawateter r lolossss (1) (1)
•• • • A A A Aftterererer 7 7 dd dayaaays,s, t thhehehhehehererrer iis s ss a a 282828282828%% %% %%% dedededededeeeeeeccccrcrcc eaeasese i in n trtranansesepipidedermala watter loss• • AAA Affttererer 22 2 ddd d daayayayyssss,s,, PP PPPPPPllalalalaal cececeeeeentntnntntntntnttntttororrororooooorr vv v egegegegeegegegegeggggeggetetetetetetetalal rreggene eratinng g ana d moisturizing
crcreaeaee m m hahass s aaaaa a a isisiggnififi cant t rer papairring effect on skin.* DERMSCAN CA CCClllinical Study -June 2012- Study carried out in 18 volunteers over 11 days- Application bi dbi-dailyaily (1. (1)Tra)TraTransepidermal Water Loss or TEWL is an indicator of the skin’s barrier function.
TOLERANCE TESTED BY DERMATOLOGISTS
ACACACACACACACACACACACAA TITITITITITITTITTIT VEVEVEVEVEVEVEVEVEVVEVVVEVVV SSSSSSSSSSS ACACACACAACACA TITITITITTTIONOONONOOOPlaPlaPlaPlal nt nt ntnt nt ntnt ntnt nt plaplaplaplaplaplaplapp cencencencencencenccentatatatattt MoiMoiMoiMoiMooooistuttttts rize immemmm diaateltelteltele yyy
StiStiStiStiStiStSttt mulm atettt thtttt e cells rs rs rregeegeegee neration
PlaPlaPlaPlaPll ntntntnntnt glyglyyglyyyycerercereeeeeeeee ininnnnPlaPlaPlaant nt nt nt nt glyglyglyglyyglyyglyyyglycercerceecececccccccc ininnnn MoiMoMoo sturize nouo risiisish ahhh nd givg e softnese sMoisturize, nouoo rish and n givgivgg e softness
CaCalCalCaCalCaCa endendendulaulalaaalaala SooSooSooSSoooo thethethhth anaaa d softt the sskinkikikCalalala endendendenen ulaulull , rrrrichi in phytoostest rols, carcarcarararoteoteteteoteteotenoinonn ds dsdsss andandaanddd sasasas poninsn , is renowned forrrrrr it it itit itits asss as ntintintinn sepsepsepps tict , softofoftenienn ng gg and healing pproproprproprr perereeeree tietietietietiet s. s. s.sss
top related