biodégradation of toluene, benzene and naphthalene ... - wur
Post on 06-May-2022
8 Views
Preview:
TRANSCRIPT
Biodégradation of toluene, benzene and naphthalene
under anaerobic conditions.
Alette Langenhoff
CENTRALE LANDBOUWCATALOGUS
gawi
Promotor: Dr. A.J.B. Zehnder
hoogleraar in de microbiologie
Co-promotor Dr. G. Schraa
universitair docent bij de vakgroep Microbiologie
A.A.M. Langenhoff
Biodegradation of toluene, benzene and naphthalene under
anaerobic conditions.
Proefschrift
ter verkrijging van de graad van doctor
op gezag van de rector magnificus
van de Landbouwuniversiteit Wageningen,
dr. C.M. Karssen,
in het openbaar te verdedigen
op vrijdag 4 april 1997
des namiddags te half twee in de Aula
f:/7 f s7£?7
CIP-DATA KONINKLIJKE BIBLIOTHEEK, DEN HAAG
Langenhoff, A.A.M.
Biodegradation of toluene, benzene and naphthalene under anaerobic conditions /
A.A.M. Langenhoff. - [S.l.rs.n.].
Thesis Landbouwuniversiteit Wageningen. - With réf. - With summary in Dutch.
ISBN 90-5485-660-2
BIBLIOTHEEK LANDBOUWUNIVERSITEIT
WAGENINGEN
This research was carried out at the Department of Microbiology, Wageningen
Agricultural University, The Netherlands. It was financed by a grant from DSM
Research, The Netherlands.
ht*o:z.à\'H% Stellingen
1. Xenobiotica zijn niet zulke wereldvreemde verbindingen als in het algemeen wordt aangenomen.
Fischer-Romero, C. et al. 1996. Tolumonas auensis gen.nov.,sp.nov., a toluene producing bacterium from anoxic sediments of a freshwater lake. Int. J. Syst. Bacteriol. 46:183-188.
2. Officieuze bacterienamen voor anaërobe tolueen-afbrekende bacteriën, zoals Tol2, strain Tl, strain PRTOL1, duiden in het algemeen op weinig creativiteit van de wetenschapper.
Frazer, A.C. et al. 1995. Toluene metabolism under anaerobic conditions: a review. Anaerobe 1:293-303.
3. De bewering van Zehnder en Stumm (1988) dat er destijds geen bacterie beschreven was die zijn energie uit de oxidatie van organische koolstofmolekulen en de reductie van mangaan of ijzer oxide kon halen, is niet terecht.
Ghiorse, W.C. 1988. Microbial reduction of manganese and iron, p. 305-331. In: A.J.B. Zehnder (ed.), Biology of Anaerobic Microorganisms, John Wiley and Sons, New York. Lovley, D.R. et al. 1987. Anaerobic production of magnetite by a dissimilatory iron-reducing organism. Nature 330:252-254; Zehnder, A.J.B. and W. Stumm. 1988. Geochemistry and biogeochemistry of anaerobic habitats, p. 1-38. In: A.J.B. Zehnder (ed.), Biology of Anaerobic Microorganisms, John Wiley and Sons, New York.
4. De stellige uitspraak 'homocyclische aromatische koolwaterstoffen kunnen onmogelijk onder anaërobe condities worden afgebroken' is heden ten dage niet meer te rechtvaardigen.
Prof. F. Wagner tijdens Dechema '91 te Karlsruhe, Duitsland.
5. De positieve werking van steeds populairdere, microbiële produkten zoals Yakult, Vifit e tc , moet niet worden overschat door met name knoflook-etende personen.
Naganawa, R. et al. 1996. Inhibition of microbial growth by ajoene, a sulfur-containing compound derived from garlic. Appl. Environ. Microb. 62:4238-4242.
6. Waardering is de beste motivatie!
7. De discussie omtrent het voorstel om werknemers voor minder dan het minimumloon te laten werken, lijkt weinig actueel gezien het aantal OIO's, AIO's, en NOPpers, dat dit al jaren -legaal- doet.
Volkskrant, 25 januari 1997.
8. Invoering van het bursalenstelsel voor promovendi heeft niet alleen een negatief effect op hun positie, maar ook op het onderzoek.
9. Een verhuizing naar Engeland verduidelijkt hoe langzaam de totstandkoming van één Europa gaat.
10. Het toenemende gebruik van genetische probes geeft kleur aan de microbiologie.
Appl. Environ. Microbiol. 1996.
11. Reizen naar onbekende plaatsen is net als onderzoek; altijd vol verrassingen!
12. Er bestaan geen giftige stoffen, er zijn alleen giftige hoeveelheden.
13. De voorspelde schade, die werkgevers lopen als gevolg van sportblessures van hun werknemers, weegt niet op tegen de verhoogde fitheid en weerstand van sportieve werknemers.
14. Vrienden zijn onmisbaar!
Stellingen behorende bij het proefschrift "Biodegradation of toluene, benzene and naphthalene under anaerobic conditions " van Alette Langenhoff. Wageningen, 4 april 1997
Ik wil graag iedereen bedanken die, op
welke wijze dan ook, een bijdrage heeft geleverd
gedurende de uitvoering van dit promotieonder
zoek en het tot stand komen van dit proefschrift.
A(*Kc
Contents
Chapter 1 General introduction. 9
Chapter 2 Behaviour of toluene, benzene and naphthalene under
anaerobic conditions in sediment columns. 29
Chapter 3 Naphthalene degradation under sulfate reducing conditions:
Attempts to enrich for naphthalene degrading bacteria. 47
Chapter 4 Microbial reduction of manganese coupled to toluene
oxidation. 63
Chapter 5 Characterization of a manganese-reducing, toluene
degrading enrichment culture. 81
Chapter 6 General discussion. 103
Summary. 121
Samenvatting. 125
Curriculum vitae. 129
List of publications. 131
Chapter 1
General Introduction
Chapter 1
Aromatic compounds are widespread in nature. They can be of biological or
of synthetical origin. The most important natural sources of aromatic compounds
are poorly degradable polymers, such as lignin, condensed tannins and humus (27).
Other natural sources of aromatics in plants contain only one or a few aromatic
rings e.g., aromatic amino acids, flavonoids, tannins, etc. (60). Increased industrial
activity has resulted in the release of a wide variety of aromatic pollutants in the
environment. Aromatic hydrocarbons are important constituents of gasoline, crude
oil and oil derivatives, are used as solvents and in wood preservation industries,
and are produced by the pyrolysis of materials such as fossil fuels, saturated and
unsaturated hydrocarbons and carbohydrates. They are widely distributed in soils
and aquatic environments, due to leakage of industrial or sewage effluent and the
use and disposal of petroleum products. High concentrations of aromatic hydrocar
bons have been detected in the Netherlands. Initially, it was thought that the
presence of certain aromatic pollutants in the environment was due to the activity
of mankind only. However, there is evidence that an aromatic compound like
toluene can be produced by bacteria as well (28, 37).
In the Netherlands, many areas exist that are heavily polluted with toxic
aromatic compounds (67). Concentrations of up to 8 g aromatic hydrocarbons/kg
dry weight were measured, e.g. in sediments of the river Ur, The Netherlands
(58).
Most of the monoaromatic hydrocarbons are depressants of the central
nervous system and can damage liver and kidneys. In addition, the polycyclic
aromatic hydrocarbons (PAHs) are known carcinogens or mutagens (70). People
have become increasingly more aware of the health risks caused by the presence of
these toxic compounds in the environment, and removal of these compounds has to
be taken care of.
In this chapter, general aspects of microbial transformations are given, and
the knowledge about the anaerobic degradation of toluene, benzene, and naphtha
lene, compounds with different chemical structures (Fig. 1), is summarized.
Various redox conditions are described, and an overview of one particular
anaerobic condition, namely where Mn4+ functions as electron acceptor will be
presented. The outline of this thesis is presented in the last section.
10
General introduction
toluene benzene naphthalene
Fig. 1. Chemical structures of toluene, benzene and naphthalene.
Microbial transformation.
Aromatic compounds are known to be transformed by microorganisms.
Biotransformation is one of the major processes determining their existence and
persistence in the environment. In contrast to the often partial degradation by
chemical transformations, a complete biological degradation (mineralization) under
aerobic and anaerobic conditions is possible (11). Sometimes however, microbial
transformations only result in small structural changes, which may lead to the
formation of products that are hazardous to the environment as well.
Microbial transformation processes depend on the properties of the chemical
compound, the involved microorganisms, and environmental factors. The struc
tural, chemical and physical properties, and the available concentration will control
microbial degradation besides the availability of other carbon- and energy sources,
or electron donors, electron acceptors, essential nutrients, growth factors, sufficient
moisture, and the absence of toxic compounds. Microbial activities depend further
on environmental conditions such as temperature, pH, redox potential (Eh),
salinity, availability of the aromatic compound etc. (33). Finally, the presence or
absence of oxygen as direct oxidant markedly determines the range of possible
metabolic pathways (71).
So far, much research has been done on the microbial degradation of
aromatic hydrocarbons under aerobic conditions. Under these conditions, oxygen
does not only serve as a terminal electron acceptor for the electrons released during
metabolic reactions, but oxygen is also incorporated into the aromatic ring by
mono- and dioxygenases. Numerous microorganisms have been isolated that
mineralize aromatic hydrocarbons under aerobic conditions, and their degradation
11
Chapter 1
pathways have been elucidated. However, due to soil characteristics and bacterial
activity in soil, oxygen may become limiting in many polluted soils. As a conse
quence anaerobic bacteria dominate. These bacteria use terminal electron acceptors
like, nitrate, Mn4+, Fe3+, sulfate or carbon dioxide. Since molecular oxygen can
not be build into the aromatic ring under anaerobic conditions, different metabolic
mechanisms are used for the degradation of aromatics.
Aromatic compounds possess an extremely high stability, because the
aromatic structure provides the carbon-carbon bonds with an extra stabilization
energy (1). Aerobic bacteria use molecular oxygen as the terminal electron
acceptor, but also as a highly reactive cosubstrate to destabilize the aromatic
structure. Under anaerobic conditions the function of oxygen as electron acceptor is
taken over by alternative electron acceptors (nitrate, manganese, iron, sulfate or
carbon dioxide). These alternatives cannot replace oxygen in its function as cosub
strate, and the first degradation steps differ from those under aerobic conditions.
Under anaerobic conditions, the stable structure of the aromatic compounds
has to be activated by carboxylation, hydroxylation or CoA thioester formation.
Intermediates have to be formed that are susceptible to reductive attack of the
aromatic ring by dehydroxylation or transhydroxylations (Fig. 2) (30).
COSCoA COOH
O - P — U V « ^ phenylacetatc phenyljjlyoxylate \> f J
B
COSCoA COSCoA
COOH
O I U ^X. - O i l ,
O — O — O — (Q phenol J 4-OH-benzo»te J T berwoyl-CoA
OH . OH O i l
C H j | CHO COOH
é - è à / p-crewl | | bciuoate
or
c
:oi—xoi coi OH OH > f OH
Ol — O — O çoo» I toluene benzylalcohol benzaldehydc O H ^ ^ A ^ O H ^ ' ^ Y ^ N T ^ 0 "
OH OH
phloroglucinol
Fig. 2. Reactions leading to the formation of benzoyl-CoA (A), resorcinol (B), and
phloroglucinol (C) (taken from Fuchs et al., 1994).
12
General introduction
These intermediates are benzoyl-CoA (rather than benzoate), resorcinol and
phloroglucinol. Compounds that enter directly one of the pathways mentioned
(e.g., benzoate, resorcinol, and phloroglucinol), are degraded faster than com
pounds that first have to undergo additional transformations (60). Further trans
formation occurs by reductases. Finally, the formed non-cyclic compounds are
converted into central metabolites using conventional pathways.
Ring substituents have their influence on the chemical stability of the
aromatic compound. Aromatic compounds with a functional group (-OH, -COOH,
-NO3) e.g., benzoate, phenol and catechol, can be degraded anaerobically using
various transformation reactions, e.g., reduction of the aromatic ring, dehydroxyla-
tion and dehydrogenation (30, 33). In homocyclic aromatic compounds (i.e., cyclic
compounds with no oxygen present either in the ring structure or as a substituent)
e.g., toluene, benzene and naphthalene, the chemical stability is much larger. This
may partly explain why the anaerobic degradation of homocyclics is much less
documented than heterocyclics.
The anaerobic degradation of the aromatic hydrocarbons toluene, benzene,
and naphthalene.
The resonance energy of benzene is higher than that of naphthalene,
indicating that the activation energy for benzene is higher than the energy needed to
activate the ring structure of naphthalene (1). Toluene is less stable than these non-
substituted aromatic compounds, because of the methyl group that destabilizes the
aromatic nucleus, and as a consequence less energy is needed to activate the
aromatic nucleus.
Anaerobic degradation of toluene has been shown with bacterial enrichment
cultures under denitrifying conditions (36, 38, 49, 72), sulfate-reducing conditions
(5, 22, 35) and methanogenic conditions (21, 34, 66, 69), and with pure bacterial
cultures under denitrifying conditions (3, 19, 26, 61), iron-reducing conditions (44)
and sulfate-reducing conditions (7, 57). No pure cultures have so far been isolated
from methanogenic enrichments. Different degradation pathways have been
postulated but more research is needed to confirm and complete them. In general,
13
Chapter 1
these degradation pathways seem to be similar, regardless of the type of terminal
electron acceptor (nitrate, manganese, iron, sulfate or carbon dioxide) involved.
Most of the research on the degradation pathway of toluene has been
performed with denitrifying bacteria. The degradation of toluene in denitrifying
bacteria mostly starts with an oxidation of the methyl group via benzylalcohol and
benzaldehyde to benzoate and further to benzoyl-CoA (Fig. 3) (4, 9, 29, 61, 62).
CH^OH CHO COOH COSCoA
toluene benzylalcohol benzaldehyde benzoate benzoyl-CoA
Fig. 3. Formation of benzoyl-CoA from toluene, measured under denitrifying conditions
(taken from Altenschmidt and Fuchs, 1992).
Both a benzylalcohol dehydrogenase and a benzoyl-Coenzyme A reductase have
been isolated from Thauera sp. strain K172 (8, 10). A different pathway was found
in both a denitrifying bacterium (strain Tl) (25), and a sulfate-reducing enrichment
culture (6) (Fig. 4). o o
-CH2CH2CSCoA *- C ^ -CSCoA •> ring cleavage
benzoyl-CoA
^ <
/
CH3
phenylpropionyl-CoA
o-toluene
\
0 II CSCoA
<^ j>-CH2CHÇH2 .
COOH o-
COOH
V ^ -CH2CHCH2
COOH
< Q > - C H 2 C = ÇH -
COOH
-X-»
benzylsuccinyl-CoA
Fig. 4.
COOH
benzylsuccinate benzylfumarate
Transformation of toluene in both a denitrifying bacterium and a sulfate-reducing
enrichment culture. The upper pathway illustrates mineralization, and the lower
pathway illustrates the formation of two dead-end products benzylsuccinate and
benzylfumarate (taken from Evans et al., 1992).
14
General introduction
About 80-85% of the toluene was transformed via an oxidative condensation of
toluene with acetyl-CoA to phenylpropionyl-CoA, which underwent complete
mineralization. The remaining toluene was transformed into two dead-end products:
benzylsuccinate and benzylfumarate. These dead-end products were also formed by
the sulfate-reducing strain PRTOL1 (7). In a methanogenic enrichment culture on
toluene small amounts of p-cresol were detected (Fig. 5), formed via the oxidation
of the aromatic ring (66).
4-melhylcyclohexanol
Ô mclhylcyclohexane
P — P — (Q) toluene bcnzylatcoho! bcnzaldchyde
<8» o-cresot 2-metliylcyclohexanol
2-liyclroxybenzoale
Fig. 5. Transformation of toluene with a methanogenic enrichment culture (taken from
Grbic-Galic and Vogel, 1987).
The hydroxyl group was demonstrated to originate from water. Nonetheless, the
conversion of toluene to /7-cresol was slow and could therefore not account for the
rapid metabolism of toluene in this culture. It was concluded that most of the
toluene was degraded via the oxidation of the methyl group, resulting in the
formation of benzoate, and that the conversion to p-cresol was only a minor
pathway. These results demonstrate that the anaerobic biodégradation of toluene
mainly starts with an attack of the methyl group.
Benzene has been considered to be persistent under anaerobic conditions for
a long time, but evidence is emerging since the last decade that degradation is
possible. For the first time benzene was demonstrated to disappear in a methano-
15
Chapter 1
genie enrichment culture, derived from sewage sludge in which ferulic acid was
degraded (34, 66). Complete anaerobic mineralization of benzene to C02 was
found with aquifer-derived organisms (20), however it was not elucidated whether
methanogenic or sulfate-reducing bacteria were involved. Only small amounts of
methane were produced and the small changes in sulfate concentration were
difficult to measure. With microbial consortia obtained from polluted sediments,
the degradation of benzene was shown with iron (47, 48), and with sulfate as elec
tron acceptor (42). So far, nothing is known about possible pathways, intermediates
and the bacteria involved.
Knowledge about the anaerobic degradation of polycyclic aromatic hydrocar
bons (PAHs) is scarce. Under denitrifying conditions, the mineralization of 14C-
naphthalene to 14C02 was found to coincide with the consumption of nitrate in a
contaminated soil slurry (2). Naphthalene and acenaphthalene were also trans
formed in a soil-water system under denitrifying conditions. As these PAHs were
not the only carbon sources in the tested system, their degradation could have been
due to a cometabolic process (50, 51). The mineralization of [14C] naphthalene and
[14C]phenanthrene to 14C02 under sulfate-reducing conditions was demonstrated
with heavily contaminated sediment as inoculum, but no degradation was observed
in less contaminated sediments (14). So far, no information is available on possible
intermediates, on the degradation of higher molecular weight PAHs, and on the
responsible bacteria.
Redox conditions.
Anaerobic bacteria that degrade aromatic hydrocarbons depend on the
presence of and the capability to use other electron acceptors than oxygen (Table
1). The use of an electron acceptor with a high redox potential will provide the
bacteria in theory more energy than the use of an electron acceptor with a lower
redox potential. Whether a compound can be degraded in the presence of an
electron acceptor partly depends on the amount of energy that is released in the
oxidation/reduction reaction.
16
General introduction
Table 1. Electron acceptors with their redox pair and redox potential (taken from Nealson
and Myers, 1992).
Electron acceptor
Oxygen Iron(IH) Nitrate Manganese(IV) Nitrite Fumarate Tetrathionate Iron(IH) Sulfite Sulfate Carbon dioxide
(aq)
(s)
(s)
Redox couple
02/H20 Fe3+/Fe2+
NCy/N02
Mn02/Mn2+
N027NO Fumarate/Succinate S406
27S2032-
Fe3+/Fe2+
HSO3/HS S04
27HS C02/CH4
Redox
+ 820 + 770 + 430 + 380 + 350 + 33 + 24 + 0 - 110 -230 -240
Calculation of the Gibbs free energy changes (AG0) of the oxidation of benzene,
toluene and naphthalene coupled to the reduction of the different electron acceptors
under standard conditions (25°C, 1 M, 1 atm and pH 7), demonstrate that all poss
ible redox reactions are exergonic (Table 2). To obtain more reliable data the
actual concentrations of the compounds, pH, and temperature have to be taken into
account. This still does not predict a reaction to take place, but only shows whether
thermodynamics allow a reaction to take place under the set conditions.
Reactions with electron acceptors that yield more energy are favoured over
the ones that yield less energy (Table 1), with methanogenic conditions being the
least favourable. The low energy yield under methanogenic conditions results in
slow transformation reactions. Furthermore, fermenting bacteria can be involved in
the initial degradation of aromatic hydrocarbons under methanogenic conditions
(60). This interdependence of bacteria might explain why no pure cultures of
methanogenic toluene degrading bacteria have been isolated so far. Furthermore,
microorganisms do not always degrade a contaminant upon exposure. Often an
adaptation phase is needed in which the compound is not degraded. Several
mechanisms are proposed to explain this phenomena such as enzyme induction,
growth of a biodegrading population, and genetic change to evolve new metabolic
pathways. These processes occur much slower under lower energy yielding condi
tions, and adaptation of a methanogenic microbial population to changing growth
substrates generally takes a long time. In contrast, in high energy yielding pro-
17
Chapter 1
cesses like nitrate reduction, adaptation takes place faster, and nitrate-reducing
bacteria degrade a wider variety of substrates (60).
Table 2. Free energy change (AG0') of the overall-reactions of benzene, toluene and
naphthalene at different redox conditions under standard conditions (25°C, 1 M, 1
atm and pH 7) in kJ/electron equivalent.
(AG0' = EAG° f(products) EAG°' ftreactants).
Data used from Weast, 1971-1972, and Stumm and Morgan, 1981.
co2 so4
2
FeOOH* Mn02* N03
Fe3+
0 2
Toluene
- 2.1 - 6.8 -40.1 -93.3 -99.8 -101.9 -106.3
Benzene
- 2.6 - 7.4 -40.7 -93.6 -100.4 -102.5 -106.9
Naphthalene
- 1,6 - 6.3 -39.6 -92.6 -99.4 -101.5 -105.9
* Solid-phase free energies were used
The sequence of electron acceptors shows that the reduction of metal oxides
is energetically favourable over the reduction of sulfate and carbon dioxide. In
sediments, sulfate-reduction and methanogenesis have been found to be inhibited by
the presence of metal oxides (56). The degradation of aromatic hydrocarbons under
methanogenic, sulfate- and nitrate-reducing conditions is well documented (16, 30).
However, much less is known about the use of solid electron acceptors like iron
and manganese oxide for the degradation of aromatic compounds. An iron-reducing
bacterium Geobacter metallireducens strain GS-15 couples the oxidation of toluene,
phenol and /»-cresol to the reduction of Fe3+ oxide. In sediments amended with
chelated Fe3+ forms the oxidation of benzene was demonstrated (48). In sediment
slurries amended with amorphous manganese oxide the degradation of some aro
matic compounds like benzoate, 4-hydroxybenzoate, aniline, 3-chlorobenzoate, 2,4-
dichlorophenoxyacetic acid could be measured (52).
18
General introduction
Manganese reduction.
Metals are abundant in terrestrial, estuarine and marine environments (e.g.,
Fe and Mn up to 51 and 0.9 g/kg, respectively) (18), where the oxidized forms of
iron (Fe3+) and manganese (Mn4+) accumulate mainly in the form of a variety of
hardly soluble oxides and hydroxides. It is postulated that these metals play an
important role in the redox balance and carbon cycle via oxidation/reduction
reactions. As shown in table 1, both iron and manganese may serve as an electron
acceptor with a considerable release of energy. As they exist mainly as solids, the
reduction of manganese oxide is energetically more favourable than the reduction
of iron oxide. An advantage of these metal oxides, besides their favourable redox
potential, is that they are not lost from the environment. The reduced forms (Mn2+
and Fe2+) are oxidized in the anoxic zone, and various solid oxides are formed.
These oxides are returned to the anoxic sediments by precipitation. With this metal
cycle they can be reused as electron acceptor (Fig. 6). Since metal cycles occur in
many sediments, the same metal can be used several times in subsequent reduction
and oxidation reactions.
MnOOH Mn02 FeOOH Fe(OH)3 Fe,0,
(s)
« * . (s) (s) (s)
O-,, bacteria Mn(II) Fe(II)
precipitation Oxic
MnOOH MnO,
(s) (s)
Anoxic
(CH,0)n-Mn reducers
Fe reducers
FeOOH (s) • Fe(OH)3 Fe,03
(s) (s)
Fe(II)
-» Fe304
Fig. 6. Schematic representation of an iron and manganese cycle in natural environments.
The reduced forms (Fe2+ and Mn2+) are oxidized in the oxic zone by 02 , forming
various solid oxides. These oxides precipitate into the anoxic zone (taken from
Nealson and Myers, 1992).
19
Chapter 1
Most scientific papers deal with the reduction of iron and manganese,
because many iron-reducing bacteria can reduce manganese as well. The reduction
mechanisms however, are different. Mutants of Shewanella putrefaciens MR-1 with
an iron-reductase deficiency were still able to reduce manganese oxide (15). This
demonstrated that at least one enzyme involved in the reduction of iron- or
manganese oxide differ.
The mineralogy of the insoluble manganese oxides greatly affects their
reactivity. Amorphous manganese oxides are reduced faster and function better as
an electron acceptor than highly crystalline ones, due to a larger specific surface
area of amorphous manganese oxides (39, 45, 56). Several dissimilatory manga
nese-reducing bacteria e.g., Geobacter metallireducens and Shewanella putrefa
ciens, reduce amorphous manganese oxide faster than more crystalline forms (39,
56). This effect varies among bacterial species; the rate of manganese reduction is
in some microorganisms more affected by the crystallinity of the manganese oxide
than in others (12, 55).
Microorganisms that use manganese oxides as electron acceptor possess
unique physical and/or biochemical properties to deal directly with these solids.
This may include the ability to solubilize manganese oxide, the ability to attach to
the manganese oxide and directly transfer electrons to it, or the ability to transport
manganese oxide into the cell as a solid. It was demonstrated that Shewanella
putrefaciens required a physical contact with the insoluble manganese oxide (55).
With the marine Pseudomonas strain Bill 88, it was found that this bacterium
contains electron shuttles in the cell envelope (Mn2+), that transport the reducing
power across the cell envelope/manganese oxide particle interface (24).
The mechanism of manganese reduction can either be a direct (enzymatic) or
an indirect process. Direct, dissimilatory manganese reduction is defined as the use
of Mn4+ as external electron acceptor, coupled to organic matter oxidation in
fermentation or anaerobic respiration (32). An example of a direct, dissimilatory
manganese-reducing bacterium is Shewanella putrefaciens MR-1. It obtains energy
for growth by using fermentation products such as H2, formate and lactate as
substrate and manganese oxide as terminal electron acceptor (53). Due to the reac
tivity of manganese oxide, it can also be reduced by organic or inorganic reduc-
tants produced and excreted by microorganisms. This process is called indirect
20
General introduction
manganese reduction. An example of indirect manganese reduction is the reaction
mediated by sulfate-reducers. The produced sulfide reacts outside the cell with
Mn4+ reducing it to Mn2+ (13). This redox reaction is fast under standard condi
tions, and yields Mn2+ and elemental sulfur. Mn2+ is stable in the presence of
sulfide, because the manganese sulfides are rather soluble and precipitate only at
high concentrations (56). At low and neutral pH conditions, iron(II) fastly reduces
manganese oxide (12, 45). In sediments with iron and manganese oxides, Mn4+
may be reduced seemingly before Fe3+, even in the absence of manganese-reducing
bacteria, since Fe2+ is immediately reoxidized by Mn4+. Nitrite can spontaneously
reduce manganese oxide as well (39). Various organic compounds can interact with
manganese oxide, e.g., hydroquinones and phenolic compounds. Reactions with
phenolic compounds occur mainly at low pH (46, 63, 64).
In nature, reduced manganese can be oxidized by 02 to Mn4+ to form
various oxides. When these fresh manganese oxides are formed, a variety of trace
metals can be incorporated in these oxides (Table 3).
Table 3. Forms of manganese oxides in nature
Data used from Nealson, 1983.
Oxides and hydroxides Birnessite (<5Mn02) Buserite Hausmannite Hollandite Manganite Manganosite Pyrolusite (Rhamsdellite) Pyrochroite Todorokite
Iron and iron-silicates Jacobsite Pyromanganite Rhodonite
Carbonate Rhodochrosite
Sulfide Albandite
(Na,K,Ca)(Mg,Mn2+)Mn„0|4.5H20 Na-Mn oxide hydrate Mn304
(Ba,K)12Mn8Ol6.xH20 MnOOH (Ba,K,Mn2+,Co)2MnsO10. xH20 Mn02
Mn(OH)2
(Na,K,Ca)(Mg,Mn2+)Mn5012.xH20
MnFe04
(Mn,Fe)Si03
(Mn,Fe,Ca)Si03
MnCO,
MnS
21
Chapter 1
This can be disadvantageous for sediments in which the formed oxides are reduced,
and the toxic trace metals are released and become concentrated in the anoxic zone.
In a carbonate-rich environment, the reduced manganese reacts with carbonate to
form insoluble MnC03 (rhodochrosite). This is precipitated in strongly buffered
manganese-reducing cultures and no longer available for further oxidation and
reduction reactions (56).
Numerous manganese-reducing bacteria have been described, including
aerobic and strictly anaerobic ones (23, 31, 40). Over 200 strains of manganese-
reducing bacteria were isolated recently, and they were found to consist of a
variety of different taxa (55). Of all isolated bacteria, only a few that couple
anaerobic respiration-linked manganese reduction to organic carbon oxidation have
been described and characterized. Shewanella putrefaciens (MR-1), formerly ident
ified as Alteromonas putrefaciens, and some other S. putrefaciens strains have been
isolated from lake and sea sediments. These facultative anaerobic bacteria use a
wide range of electron acceptors, such as 02, Fe3+, Mn4+, N03 , N02", S2032, S°,
and fumarate, and can utilize lactate, pyruvate and some amino acids as substrate
(56). The obligate anaerobe Geobacter metallireducens (GS-15) oxidizes a wide
range of organic compounds, including organic pollutants like phenol, toluene and
p-cresol, under iron-reducing conditions (41, 44). This bacterium was isolated from
iron-rich sediment and is categorized in the ô-subclass of the Proteobacteria, which
are closely related to Desulfuromonas acetoxidans (43). G. metallireducens
degrades compounds like acetate, butyrate, propionate and ethanol with manganese
oxide as electron acceptor. It can use nitrate or U(IV) as electron acceptor as well
(44). Several Bacillus sp. have been isolated, but only one species (SGI) couples
the reduction of manganese to growth with peptone as substrate (16).
The enzyme involved in the direct manganese reduction, the manganese
reductase, has not yet been studied as extensively as the iron reductase. Manganese
reduction has been found to be coupled to oxidative phosphorylation by using
carbonyl cyanide w-chlorophenyl hydrazone (CCCP). In cultures of S. putrefaciens
MR-1, the addition of CCCP resulted in inhibition of the oxidative
phosphorylation, while manganese reduction was inhibited at the same time (53). In
the same cultures, the presence of nitrate inhibited manganese reduction, just as in
the case of iron reduction. This led to the hypothesis that nitrate reductase should
22
General introduction
be the enzyme responsible for manganese reduction (31). However, the isolation of
mutants deficient in either nitrate or manganese reduction, indicate the presence of
different enzymes (17, 59).
In conclusion: manganese in the form of a manganese oxide is a solid
electron acceptor, which can be found in different forms and can interact with
many natural occurring oxidants and reductants. In some anaerobic sediments and
soils, microbial catalyzed manganese reduction is a major process for the decompo
sition of naturally occuring organic matter and can play an important role in the
degradation of organic contaminants. Little is known about the physiology of
manganese reducing bacteria, and the enzymes involved in this metabolism.
Outline of this thesis.
The aim of the research presented in this thesis was to gain more insight in
the possibilities and limitations of the degradation of homocyclic aromatic com
pounds under anaerobic conditions. Numerous soils and sediments that are polluted
with aromatic hydrocarbons wait for their bioremediation. Toluene, benzene, and
naphthalene were chosen as model compounds. With sediment column experiments,
the behaviour of these aromatic compounds under five different redox conditions,
methanogenic, sulfate-, iron-, manganese-, and nitrate-reducing conditions was
studied (Chapter 2). The observed degradation of aromatics in these columns have
been further elucidated. Chapter 3 describes attempts to enrich for naphthalene
degrading sulfate-reducing bacteria. In chapter 4, the coupling between manganese
reduction and toluene degradation is shown and the role of the solid electron
acceptor and its influence on the degradation rate of toluene is studied in details.
Chapter 5 deals with the characterization of the manganese-reducing, toluene
degrading enrichment culture and its properties using physiological and rRNA
techniques. Finally, the results obtained in this research are discussed in relation to
their relevance for soil bioremediation technologies (Chapter 6).
23
Chapter 1
REFERENCES
1. Aihara, J. 1992. Why aromatic compounds are stable. Sei. Am. 266:62-68. 2. Al-bashir, B., T. Cseh, R. Leduc and R. Samson. 1990. Effect of soil contaminant
interactions on the biodégradation of naphthalene in flooded soil under denitrifying conditions. Appl. Microbiol. Biotechnol. 34:414-419.
3. Altenschmidt, U. and G. Fuchs. 1991. Anaerobic degradation of toluene in denitrifying Pseudomonas sp.: indication for toluene methylhydroxylation and benzoyl-CoA as central aromatic intermediate. Arch. Microbiol. 156:152-158.
4. Altenschmidt, U. and G. Fuchs. 1992. Anaerobic toluene oxidation to benzyl alcohol and benzaldehyde in a denitrifying Pseudomonas strain. J. Bacteriol. 174:4860-4862.
5. Beller, H. R., D. Grbic-Galic and M. Reinhard. 1992. Microbial degradation of toluene under sulfate-reducing conditions and the influence of iron on the process. Appl. Environ. Microbiol. 58:786-793.
6. Beller, H. R., M. Reinhard and D. Grbic-Galic. 1992. Metabolie by-products of anaerobic toluene degradation by sulfate-reducing enrichment cultures. Appl. Environ. Microbiol. 58:3192-3195.
7. Beller, H. R., A. M. Spormann, P. K. Sharma, J. R. Cole and M. Reinhard. 1996. Isolation and characterization of a novel toluene-degrading, sulfate-reducing bacterium. Appl. Environ. Microbiol. 62:1188-1196.
8. Biegert, T., U. Altenschmidt, C. Eckerskorn and G. Fuchs. 1995. Purification and properties of benzyl alcohol dehydrogenase from a denitrifying Thauera sp. Arch. Microbiol. 163:418-423.
9. Biegert, T. and G. Fuchs. 1995. Anaerobic oxidation of toluene (analogues) to benzoate (analogues) by whole cells and by cell extracts of a denitrifying Thauera sp. Arch. Microbiol. 163:407-417.
10. Boll, M. and G. Fuchs. 1995. Benzoyl-Coenzyme A reductase (dearomatizing), a key enzyme of anaerobic aromatic metabolism - ATP dependence of the reaction, purification and some properties of the enzyme from Thauera aromatica strain K172. Eur. J. Biochem. 234:921-933.
11. Bouwer, E. J. 1991. Bioremediation of organic contaminants in the subsurface. New Concepts in Environmental Microbiology.
12. Burdige, D. J., S. P. Dhakar and K. H. Nealson. 1992. Effects of manganese oxide mineralogy on microbial and chemical manganese reduction. Geomicrobiol. J. 10:27-48.
13. Burdige, D. J. and K. H. Nealson. 1986. Chemical and microbial studies of sulfide mediated manganese reduction. Geomicrobiol. J. 4:361-187.
14. Coates, J. D., R. T. Anderson and D. R. Lovley. 1996. Oxidation of polycyclic aromatic hydrocarbons under sulfate-reducing conditions. Appl. Biotechnol. Microbiol. 62:1099-1101.
15. de Vrind-de Jong, E. W. 1994. Personal communication. 16. de Vrind, J. P. M., F. C. Boogaard and E. W. de Vrind-de Jong. 1986. Manganese
reduction by a marine bacillus species. J. Bacteriol. 167:30-34. 17. DiChristina, T. J., R. G. Arnold, M. E. Lidstrom and M. R. Hoffmann. 1988.
Dissimilative Fe(III) reduction by the marine eubacterium Alteromonas putrefaciens strain 200. Water Sei. Tech. 20:69-79.
18. Dixon, J. B. and H. C. W. Skinner. 1992. Manganese minerals in surface environments, p. 432. In H. C. W. Skinner and R. W. Fitzpatrick (eds.), Biomineralization, Processes of Iron and Manganese, Catena-Verlag, Cremlingen-Destedt.
24
General introduction
19. Dolfing, J., J. Zeyer, P. Binder-Eicher and R. P. Schwarzenbauch. 1990. Isolation and characterization of a bacterium that mineralizes toluene in the absence of molecular oxygen. Arch. Microbiol. 154:336-341.
20. Edwards, E. A. and D. Grbic-Galic. 1992. Complete mineralization of benzene by aquifer microorganisms under strictly anaerobic conditions. Appl. Environ. Microbiol. 58:2663-2666.
21. Edwards, E. A. and D. Grbic-Galic. 1994. Anaerobic degradation of toluene and o-xylene by a methanogenic consortium. Appl. Environ. Microbiol. 60:313-322.
22. Edwards, E. A., L. E. Wills, M. Reinhard and D. Grbic-Galic. 1992. Anaerobic degradation of toluene and xylene by aquifer microorganisms under sulfate-reducing conditions. Appl. Environ. Microbiol. 58:794-800.
23. Ehrlich, H. L. 1990. Geomicrobiology. Marcel Dekker, Inc., New York. 24. Ehrlich, H. L. 1993. Electron transfer from acetate to the surface of Mn02 particles by a
marine bacterium. J. Ind. Microbiol. 12:121-128. 25. Evans, P. J., W. Ling, B. Goldschmidt, E. R. Ritter and L. Y. Young. 1992.
Metabolites formed during anaerobic transformation of toluene and orf/îo-xylene and their proposed relationship to the initial steps of toluene mineralization. Appl. Environ. Microbiol. 58:496-501.
26. Evans, P. J., D. T. Mang and L. Y. Young. 1991. Degradation of toluene and /«-xylene and transformation of o-xylene by denitrifying enrichment cultures. Appl. Environ. Microbiol. 57:450-454.
27. Field, J. A., A. J. M. Stams, M. Kato and G. Schraa. 1995. Enhanced biodégradation of aromatic pollutants in cocultures of anaerobic and aerobic bacterial consortia. Antonie Van Leeuwenhoek 67:47-77.
28. Fischer-Romero, C , B. J. Tindall and F. Jiittner. 1996. Tolumonas auensis gen. nov., sp. nov., a toluene-producing bacterium from anoxic sediments of a freshwater lake. Int. J. Syst. Bacteriol. 46:183-188.
29. Frazer, A. C , W. Ling and L. Y. Young. 1993. Substrate induction and metabolite accumulation during anaerobic toluene utilization by the denitrifying strain-Tl. Appl. Environ. Microbiol. 59:3157-3160.
30. Fuchs, G., M. E. S. Mohamed, U. Altenschmidt, J. Koch, A. Lack, R. Brackmann, C. Lochmeyer and B. Oswald. 1994. Biochemistry of anaerobic degradation of aromatic compounds, p. 513-553. In C. Ratledge (ed.), Biochemistry of Microbial Degradation, Kluwer Academic Publishers, Dordrecht.
31. Ghiorse, W. C. 1988. Microbial reduction of manganese and iron, In A. J. B. Zehnder (ed.), Biology of Anaerobic Microorganisms, John Wiley and Sons, New York.
32. Gounot, A. M. 1994. Microbial oxidation and reduction of manganese: consequences in groundwater and applications. FEMS Microbiol. Rev. 14:339-349.
33. Grbic-Galic, D. 1990. Anaerobic microbial transformation of nonoxygenated aromatic and alicyclic compounds in soil, subsurface and freshwater sediments, p. 117-189. In J. M. Bollag and G. Stotzky (eds.), Soil Biochemistry and Microbiology, Marcel Dekker, Inc., New York.
34. Grbic-Galic, D. and T. M. Vogel. 1987. Transformation of toluene and benzene by mixed methanogenic cultures. Appl. Environ. Microbiol. 53:254-260.
35. Haag, F., M. Reinhard and P. L. McCarty. 1991. Degradation of toluene and p-xylene in anaerobic microcosms: Evidence for sulfate as terminal electron acceptor. Environ. Toxicol. Chem. 10:1379-1389.
25
Chapter 1
36. Hutchins, S. R., G. W. Sewell, D. A. Kovacs and G. A. Smith. 1991. Biodegradation of aromatic hydrocarbons by aquifer micro-organisms under denitrifying conditions. Environ. Sei. Technol. 25:68-76.
37. Jüttner, F. 1991. Formation of toluene by microorganisms from anoxic freshwater sediments. Fres. J. Anal. Chem. 339:785-787.
38. Kuhn, E. P., J. Zeyer, P. Eicherand and R. P. Schwarzenbach. 1988. Anaerobic degradation of alkylated benzenes in denitrifying laboratory aquifer columns. Appl. Environ. Microbiol. 54:490-496.
39. Lovley, D. R. 1991. Dissimilatory Fe(III) and Mn(IV) reduction. Microbiol. Rev. 55:259-287.
40. Lovley, D. R. 1995. Microbial reduction of iron, manganese, and other metals, p. 175-231. In D. L. Sparks (ed.), Advances in Agronomy, vol. 54, Academic Press Inc., San Diego.
41. Lovley, D. R., M. J. Baedecker and D. J. Lonergan. 1989. Oxidation of aromatic contaminants coupled to microbial iron reduction. Nature 339:297-300.
42. Lovley, D. R., J. D. Coates, J. C. Woodward and E. J. P. Phillips. 1995. Benzene oxidation coupled to sulfate reduction. Appl. Environ. Microbiol. 61:953-958.
43. Lovley, D. R., S. J. Giovannoni, D. C. White, J. E. Champine, E. Phillips, Y. A. Gorby and S. Goodwin. 1993. Geobacter-metallireducens gen. nov. sp. nov., a microorganism capable of coupling the complete oxidation of organic compounds to the reduction of iron and other metals. Arch. Microbiol. 159:336-344.
44. Lovley, D. R. and D. J. Lonergan. 1990. Anaerobic oxidation of toluene, phenol and p-cresol by the dissimilatory iron-reducing organism, GS-15. Appl. Environ. Microbiol. 56:1858-1864.
45. Lovley, D. R. and E. J. P. Phillips. 1988. Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory reduction of iron or manganese. Appl. Environ. Microbiol. 54:1472-1480.
46. Lovley, D. R., E. J. P. Phillips and D. J. Lonergan. 1989. Hydrogen and formate oxidation coupled to dissimilatory reduction of iron or manganese by Alteromonas putrefaciens. Appl. Environ. Microbiol. 55:700-706.
47. Lovley, D. R., J. C. Woodward and F. H. Chapelle. 1994. Stimulated anoxic biodégradation of aromatic hydrocarbons using Fe(III) ligands. Nature 370:128-131.
48. Lovley, D. R., J. C. Woodward and F. H. Chapelle. 1996. Rapid anaerobic benzene oxidation with a variety of chelated Fe(III) forms. Appl. Environ. Microbiol. 62:288-291.
49. Major, D. W., C. I. Mayfield and J. F. Barker. 1988. Biotransformation of benzene by denitrification in aquifer sand. Ground Water 26:8-14.
50. Mihelcic, J. R. and R. G. Luthy. 1988. Degradation of aromatic hydrocarbon compounds under various redox conditions in soil-water systems. Appl. Environ. Microbiol. 54:1182-1187.
51. Mihelcic, J. R. and R. G. Luthy. 1988. Microbial degradation of acenaphthalene and naphthalene under denitrification conditions in soil-water systems. Appl. Environ. Microbiol. 54:1188-1198.
52. Myers, C. R., L. J. Alatalo and J. M. Myers. 1994. Microbial potential for the anaerobic degradation of simple aromatic compounds in sediments of the Milwaukee harbor, Green Bay and Lake Erie. Environ. Toxicol. Chem. 13:461-471.
53. Myers, C. R. and K. H. Nealson. 1988. Bacterial manganese reduction and growth with manganese oxide as the sole electron acceptor. Science 240: 1319-1321.
54. Nealson, K. H. 1983. The microbial manganese cycle, p. 191-222. In W. Krumbein (ed.), Microbial Geochemistry, Blackwell Scientific, Oxford.
26
General introduction
55. Nealson, K. H. and C. R. Myers. 1992. Microbial reduction of manganese and iron -New approaches to carbon cycling. Appl. Environ. Microbiol. 58:439-443.
56. Nealson, K. H. and D. Saffarini. 1994. Iron and manganese in anaerobic respiration: environmental significance, physiology, and regulation. Ann. Rev. Microbiol. 48:311-343.
57. Rabus, R., R. Nordhaus, W. Ludwig and F. Widdel. 1993. Complete oxidation of toluene under strictly anoxic conditions by a new sulfate-reducing bacterium. Appl. Environ. Microbiol. 59:1444-1451.
58. RIWA. 1993. Ur ernstig verontreinigd, IAZI van DSM onterecht beschuldigd. H20 26:659-660.
59. Saffarini, D. A., T. J. DiChristina, D. Bermudes and K. H. Nealson. 1994. Anaerobic respiration of Shewanella putrafaciens requires both chromosomal and plasmid-born genes. FEMS Microbiol. Lett. 119:271-278.
60. Schink, B., A. Brune and S. Schnell. 1992. Anaerobic degradation of aromatic compounds, p. 219-242. In G. Winkelmann (ed.), Microbial Degradation of Natural Products, VCH, Weinheim, New York, Basel, Cambridge.
61. Schocher, R. J., B. Seyfried, F. Vazquez and J. Zeyer. 1991. Anaerobic degradation of toluene by pure cultures of denitrifying bacteria. Arch. Microbiol. 157:7-12.
62. Seyfried, B., G. Glod, R. Schocher, A. Tschech and J. Zeyer. 1994. Initial reactions in the anaerobic oxidation of toluene and wz-xylene by denitrifying bacteria. Appl. Environ. Microbiol. 60:4047-4052.
63. Stone, A. T. 1987. Reductive dissolution of manganese(III/IV)oxides by substituted phenols. Environ. Sei. Technol. 21:979-988.
64. Stone, A. T. and J. J. Morgan. 1984. Reduction and dissolution of manganese(III) and manganese(IV) oxides by organics: 1.Reaction with hydroquinone. Environ. Sei. Technol. 18:450-456.
65. Stumm, W. and J. J. Morgan. 1981. Aquatic chemistry, 2nd ed. John Wiley and Sons, Inc., New York.
66. Vogel, T. M. and D. Grbic-Galic. 1986. Incorporation of oxygen from water into toluene and benzene during anaerobic fermentative transformation. Appl. Environ. Microbiol. 52:200-202.
67. Vrij Nederland. 1983. VN Gifatlas. 68. Wilson, B. H., G. B. Smith and J. F. Rees. 1986. Biotransformations of selected
alkylbenzenes and halogenated aliphatic hydrocarbons in methanogenic aquifer material: A microcosm study. Environ. Sei. Technol. 20:997-1002.
69. Weast, R. C. 1971-1972. Handbook of Chemistry and Physics. The Chemical Rubber Co., Cleveland.
70. Zedeck, M. S. 1980. Polycyclic aromatic hydrocarbons - a review. J. Environ. Pathol. Toxicol. 3:537-567.
71. Zehnder, A. J. B. and B. H. Svensson. 1986. Life without oxygen: what can and cannot? Experientia 42:1197-1205.
72. Zeyer, J., E. P. Kuhn and R. P. Schwarzenbach. 1986. Rapid microbial degradation of toluene and 1,3-dimethylbenzene in the absence of molecular oxygen. Appl. Environ. Microbiol. 52:944-947.
27
Chapter 2
Behaviour of Toluene, Benzene and Naphthalene
under Anaerobic Conditions in Sediment Columns
Alette A.M. Langenhoff,
Alexander J.B. Zehnder and Gosse Schraa
Biodegradation (1996) 7:267-274
29
Chapter 2
ABSTRACT
The biotransformation of toluene, benzene and naphthalene was examined in
anaerobic sediment columns. Five columns filled with a mixture of sediments were
operated in the presence of bicarbonate, sulfate, iron, manganese, or nitrate as
electron acceptor. The columns were continuously percolated with a mixture of the
three organic compounds (individual concentrations 25-200 fxM) at 20°C.
Toluene was transformed readily (within 1 to 2 months) under all redox
conditions tested. Benzene was recalcitrant over the test period of 375-525 days in
all five columns. Naphthalene was partly transformed in the column with nitrate or
manganese as electron acceptor present; the addition of benzoate had a positive
effect in the column with nitrate. In the column with sulfate, the majority of the
added naphthalene disappeared. No effect was observed after adding and omitting
an easier degradable substrate. [14C]naphthalene was used to confirm this disappear
ance to be the result of degradation; two third of the naphthalene was converted to
C02.
INTRODUCTION
Aromatic hydrocarbons are widespread in nature and often contribute to
polluted soils, sediments, and groundwater. Although part of the hydrocarbons is of
biosynthetic origin, the majority is produced by the pyrolysis of organic material
(15). The contamination of soil with aromatic hydrocarbons is seen on many
industrial sites, especially those associated with petroleum industry. Concentrations
of 8 g aromatic hydrocarbons/kg dry weight were measured in the sediment of the
river Ur, The Netherlands (30). Most of these compounds were shown to be
mutagenic or carcinogenic (37).
Research on the microbial degradation of aromatics has mainly focused on
aerobic transformation reactions (15, 32). In these transformations, molecular
oxygen has two functions: (i) as a terminal electron acceptor for the electrons
released during metabolic reactions and (ii) as a direct oxidant of the aromatic ring.
In many polluted environments, oxygen is limited and anaerobic processes prevail.
30
Biotransformations in sediment columns
In the absence of oxygen, electron acceptors like nitrate, sulfate, bicarbonate and
some metal-ions (e.g. iron and manganese) have taken over the function of oxygen
as a terminal electron acceptor. Since these alternative electron acceptors cannot
replace oxygen in its second function, the first reaction steps differ from those in
the aerobic processes. Anaerobic degradation of homocyclic aromatic hydrocarbons
has only been found recently (14, 16, 33). Degradation of toluene by pure cultures
has been reported under sulfate-reducing (29), iron-reducing (22) and denitrifying
conditions (3, 9, 13, 31), and parts of degradation pathways were elucidated (4, 5,
12). Only a few reports exist on the anaerobic degradation of benzene. With
consortia obtained from sediments, the degradation of benzene was demonstrated
under iron-reducing conditions (24), and with sulfate as electron acceptor (21). In
mixed cultures, derived from ferulic acid-degrading sewage sludge enrichments,
benzene degradation was shown under methanogenic conditions (17, 35). With
aquifer-derived organisms a complete mineralization of benzene to C02 was
demonstrated, although it was not clear whether this occurred under methanogenic
or sulfate-reducing conditions (10).
Knowledge about the anaerobic degradation of polycyclic aromatic hydrocar
bons (PAH) is scarce. In one study the lower molecular weight polycyclic com
pounds naphthalene and acenaphthene were degraded under denitrifying conditions
in soil-water systems (26, 27, 28). This degradation was also demonstrated in soil-
slurry systems (2). So far, nothing is known about possible pathways or intermedi
ates. Although anaerobic bacteria have the ability to degrade homo- and polycyclic
aromatic compounds, little is known about the most appropriate redox conditions
for the biotechnological clean-up of anaerobic soils and sediments.
The objective of this study was to examine the anaerobic transformation of
toluene, benzene and naphthalene in the presence of bicarbonate, sulfate, iron,
manganese, or nitrate in soil percolation columns.
31
Chapter 2
MATERIALS AND METHODS
Experimental set-up. The transformation studies were performed in five
continuous-flow packed-bed columns (Fig. 1) during 375-525 days, with one
electron acceptor per column. The columns were glass cylinders (60 ml volume, 15
cm length, 2.3 cm inside diameter) which were capped at the lower end by a
standard fitting (Schott, Germany) and at the upper end with a viton stopper
(Rubber B.V., Hilversum, The Netherlands).
Fig. 1.
nitrogen
J^
medium reservoir substrates
+ sulfide w
glass beads +
naphthalene crystals
-a-mixing chamber
peristaltic pump
= ® -column
syringe pump
Schematic diagram of the column system.
The wet-packed bed in the five columns consisted of a mixture of anaerobic
soil and sediment polluted with (polycyclic) aromatic compounds and of granular
sludge. Sediment from the river Rhine near Wageningen was used, because
toluene, benzene, and naphthalene have been detected as contaminants in Rhine
water. The same accounts for the use of polluted harbour sludge (Rotterdam and
Zierikzee, The Netherlands) and soil polluted with PAH (DSM, De Staatsmijnen,
Geleen, The Netherlands). In addition, granular sludge from an upflow anaerobic-
sludge blanket reactor, used for the treatment of sugar beet wastewater (CSM,
Centrale Suikermaatschappij, Breda, The Netherlands), was used because of its
high density of anaerobic bacteria.
32
Biotransformations in sediment columns
The columns were percolated continuously in an upflow mode under
saturated conditions with an anaerobic medium containing per liter: 0.34 g
KH2P04; 1.07 g Na2HPO4.2H20; 0.063 g NaHC03; 0.11 g CaCl2.2H20; 0.1 g
MgCl2.6H20; 0.027 g NH4C1; 0.0085 g Na2S04, and 0.1 ml of a trace element
solution (18). The medium was boiled, followed by cooling down under a N2/C02
atmosphere (99.5/0.5%) to preserve anaerobic conditions. An excess of granular
marble in the reservoir served as carbonate buffer in combination with the C02 in
the gas phase. Mixtures of toluene, benzene, and naphthalene were added continu
ously with a syringe pump (Braun Medical, Utrecht, The Netherlands). Mixing of
the aromatics and the medium occurred in a small mixing chamber (13 ml) just
before the peristaltic pump. An influent concentration of 25 ^M for each of the
compounds was chosen. After 7 months of testing, the addition of naphthalene to
the column with sulfate was changed. Medium was pumped through a glass column
(15 ml) filled with glass beads and naphthalene crystals. This resulted in an influent
naphthalene concentration of 200 /nM.
Bicarbonate as electron acceptor was present in excess in the medium.
Sulfate and nitrate were added as Na2S04 and NaN03 via the syringe pump. Final
concentrations were 10 mM each. In the columns with iron and manganese,
amorphous Fe(III)- and Mn(IV)-oxide were mixed through the column material
(approximately 5 mmol) and were re-added upon depletion. Toluene served as a
positive control in these columns and its reappearance in the effluent was seen as a
depletion of the iron- and manganese-oxide. This was done because it was not
possible to measure the actual concentration of the oxides in the columns. The
metaloxides were re-added by sluicing the columns into an anaerobic glovebox
(Coy Laboratories Products, Toepffer GmbH, Göppingen, FRG), in which freshly
made iron- or manganese-oxide was mixed through the material in the column.
Reducing conditions were maintained by the addition of Na2S via the syringe pump
(0.4 mM final concentration). Because of possible inhibitory effects on
denitrification processes, Na2S was not used in the nitrate-reducing column (19). In
the columns with iron and manganese, the added amorphous Fe(III)- and Mn(IV)-
oxide were not significantly reduced by the sulfide because of their large excess in
concentration.
33
Chapter 2
The tubing in the system was either gastight neoprene or viton (Rubber
B.V., Hilversum, The Netherlands). Viton was used from the point were the
aromatics entered the system. The medium was pumped into the system by a
peristaltic pump, equipped with acid-flex pump-tubes (Bran & Lubbe, Maarssen,
The Netherlands).
The flow rate in the columns was 3.5 ml/h, which gave a retention time of
the liquid in the packed-bed columns of 10 h. The experiments were done at 20°C
in the dark.
[14C]naphthalene study. A smaller column (10 cm length and 1.2 cm inner
diameter giving a volume of 11 ml) was used to study the degradation of [14C] naph
thalene in the presence of sulfate in more detail. The wet-packed bed in this
column was material from the larger column, in which disappearance of naphtha
lene had occurred in the presence of sulfate. Initially, the column was operated in
the same way as the larger column. Upon breakthrough, followed by disappearance
of the naphthalene, the column was operated as a closed circulating system for 60
days (Fig. 2).
hexadecane medium
} k peristaltic @-
pump
circulation bottle
Fig. 2.
column
Schematic diagram of the circulating column system.
Anaerobic medium (as described above plus 15 mM Na2S04, 0.4 mM Na2S
and 0.5 mg/1 resazurin) was circulated through the column. In the circulation
bottle, a layer of hexadecane (1 ml) floated on top of the medium to create a two-
liquid-phase system. The hexadecane layer contained both [l2C]- and [14C]naph-
34
Biotransformations in sediment columns
thalene, in a total concentration of 0.2 M with an activity of 3 ^tCi. This resulted in
a naphthalene concentration in the liquid medium of about 35 jiiM. During the 60
days, a total of 75 /xmol naphthalene was fed through the column. The experiment
was performed at 20°C in the dark.
Preparation of Fe- and Mn-oxides. Amorphous iron-oxide, Fe(III)-oxyhy-
droxide, was made by neutralising a 0.4 M FeCl3 solution with IN NaOH until pH
7 (23).
Amorphous manganese(IV)-oxide was made by mixing equal amounts of 0.4
M KMn04 and 0.4 M MnCl2 and adding IN NaOH to obtain a pH 10 (7).
Thereafter, both metal-oxides were washed 4 times with demineralized
water.
Addition of different substrates. The effect of several easily degradable
carbon compounds on the transformation of toluene, benzene, or naphthalene was
tested. Acetate, benzoate, lactate, and phenol were added at different time intervals
via the syringe pump. Tested concentrations were 5-250 /xM.
Sampling and analyses. The concentrations of toluene, benzene, and
naphthalene were measured routinely. Samples were taken by allowing either the
influent or effluent to flow into a gas-tight syringe. After centrifugation (13,000
rpm. for 3 min.) of the samples, they were analyzed on a High Performance Liquid
Chromatograph (LKB, Bromma, Sweden). Samples (20 tl) were injected onto a
Chromsep Chromspher PAH column (200x30 mm) at 25°C. The flow rate was 1
ml/min with an eluent of 55% acetonitrile and 45% nanopure water. All aromatic
compounds were detected with an UV detector at 206 nm.
The production of 14C02 was measured routinely in 1 ml of medium
withdrawn from the circulation bottle. 0.5 ml of medium was injected into 1 ml of
1.5 N NaOH and stripped with air (30 ml/min) for 5 min. To a third of this sample
(0.5 ml), 4.5 ml scintillation liquid was added (Aqualuma Plus, Lumac, 3M, The
Netherlands) and counted for 3 min in a scintillation counter (1211 Rackbeta,
LKB). This measurement represented the total activity of the non-volatile com
pounds and C02. Another 0.5 ml medium was injected into 1 ml of 1.5 N HCl,
stripped with air, and used for scintillation counting as previously described. This
measurement represented the total activity of the non-volatile compounds. The 14C02-production was calculated as the difference between these two methods.
35
Chapter 2
Chemicals. Toluene, benzene, naphthalene, acetate, benzoate, lactate, and
phenol were purchased from E. Merck, Darmstadt, Germany. Naphthalene-1-14C
with a specific activity of 8.3 mCi/mmol was purchased from Sigma, St Louis,
USA. All chemicals were of analytical grade and were used without further
purification.
RESULTS
Methanogenic column. The column was operated for 525 days. After a
partial breakthrough, toluene could not be detected in the effluent 2 months after
start-up. The detection limit was 0.05 /xM. No disappearance of benzene and
naphthalene was observed, not even after the addition of acetate, benzoate, lactate,
and phenol for a period of 20 to 40 days (results not shown).
benzene
naphthalene
200 300
time (days)
Fig. 3. Behaviour of toluene, benzene and naphthalene in the presence of sulfate. C/Co is
effluent concentration relative to influent concentration. (1): no benzoate added,
(2): addition to the medium of 5 ßM benzoate.
36
Biotransformations in sediment columns
Sulfate-reducing column. The behaviour of toluene, benzene, and naphtha
lene in the column with sulfate is shown in Figure 3. After a partial breakthrough
of toluene, it was not detected in the effluent after 50 days of operation. From day
100 on toluene was omitted from the medium. Naphthalene also showed a partial
breakthrough, followed by a steady decline. After 100 days, roughly 70 - 80% of
the incoming naphthalene was removed. The addition or omittance of 5 pM
benzoate did not seem to have any effect on the disappearance of naphthalene. The
increase in influent concentration to 200 /iM at day 200 did not result in an
increase in the effluent concentration. No significant removal of benzene was
observed during the 425 days of operation of the column.
Fig. 4.
30 40
time (days)
Production of l4C02 from [l4C]naphthalene in the presence of sulfate in a
recirculating system.
The second column with sulfate showed a fast breakthrough and disappear
ance of the naphthalene upon which radiolabeled naphthalene was added. Through
circulation of the medium, the produced 14C02 accumulated in the system (Fig. 4).
After 2 months, 60% of the added naphthalene was transformed to C02 (0.5
mmol).
37
Chapter 2
Iron-reducing column. After a partial breakthrough, toluene was
undetectable in the effluent after about 2 months of operation. At day 100 it was
temporarily omitted from the medium. After 225 days, benzene and naphthalene
were still not removed, and toluene was then re-added to check for microbial
activity in the column. Within one week after this addition, toluene could no longer
be detected in the effluent. The subsequent additions of easier degradable substrates
(50-250 /itM benzoate, phenol, and lactate) did not result in any disappearance of
benzene or naphthalene during the 375 days of operation (results not shown).
u ö
• . A
pr h T \" '. / ' , ^ % ' f* ; ' /' ; •
* ' i . •
I
1 1
/
1 1 2 |
1 !/, \ /° >
J
1 '
3
\
, t 4
. benzene
\ \ ^ . - ^ - v
^ ^ ^ naphthalene
i i
• • 7 toluene .' \ • ' '" »
0 100 200 300 400 500
time (days)
Fig. 5. Behaviour of toluene, benzene and naphthalene in the presence of manganese.
C/Co is effluent concentration relative to influent concentration. Additional
substrates at (1): 50 /*M benzoate, (2): 250 /tM benzoate, (3): 50 /i*M phenol: (4):
50 /iM lactate. Between day 100 and 225 toluene was omitted from the influent.
At day 300 (1 )5 mmol Mn02 was added to the column.
Manganese-reducing column. Toluene showed a partial breakthrough (Fig.
5). After 85 days, less than 2% was detected in the effluent. Similar to the
operation of the column with iron, toluene was omitted from day 100 on and re-
added at day 225. A similar pattern as in the first few months was observed, except
for a faster removal of toluene after the breakthrough.
38
Biotransformations in sediment columns
After readdition of manganese-oxide (5 mmol) at day 300, toluene was detected in
the effluent (around 2 fxM) for the remainder of the experiment. In contrast to
benzene, part of the naphthalene disappeared. During the first 300 days, the
naphthalene concentration in the effluent varied strongly (between 10 and 60%
removal), but after the extra addition of Mn(IV)-oxide, a steady decline in the
naphthalene concentration occurred. At the end of the experiment, around 60% of
the incoming naphthalene was transformed. The effects of the additions of
benzoate, phenol, and lactate were not conclusive.
Nitrate-reducing column. Also under denitrifying conditions, toluene
showed a partial breakthrough. After 90 days of operation it was no longer
detected in the effluent anymore and omitted from day 100 on (Fig. 6).
o U U S 0.8
S 0.4 -I
1 1 1 2 1 3 141 51 6
-
.
• >
7 181
\ ^r\K\ i. i xi M \ \r^ 1 ^ » \ . V
"» ' J
j 1 r ' : N ,.
I » toluene
; • i
p-V J f / I r v •
9
benzene
naphthalene
^ ^, - - / x
0 100 200 300 400 500 600
time (days)
Fig. 6. Behaviour of toluene, benzene and naphthalene in the presence of nitrate. C/Co is
effluent concentration relative to influent concentration. Additional substrates at
(1): 5 /M. benzoate: (2): 50 juM benzoate, (3): 250 fiM benzoate, (4): 50 /xM
acetate, (5): 50 /xM lactate, (6): 150 /xM lactate, (7): 250 /xM acetate, (8): 50 tiM
phenol, (9): 250 tiM benzoate. Between day 200 and day 300 benzene was omitted
from the column.
Benzene underwent no significant removal and therefore it was omitted between
day 200 and 300. This was done to test a possible effect on the transformation of
naphthalene. No effect was observed. A breakthrough of naphthalene was followed
39
Chapter 2
by a removal of 10-50 % during the first 200 days. From day 300, a steady decline
to 70 % removal at day 520 occurred in the presence of 250 pM benzoate.
Previous additions of 5-250 ^M benzoate, acetate, lactate, and phenol had no
effect.
DISCUSSION
We have examined the behaviour of three aromatic hydrocarbons in flow-
through sediment columns under different anaerobic conditions. Favourable
conditions were created to succeed in biological transformations of the selected
compounds. The experimental set-up allowed an easy change of the conditions to
test different substrates. The packed-bed of the sediment columns provided aerobic
and anaerobic microorganisms with a history of exposure to toluene, benzene, and
naphthalene. Earlier, comparable experiments in our laboratory with anaerobic
sediment columns resulted in transformation reactions of compounds like di- and
trichlorobenzene (6) tetrachloroethene (8) and hexachlorocyclohexanes (25). In
sediment column experiments, attention has to be paid to the adsorption of
hydrophobic substrates to the column material. This to be sure that a decrease in
effluent concentration is due to transformation and not a result of adsorption. The
degree of adsorption of the aromatic hydrocarbons to the column material was
studied in batch experiments. The results indicated a negligible adsorption (results
not shown). In addition, we found that the three substrates showed a breakthrough
in all tested columns. This also indicated little adsorption to the column material.
Bacteria can only use a compound for growth when the Gibbs free energy
change (AG) is negative. Calculations of the AG-values of the oxidation of
benzene, toluene, and naphthalene coupled to the reduction of the different electron
acceptors in our experiments, demonstrate that under the conditions used, all
possible redox reactions were exergonic (Table 1). So, all reactions are thermody-
namically possible, with methanogenic and sulfate-reducing conditions being less
favourable.
40
Biotransformations in sediment columns
Table 1. Free energy change (AG) of the overall-reactions of benzene, toluene and naphtha
lene at different redox conditions under the used conditions (20°C, 25-200 /*M, 1
atm and pH 6.7) in kJ/electron equivalent
(AG = AG0 + RT In K).
Data used from Weast (1971-1972) and Stumm and Morgan (1981).
co2 so4
2-FeOOH* Mn02* NO,
Toluene ci„=25/iM
- 4.1 - 8.8 -40.2 -94.2 -100.2
Benzene Ci„=25/xM
- 4.5 - 10.3 -41.4 -94.3 -104.3
Naphthalene Ci„=25^M
- 3.8 - 8.6 -40.8 -93.7 -100.0
Naphthalene Ci„=200jtM
- 3.9 - 8.7 -40.9 -93.8 -100.1
* Solid-phase free energies were used
This table shows the free energy change of the different reactions after complete degradation of 1 tM. substrate. The concentration of C02 (present as granular marble CaC03) was calculated according to Stumm and Morgan (34), the maximum solubility of N2 was used as the concentration of N2 in the medium and the concentration of methane was 1 mM.
It can be predicted that benzene and naphthalene degradation under
anaerobic conditions is more difficult than the degradation of toluene and that the
reaction mechanisms will vary, due to the chemical properties of the aromatics.
The chemical stability of the aromatic ring is determined by the presence of side-
groups. Methyl- and hydroxylgroups drive electrons towards the aromatic ring and
make the ring more susceptible to electrophilic substitution reactions. This, because
less energy is needed to activate the ring structure. Benzene and naphthalene are
therefore chemically more stable than toluene, and benzene is more stable than
naphthalene (1).
Toluene was transformed relatively fast in the presence of bicarbonate,
sulfate, iron, manganese, and nitrate as electron acceptor. This is in agreement
with many other findings (14, 33). However, the transformation under manganese-
reducing conditions is novel. In batch experiments with material taken from the
column with manganese present, a decrease in toluene concentration coincided with
an increase in Mn(II) concentration and we were able to enrich for toluene
degrading manganese-reducing bacteria (20). This has not yet been documented
41
Chapter 2
before.
Benzene was found to be recalcitrant under all conditions tested. Even after
test periods of 375 to 525 days, no transformation of benzene was observed. This
can only partly be explained by its high chemical stability because our findings are
in contrast with those in three other studies, in which mineralization of benzene
was found under anaerobic conditions (10, 21, 24). In the first study, over 90 % of
the added [14C]benzene could be recovered as 14C02. A specific electron acceptor
for the oxidation of benzene could not be established. More than 80 %
mineralization of [14C]benzene was reported in the other two studies. The oxidation
of benzene was coupled to the reduction of Fe(III) and sulfate, respectively.
Previous anaerobic degradation studies with benzene, toluene, xylenes, and
ethylbenzene added as mixtures, have shown that toluene and the xylenes were
degraded, but that benzene and ethylbenzene were persistent (11). It was concluded
that environmental conditions, like the presence of other substrates, are important
for the anaerobic biodegradability of benzene. In our study, the presence of the
more readily degradable toluene and naphthalene in the columns may have been of
influence on the persistence of benzene.
Degradation of naphthalene was seen in the columns amended with sulfate,
manganese and nitrate. In the presence of nitrate, a steady decrease in the naphtha
lene concentration was only found after the addition of 250 /xM benzoate. Degrada
tion of naphthalene did not occur with other tested substrates. Several explanations
are possible: Benzoate can (i) serve as an electron donor, necessary for the
reduction of the aromatic ring, (ii) have a positive effect as a possible intermediate
in the degradation of naphthalene or (iii) act as an easily degradable substrate for
growth. It has been shown before that naphthalene can be degraded under
denitrifying conditions in soil-water systems. With excess nitrate, 4.5 mg/1
naphthalene was degraded in batch-experiments to non-detectable levels (<0.01
mg/1) within two months (26, 27).
In the presence of manganese, part of the naphthalene was transformed.
Whether this disappearance was influenced by the addition of easily degradable
substrates is not yet clear. The decrease in effluent concentration beyond day 300
(Fig. 5) could have been due to the addition of fresh Mn02 or to the presence of 50
iuM lactate.
42
Biotransformations in sediment columns
The disappearance of naphthalene was also found in the column with sulfate
as electron acceptor. An eight-fold increase in the naphthalene concentration at day
200 had no effect on the effluent concentration. In contrast to the columns with
nitrate and manganese, no effect was seen upon the addition or omission of an
easily degradable substrate, in this case benzoate (5 /xM). These experiments
indicate the presence of an active naphthalene transforming microbial population.
This was confirmed in the second column experiment, in which mineralization of
naphthalene was proven. 60 % of the [14C]naphthalene that had passed the column,
could be recovered as 14C02.
In the described column experiments, the role of the electron acceptor has
not been verified. With sulfate and nitrate as electron acceptor it was not possible
to quantify the decrease in electron acceptor concentration, needed to transform the
substrates, because of the low concentration of the aromatic substrates and the
fluctuations in the influent and effluent concentrations. The reduced forms of the
metal-oxides, Fe(II) and Mn(II), formed precipitates with sulfide and other
compounds in the column and could not be measured in the effluent for that
reason. This indicates that, for example in the column with sulfate, other electron
acceptors like bicarbonate or oxidized metal-ions could have been involved in the
degradation of naphthalene. However, this is not likely, because the columns with
the electron acceptors bicarbonate and Fe(III) did not show a comparable degrada
tion of naphthalene.
In conclusion, homocyclic aromatic compounds can be degraded
anaerobically under favourable conditions. Proper environmental conditions like the
presence of a suitable electron acceptor, nutrients, and other oxidizable compounds
will be essential for the transformations to take place. Although these transform
ations are slow and unpredictable, anaerobic bioremediation processes do not
require the addition of oxygen like in aerobic processes. This may decrease the
bioremediation costs substantially. It is known that these aromatics are more
susceptible to aerobic degradation and for bioremediation purposes it has to be
evaluated whether lower degradation rates at lower costs under anaerobic condi
tions can compete with a faster, but more expensive, aerobic process.
43
Chapter 2
ACKNOWLEDGEMENTS
We thank Wim Roelofsen for his help with HPLC-analyses. This work was
supported by a grant from DSM Research, The Netherlands.
REFERENCES
1. Aihara, J. 1992. Why aromatic compounds are stable. Sei. Am. 266:62-68. 2. Al-bashir, B., T. Cseh, R. Leduc and R. Samson. 1990. Effect of soil contaminant
interactions on the biodégradation of naphthalene in flooded soil under denitrifying conditions. Appl. Microbiol. Biotechnol. 34:414-419.
3. Altenschmidt, U. and G. Fuchs. 1991. Anaerobic degradation of toluene in denitrifying Pseudomonas sp. : indication for toluene methylhydroxylation and benzoyl-CoA as central aromatic intermediate. Arch. Microbiol. 156:152-158.
4. Altenschmidt, U. and G. Fuchs. 1992. Anaerobic toluene oxidation to benzyl alcohol and benzaldehyde in a denitrifying Pseudomonas strain. J. Bacteriol. 174:4860-4862.
5. Beller, H. R., M. Reinhard and D. Grbic-Galic. 1992. Metabolic by-products of anaerobic toluene degradation by sulfate-reducing enrichment cultures. Appl. Environ. Microbiol. 58:3192-3195.
6. Bosma, T. N. P., J. R. van der Meer, G. Schraa, M. Tros and A. J. B. Zehnder. 1988. Reductive dechlorination of all trichloro- and dichlorobenzene isomers. FEMS Microbiol. Ecol. 53:223-229.
7. Burdige, D. J. and K. H. Nealson. 1985. Microbial manganese-reduction by enrichment cultures from coastal marine sediments. Appl. Environ. Microbiol. 50:491-497.
8. de Bruin, W. P., M. J. J. Kotterman, M. A. Posthumus, G. Schraa and A. J. B. Zehnder. 1992. Complete biological reductive transformation of tetrachloroethene to ethane. Appl. Environ. Microbiol. 58:1996-2000.
9. Dolling, J., J. Zeyer, P. Binder-Eicher and R. P. Schwarzenbauch. 1990. Isolation and characterization of a bacterium that mineralizes toluene in the absence of molecular oxygen. Arch. Microbiol. 154:336-341.
10. Edwards, E. A. and D. Grbic-Galic. 1992. Complete mineralization of benzene by aquifer microorganisms under strictly anaerobic conditions. Appl. Environ. Microbiol. 58:2663-2666.
11. Edwards, E. A., L. E. Wills, M. Reinhard and D. Grbic-Galic. 1992. Anaerobic degradation of toluene and xylene by aquifer microorganisms under sulfate-reducing conditions. Appl. Environ. Microbiol. 58:794-800.
12. Evans, P. J., W. Ling, B. Goldschmidt, E. R. Ritter and L. Y. Young. 1992. Metabolites formed during anaerobic transformation of toluene and ortho-xylene and their proposed relationship to the initial steps of toluene mineralization. Appl. Environ. Microbiol. 58:496-501.
13. Evans, P. J., D. T. Mang, K. S. Kim and L. Y. Young. 1991. Anaerobic degradation of toluene by a denitrifying bacterium. Appl. Environ. Microbiol. 57:1139-1145.
44
Biotransformations in sediment columns
14. Fuchs, G., M. E. S. Mohamed, U. Altenschmidt, J. Koch, A. Lack, R. Brackmann, C. Lochmeyer and B. Oswald. 1994. Biochemistry of anaerobic degradation of aromatic compounds, p. 513-553. In C. Ratledge (ed.), Biochemistry of Microbial Degradation, Kluwer Academic Publishers, Dordrecht.
15. Gibson, D. T. and V. Subramanian. 1984. Microbial degradation of aromatic hydrocarbons, p. 181-252. In D. T. Gibson (ed.), Microbial Degradation of Organic Compounds, Marcel Dekker, Inc., New York and Basel.
16. Grbic-Galic, D. 1990. Anaerobic microbial transformation of nonoxygenated aromatic and alicyclic compounds in soil, subsurface and freshwater sediments, p. 117-189. In J. M. Bollag and G. Stotzky (eds.), Soil Biochemistry and Microbiology, Marcel Dekker, Inc.
17. Grbic-Galic, D. and T. M. Vogel. 1987. Transformation of toluene and benzene by mixed methanogenic cultures. Appl. Environ. Microbiol. 53:254-260.
18. Holliger, C., G. Schraa, A. J. M. Stams and A. J. B. Zehnder. 1993. A highly purified bacterium couples the reductive dechlorination of tetrachloroethene to growth. Appl. Environ. Microbiol. 59:2991-2997.
19. Knowles, R. 1982. Denitrification. Microbiol. Rev. 46:43-70. 20. Langenhoff, A. A. M., D. L. Brouwers-Ceiler, J. H. L. Engelberting, J. J. Quist, J.
G. P. N. Wolkenfelt, A. J. B. Zehnder and G. Schraa. 1997. Microbial reduction of manganese coupled to toluene oxidation. FEMS Microbiol. Ecol. 22:119-127.
21. Lovley, D. R., J. D. Coates, J. C. Woodward and E. J. P. Phillips. 1995. Benzene oxidation coupled to sulfate reduction. Appl. Environ. Microbiol. 61:953-958.
22. Lovley, D. R. and D. J. Lonergan. 1990. Anaerobic oxidation of toluene, phenol and p-cresol by the dissimilatory iron-reducing organism, GS-15. Appl. Environ. Microbiol. 56:1858-1864.
23. Lovley, D. R. and E. J. P. Phillips. 1986. Organic matter mineralization with reduction of ferric iron in anaerobic sediments. Appl. Environ. Microbiol. 51:683-689.
24. Lovley, D. R., J. C. Woodward and F. H. Chapelle. 1994. Stimulated anoxic biodégradation of aromatic hydrocarbons using Fe(III) ligands. Nature 370:128-131.
25 Middeldorp, P. J. M., M. Jaspers, A. J. B. Zehnder and G. Schraa. 1996 Biotransformation of a-,R-, y- and ô-hexachlorocyclohexane to benzene and chlorobenzene under methanogenic conditions. Environ. Sei. Technol. 30:2345-2349.
26. Mihelcic, J. R. and R. G. Luthy. 1988. Degradation of aromatic hydrocarbon compounds under various redox conditions in soil-water systems. Appl. Environ. Microbiol. 54:1182-1187.
27. Mihelcic, J. R. and R. G. Luthy. 1988. Microbial degradation of acenaphthalene and naphthalene under denitrification conditions in soil-water systems. Appl. Environ. Microbiol. 54:1188-1198.
28. Mihelcic, J. R. and R. G. Luthy. 1991. Sorption and microbial degradation of naphthalene in soil-water suspensions under denitrification conditions. Environ. Sc. Technol. 25:169-177.
29. Rabus, R., R. Nordhaus, W. Ludwig and F. Widdel. 1993. Complete oxidation of toluene under strictly anoxic conditions by a new sulfate- reducing bacterium. Appl. Environ. Microbiol. 59:1444-1451.
30. RIWA. 1993. Ur ernstig verontreinigd, IAZI van DSM onterecht beschuldigd. H20 26:659-660.
31. Schocher, R. J., B. Seyfried, F. Vazquez and J . Zeyer. 1991. Anaerobic degradation of toluene by pure cultures of denitrifying bacteria. Arch. Microbiol. 157:7-12.
45
Chapter 2
32. Smith, M. R. 1990. The biodégradation of aromatic hydrocarbons by bacteria. Biodegradation 1:191-206.
33. Smith, M. R. 1994. The physiology of aromatic hydrocarbon degrading bacteria, p. 347-378. In C. Ratledge (ed.), Biochemistry of Microbial Degradation, Kluwer Academic Publishers, Dordrecht.
34. Stumm, W. and J. J. Morgan. 1981. Aquatic chemistry, 2nd ed. John Wiley and Sons, Inc., New York.
35. Vogel, T. M. and D. Grbic-Galic. 1986. Incorporation of oxygen from water into toluene and benzene during anaerobic fermentative transformation. Appl. Environ. Microbiol. 52:200-202.
36. Weast, R. C. 1971-1972. Handbook of Chemistry and Physics. The Chemical Rubber Co., Cleveland.
37. Zedeck, M. S. 1980. Polycyclic aromatic hydrocarbons - a review. J. Environ. Pathol. Toxicol. 3:537-567.
46
Chapter 3
Naphthalene Degradation under Sulfate Reducing Conditions:
Attempts to Enrich for Naphthalene Degrading Bacteria
Alette A.M. Langenhoff and Gosse Schraa
47
Chapter 3
ABSTRACT
Naphthalene was degraded in continuously percolated, anaerobic sediment
columns with sulfate as electron acceptor. Numerous attempts were made for
further enrichment of sulfate-reducing, naphthalene degrading bacteria. Different
naphthalene concentrations, inoculum sizes, medium compositions, extra additions
etc. were used, but all attempts failed.
Naphthalene was shown not to be toxic for four strains of sulfate-reducing
bacteria, Desulforhabdus amnigenus str. ASRB1, Syntrophobacter fumaroxidans str.
MPOB, Desulfitobacterium dehalogenans and Desulfomonile tiedjei.
INTRODUCTION
The anaerobic degradation of various monoaromatic hydrocarbons has been
extensively documented (7, 8, 20), but little is known about the degradation of
polycyclic aromatic hydrocarbons (PAHs) in the absence of molecular oxygen.
Under anaerobic conditions the aromatic hydrocarbons have to be activated via
carboxylation, hydroxylation or CoA thioester formation, and need to be directed
into a few central intermediates that are susceptible to reductive attack of the
aromatic ring via dehydroxylations or transhydroxylations (7). The formed inter
mediates (benzoate, resorcinol and phloroglucinol) can be enzymatically attacked
by reductases and the formed non-cyclic compounds are converted into central
intermediates using conventional pathways (20). The degradation of PAHs like
naphthalene, anthracene, phenanthrene and pyrene with other electron acceptors
than molecular oxygen is thermodynamically possible, but the Gibbs free energy
change under methanogenic and sulfate-reducing conditions is small. This suggests
that these conditions are less favourable than nitrate-, manganese- or iron-reducing
conditions (14).
Only a few reports exist on the anaerobic degradation of PAHs. Naphthalene
(55 ixM) and acenaphthalene (2.6 /xM) were found to be transformed in the
presence of other carbon sources under denitrifying conditions in 40 to 50 days in a
soil-water system (16, 17). The degradation of naphthalene under denitrifying
48
Naphthalene degradation in batches
conditions was also demonstrated in a contaminated soil slurry. The mineralization
of [14C]naphthalene to 14C02 coincided with the consumption of nitrate (2).
Recently, the mineralization of [14C]naphthalene and [14C]phenanthrene was
demonstrated under sulfate-reducing conditions with heavily contaminated sedi
ments as inoculum. No degradation was observed in less contaminated sediments
(5). We previously showed that naphthalene was degraded in laboratory-scale
sediment columns (13). Two-third of the added [14C]naphthalene was degraded to 14C02 in the presence of sulfate as electron acceptor.
Here we describe our attempts to enrich for, and isolate naphthalene
degrading, sulfate-reducing bacteria.
MATERIALS AND METHODS
Medium and cultivation. Batch experiments were performed in 115-ml
bottles, filled with 20 ml medium, designed to support sulfate-reducing bacteria. It
contained per liter of demineralized water: 0.41 g of KH2P04.2H20; 3.6 g of
NaHC03; 0.44 g of NH4C03; 0.11 g of CaCl2.2H20; 0.1 g of MgS04.4H20; 0.3 g
of NH4C1; 0.3 g of NaCl; 0.48 g of Na2S.9H20; 2.56 g of Na2S04; 0.0005 g of
resazurin; 1 ml of acid trace element solution I (containing per liter: 1.5 g of
FeCl2.4H20; 0.1 g of MnCl2.4H20; 0.12 g of CoCl2.6H20; 0.07 g of ZnCl2; 0.015
g of CuCl2; 0.06 g of H3B03; 0.25 g of NiCl2.6H20; 1.4 g of HCl); 1 ml of
alkaline trace element solution II (containing per liter: 0.4 g of NaOH; 0.02 g of
Na2Se03; 0.03 g of Na2W04; 0.025 g of Na2Mo04) and 1 ml of vitamin solution
(containing per liter: 2 mg of biotin; 10 mg of p-aminobenzoate; 10 mg of
pantothenate; 50 mg of pyridoxine; 20 mg of nicotinamide; 20 mg of thiamine
HCl; 10 mg of riboflavine; 10 mg of cyanocobalamine).
In an anaerobic glovebox (Coy Laboratories Products, Toeppfer GmbH,
Göppingen, FRG), aliquots of stock solutions of KH2P04.2H20, Na2S04 and
resazurin were made up with anaerobic demineralized H20 to 90% of the final
volume of the medium. The bottles were sealed with viton stoppers (Maag Technic
AG, Dübendorf, Switzerland). The gas phase was changed to N2/C02 and brought
to 1.3 bar. The bottles were heat-sterilized at 121 °C. To complete the medium,
49
Chapter 3
three filter sterilized stock solutions (A, B and C) were added aseptically by
syringe. Solution A contained 1 ml of trace element solution I, 1 ml of trace
element solution II, and 1 ml of vitamin solution per 25 ml of demineralized water.
Solution B contained NaHC03, NH4HC03 and Na2S, 20-fold the final concentra
tion. Solution C contained CaCl2, MgS04, NH4C1 and NaCl, 40-fold the final
concentration. 25 ml of solution A, 50 ml of solution B, and 25 ml of solution C
were added per liter medium. The pH of the medium was usually between 6.5 and
6.8.
Material from an anaerobic sediment column in which the transformation of
high concentrations of naphthalene (200 /xM) in the presence of sulfate was
observed (13), was used as inoculum. Approximately 1 gram of homogeneous
column material was added to each of the batches. Naphthalene was the carbon-
and energy source, and it was added to the batches in four ways. Naphthalene was
added as an aqueous solution varying in concentration from 1 to 200 fiM (satura
tion). To obtain higher final concentrations, the medium was completely saturated
with naphthalene via the addition of naphthalene crystals. Before inoculation, the
medium was filtered into empty, sterile, anaerobic bottles, to remove the crystals
from the medium. A two-liquid-phase system of medium and hexadecane with
naphthalene, was used to obtain a low concentration of naphthalene in the aqueous
phase. For this, 0.2 ml of naphthalene dissolved in hexadecane (0.2 mM) was
added to the batches. This resulted in a constant naphthalene concentration in the
medium of 15 /xM. A two-liquid-phase system with both [12C]- and [14C]-naphtha-
lene in the hexadecane layer (0.2 M with an activity of 5 /iCi/ml) was also used. A
fourth way was to add naphthalene as an ethanol solution (50 mM of naphthalene
in ethanol). Ethanol served thus as a second carbon- and energy source.
The bottles were incubated stationary in the dark at 30°C during at least one
year. Every experiment was performed at least in duplicate and controls with
inhibitors of microbial activity were taken along as well. 1 mM of sodium azide
(an inhibitor of electron transport-linked respiration) and 15 mM of sodium
molybdate (substrate analogue of sulfate and an inhibitor of sulfate-reducing
bacteria) were used. Microbial activity in the batches was examined by measuring
the naphthalene concentration, the production of sulfide and/or the production of MC02.
50
Naphthalene degradation in batches
Addition of fresh column material, column medium or column effluent.
To approach the conditions of the column experiments in the batches, extra
sediment (10 g) was added together with the inoculum, to a number of batches.
This sediment was a freshly made mixture of soil, sediment and sludge as was used
in the column with sulfate as electron acceptor, where the inoculum material
originated from. Besides incubations with batch medium, column medium was used
(13) or 50 % of the batch medium was replaced by column medium or effluent.
Addition of various compounds. Several batches were made with extra
additions. Two grams of teflon beads (00.5 mm), glass beads (01.5 mm),
bentonite (<0.5 mm), vermiculite, sterilized granular sludge from an upflow
anaerobic sludge blanket reactor (CSM, Centrale Suikermaatschappij Breda, The
Netherlands), sterilized Rhine river sediment (0.5 m depth, Wageningen, The
Netherlands) or artificial sediment like precipitated aluminium phosphate (0.24 g/1
of A1C13.6H20 added to phosphate rich medium) or sloppy agar (0.2 % w/v) was
added to 115 ml bottles in a glovebox. The bottles were filled with anaerobic
medium as described and inoculated with the column material.
Immobilization of the column material. Small amounts of the column
material were used to be immobilized in K-carrageenan (10). In an anaerobic
glovebox, a solution of 3% /c-carrageenan in naphthalene-saturated medium was
mixed with material from the sediment column. The medium composition was the
same as previously described, except that NaHC03 was replaced by KHC03.
Droplets were made with a syringe and needle, and coagulated in a 0.75 M KCl
solution in naphthalene-saturated medium. After 1 hour of coagulation, the beads
were used for further incubation in naphthalene-saturated medium.
Solid media. In addition to cultivation in liquid media, enrichments were
also done in solid media. Both roll-tubes (medium with 2 % agar) (11) and soft
agar shake tubes (medium with 1 % agar), with naphthalene (0.1 mM) as substrate
and 0.1 g of column material as inoculum, were made.
Naphthalene toxicity. The toxicity of naphthalene to four sulfate-reducing
bacteria was tested in batch experiments. Desulforhabdus amnigenus str ASRB1
(DSM 10338) (19), Syntrophobacter fumaroxidans str. MPOB (DSM 10017) (21),
Desulfitobacterium dehalogenans (23) and Desulfomonile tiedjei (6) were grown in
the previously described medium with 20 mM of propionate and 15 mM of sulfate,
51
Chapter 3
20 mM of fumarate, 20 mM of pyruvate and 15 mM of sulfate, and 20 mM of
pyruvate, respectively.
Various concentrations of naphthalene were added to a final medium
concentration of 10, 50, 100 and 200 fiM. The amount of inoculum varied from
0.25, 0.5, 1 to 2 % and the bottles were incubated at 37°C. Growth and the rate of
substrate consumption (propionate, fumarate or pyruvate) were used to evaluate a
toxic effect on the activity of the culture.
Sampling and analyses. The concentration of naphthalene in the batches
was measured routinely. 0.5 ml of medium was taken with a syringe, centrifuged
(13,000 rpm. for 3 min.) and analyzed on a High Performance Liquid Chromato
graph (LKB, Bromma, Sweden). Samples (20 JX\) were injected onto a Chromsep
Chromspher PAH column (200x30 mm) at 25°C by using an autosampler (Spectra
System AS 1000). The mobile phase was 55% acetonitrile and 45% nanopure water
at a flow rate of 1 ml/min. The eluted compounds were identified and quantified
with a fluorescence detector (Fluor LC 304, Linear Instruments, Reno, Nevada,
USA) at an excitation wavelength of 270 nm and an emission wavelength of 360
nm.
Organic acids (fumarate, pyruvate and propionate) were analyzed on a High
Performance Liquid Chromatograph (LKB, Bromma, Sweden). Samples (20 ix\)
were injected onto a Chrompack organic acid column (300x6.5 mm) at 60°C by
using an autosampler (Spectra System AS1000). The mobile phase was 0.01 N
H2S04 at a flow rate of 1 ml/min. The eluted compounds were identified and
quantified by differential refractometry (LKB 2142 refractometer)
Sulfide was measured as described by Triiper and Schlegel (22).
The formation of 14C02 was measured as described in Chapter 4 (12).
Chemicals. Naphthalene, acetate, lactate, benzoate, propionate, fumarate,
and pyruvate were purchased from E. Merck, Darmstadt, Germany. K-Carrageenan
Genugel X-028 was purchased from A/S Kobenhavns Pektinfabrik, Kopenhagen,
Denmark. Naphthalene-1-14C with a specific activity of 8.3 mCi/mmol was
purchased from Sigma, St Louis, USA. All chemicals were of analytical grade and
were used without further purification.
52
Naphthalene degradation in batches
RESULTS & DISCUSSION
The goal of this work was to enrich for naphthalene degrading sulfate-
reducing bacteria in batches from the previously described sediment column (13)
and to study the degradation of naphthalene under sulfate-reducing conditions in
more detail. The occurrence of naphthalene degradation in a sediment column with
sulfate as electron acceptor was demonstrated in that work. The use of [14C]naph-
thalene in a recycling column under similar conditions had resulted in the produc
tion of '4C02 (Chapter 2). As a consequence, one would expect to be able to
transfer this activity to batches using the column material as inoculum. This pro
cedure had been successful for the isolation of the tetrachloroethene degrading
bacterium "Dehalobacter restrictus" (PER-K23) from a methanogenic sediment
column in which tetrachloroethene was transformed to ethene (9).
A variety of incubation conditions has been tested, but none of them resulted
in the enrichment of bacteria capable of degrading naphthalene in the presence of
sulfate. The reason for this is unknown. One possibility is that naphthalene is toxic
for anaerobic bacteria. At the time these experiments were done, no information
was available about the toxicity of naphthalene to anaerobic bacteria.
time (days)
no naphthalene lOuM 50 uM 100 uM 200 uM -*— - • - —•»• —•— - • •
Fig. 1. Decrease in substrate concentration (propionate) during the growth of Desulforhab-
dus amnigenus in the presence of various concentrations of naphthalene (1%
inoculum).
53
Chapter 3
We performed toxicity tests with Desulforhabdus amnigenus, Syntrophobacter
fumaroxidans, Desulfitobacterium dehalogenans and Desulfomonile tiedjei. The first
two organisms had been isolated from granular sludge (19, 21). Granular sludge
was also mixed through the sediment in our successful column experiments. The
growth of the four sulfate-reducing bacteria was not affected by the presence of the
different naphthalene concentrations. The batches with and without naphthalene
showed more or less comparable growth of the four strains (Fig. 1). Even at the
smallest inoculum size, the activity was maintained under all conditions tested
(Table 1).
Table 1. The growth of four sulfate-reducing bacteria (Desulforhabdus amnigenus, Syntro
phobacter fumaroxidans, Desulfitobacterium dehalogenans and Desulfomonile
tiedjei) on their growth substrates propionate, fumarate, pyruvate and pyruvate,
respectively, in the presence of various concentrations of naphthalene and with
different amounts of inoculum size.
concentration naphthalene
O^M 10/iM 50 ^M
100 ^M 200/tM
Desulforhabdus amnigenus inoculum 0.25 0.50 + + + + +
+ + + + +
size (%) 1.0 + + + + +
2.0 + + + + +
Syntrophobacter fumaroxidans inoculum 0.25 0.5 + + + + +
+ + + + +
size 1.0 + + + + +
(%) 2.0 + + + + +
Desulfitobacterium dehalogenans inoculum 0.25 0.5 + + + + +
+ + + + +
size 1.0 + + + + +
(%) 2.0 + + + + +
Desulfomonile
inoculum 0.25 0.5 + + + + +
+ + + + +
size 1.0 + + + + +
tiedje
{%) 2.0 + + + + +
+ normal growth of the culture
These results demonstrate that the lack of transformation of naphthalene in our
batch experiments with column material as inoculum is not likely to be due to
toxicity. Toxic effects of naphthalene on aerobic bacteria have not been docu
mented. Naphthalene crystals, resulting in relatively high naphthalene concentra
tions in the medium, were used to grow several Pseudomonas sp. without detri
mental effects (24).
54
Naphthalene degradation in batches
We used a variety of naphthalene concentrations in our enrichments, but we
were never able to enrich for naphthalene degrading microorganisms. The addition
of naphthalene dissolved in an ethanol solution, only resulted in the enrichment of
ethanol degrading organisms. In the one-liquid-phase batches with naphthalene
concentrations from 1 to 200 /xM, no decrease of naphthalene was measured during
340 days (Fig. 2).
200
time (days)
uM 10 uM 50 uM 100 uM 200 uM naphthalene
Fig. 2. Behaviour of naphthalene in one-liquid-phase batches with different concentrations
of naphthalene as the only carbon- and energy source, and column material as
inoculum.
In two-liquid-phase batches, it was not possible to measure a naphthalene decrease.
We therefore followed the production of sulfide (Fig. 3) or 14C02. The batches
with a high sulfide production were transferred into one-liquid-phase batches, but
no decrease in naphthalene concentration could be measured after this transfer. The
formation of sulfide in the first enrichments was probably due to the transformation
of organic material present in the inoculum or the transformation of hexadecane. It
is known that hexadecane can be degraded under sulfate-reducing conditions (1),
although our controls without hexadecane showed the same sulfide production (data
not shown). In batches with [14C]naphthalene in a two-liquid-phase system, we
could never detect the production of 14C02. This could be due to the persistence of
55
Chapter 3
naphthalene or to a partial degradation, which would not result in C02 formation.
Partial degradation would be in contrast to what we have seen in a previous
sediment column.
3
-
-
^to^^S1^*
/ * . •
.^v ••
*•
200 300
time (days)
2 3 4 « »•• —•- X-
Fig. 3. Sulfide production in two-liquid-phase batches with naphthalene as substrate and
column material as inoculum in quadruplicate.
Cysteine, in stead of sulfide, was used as a reducing agent in several experi
ments. Sulfide can react with metal ions present in the medium, forming insoluble
complexes, and thus making them unavailable for bacteria. Combinations of sulfide
(3mM) and cysteine (1 mM), and sulfide (ImM) and dithionite (0.17 mM) were
tested as well, but none of these resulted in the enrichment of naphthalene degrad
ing bacteria.
In the naphthalene degrading sediment column, the role of sulfate as electron
acceptor was not verified, due to low concentrations and practical problems.
Although it was not likely that other electron acceptors were involved in the
degradation of naphthalene (13), other electron acceptors were tested in batch
experiments as well. Only in the presence of oxygen a degradation of naphthalene
in batches was found. With nitrate, amorphous manganese oxide, ferrous citrate,
amorphous iron oxide, sulfite, thiosulfate or bicarbonate as electron acceptor no
56
Naphthalene degradation in batches
degradation was observed.
A difference between the columns and the batches is the continuous flow of
fresh medium with nutrients in the columns and the liquid/solid material ratio. The
solid material in the columns can act as binding site for bacteria. In addition, some
organic compounds, trace elements or other micronutrients from the sediment
and/or granular sludge may be essential for the bacteria. It has been shown that the
anaerobic degradation of polychlorinated biphenyls by enrichment cultures
increased in the presence of sterile Rhine river sand (15) or Raritan river sediment
(4). Sterile Rhine river sediment was also needed to maintain the mineralization of
toluene by an enrichment culture that uses manganese oxide as ultimate electron
acceptor (12). Furthermore, aluminium phosphate and sloppy agar were found to
be necessary to cultivate gliding bacterial species, like filamentous sulfate reducers
of the genus Desulfonema (25). The presence of two grams of teflon beads, glass
beads, bentonite, vermiculite, granular sludge, Rhine river sediment or artificial
sediment like precipitated aluminium phosphate or sloppy agar did not result in the
enrichment of naphthalene degrading bacteria. This suggests that the inability to
enrich for bacteria may not be due to the lack of a solid surface or the need of
nutrients.
The addition of different organic substrates was tested, because lactate and
benzoate had a positive effect on the transformation of naphthalene in sediment
columns (13). The addition of acetate, lactate or benzoate (0.1 mM) had no
positive effect on the lack of transformation of naphthalene in our batches.
To approach the conditions of the column experiments in the batches, extra
sediment was added to the batches to obtain a lower liquid/solid material ratio.
Furthermore, the column medium was used in stead of the normally used batch
medium. Degradation of naphthalene could not be observed here either, not even
when 50 % of the batch medium was replaced by column medium or by effluent of
the sulfate-reducing column.
The columns had been operated at 20°C, whereas the batches were routinely
incubated at 30°C. Incubation of batches at 20°C did also not result in the degrada
tion of naphthalene.
57
Chapter 3
Clustering the inoculum material by using /c-carrageenan can have a positive
effect, when consortia of bacteria are needed to degrade naphthalene. Bringing the
bacteria together may facilitate the diffusion of intermediates, thus increasing the
degradation rate. Although the bacteria in the immobilized column material in the
K-carrageenan beads produced sulfide, no degradation of naphthalene was observed
(Fig. 4). The produced sulfide was probably due to the transformation of organic
material present in the inoculum, or the transformation of /c-carrageenan. /c-Carra-
geenan can be degraded under anaerobic conditions, although the solidified state
makes it less available for microbial degradation (18). The production of sulfide
indicates that bacteria were immobilized and were active, but that they had no
ability to degrade naphthalene.
Fig. 4.
0 50 100 150 200
time (days)
1, naphthalene 2, naphthalene 1, sulfide 2, sulfide
The production of sulfide and the behaviour of the naphthalene concentration in
the liquid in one-liquid-phase batches with immobilized column material as
inoculum in duplicate.
Cultivation on solid agar resulted in the formation of black colonies on the
agar. Transferring the colonies into liquid media or sloppy agar did not result in
the enrichment of sulfate-reducing naphthalene degrading bacteria. The colonies
may have grown on agar or impurities in the agar instead of on naphthalene.
58
Naphthalene degradation in batches
Finally, it is known that microorganisms do not often degrade a contaminant
upon exposure, but develop the capability to degrade the contaminant after pro
longed exposure. This adaptation was demonstrated in a study with sediment from
San Diego Bay. Naphthalene and phenanthrene were oxidized to carbon dioxide in
sediments that were heavily contaminated with PAHs (33 mg/kg of sediment) but
not in less contaminated sediments (4 mg/kg of sediment) (5). We performed batch
experiments with heavily and less contaminated sludge and sediment originating
from various locations, but were not able to transform naphthalene under a variety
of anaerobic conditions.
In conclusion, we were not able to enrich for naphthalene degrading, sulfate-
reducing bacteria, despite a variety of batch experiments (over 400) to create
optimal conditions for degradation. It is frustrating, but the reason is not clear. It
seems that selective enrichment for bacteria, responsible for the degradation of
naphthalene, can fail to mimic the conditions that microorganisms require for their
growth. Finding the reasons for failure, e.g. when unculturable organisms are
involved (3), and finding microorganisms, is needed to obtain knowledge about the
physiology and biochemistry of the anaerobic degradation of polycyclic aromatic
hydrocarbons.
REFERENCES
1. Aeckersberg, F., F. Bak and F. Widdel. 1991. Anaerobic degradation of saturated hydrocarbons to C02 by a new type of sulfate-reducing bacterium. Arch. Microbiol. 156:5-14.
2. Al-bashir, B., T. Cseh, R. Leduc and R. Samson. 1990. Effect of soil contaminant interactions on the biodégradation of naphthalene in flooded soil under denitrifying conditions. Appl. Microbiol. Biotechnol. 34:414-419.
3. Amann, R. I., W. Ludwig and K. H. Schleifer. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59:143-169.
4 Boyle, A. W., C. K. Blake, W. A. Price and H. D. May. 1993 Effects of polychlorinated biphenyl congener concentration and sediment supplementation on rates of methanogenesis and 2,3.6-trichlorobiphenyl dechlorination in an anaerobic enrichment. Appl. Environ. Microbiol. 59:3027-3031.
5. Coates, J. D., R. T. Anderson and D. R. Lovley. 1996. Oxidation of polycyclic aromatic hydrocarbons under sulfate-reducing conditions. Appl. Environ. Microbiol. 62:1099-1101.
59
Chapter 3
6. De Weerd, K. A., L. Mandelco, R. S. Tanner, C. R. Woese and J. M. Suflita. 1990. Desulfomonile tiedjei gen. nov. and sp. nov., a novel anaerobic, dehalogenating, sulfate-reducing bacterium. Arch. Microbiol. 154:23-30.
7. Fuchs, G., M. E. S. Mohamed, U. Altenschmidt, J. Koch, A. Lack, R. Brackmann, C. Lochmeyer and B. Oswald. 1994. Biochemistry of anaerobic degradation of aromatic compounds, p. 513-553. In C. Ratledge (ed.), Biochemistry of Microbial Degradation, Kluwer Academic Publishers, Dordrecht.
8. Grbic-Galic, D. 1990. Anaerobic microbial transformation of nonoxygenated aromatic and alicyclic compounds in soil, subsurface and freshwater sediments, p. 117-189. In J. M. Bollag and G. Stotzky (eds.), Soil Biochemistry and Microbiology, Marcel Dekker, Inc., New York.
9. Holliger, C , G. Schraa, A. J. M. Stams and A. J. B. Zehnder. 1993. A highly purified enrichment culture couples the reductive dechlorination of tetrachloroethene to growth. Appl. Environ. Microbiol. 59:2991-2997.
10. Hulst, A. C., J. Tramper, K. van 't Riet and J. M. M. Westerbeek. 1985. A new technique for the production of immobilized biocatalyst in large quantities. Biotechnol. Bioeng. 27:870-876.
11. Hungate, R. E. 1969. A roll tube method for cultivation of strict anaerobes, p. 117-132. In J. R. Norris and D. W. Ribbons (eds.), Methods in Microbiology, Academic press, New York.
12. Langenhoff, A. A. M., D. L. Brouwers-Ceiler, J. H. L. Engelberting, J. J. Quist, J. G. P. N. Wolkenfelt, A. J. B. Zehnder, and G. Schraa. 1997. Microbial reduction of manganese coupled to toluene oxidation. FEMS Microbiol. Ecol. 22:119-127.
13. Langenhoff, A. A. M., A. J. B. Zehnder and G. Schraa. 1996. Behaviour of toluene, benzene and naphthalene under anaerobic conditions in sediment columns. Biodegradation 7:267-274.
14. McFarland, M. J. and R. C. Sims. 1991. Thermodynamic framework for evaluating PAH degradation in the subsurface. Ground Water 29:885-896.
15 Middeldorp, P. J. M., J. de Wolf, A. J. B. Zehnder and G. Schraa. 1996. Reduction of the lag phase for microbial reductive dechlorination of poly chlorinated biphenyls. Environ. Sei. Technol. submitted.
16. Mihelcic, J. R. and R. G. Luthy. 1988. Degradation of aromatic hydrocarbon compounds under various redox conditions in soil-water systems. Appl. Environ. Microbiol. 54:1182-1187.
17. Mihelcic, J. R. and R. G. Luthy. 1988. Microbial degradation of acenaphthalene and naphthalene under denitrification conditions in soil-water systems. Appl. Environ. Microbiol. 54:1188-1198.
18. 0stgaard, K., B. F. Wangen, S. H. Knutsen and I. M. Aasen. 1993. Large-scale production and purification of /c-carrageenase from Pseudomonas carrageenovora for applications in seaweed biotechnology. Enzyme Microb. Technol. 15:326-333.
19. Oude Elferink, S. J. W. H., R. N. Maas, H. J. M. Harmsen and A. J. M. Stams. 1995. Desulforhabdus amnigenus gen. nov. sp. nov., a sulfate reducer isolated from anaerobic granular sludge. Arch. Microbiol. 164:119-124.
20. Schink, B., A. Brune and S. Schnell. 1992. Anaerobic degradation of aromatic compounds, p. 219-242. In G. Winkelmann (ed.), Microbial Degradation of Natural Products, VCH, Weinheim, New York.
21. Stams, A. J. M., J. B. Van Dijk, C. Dijkema and CM. Plugge 1993. Growth of syn-trophic propionate oxidizing bacteria with fumarate in the absence of methanogenic bacteria. Appl. Environ. Microbiol. 59:1114-1119.
60
Naphthalene degradation in batches
22. Triiper, H. G. and H. G. Schlegel. 1964. Sulphur metabolism in Thiorhodaceae. 1. Quantitiative measurements on growing cells of Chromatium okenii. Antonie van Leeuwenhoek 30:225-238.
23. Utkin, I., C. R. Woese and J . Wiegel. 1994. Isolation and characterization of Desulfito-bacterium dehalogenans gen.nov., sp.nov., an anaerobic bacterium which reductively dechlorinates chlorophenolic compounds. Int. J. Syst. Bacteriol. 44:612- 619.
24. Volkering, F., A. M. Breure and J. G. Van Andel. 1993. Effect of microorganisms on the bioavailability and biodégradation of crystalline naphthalene. Appl. Microbiol. Biotechnol. 40:535-540.
25. Widdel, F., G.-W. Kohring and F. Mayer. 1983. Studies on dissimilatory sulfate-reducing bacteria that decompose fatty acids. Ill Characterization of the filamentous gliding Desulfonema limicola gen.nov.sp.nov. and Desulfonema magnum sp.nov. Arch. Microbiol. 134:286-294.
61
Chapter 4
Microbial Reduction of Manganese
Coupled to Toluene Oxidation
Alette A.M. Langenhoff, Deborah L. Brouwers-Ceiler,
Johannes H.L. Engelberting, Janine J. Quist, Johannes G.P.N. Wolkenfelt,
Alexander J.B. Zehnder and Gosse Schraa
FEMS Microbiol. Ecol. (1997) 22:119-127
63
Chapter 4
ABSTRACT
Toluene degradation occurred in anaerobic flow-through sediment columns
filled with contaminated sediment and sludge to which either amorphous or highly
crystalline manganese oxide was added.
An enrichment culture from these sediment columns was able to grow on
toluene under strictly anaerobic conditions in the presence of manganese oxide. The
oxidation of toluene was coupled to the production of C02 and to the reduction of
Mn(IV). Of the different manganese oxides tested, the rate was slowest with
crystalline manganese oxide.
After several transfers of the enrichment culture, its ability to degrade
toluene became less and was ultimately lost, unless sterilized Rhine river sediment
was present in the medium.
Direct contact between the bacteria and the manganese oxide was found to
be advantageous for a rapid toluene degradation. The degradation rate could further
be increased by adding organic ligands such as oxalic acid or nitrilotriacetic acid.
INTRODUCTION
Leaks in underground fuel storage tanks, improper disposal techniques and
spills of all types of petroleum products have led to a widespread toluene contami
nation of soil, sediment and groundwater. The growing awareness concerning the
toxic and even suspected carcinogenic effect requires to reduce this contamination
and to remediate the contaminated areas (9).
Under aerobic conditions toluene degradation proceeds rapidly and several
aerobic toluene degrading bacteria have been isolated (16, 34, 35). However, in
many polluted areas oxygen is limited and anaerobic processes prevail. Toluene
degradation under anaerobic conditions has been demonstrated under methanogenic
(11, 17, 36, 37), sulfate-reducing (2, 12), and nitrate-reducing conditions (19, 20,
27, 38) and several pure cultures of toluene degrading anaerobic bacteria have been
described under sulfate-reducing (3, 32), iron-reducing (23), and nitrate-reducing
(1, 10, 15, 33). In a previous study in our laboratory, we have observed the disap-
64
Manganese reduction coupled to toluene oxidation
pearance of toluene in an anaerobic continuous flow sediment column in which
Mn(IV), present as manganese oxide (Mn02), was the dominant electron acceptor
(21). Manganese is a widespread transition metal (about 5-10 times less abundant
than iron) in our environment, and the different manganese oxides are potential
electron acceptors for the oxidation of organic compounds in anaerobic sediments.
Manganese reduction is energetically more favourable than iron reduction. The
mineralogy of the insoluble oxides greatly influences their reactivity. Amorphous
manganese oxides have a larger specific surface area than the crystalline forms,
and this may make the manganese reduction to proceed faster (30). Except for that
study, we are not aware of any reports on the anaerobic degradation of toluene
under manganese-reducing conditions. A variety of manganese-reducing bacteria
has been described, but none of them is able to degrade aromatic compounds (13,
22, 31). The manganese- and iron-reducing bacterium Geobacter metallireducens is
able to degrade toluene with iron oxide as electron acceptor, but not with manga
nese oxide as electron acceptor (unpublished results). Only in sediment slurries
amended with amorphous manganese oxide was the degradation of some aromatic
compounds like benzoate, 4-hydroxybenzoate, aniline, 3-chlorobenzoate, and 2,4-
dichlorophenoxyacetic acid observed (29).
In this study we report details on the degradation of toluene in sediment
columns with three types of manganese oxide and on the enrichment and mainten
ance of a bacterial mixed culture that couples the oxidation of toluene to the
reduction of Mn(IV).
MATERIALS AND METHODS
Sediment columns. The behaviour of toluene was studied in continuous-flow
packed-bed columns as previously described (21). Three types of manganese oxide
were used in three different columns: highly crystalline manganese oxide, amor
phous manganese oxide and freeze dried amorphous manganese oxide (see below
for details). These oxides (approximately 10 mmol/column) were mixed through
the column material at the beginning of the experiment. Upon depletion, caused by
reduction of the manganese oxide, fresh manganese oxide (5 mmol) was mixed
65
Chapter 4
through the column material. These additions were done under strict anaerobic
conditions in a glovebox.
A flow rate of 3.5 ml/h was used, which gave a column retention time of 10
h. The toluene concentration was 70 ;uM at the beginning of the experiments and
was increased over a 110-day period to 300 /JLM. The columns were operated at
20°C in the dark.
The concentration of toluene was measured routinely in the dark. Samples
were taken by allowing either the influent or the effluent to flow into a gas-tight
syringe. After centrifugation (13,000 rpm. for 3 min) of the samples, they were
analyzed by High Performance Liquid Chromatograph (HPLC).
Medium. For the enrichment cultures and for the batch experiments 115-ml
bottles were used, filled with 20 ml of anaerobic medium. The medium contained
per liter of demineralized water: 0.58 g of NaH2P04.2H20; 2.5 g of NaHC03; 0.25
g of NH4HC03; 0.11 g of CaCl2.2H20; 0.1 g of MgCl2.6H20; 0.1 g of KCl; 1.5 g
of NH4C1; 0.4 g of Na2S.9H20; 0.0005 g of resazurin; 1 ml of trace element sol
ution (containing per liter: 15 mg of NTA; 1 mg of FeS04.7H20; 5 mg of MnS04-
.2H20; 1 mg of CoS04; 1 mg of ZnS04; 0.1 mg of CuS04.6H20; 0.1 mg of
A1K(S04)2; 0.1 mg of H3B03; 25 mg of Na2Mo04; 0.1 mg of NiCl2.6H20; 10 mg
of NaCl) and 1 ml of vitamin solution (containing per liter: 20 mg of biotin; 50 mg
of p-aminobenzoate; 50 mg of pantothenate; 20 mg/1 of folic acid; 50 mg of lipoic
acid; 100 mg of pyridoxine; 50 mg of nicotinamide; 50 mg of thiamine-HCl; 50
mg of riboflavine; 1 mg of cyanocobalamine).
Media were prepared as described by Holliger (18): Aliquots of stock sol
utions of NaH2P04.2H20 and resazurin were made up with anaerobic demineralized
H20 to 90% of the final volume of the medium in an anaerobic glovebox. The
poorly soluble manganese oxide (0.1 g) was added to the bottles inside the glove
box as well. The bottles were sealed with viton stoppers (Maag Technic AG,
Dübendorf, Switzerland) and outside the glovebox the gas phase was changed to
N2/C02 (80%/20%) and brought to 1.3 bar. The bottles were heat-sterilized at
121 °C, before the aseptic addition by syringe of the rest of the medium from three
filter-sterilized anaerobic stock solutions (A, B and C). Solution A contained 1 ml
of trace element solution and 1 ml of vitamin solution per 25 ml of demineralized
water. Solution B contained NaHC03, NH4HC03 and Na2S, 20-fold the final
66
Manganese reduction coupled to toluene oxidation
concentration. Solution C contained CaCl2 and MgCl2, 40-fold the final concen
tration. Per liter medium, 25 ml of solution A, 50 ml of solution B and 25 ml of
solution C were added. The pH of the medium was 6.7-7.0.
Toluene was added to the batches in two ways. A one-liquid-phase system
was created via the addition of 2-6 ml of a toluene solution (5 mM, saturation) to
give a final concentration in the liquid of 0.3 to 1 mM. Higher concentrations were
not used because of possible inhibitory effects, but toluene was readded when
depleted. A two-liquid-phase system of medium and hexadecane was used to create
a constant low toluene concentration in the medium and a constant flux of toluene
from the organic phase to the aquatic medium. To the batches, 0.5 ml of
hexadecane containing 0.2 M toluene was added. This resulted in a concentration
in the liquid phase of 190 /xM. The bottles were incubated stationary in the dark at
30°C.
Chemicals. Toluene was purchased from Merck (Darmstadt, Germany) and
was of analytical grade. [n'n,g-UL-14C]Toluene with a specific activity of 10.2
mCi/mmol was purchased from Sigma (St. Louis, MO, USA).
Highly crystalline manganese oxide (pyrulosite) with a specific surface area
of less than 0.20 m2/g was purchased from Aldrich (The Netherlands) and amor
phous manganese oxide was made according to Burdige (6). The amorphous form
had been identified as vernadite (<5Mn02), based on its X-ray diffraction pattern, its
average oxidation state and its specific surface area (+ 180 m2/g). The amorphous
manganese oxide was washed 4 times by centrifugation and resuspended in
demineralized water. Finally, the suspension was (freeze-dried and) stored
anaerobically in bottles. Suspensions of amorphous manganese oxide in anaerobic
medium were made for the addition to batch incubations.
Enrichment procedures. Material from each of the three sediment columns
(2 g [wet weight]), in which toluene was transformed, served as inoculum for the
primary enrichment cultures. Secondary enrichment cultures were prepared by
transferring liquid and solids (Mn02 + sediment; 10% [v/v]) to bottles containing
fresh medium, after approximately 100 / mol of the toluene was transformed. A
decrease in toluene concentration was measured routinely in the headspace by Gas
Chromatograph (GC). The transfers were done every 30 to 60 days, depending on
the transformation rate.
67
Chapter 4
Subculturing the enrichment culture in the absence of sediment material after
4 to 5 transfers always resulted in the loss of the toluene transformation activity.
Two grams of either teflon beads (00.5 mm), glass beads (01.5 mm), bentonite
(0<O.5 mm), vermiculite (0<O.5 mm), granular sludge from an upflow
anaerobic-sludge blanket reactor (CSM Breda, The Netherlands) or Rhine river
sediment (from 0.5 m depth, Wageningen, The Netherlands) were added to the
bottles in an anaerobic glovebox. The bottles were filled with anaerobic medium
and amorphous Mn02, sterilized, and inoculated with 10% (v/v) of an active
enrichment culture. 2 ml of a toluene solution (5 mM) was added. The effect of the
additions on the transformation activity was examined by GC during a period of at
least 5 transfers (150 to 350 days).
Batch experiments. The coupling between the mineralization of toluene and
the formation of Mn(II), the effect of direct contact between bacteria and manga
nese oxide and the effect of the addition of organic ligands were tested in batch
experiments with enrichment cultures from the 12lh generation or more. All experi
ments were performed at least in duplicate and controls with inhibitors for micro
bial activity were taken along. 1 mM of sodium azide (an inhibitor of electron
transport-linked respiration) and 0.175% of formaldehyde (a general inhibitor of
biological activity) both inhibiting manganese-reducing bacteria, were used (7).
The mineralization of toluene and the formation of Mn(II) was tested in two
simultaneous batch experiments. In the first set of batches, the decrease in toluene
concentration and the amount of Mn(II) formed was measured during the degra
dation of toluene in a two-liquid-phase system. A separate bottle was sacrificed for
each Mn(II) measurement, because part of the produced Mn(II) will bind and
adsorb to the remaining amorphous Mn02, and also forms precipitates with metal
ions present in the medium (8). In the second set of batches, the 14C02 production
was examined. In two-liquid-phase batches [12C]toluene and [ring-uC]toluene were
dissolved in hexadecane up to a total concentration of 0.2 M with an activity of 1
/«Ci/ml, and 0.5 ml was added to the batches. Routinely, 1 ml of medium was
analyzed for the production of 14C02. Killed controls, controls without manganese
oxide, and controls without toluene were taken along.
The effect of direct contact between the manganese-reducing bacteria and the
manganese oxide surface was tested by adding amorphous manganese oxide to the
68
Manganese reduction coupled to toluene oxidation
medium as described before or enclosed in a bacterial-filter package. The bacterial-
filter package was a small, sealed package of 0.22 im Durapore filter (Millipore,
Etten-Leur, The Netherlands), which contained manganese oxide. This prevented
the bacteria to be in direct contact with the solid manganese oxide. The bottles
were inoculated with 10% (v/v) of an active enrichment culture, and toluene, in a
hexadecane solution, was added as substrate. A decrease in toluene concentration in
the headspace was measured routinely by GC.
The effect of an increased solubility of Mn(IV) on the toluene transformation
rate was tested by the addition of organic ligands to the Mn02. The effect of
various concentrations of oxalic acid and nitrilotriacetic acid (NTA) on the
solubility of manganese oxide was tested. Batches were made with 4 mM of oxalic
acid or 2 mM of NTA and amorphous manganese oxide. The bottles were inocu
lated with 10% (v/v) of an active enrichment culture. Toluene, in a hexadecane sol
ution, was added as substrate and its decrease was followed over time by GC.
Analytical procedures. The concentration of toluene in the column samples
was measured by HPLC (LKB, Bromma, Sweden). Samples (20 ptl) were injected
onto a Chromsep Chromspher PAH column (200x30 mm) at 25°C. The flow rate
was 1 ml/min with an eluent of 55% acetonitrile and 45% nanopure water. All
aromatic compounds were detected with an UV detector at 206 nm.
The concentration of toluene in the batches was measured in the headspace
by GC (Chrompack 438A, Chrompack Packard B.V., The Netherlands). Head-
space samples of 200 /*1 were injected onto a capillary column (SIL 5CB; 10m *
0.53 mm, 2 /um bead size, Chrompack Packard B.V.) and analyzed with a flame
ionization detector. The column temperature was 70°C.
Mn(II) and Mn(IV) were determined by Atomic Adsorption Spectroscopy
(AAS). Solubilizing the different manganese complexes made it possible to
distinguish between the different redox states of manganese (24). Both Mn(II) and
Mn(IV) solubilize in a mixture of 0.25 N hydroxylamine-hydrochloride and 0.25 N
hydrochloric acid, whereas in 0.5 N hydrochloric acid only Mn(II) solubilizes.
After solubilising the manganese complexes in a separate bottle for each time
measurement, the samples were filtered over an 0.45 pm filter and measured with
AAS (Varian AAS 300/400 Spectroscopy). An air-acetylene flame and a wave
length of 279.5 nm (monochromatic light) were used. Concentrations of 0.02-5 mg
69
Chapter 4
Mn/1 could be measured with this method.
The production of 14C02 was measured in the liquid phase as previously
described (21). The purged NaOH-treated samples accounted for the total activity
of the non-volatile compounds, biomass, and C02. The HCl-treated samples
accounted for the total activity of the non-volatile compounds, and biomass. The 14C02-production was calculated as the difference between these two measurements
and corrections were made for the C02 concentration in the gas phase. Volatile
[14C]-compounds (other than C02) were calculated as the difference between
unpurged NaOH-treated and purged NaOH-treated samples.
The trace element composition (Pb, B, Cr, Cu, Zn, Cd, Al, Mo, Ni, Co) of
the medium with and without sterile Rhine river sediment was measured with
Inductively Coupled Plasma Atomic Emission Spectrometry (ICP-AES).
RESULTS
Sediment columns. Degradation of toluene occurred in the sediment
columns in the presence of crystalline, amorphous and freeze-dried amorphous
manganese oxide (Fig. 1). Following a partial breakthrough of toluene in the
columns with crystalline and amorphous manganese oxide, between 80 and 95% of
the incoming toluene was degraded after 100 days of operation. In the column with
freeze-dried amorphous manganese oxide a partial breakthrough followed by
degradation of toluene was observed as well, but not as fast as in the other two col
umns. In time, we increased step-wise the toluene concentration in the influent.
The toluene degradation in the column with freeze-dried amorphous manganese
oxide levelled off to 60% degradation during the first 60 days and decreased after
this time period. Readditions of manganese oxide (5 mmol) at day 70 and day 110
to the column with freeze-dried amorphous manganese oxide led to a further
toluene degradation.
70
Manganese reduction coupled to toluene oxidation
70 influent cone, toluene (uM)
80 ,100 |ISO ,200 300
time (days)
crystalline Mn02 amorphous Mn02 amorphous Mn02, freeze-dried
Fig. 1. Behaviour of toluene in anaerobic sediment columns with crystalline, amorphous
or freeze-dried amorphous manganese oxide. C/Co is effluent concentration
relative to influent concentration. On day 70 and day 110 (1) 5 mmol of Mn02
was added to the column. The influent toluene concentrations are given at the top
of the figure.
Enrichment cultures. The first enrichment cultures degraded toluene in the
presence of all three types of manganese oxide (Fig 2.). Upon transferring these
first enrichments into fresh medium, 5 mM of bromoethanesulfonic acid (BrES), an
inhibitor of methanogenesis, was added. The batches with amorphous Mn02 and
freeze-dried amorphous Mn02 continued to degrade toluene, but no degradation
was found with crystalline manganese oxide (results not shown).
71
Chapter 4
> 40
"ô S
c a>
J3 20
"g
10
+• | \
- fv> :-, ] \ \ i "B-iî^^ "4 N>.
10 20 30 40
time (days)
crystalline Mn02 amorphous Mn02 amorphous Mn02, freeze-dried
Fig. 2. Degradation of toluene by the first enrichment cultures with different types of
manganese oxide.
Table 1. Effect of the presence of solid materials on the toluene degradation rate.
Addition
none glass beads teflon beads bentonite vermiculite granular sludge Rhine river sediment
Transfer
1 2
+ + + + + + + + + + + + + +
3
+ + + + + ± +
4
± ± + + + + +
nt nt nt nt nt nt +
nt nt nt nt nt nt +
nt nt nt nt nt nt +
nt nt nt nt nt nt +
+ = degradation of 100 /xmol of toluene within 30 days of incubation ± = degradation of 100 /umol of toluene between 30-120 days of incubation - = no degradation of 100 //.mol of toluene after 200 days of incubation nt = not tested
72
Manganese reduction coupled to toluene oxidation
Maintaining the degradation of toluene by the enrichment culture. The
ability of the enrichment culture to degrade toluene decreased after several trans
fers. After the second transfer, lag phases of 80 days were observed as well as a
decreasing toluene degradation rate, and after the fourth transfer degradation of
toluene was not even observed after 200 days of incubation. The effect of different
additions of solid materials was tested during 5 transfers (Table 1). The enrichment
culture was able to maintain the activity only in the presence of sterile Rhine river
sediment. In all cases, with sodium azide or formaldehyde killed controls and
controls without manganese oxide did not show degradation of toluene.
Toluene oxidation versus manganese reduction. The degradation of
toluene was coupled to the production of Mn(II) and 14C02 (Fig. 3). After 2 weeks
of incubation, the toluene concentration had decreased from 135 to 95 /^mol/vial,
and 500 /xmol/vial of reduced manganese and 110 /«nol/vial of C02 were pro
duced. Fifty percent of the toluene carbon was mineralized to C02, whereas 28%
was transformed to non-volatile compounds and biomass, and 20% to volatile
compounds (other than C02 or toluene). In batches without manganese oxide or
toluene, no toluene oxidation or manganese reduction, respectively, was found.
Fig. 3.
6 8 10
time (days)
Mn(II) toluene C02 - • - ••*•• —•—
Degradation of toluene and the production of Mn(II) and 14C02 in batch experi
ments with amorphous manganese oxide.
73
Chapter 4
Direct contact between bacteria and manganese oxide. The necessity of
the bacteria to be in contact with the insoluble manganese oxide, was tested by
wrapping amorphous manganese oxide in a bacterial-filter package. This resulted in
a slow degradation of toluene (Fig. 4). With the same amount of amorphous
manganese oxide directly in the medium, toluene was degraded much faster. The
use of highly crystalline manganese oxide showed a slow degradation of toluene, as
already demonstrated.
200
a: 150
> o S 3 100 o G u 3 S 50
: *. F - - • - • : : ^ ^ +..... ' • » * * • • * • - • • •
*• ^ ^ ^ * • - • -
^ " " " • « s * ^ ^ - • » - • -• -••• - • - •
5 10 15 20 25 .10
time (days)
amorphous Mn02 amorphous Mn02 in filter crystalline Mn02
Fig. 4. Degradation of toluene in batch experiments with different types of manganese
oxide.
Organic ligands. The solubility of manganese oxide can be increased by the
addition of organic ligands like oxalic acid or NT A. The effect of various concen
trations of oxalic acid and NTA on the solubility of amorphous manganese oxide
was tested. The highest concentrations were found in the presence of 4 mM of
oxalic acid or 2 mM of NTA, 12 mg Mn4+/1 and 75 mg Mn4+/1, respectively.
Without chelating agents, the soluble Mn concentration was 0.7 mg Mn4+/1. These
additions improved the degradation rate of toluene considerably (Fig. 5). In the
incubations without chelating agents the degradation levelled off, most probably
because the soluble Mn(IV) had been depleted after one week. In the presence of 4
mM of oxalic acid or 2 mM of NTA more soluble Mn(IV) was available and a
higher degradation rate was maintained.
74
Manganese reduction coupled to toluene oxidation
15 20
time (days)
oxalic acid NTA no addition
Fig. 5. Degradation of toluene in batch experiments with amorphous manganese oxide in
the presence of 4 mM of oxalic acid or 2 mM of NTA.
DISCUSSION
Our results indicate that degradation of toluene under manganese-reducing
conditions is possible. Toluene degradation was observed in flow-through sediment
columns in the presence of crystalline manganese oxide, amorphous manganese
oxide and freeze-dried amorphous manganese oxide. We did not verify whether
manganese oxide indeed functioned as electron acceptor for toluene degradation in
the columns. It was not possible to quantify the decrease in manganese oxide
concentration, because the reduced form of Mn4+ formed precipitates with sulfide
and other compounds in the column and could not be measured in the effluent for
that reason. However, the finding that the gradual increase in toluene concentration
in the effluent of the column with freeze-dried amorphous manganese oxide
between day 57 and 70, and day 83 and 110, could be reversed by readding
manganese oxide to the column, can only be explained when manganese oxide acts
as electron acceptor. Opening the column and mixing the manganese oxide through
the column material disturbed the microbial activity. This resulted in a temporary
75
Chapter 4
increase of the toluene concentration in the effluent.
The type of manganese oxide in the enrichment cultures, strongly affected
the degradation rate of toluene. In the primary enrichments, toluene was still
degraded with all three types of manganese oxide. However, in secondary enrich
ments hardly any degradation of toluene was observed with crystalline manganese
oxide as electron acceptor. This shows that the crystallinity of manganese oxide
strongly affects the rate of reduction. Due to its larger specific surface area, a more
amorphous form is reduced faster and functions better as an electron acceptor than
a more crystalline one, [24, 25, 29]. Several dissimilatory manganese-reducing
bacteria, e.g. G. metallireducens and Shewanella putrefaciens MR-1, reduce amor
phous manganese oxide faster than a more crystalline form [24, 25]. However, this
effect varies among bacterial species, with some being more sensitive to mineral
ogy than others [29, 32]. Amorphous manganese oxide was used for our further
enrichments and batch experiments.
Despite the use of amorphous manganese oxide, we had difficulties to
maintain the activity upon subculturing. The positive effect of the addition of sterile
Rhine river sediment, which lasted at least 12 transfers, may be due to the presence
of essential trace elements or nutrients. Analysis of the trace element composition
in the medium with and without Rhine river sediment could not clarify this
hypothesis. The concentrations of the trace elements in the medium were too low
(<0.01 mg/1) to detect any differences. A comparable positive effect of the addi
tion of river sediment on the degradation rate of xenobiotic compounds was found
by others. The degradation rate of polychlorinated biphenyls by anaerobic enrich
ment cultures increased in the presence of sterile Rhine river sand (28) or sterile
Raritan river sediment (5). In further experiments these authors demonstrated that
replacement of the sediment by humic acids and a complex carbon and energy
source can support this dechlorination as well (4). We added sterile Rhine river
sediment standard to our medium to maintain active enrichment cultures. We did
not add the sediment during batch experiments, because the enrichments could be
used without any additions during 1 or 2 transfers.
The results from the batch experiments (Fig. 3) demonstrate that toluene was
oxidized to carbon dioxide and that manganese oxide was the ultimate electron
acceptor. The amount of C02 produced was less than expected, but this is because
76
Manganese reduction coupled to toluene oxidation
part of the toluene has been used for cell synthesis (biomass) and because inter
mediates or dead-end products were formed (48% of the transformed toluene). The
toluene consumption and the production of Mn(II) indicated that for each mol of
toluene oxidized, ca. 14 mol of manganese oxide was reduced to Mn(II). This is
less than expected, according the theoretical reaction 1, but this reaction does not
include the formation of biomass and the partial transformation of toluene.
C7H8 + 18 Mn02 + 18 H2C03 -» 7 C02 + 18 MnC03 + 22 H20 (reaction 1)
The poor availability of manganese oxide is severely rate limiting in the
toluene oxidation. The degradation rate was higher, when the enrichment culture
was in direct contact with the solid manganese oxide. This indicates that the
bacteria did not only use soluble manganese(IV) as electron acceptor, but also solid
manganese oxide. They may have the ability to attach to the solid oxide. This will
result in a direct and faster transfer of electrons. It has been proposed that manga
nese-reducing bacteria contain electron shuttles (Mn2+) in the cell envelope, that
transport the reducing power across the cell envelope/manganese oxide particle
interface (14). The necessity of contact was also demonstrated in studies with
Shewanella putrefaciens (formerly Alteromonas putrefaciens MR1). This bacterium
grew on agar plates only in the manganese oxide rich overlay and not in the other
agar layer. It was concluded, that for growth the bacterium requires physical
contact with the insoluble manganese oxide.
Increasing the solubility of Mn02 by the addition of organic ligands resulted
in an increased toluene degradation rate. Lovley and coworkers found a similar
effect with Fe(III) chelation. Toluene was more rapidly degraded in iron containing
sediments when NT A or EDTA was added (25), and benzene was more rapidly
degraded in iron-containing sediments when NTA, EDTA, humic acids or phos
phates were added (26).
Microbial degradation of toluene with solid manganese oxide as electron
acceptor is possible. Manganese is a widespread transition metal (about 5-10 times
less abundant than iron), and manganese reduction is energetically more favourable
than iron reduction. However, the degradation rate is low, due to the limited
availability and solubility of the electron acceptor. Our results may be helpful for
77
Chapter 4
further isolation studies of manganese- and iron-reducing bacteria which degrade
xenobiotic compounds. For bioremediation purposes, the use of a solid electron
acceptor like manganese or iron oxide that is not lost from the environmental
compartment may be promising. Following reduction, it can be reoxidized and
thereby returned to the sediments by precipitation, via which it can be reused as
electron acceptor. Since these manganese and iron cycles occur in many sediments,
manganese and iron oxide may be used numerous times.
ACKNOWLEDGEMENT
We thank Wendy D. Lukassen of the Department of Soil Science and Plant
Nutrition (WAU) for the AAS and ICP-AES measurements. This work was
supported by a grant from DSM Research, The Netherlands.
REFERENCES
1. Altenschmidt, U. and G. Fuchs. 1991. Anaerobic degradation of toluene in denitrifying Pseudomonas sp.: indication for toluene methylhydroxylation and benzoyl-CoA as central aromatic intermediate. Arch. Microbiol. 156: 152-158.
2. Beller, H. R., M. Reinhard and D. Grbic-Galic. 1992. Metabolie by-products of anaerobic toluene degradation by sulfate-reducing enrichment cultures. Appl. Environ. Microbiol. 58:3192-3195.
3. Beller, H. R., A. M. Spormann, P. K. Sharma, J. R. Cole and M. Reinhard. 1996. Isolation and characterization of a novel toluene-degrading, sulfate-reducing bacterium. Appl. Environ. Microbiol. 62:1188-1196.
4. Blake, C. K. and H. D. May. 1992. Anaerobic PCB-degradation in the absence of river sediment. In Abstracts 92"d Genera! Meeting ASM, American Society for Microbiology, Washington, DC.
5. Boyle, A. W., C. K. Blake, W. A. Price and H. D. May. 1993. Effects of polychlorinated biphenyl congener concentration and sediment supplementation on rates of methanogenesis and 2,3,6-trichlorobiphenyl dechlorination in an anaerobic enrichment. Appl. Environ. Microbiol. 59:3027-3031.
6. Burdige, D. J. 1983. The biogeochemistry of manganese redox reactions: rates and mechanisms. PhD-thesis Scripps Institute of Oceanography, University of Californie, San Diego.
7. Burdige, D. J., S. P. Dhakar and K. H. Nealson. 1992. Effects of manganese oxide mineralogy on microbial and chemical manganese reduction. Geomicrobiol. J. 10:27-48.
8. Burdige, D. J. and K. H. Nealson. 1985. Microbial manganese-reduction by enrichment cultures from coastal marine sediments. Appl. Environ. Microbiol. 50: 491-497.
78
Manganese reduction coupled to toluene oxidation
9. Burg, R. v. 1993. Toxicology update. J. Appl. Toxicol. 13:441-446. 10. Dolfing, J., J. Zeyer, P. Binder-Eicher and R. P. Schwarzenbauch. 1990. Isolation
and characterization of a bacterium that mineralizes toluene in the absence of molecular oxygen. Arch. Microbiol. 154:336-341.
11. Edwards, E. A. and D. Grbic-Galic. 1994. Anaerobic degradation of toluene and o-xylene by a methanogenic consortium. Appl. Environ. Microbiol. 60:313-322.
12. Edwards, E. A., L. E. Wills, M. Reinhard and D. Grbic-Galic. 1992. Anaerobic degradation of toluene and xylene by aquifer microorganisms under sulfate-reducing conditions. Appl. Environ. Microbiol. 58:794-800.
13. Ehrlich, H. L. 1990. Geomicrobiology. Marcel Dekker, Inc., New York. 14. Ehrlich, H. L. 1993. Electron transfer from acetate to the surface of Mn02 particles by a
marine bacterium. J. Ind. Microbiol. 12:121-128. 15. Evans, P. J., D. T. Mang, K. S. Kim and L. Y. Young. 1991. Anaerobic degradation
of toluene by a denitrifying bacterium. Appl. Environ. Microbiol. 57:1139-1145. 16. Gibson, D. T. 1984. Microbial Degradation of Aromatic Compounds. Marcel Dekker,
Inc., New York and Basel. 17. Grbic-Galic, D. and T. M. Vogel. 1987. Transformation of toluene and benzene by
mixed methanogenic cultures. Appl. Environ. Microbiol. 53:254-260. 18. Holliger, C , G. Schraa, A. J. M. Stams and A. J. B. Zehnder. 1993. A highly
purified enrichment culture couples the reductive dechlorination of tetrachloroethene to growth. Appl. Environ. Microbiol. 59:2991-2997.
19. Hutchins, S. R. 1991. Biodegradation of monoaromatic hydrocarbons by aquifer micro-organisms using oxygen, nitrate, or nitrous oxyde as the terminal electron acceptor. Appl. Environ. Microbiol. 57:2403-2407.
20. Kuhn, E. P., J. Zeyer, P. Eicherand and R. P. Schwarzenbach. 1988. Anaerobic degradation of alkylated benzenes in denitrifying laboratory aquifer columns. Appl. Environ. Microbiol. 54:490-496.
21. Langenhoff, A. A. M., A. J. B. Zehnder and G. Schraa. 1996. Behaviour of toluene, benzene and naphthalene under anaerobic conditions in sediment columns. Biodegradation 7:267-274.
22. Lovley, D. R. 1991. Dissimilatory Fe(III) and Mn(IV) reduction. Microbiol. Rev. 55:259-287.
23. Lovley, D. R. and D. J. Lonergan. 1990. Anaerobic oxidation of toluene, phenol and p-cresol by the dissimilatory iron-reducing organism, GS-15. Appl. Environ. Microbiol. 56:1858-1864.
24. Lovley, D. R. and E. J. P. Phillips. 1988. Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory reduction of iron or manganese. Appl. Environ. Microbiol. 54:1472-1480.
25. Lovley, D. R., J. C. Woodward and F. H. Chapelle. 1994. Stimulated anoxic biodégradation of aromatic hydrocarbons using Fe(III) ligands. Nature 370:128-131.
26. Lovley, D. R., J. C. Woodward and F. II. Chapelle. 1996. Rapid anaerobic benzene oxidation with a variety of chelated Fe(III) forms. Appl. Environ. Microbiol. 62:288-291.
27. Major, D. W., C. I. Mayfiel and J. F. Barker. 1988. Biotransformation of benzene by denitrification in aquifer sand. Groundwater 29:8-14.
28. Middeldorp, P. J. M., J. de Wolf, A. J. B. Zehnder and G. Schraa. 1996. Reduction of the lag phase for microbial reductive dechlorination of polychlorinated biphenyls. Environ. Sei. Technol. submitted.
79
Chapter 4
29. Myers, C. R., L. J. Alatalo and J. M. Myers. 1994. Microbial potential for the anaerobic degradation of simple aromatic compounds in sediments of the Milwaukee harbor, Green Bay and Lake Erie. Environ. Toxicol. Chem. 13:461-471.
30. Nealson, K. H. and C. R. Myers. 1992. Microbial reduction of manganese and iron -New approaches to carbon cycling. Appl. Environ. Microbiol. 58:439-443.
31. Nealson, K. H. and D. Saffarini. 1994. Iron and manganese in anaerobic respiration: environmental significance, physiology, and regulation. Ann. Rev. Microbiol. 48:311-343.
32. Rabus, R., R. Nordhaus, W. Ludwig and F. Widdel. 1993. Complete oxidation of toluene under strictly anoxic conditions by a new sulfate-reducing bacterium. Appl. Environ. Microbiol. 59:1444-1451.
33. Schocher, R. J., B. Seyfried, F. Vazquez and J. Zeyer. 1991. Anaerobic degradation of toluene by pure cultures of denitrifying bacteria. Arch. Microbiol. 157:7-12.
34. Smith, M. R. 1990. The biodégradation of aromatic hydrocarbons by bacteria. Biodegradation 1:191 -206.
35. Smith, M. R. 1994. The physiology of aromatic hydrocarbon degrading bacteria, p. 347-378. In C. Ratledge (ed.). Biochemistry of Microbial Degradation, Kluwer Academic Publishers, Dordrecht.
36. Vogel, T. M. and D. Grbic-Galic. 1986. Incorporation of oxygen from water into toluene and benzene during anaerobic fermentative transformation. Appl. Environ. Microbiol. 52:200-202.
37. Wilson, B. H., G. B. Smith and J. F. Rees. 1986. Biotransformations of selected alkylbenzenes and halogenated aliphatic hydrocarbons in methanogenic aquifer material: A microcosm study. Environ. Sei. Technol. 20:997-1002.
38. Zeyer, J., E. P. Kuhn and R. P. Schwarzenbach. 1986. Rapid microbial degradation of toluene and 1,3-dimethylbenzene in the absence of molecular oxygen. Appl. Environ. Microbiol. 52:944-947.
80
Chapter 5
Characterization of a Manganese-Reducing,
Toluene Degrading Enrichment Culture
Alette A.M. Langenhoff, Maria Briglia, Ivonne Nijenhuis,
Nico C G . Tan, Alexander J.B. Zehnder and Gosse Schraa
FEMS Microbiol. Ecol. (1997) submitted
81
Chapter 5
ABSTRACT
A bacterial culture (LET-13) was enriched, which uses toluene as sole
carbon and energy source, and manganese oxide as terminal electron acceptor. The
culture is able to degrade a variety of substituted monoaromatic compounds like (p-
hydroxy) benzylalcohol, (/7-hydroxy) benzaldehyde, (p-hydroxy) benzoate, phenol,
and the three isomers of cresol. Benzene, ethylbenzene, all xylenes and naphthalene
were not degraded under the experimental conditions used.
Based on the results of growth experiments and the detection of intermedi
ates, it is concluded that toluene is degraded via a methyl hydroxylation. A possible
side reaction can lead to the formation of cresol.
All organisms in the culture look similar; motile rods, which are gram nega
tive, oxidase negative and catalase negative. The culture was partly identified with
phylogenetic analysis of cloned rDNA sequences. The phylogenetic analysis
showed that at least two major groups of bacteria are present. One group of
bacteria belongs to the Bacteroides-Cytophaga group, and one group consists of
members of the ß-subclass of the Proteobacteria.
INTRODUCTION
Toluene is one of the non-oxygenated, monoaromatic compounds that are
present in petroleum (others are e.g. benzene, ethylbenzene and xylenes). Due to
leakages of petroleum storage tanks and spills at petroleum wells, these hydro
carbons contribute significantly to groundwater contamination. In anaerobic envi
ronments, they often seem to accumulate. Toluene is also known to be formed bio
logically (18) in anoxic freshwater sediments.
Most aromatic hydrocarbons are rapidly degraded under aerobic conditions;
oxygen is involved in activation and fission of the aromatic ring and is the terminal
electron acceptor. Information on the anaerobic microbial degradation of these
compounds is emerging in the literature only since the last decade. Recently, we
have published data about the bacterial degradation of toluene under manganese-
reducing conditions (32). Such a degradation has never been demonstrated before.
82
Characterization of a manganese-reducing culture
Several manganese-reducing bacteria have been described in literature, but none of
them can degrade aromatic compounds (33, 40). The manganese-reducing bacter
ium Shewanella putrefaciens MR-1 obtains energy for growth by using H2,
formate, or lactate as electron donor. The bacterium has been classified as a
member of the 7-subclass of the Proteobacteria (39). Geobacter metallireducens
degrades compounds like acetate, butyrate, propionate, and ethanol with amorphous
manganese oxide as electron acceptor. G. metallireducens can degrade toluene with
iron oxide as electron acceptor, but not with manganese oxide as electron acceptor
(unpublished results). G. metallireducens has been categorized in the ô-subclass of
the Proteobacteria, and is closely related to Desulfuromonas acetoxidans (34).
Toluene has been found anaerobically degradable under denitrifying (1, 2,
12, 15, 16, 21, 29, 31, 36, 46, 47, 52, 53), iron-reducing (35), sulfate-reducing
(5, 6, 14, 26, 41) and methanogenic conditions (13, 25, 50, 51). Various bacteria
have been isolated and parts of degradation routes have been elucidated. An
overview of the anaerobic toluene metabolism is given by Frazer et al. (19).
Studies on the formation of intermediates in denitrifying bacteria (2, 46, 47),
the sulfate-reducing bacterium Tol2 (41) and the iron-reducing bacterium Geobacter
metallireducens (formerly known as GS-15) (35), suggest that the degradation pro
ceeds through oxidation of the methyl group. Benzoyl-CoA is formed via benzyl-
alcohol, benzaldehyde and benzoate, upon which ring fission occurs. Another path
way has been found for the denitrifying strain Tl (15) and in a sulfate-reducing
enrichment culture (5). Toluene is first converted with acetyl-CoA to phenylpropio-
nyl-CoA, which is further degraded to benzoyl-CoA. About 15% of the toluene
would react with succinyl-CoA to form two dead-end products: benzylsuccinate and
benzylfumarate. The same dead-end products have been detected with the sulfate-
reducing bacterium strain PRTOL1 (6), but the main degradation pathway of
toluene has not been clarified. Recently, the degradation of toluene in the
denitrifying bacterium Thauera aromatica has been demonstrated to start with an
initial addition of fumarate to the methyl group of toluene, to yield benzylsuccinate
(9). A further degradation of benzylsuccinate to benzoyl-CoA is suggested to occur
via ß-oxidation. Alternate pathways via a ring hydroxylation to cresol or a car-
boxylation to toluate have also been discussed, but no experimental data exist to
support the occurrence of such a pathway (1, 35, 46). Small amounts of p-cresol
83
Chapter 5
have been detected in a methanogenic enrichment culture with toluene, in which
they seem to be formed via the oxidation of the aromatic ring (50). It was demon
strated that the hydroxyl group originated from water. However, the conversion of
toluene to /7-cresol is very slow, compared with the rapid breakdown of toluene in
this culture.
Here we report the physiological and phylogenetical characterization of an
anaerobic enrichment culture that mineralizes toluene in the presence of amorphous
manganese oxide as electron acceptor. The culture has been maintained with
toluene as sole carbon and energy source and with manganese oxide as electron
acceptor for more than two years. Data on the use of alternate electron acceptors,
the growth on possible intermediates and the identification of formed intermediates
are discussed in this paper.
MATERIALS AND METHODS
Chemicals. All aromatics were purchased from E. Merck, Darmstadt,
Germany and were of analytical grade. 13C-toluene was purchased from ISOTEC
Inc. (Miamisburg, Ohio, USA) and 99.3% was a-labelled.
Enrichment and cultivation. The enrichment culture had been obtained
from sediment columns in which toluene was transformed under manganese-
reducing conditions (32). Routine cultivations were carried out in 115-ml serum
bottles with 20 ml of anaerobic medium and amorphous manganese oxide (5Mn02)
as electron acceptor, as described by Langenhoff et al. (32). In addition, 2 mM of
nitrilotriacetic acid (NTA) was added to the medium to solubilize Mn(IV). Toluene
was added from a heat sterilized water-saturated solution (2 ml), to obtain a
medium concentration of 300 ^M (18 /xmol/bottle). Higher concentrations were not
used because of inhibitory effects. Toluene was re-added when depleted. We have
demonstrated in previous experiments that the addition of sterile Rhine river sedi
ment was necessary to maintain the activity of the culture (32). In further experi
ments, we found that a concentrated supernatant of the Rhine river sediment could
be used as well. The supernatant was prepared by shaking 40 g of sterile Rhine
river sediment and 40 ml of manganese-reducing medium anaerobically at 30°C
84
Characterization of a manganese-reducing culture
overnight. This was followed by centrifugation and filter sterilization (0.22 ^m
Durapore filter, Millipore, USA). 2 ml of this Rhine river sediment supernatant
was added standard to each of the batches. A gas phase of N2/C02 (80%/20%),
and a pressure of 1.3 bar were used. The bottles were incubated stationary in the
dark at 30°C.
Transfer of the enrichment cultures (10% [v/v]) to bottles containing fresh
medium was done after a total of approximately 100 /«nol of toluene had been
transformed. Transfers were normally made after 30 to 60 days, depending on the
rate of transformation.
Purification. The manganese-reducing, toluene degrading bacterial culture
was further attempted to purify using dilution series in liquid cultures and on solid
media. Anaerobic agar roll tubes (28) or anaerobic agar plates were made with
anaerobic medium with and without manganese oxide, 2% highly purified noble
agar (Difco, Detroit, USA), and 0.3 mM toluene as substrate. The tubes or plates
were inoculated with 0.1% (v/v) of the enrichment culture. The solidified agar in
roll tubes or plates without manganese oxide was covered with a second agar layer
in which amorphous manganese oxide was present. Both the tubes and the plates
with one or a double layer of agar were incubated at 30°C in an anaerobic
glovebox. The formation of clearing zones in the agar overlays (dark by the
presence of manganese oxide) were used as indication for growth of manganese-
reducing bacteria. This method has been described previously by Nealson (40),
who found that manganese-reducing bacteria do not form visible colonies on solid
media. Upon clearing of the agar, agar from the edges of these clearing zones was
transferred to anaerobic manganese-reducing liquid medium.
Effect of temperature and pH. The temperature optimum for toluene
degradation was determined in two-liquid-phase batches. A two-liquid-phase system
of medium and hexadecane was used because of the low water solubility of toluene.
Such a system creates a constant low toluene concentration in the medium and a
constant flux of toluene from the organic phase to the aquatic medium. To 115-ml
serum bottles with 20 ml of anaerobic manganese-reducing medium with NTA, 0.5
ml of hexadecane containing 0.2 M toluene was added. This resulted in a concen
tration in the liquid phase of 190 JUM toluene (32). The bottles were inoculated
with 10% [v/v] of the toluene degrading enrichment culture, and incubated at 4,
85
Chapter 5
10, 20, 25, 30, 37, 43, and 55°C stationary in the dark.
The effect of pH on the toluene degradation rate was tested in similar two-
liquid-phase batches. The pH was varied by applying different partial pressures of
C02 in the gas phase and varying the concentration of phosphate buffer (K2HP04
and NaH2P04.2H20). It was confirmed that the pH at the end of each experiment
was the same as the initial pH.
All experiments were performed in triplicate. Controls were made with 1
mM of sodium azide (an inhibitor of electron transport-linked respiration) and
0.175% of formaldehyde (a general inhibitor of biological activity). Both are
known to inhibit manganese-reducing bacteria (11).
Electron microscopy. For negative staining, cells were fixed in 3% (v/v)
glutaraldehyde and 2% (w/v) paraformaldehyde in 0.1 M of sodium phosphate
buffer pH 7.2. A formvar coated copper grid (150 mesh, 0 3 mm) was placed on
a drop of cell suspension for 15 min. After washing the grid three times with
distilled water, the grid was air-dried. After drying, the cells were contrasted with
uranyl acetate and examined with a Jeol EM 1200 ex II transmission electron
microscope.
Electron acceptor and donor utilization. Experiments were carried out in
115-ml serum bottles with 20 ml of anaerobic manganese-reducing medium with
NTA, which had been inoculated with 10% [v/v] of the toluene degrading enrich
ment culture. Thiosulfate (20 mM), fumarate (20 mM), nitrate (20 mM), and
oxygen were tested as electron acceptor with toluene in hexadecane (0.2 M) as
substrate. Controls with manganese oxide as an electron acceptor and without
electron acceptor were taken along as well.
Various possible intermediates in the degradation of toluene and different
monoaromatic compounds were tested for their degradability by the enrichment cul
ture. Compounds tested in one-liquid-phase batches were benzylalcohol, benzoate,
p-hydroxy-benzylalcohol, /»-hydroxy-benzaldehyde, /?-hydroxy-benzoate, o-, m- and
p-toluate, and phenol (all at 100 /xM). Toluene, benzaldehyde, o-, m- and p-cresol,
o-, m- and /»-xylene, benzene, ethylbenzene, styrene, and naphthalene were tested
in two-liquid-phase batches. A two-liquid-phase system was used because of the
low water solubility of these compounds. 0.5 ml of hexadecane containing 0.2 M
substrate was added. Controls were taken along to test for chemical interactions
86
Characterization of a manganese-reducing culture
between the aromatic substrates and manganese oxide. They were incubated under
similar conditions, but without inoculum added.
Intermediates in the degradation of toluene were measured in one-liquid-
phase batches. In time, liquid samples were taken and analyzed with HPLC and
GC-MS. Higher concentrations of intermediates were obtained by adding 1 mM
fluoro-acetate, an inhibitor of the tricarboxylic acid cycle. The inhibitor was added
after 50 iimol of toluene was degraded (46).
Determination of intermediates was also done with [13C]toluene. Cultures
that had degraded 50 /xmol of [12C]toluene in a one-liquid-phase system, were fed
[13C]toluene. The formation of labelled intermediates was followed by GC-MS.
All experiments were performed at least in triplicate.
Isolation of nucleic acids. Nucleic acids were extracted from cultures that
had degraded approximately 80 /xmol of toluene. A 10-ml medium sample was
centrifuged at 13,000 rpm for 20 minutes. The pellet was resuspended in 400 /tl of
autoclaved TE buffer (10 mM Tris/HCl, 1 mM EDTA, pH 8.0) and transferred to
a 1.5 ml Eppendorf tube. 200 /xl of Tris/HCl buffered phenol (pH 8.0) was added
together with 300 /xl of glass beads ( 0 0.11 mm). The cells were disrupted by
beat-beating during 5 min, using a cell homogenizer MSK (Braun, Melsungen,
Germany) under C02-cooling, and subsequently centrifuged (15 min at 13,000
rpm). Nucleic acids were extracted from the aqueous phase with a
phenol/chloroform/isoamylalcohol-mixture (25/24/1 [v/v/v]), and after
centrifugation (15 min at 13,000 rpm), the aqueous phase was extracted by chloro-
form/isoamylalcohol (24/1 [v/v]). After centrifugation (15 min at 13,000 rpm), the
nucleic acids were precipitated with 0.5 ml of isopropanol and 40 /xl of 3 M
sodium acetate (pH 5.2) at -70°C for 30 min. After centrifugation (15 min at
13,000 rpm), the nucleic acid pellet was washed with 70% ethanol, dried under
vacuum and resuspended in 100 /xl TE buffer. The quality of the extracts was ana
lyzed by agarose gel-electrophoresis, followed by ethidium bromide staining (44).
The DNA and rRNA extracts were used for dot blot hybridization, polymerase
chain reaction (PCR), cloning, and temperature gradient gel electrophoresis
(TGGE).
87
Chapter 5
Dot blot hybridization. The sequences for the used 16S rRNA oligo
nucleotide probes and their target organisms are listed in table 1. All oligonucleo
tides for dot blot hybridizations were synthesized by Pharmacia (Uppsala, Sweden)
and were 5' end labelled with [Y32P]ATP (3000 Ci/mmol, Amersham, Little
Chalfont, UK) (27).
Table 1. Summary of the oligonucleotide probes used in this study.
Probe EUB338 ARC915 BET42a
GAM42a
SRB385
Target group Bacteria Archaea ß-subclass of Proteobacteria 7-subclass of Proteobacteria sulfate-reducing bacteria
Sequence 5 '-GCTGCCTCCCGTAGGAGT-3 ' 5 '-GTGCTCCCCCGCCAATTCCT-3 '
5 ' -GCCTTCCCACTTCGTTT-3 '
5 '-GCCTTCCCACATCGTTT-3 '
5 '-CGGCGTCGCTGCGTCAGG-3 '
Ref (3)
(48)
(37)
(37)
(3)
Dot blot hybridizations were performed on Hybond N+ filters (Amersham).
Nucleic acid extracts of LET-13 were applied to the membrane with a Hybri.Dot
manifold (Gibco BRL, Life Science Technologies, Gaithersberg MD, USA) and
immobilized by UV light (4 min). Escherichia coli (y-Proteobacterium), Syn-
throphobacter wolinii (DSM 2805, sulfate-reducing bacterium) and Methanosaeta
soehngenii (DSM 2139, Archaeä) were used as positive controls. All membranes
were pretreated with 10 ml of hybridization buffer (0.5 mM phosphate buffer, 7%
sodium dodecyl sulfate (SDS), 1% bovine serum albumine, and 1 mM EDTA, pH
7.2) for 30 min. The probes were 5'-labelled with 32P by using [7-32P]ATP and
polynucleotide kinase. 1 ^1 (100 ng) of the probe was mixed with 2 ^1 of lOx
kinase buffer (44), 1 ^1 of T4 polynucleotide kinase (Gibco BRL), 1.5 yu.1 of [7-32P]ATP (3000 mCi/mmol, Amersham), and water to obtain a total volume of 20
nl. This mixture was incubated at 37°C for 30 min. The membranes were hybrid
ized overnight at a temperature of 46 °C and rinsed with 10 ml of 1 mM EDTA
and 5x SSC (0.15 M NaCl, 0.015 M sodium citrate, pH 7.0). Finally, the mem
branes were washed in 10 ml of 1% SDS, lx SSC at 48°C , sealed in polyethylene
foil, and exposed to a phosphor storage screen for 2 hours. The screen was
scanned for radioactive respons on a Phosphor Imager (Molecular Dynamics,
Characterization of a manganese-reducing culture
Sunnyvale, USA). The digital signals were processed by the manufacturers
software (ImageQuant).
PCR amplification, isolation, cloning and sequencing of the 16S rRNA gene. The 16S-targeted polymerase chain reaction (PCR) was used to amplify 16S
rRNA genes (1.5 kb fragments) of the bacteria present in the enrichment culture.
Two eubacterial universal primers were used: the forward primer corresponding to
Escherichia coli positions 8 to 27 (5' CACGGATCCAGAGTTTGATC/T(A/C)TG-
GCTCAG) and the reverse primer corresponding to E. coli positions 1493 to 1510
(5' GTGCTGCAGGGTTACCTTGTTACGACT). The PCR assay (100 jtl) con
tained amplification buffer (20 mM Tris/HCl pH 8.4, 50mM KCl), 3mM MgCl2,
200/«M each deoxynucleotide, 0.2 iM each primer, 2.5 U Taq DNA polymerase
(Life Technology) and 1 /xg template DNA. The PCR involved an initial
denaturation step of 4 min at 90°C, followed by 35 amplification cycles: 94°C for
45 s, 54°C for 45 s, and 68°C for 2 min. This was followed by a final 7 min
incubation at 68°C.
The isolation, cloning and sequence analyses manipulations were done by
using previously described procedures (44), with the following modifications. The
amplification products were isolated and purified by agarose gel electrophoresis,
excised from the gel and cleaned with glass milk (GlassMAX™, Gibco BRL). The
fragments were cloned in a pGEMT vector (Promega, Madison, WI, USA), and
plasmid preparation was done with the Wizard kit (Promega). The positive clones
were sequenced by using the dideoxy chain termination reaction (45), using an
automated DNA sequencer model 373A (Licon, USA). The resulting sequences
were compared with the 16S rRNA sequences available in literature and EMBL
data bank by using a Fasta program. The sequences of clones I, II and III were
deposited in the EMBL data bank.
Temperature gradient gel electrophoresis (TGGE). TGGE (Diagen TGGE
system, Diagen GmbH, Düsseldorf, Germany) was used to obtain a band profile of
the 16S rRNA fragments present in the DNA from the enrichment culture (17).
The 16S rRNA fragments of the V6-V8 regions (0.4 kb) originated from direct
amplification of the DNA extracted from the enrichment culture, and from the
whole 16S rRNA cloned fragments. The primers used were universal eubacterial
primers: the forward U968-GC primer (5' [GC-clamp] AACGCGAAGAACCT-
89
Chapter 5
TAC 3') and the reverse primer L1401 (5' CGGTGTGTACAAGACCC 3'). The
presence of the GC-clamp on one of the two primers is required to improve
separation of the bands in the gel (38). The PCR assay contained the reagents in
the same proportions as described before. PCR conditions were 25 cycles (94°C
for 20 s, 56°C for 20 s, and 68°C for 40 s). A volume of 6 /xl of the PCR prod
ucts was used for the TGGE run.
The TGGE consisted of Polyacrylamide gel (6% w/v acrylamide, 0.1% w/v
bis-acrylamide, 8M urea, 20% v/v formamide, 2% v/v glycerol) and lx TAE
buffer (17). A temperature range (37 °C to 46 °C) at a constant voltage (120 V) for
15h was chosen. After the electrophoresis, the band profile on the gel was visual
ized by silver staining the gel as follows: a) 3 min fixing in 10% ethanol and 0.5%
acetic acid; b) 10 min staining in 10% ethanol and 0.5% acetic acid and 0.2%
AgN03; c) 2 to 3 min washing in demineralized water; d) developing in 1.5%
NaOH, 0.1% formaldehyde and 0.01% NaBH4, till good visualization of the bands;
e) 5 min fixing in the same solution as in a); f) 5 min washing in demineralized
water; g) 7 min treatment in a preservation solution containing 25% ethanol and
10% glycerol; h) cover the gel with cellophane and drying overnight in the oven at
60°C.
Other methods. Gram staining, and oxidase and catalase reactivity tests
were performed by standard procedures (23).
Analytical procedures. Toluene, benzene, ethylbenzene, styrène, o-, m- and
p-xylene were measured gaschromatographically by headspace analysis (32).
Benzylalcohol, benzaldehyde, benzoate, o-, m- and p-cresol, phenol, p-
hydroxy-benzylalcohol, p-hydroxy-benzaldehyde, /»-hydroxy-benzoate, o-, m-, and
p-toluate, ethylbenzene, and naphthalene were measured by High Performance
Liquid Chromatograph. Liquid samples (0.5 ml) were taken by syringe, centrifuged
(13,000 rpm for 3 min) and analyzed on a HPLC (LKB, Bromma, Sweden).
Samples (20 itl) were injected by using an autosampler (Spectra System AS 1000)
onto two Chromspher C8 columns (Chrompack, Bergen op Zoom, The Nether
lands) connected in serie at roomtemperature. The mobile phase was 20%
acetonitrile and 80% 10 mM H2S04 at a flow rate of 0.6 ml/min. The eluted
compounds were identified and quantified with an UV detector (LKB 2158 Uvicord
SD, Bromma, Sweden) at 206 nm.
90
Characterization of a manganese-reducing culture
To identify and quantify aromatic intermediates by GC-MS, the samples
were extracted (1:1) overnight in chloroform. The chloroform extracts were
analyzed on a Hewlett-Packard 5890 series II gas Chromatograph (Hewlett Packard,
Amsterdam, The Netherlands) equipped with a mass selective detector (HP 5971A
series mass selector). The samples (1 /xl) were injected on a fused silica analytical
column (HP5, 30 m x 0.25 mm) with an autosampler (HP, series 7673A). Oven
temperature conditions for the separation were 40°C for 2 min, 10°C/min to
250°C, 250°C for 5 min. Data were acquired using either a full scan mode for
identification of metabolites, or a selected ion monitoring mode (SIM) for
quantification. The GC column did not allow the separation of /n-cresol from p-
cresol. Hence, when both compounds could be present, they were reported as
summed parameter (m+/?)-cresol.
RESULTS
Enrichment. A stable enrichment culture, capable of mineralizing toluene in
the presence of amorphous manganese oxide, was obtained via repeated dilution
and transfers in liquid media after two years of cultivation.
V
\
Fig. 1. Electron micrographs of culture LET-13; bars indicate 0.2 ^m and 2 /«n, respect
ively.
91
Chapter 5
The culture, which will further be referred to as LET-13, consists of gram
negative, motile rods, that are oxidase and catalase negative, and microscopically
identical. The rods are about 1 to 2 /an long, and possess several peritrichious
flagella (up to 6 jum in length), irregularly distributed around the cell (Fig. 1).
LET-13 grows optimally between 25 and 35°C (Fig. 2A), whereas at 4 and 55 °C
no growth was observed. The toluene degradation rate was maximal around pH 7.0
(Fig. 2B). No degradation of toluene was observed below pH 4.9 and above pH
8.8.
Fie. 2. temperature ( C) pH
Temperature (A) and pH (B) dependence of the toluene degradation rate of LET-
13 in two-liquid-phase incubations with amorphous manganese oxide as electron
acceptor.
Cultivation in agar roll tubes or on agar plates was not successful. Clearing
zones, indicating the presence of manganese-reducing bacteria, did develop in the
double-layer agar roll tubes and on the double-layer agar plates. However, no
degradation of toluene was observed, after transferring the clearing zones into
liquid medium, during 120 days of incubation.
Growth of LET-13 with alternate electron acceptors and donors. Nitrate
and oxygen were both found to support growth of LET-13 with toluene as
substrate. Transfer of these cultures into fresh medium with amorphous manganese
oxide as electron acceptor resulted again in toluene degradation and manganese
reduction. However, routine cultivation of LET-13 with nitrate or oxygen as
electron acceptor and toluene as substrate, resulted after several transfers in enrich-
92
Characterization of a manganese-reducing culture
ment cultures, which could no longer use manganese oxide as electron acceptor.
No degradation of toluene was observed with fumarate or thiosulfate as electron
acceptor during 150 days of incubation.
LET-13 is able to oxidize and grow on benzylalcohol, benzaldehyde,
benzoate, o-, m-, and p-cresol, phenol, p-hydroxy-benzylalcohol, p-hydroxy-
benzaldehyde, and p-hydroxy-benzoate in the presence of manganese oxide. All
cultures could be transferred successfully to fresh medium with the same aromatic
compound or with toluene as substrate. No growth occurred with o-, m-, and p-
xylene, o-, m-, and p-toluate, benzene, ethylbenzene, styrene and naphthalene. The
incubations with the cresols were performed with nitrate instead of manganese
oxide as electron acceptor, since the concentration of the cresols decreased rapidly
in our controls. This was due to an abiotic reaction of manganese oxide with the
cresols. All other tested compounds gave no chemical reaction with amorphous
manganese oxide.
Detection of intermediates. With the presence of the tricarboxylic acid
cycle inhibitor fluoro-acetate present in a manganese-reducing, toluene degrading
culture LET-13, 30% of the toluene could be recovered as benzoate and less than
1% as o-cresol.
After the addition of [13C]toluene to culture LET-13, small amounts of Re
labelled o-cresol (<1% of the added toluene) and 13C-labelled (m+p)-cresol (1 to
3% of the added toluene) could be detected.
CHfH CHO GOCH
benzylalcohol benzaldehyde benzoate
Fig. 3. Initial pathways in two proposed pathways for toluene metabolism in LET-13: an
oxidation of the methyl group (upper branch), and an oxidation of the aromatic
ring (lower branch) in the enrichment culture LET-13.
93
Chapter 5
Since a large fraction of the produced cresols reacted abiotically with
manganese oxide to undetectable products, we were unable to make a mass balance
of the degradation of toluene and the accumulation of intermediates. 30% of the
added toluene was transformed to benzoate, and in previous experiments (32) was
shown that approximately 50% of the added toluene was completely mineralized.
The initial steps in possible pathways for the toluene degradation in enrichment
culture LET-13 are given in figure 3.
Dot blot hybridization of the enrichment. 16S rRNA isolated from LET-
13 hybridized with a universal eubacterial probe (EUB338) and probes specifically
for members of the ß-subclass (BET42a) and the 7-subclass (GAM42a) of the
Proteobacteria (Fig. 4). No hybridization signal was found with the universal
archaeal probe (ARC915) and the sulfate-reducing bacterial probe (SRB385). The
16S rRNA of the microorganisms that were used as positive controls gave hybri
dization signals as expected. Only Escherichia coli gave also a weak signal with
BET42a.
ARC915 EUB338 BET42a OAM42a SRB385
Fig. 4. Dot blot hybridization of 5 identical filters containing nucleic acids of 5 bacterial
cultures. 1 /ig of 16S rRNA extract from the following bacteria was bound to the
filter; 1: LET-13 grown with toluene as substrate and manganese oxide as electron
acceptor, 2: Escherichia coli, 3: Synthrophobacter wolinii, 4: Methanosaeta
soehngenii.
DNA molecular analysis (TGGE, cloning, sequence analysis). The TGGE
profile of the variable regions V6-V8 of LET-13 consisted of two strong bands (A
and B) with a large difference in retention time and several weak bands in the
proximity of these two bands (Fig. 5, line 1). PCR products from the clones I, II
and III (Fig. 5, lines 2-3-4) gave bands with equal positions in the TGGE profile of
94
Characterization of a manganese-reducing culture
LET-13 (Fig. 5, band A, B, and Al). TGGE analyses of the 16S rRNA fragments
corresponding to the variable regions VI-V3 and V4-V6 resulted in a TGGE pro
file with bands at comparable retention times as A, Al and B (data not shown).
A,
Fig. 5. Silver stained TGGE profile of product originating from V6-V8 regions 16S rRNA
genes extracted from LET-13; 1: LET-13, 2: clone I, 3: clone II, 4: clone III. The
strong bands are indicated as A and B, respectively, and a weak band as A,.
The 16S rRNA gene sequence analysis was confined to the Eubacterial
domain. The Archaeal domain was not analyzed since hybridization of the DNA
with the archaebacterial probe did not reveal the presence of Archaea in LET-13.
Nucleic acid sequence of 740 bp of clone I was determined. It comprised the
variable regions V1-V4 and a long stretch of conserved region. From the compari
son analysis, it belongs to the Bacteroides/Cytophaga branch group with homology
levels between 70% to 80% with Cytophaga and Bacteroides genera. The nucleic
acid sequence of two stretches of clone II, 550 bp comprising V3-V6 regions, and
500 bp comprising V7-V9 regions, were determined. The results from the compari
son analysis of both stretches indicate members of the ß-subclass of the Proteobac-
teria. The highest homology (91%) was found with the genus Azoarcus. Two
stretches (VI-V4 and V7-V9) of clone III that corresponded to a weak band A!
close to the band A, showed homology values between 80 and 85% with Cyto
phaga and Bacteroides genera. Moreover, clones I and III showed a homology of
more than 95 %.
95
Chapter 5
DISCUSSION
The newly enriched culture LET-13 is the first anaerobic bacterial enrich
ment culture that is able to couple the mineralization of toluene to the reduction of
manganese oxide. We have demonstrated in earlier experiments (32) that the low
degradation rate of toluene was mainly due to the use of the hardly soluble manga
nese oxide as electron acceptor (Mn02). This rate could only be increased slightly
by the addition of organic ligands. Routine transfers were done after 30 to 60 days
of incubation, when approximately 100 /umol of toluene had been degraded. A
culture was obtained that consisted only of short, motile, rod shaped bacteria. As
all attempts to isolate a pure culture failed, we decided to proceed with a further
characterization of the enriched culture LET-13, which stayed stable for more than
two years.
Except for manganese (IV), enrichment culture LET-13 was also able to use
nitrate and oxygen as electron acceptor. The degradation rate of toluene with these
alternate electron acceptors was much higher than when manganese oxide was
used. The redox potential of these electron acceptors is in the same range as
Mn(IV), but nitrate and oxygen are more soluble and have a higher availability
than Mn(IV). Thiosulfate and fumarate were not used as electron acceptors.
We have routinely tested cultivations of LET-13 on benzoate. Since benzoate
was degraded faster than toluene, a faster growth of the bacteria would be the
result. However, after cultivating four generations with benzoate, the bacteria had
lost their toluene degrading activity completely.
The ability of LET-13 to degrade specific monoaromatic hydrocarbons, and
the detection of large amounts of benzoate and minor amounts of o- and {m+p)-
cresol as intermediates in the degradation of toluene, suggest the presence of at
least two pathways. A major part of the toluene was degraded to benzoate, most
probably via a methyl oxidation to benzylalcohol and benzaldehyde. We were not
able to detect these compounds as intermediates, but both functioned as growth
substrate. In a denitrifying, toluene degrading Pseudomonas strain, both compounds
were found to be intracellular products (2). The oxidation of toluene via benzyl-
alcohol and benzaldehyde has also been demonstrated in several other denitrifying
strains (8, 20, 46, 47). Furthermore, benzylalcohol dehydrogenase and benzoyl-
96
Characterization of a manganese-reducing culture
CoA reductase have been purified from cell extracts of Thauera aromatica grown
on toluene (7, 10). No information is available in the literature about the first
enzyme that converts toluene into benzylalcohol, toluene methyl hydroxylase (1,
22). LET-13 is able to grow on o-, m- and p-cresol with nitrate as electron
acceptor. The transformation of p-cresol has also been demonstrated before in a
methanogenic enrichment culture (24), but could not be detected in a denitrifying
and in a sulfate-reducing toluene degrading bacterium (1, 41). With toluene and
manganese oxide, small amounts of o-cresol and (/n+p)-cresol were found in the
culture LET-13. No quantitative estimates could be made, since the cresols under
went a fast abiotic reaction with manganese oxide. The formation of polymeric
oxidation products is the most logical result of the abiotic reaction of the cresols
and manganese oxide (49).
The proposed pathways for toluene degradation by LET-13 as given in
figure 3 have also been postulated by Lovley et al. (35) to occur in G. metalli-
reducens, with iron as electron acceptor.
Two other pathways have been suggested. Toluene can be mineralized by an
oxidative addition of acetyl-CoA to the methyl group of toluene, followed by ß-
oxidation of the formed phenylpropionyl-CoA (5, 15). The addition of fumarate to
the methyl group to form benzylsuccinate and benzoyl-CoA was demonstrated in
the denitrifying bacterium T. auromatica (9). Since benzoate and cresol are no
intermediates in these pathways, it is unlikely that these routes are significant
pathways in LET-13.
Analyses of rRNA of LET-13 indicated the absence of methanogens and the
presence of members of the ß- and 7-subclasses of the Proteobacteria. The high
homology of the probes for the ß- and 7-subclasses of the Proteobacteria makes it
with the used dot blot hybridizations difficult to distinguish between these two
groups of bacteria. It has been shown in other studies that E. coli and other
members of the 7-subclass of the Proteobacteria, gave a weak hybridization signal
with BET42a while members of the ß-subclass can hybridize with GAM42a as well
(37).
Sequence analyses of cloned rDNA of the enrichment culture resulted in at
least 3 different sequences. Clone I and III are closely related (>95 % homology)
and may be two copies of rDNA in the same bacterium. It is known that 16S
97
Chapter 5
rRNA genes can differ in the same bacterium (30). In addition, sequence analyses
showed that LET-13 contains two major bacterial types. One can be ascribed to the
group of Bacteroides-Cytophaga and the other to the ß-subclass of the Proteo-
bacteria (e.g. Azoarcus). Both Bacteroides-Cytophaga and Azoarcus can grow
anaerobically, are motile rods and may possess flagella (4, 42). Azoarcus strains
used to be characterized as strictly aerobic, but recently, anaerobic denitrifying,
toluene degrading bacteria have been described as members of Azoarcus sp. (53).
Since the level of homology of the two major groups of bacteria in LET-13 with
known sequences for Bacteroides-Cytophaga and Azoarcus is less than 95%, it is
likely that both bacteria in LET-13 belong to unknown genera. In fact, 95% is
considered to be the homology value for attribution at the genus level (43). We
could not clarify which type of bacterium is dominant in LET-13, nor which one is
involved in the reduction of manganese oxide.
Several manganese-reducing bacteria have been described, but they are not
closely related to the ones in LET-13. The manganese-reducing bacteria Shewanella
putrefaciens and Geobacter metallireducens were classified as members of the y-
subclass and the ô-subclass of the Proteobacteria, respectively (34, 39). The latter
was found to be closely related to Desulfuromonas acetoxidans.
We have demonstrated that LET-13 consists of two major groups of
bacteria. The bacteria are related to Bacteroides-Cytophaga types and members of
the ß-subclass of the Proteobacteria, but it is more likely that they belong to yet
unknown genera. Whether each group of these bacteria in LET-13 performs one
degradation pathway of toluene, or possesses the enzymes to perform both path
ways is not known yet. Furthermore, it is possible that both groups of bacteria per
form the mineralization of toluene in a syntrophic association.
ACKNOWLEDGEMENT
We like to thank Francis Koene-Cottaar for the electron micrographs,
Antoon D.L. Akkermans and Wilma M. Akkermans-van Vliet for their help with
the molecular analyses and Tim Grotenhuis of the Department of Environmental
Sciene and Technology for providing 13C-toluene.
98
Characterization of a manganese-reducing culture
This work was supported by a grant from DSM Research, The Netherlands
and by a fellowship to Maria Briglia from Wageningen Agricultural University,
The Netherlands.
REFERENCES
1. Altenschmidt, U. and G. Fuchs. 1991. Anaerobic degradation of toluene in denitrifying Pseudomonas sp.: indication for toluene methylhydroxylation and benzoyl-CoA as central aromatic intermediate. Arch. Microbiol. 156:152-158.
2. Altenschmidt, U. and G. Fuchs. 1992. Anaerobic toluene oxidation to benzyl alcohol and benzaldehyde in a denitrifying Pseudomonas strain. J. Bacteriol. 174:4860-4862.
3. Amann, R. I., J. Stromley, R. Devereux, R. Key and D. A. Stahl. 1992. Molecular and microscopic identification of sulfate-reducing bacteria in multispecies biofilms. Appl. Environ. Microbiol. 58:614-623.
4. Balows, A., H. G. Truper, M. Dworkin, W. Harder and K. H. Schleifer. 1991. The Prokaryotes, 2'"1 ed. Springer-Verlag, New York.
5. Beller, H. R., M. Reinhard and D. Grbic-Galic. 1992. Metabolie by-products of anaerobic toluene degradation by sulfate-reducing enrichment cultures. Appl. Environ. Microbiol. 58:3192-3195.
6. Beller, H. R., A. M. Spormann, P. K. Sharma, J. R. Cole and M. Reinhard. 1996. Isolation and characterization of a novel toluene-degrading, sulfate-reducing bacterium. Appl. Environ. Microbiol. 62:1188-1196.
7. Biegert, T., U. Altenschmidt, C. Ek;kerskorn and G. Fuchs. 1995. Purification and properties of benzyl alcohol dehydrogenase from a denitrifying Thauera sp. Arch. Microbiol. 163:418-423.
8. Biegert, T. and G. Fuchs. 1995. Anaerobic oxidation of toluene (analogues) to benzoate (analogues) by whole cells and by cell extracts of a denitrifying Thauera sp. Arch. Microbiol. 163:407-417.
9. Biegert, T., G. Fuchs and F. Heider. 1996. Evidence that anaerobic oxidation of toluene in the denitrifying bacterium Thauera aromatica is initiated by formation of benzyl-succinate from toluene and fumarate. Eur. J. Biochem. 238:661-668.
10. Boll, M. and G. Fuchs. 1995. Benzoyl-Coenzyme A reductase (dearomatizing), a key enzyme of anaerobic aromatic metabolism - ATP dependence of the reaction, purification and some properties of the enzyme from Thauera aromatica strain K172. Eur. J. Biochem. 234:921-933.
11. Burdige, D. J., S. P. Dhakar and K. H. Nealson. 1992. Effects of manganese oxide mineralogy on microbial and chemical manganese reduction. Geomicrobiol. J. 10:27-48.
12. Dolfing, J., J. Zeyer, P. Binder-Eicher and R. P. Schwarzenbauch. 1990. Isolation and characterization of a bacterium that mineralizes toluene in the absence of molecular oxygen. Arch. Microbiol. 154:336-341.
13. Edwards, E. A. and D. Grbic-Galic. 1994. Anaerobic degradation of toluene and o-xylene by a methanogenic consortium. Appl. Environ. Microbiol. 60:313-322.
14. Edwards, E. A., L. E. Wills, M. Reinhard and D. Grbic-Galic. 1992. Anaerobic degradation of toluene and xylene by aquifer microorganisms under sulfate-reducing conditions. Appl. Environ. Microbiol. 58:794-800.
99
Chapter 5
15. Evans, P. J., W. Ling, B. Goldschmidt, E. R. Ritter and L. Y. Young. 1992 Metabolites formed during anaerobic transformation of toluene and ortho-xy\ene and their proposed relationship to the initial steps of toluene mineralization. Appl. Environ. Microbiol. 58:496-501.
16. Evans, P. J., D. T. Mang and L. Y. Young. 1991. Degradation of toluene and «-xylene and transformation of o-xylene by denitrifying enrichment cultures. Appl. Environ. Microbiol. 57:450-454.
17. Felske, A., B. Engelen, U. Nubel, H. Backhaus. 1996. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis. Appl. Environ. Microbiol. 62:4162-4167.
18. Fischer-Romero, C , B. J. Tindall and F. Jiittner. 1996. Tolumonas auensis gen.nov., sp. nov., a toluene-producing bacterium from anoxic sediments of a freshwater lake. Int. J. Syst. Bacteriol. 46:183-188.
19. Frazer, A. C , P. W. Coschigano and L. Y. Young. 1995. Toluene metabolism under anaerobic conditions: a review. Anaerobe 1:293-303.
20. Frazer, A. C , W. Ling and L. Y. Young. 1993. Substrate induction and metabolite accumulation during anaerobic toluene utilization by the denitrifying strain-Tl. Appl. Environ. Microbiol. 59:3157-3160.
21. Fries, M. R., J. H. Zhou, J. Cheesanford and J. M. Tiedje. 1994. Isolation, characterization, and distribution of denitrifying toluene degraders from a variety of habitats. Appl. Environ. Microbiol. 60:2802-2810.
22. Fuchs, G., M. E. S. Mohamed, U. Altenschmidt, J. Koch, A. Lack, R. Brackmann, C. Lochmeyer and B. Oswald. 1994. Biochemistry of anaerobic degradation of aromatic compounds, p. 513-553. In C. Ratledge (ed.), Biochemistry of Microbial Degradation, Kluwer Academic Publishers, Dordrecht.
23. Gerhardt, P., R. G. E. Murray, R. N. Costilow, E. W. Nester, W. A. Wood, N. R. Krieg and G. B. Philips. 1981. Manual of Methods for General Microbiology, American Society of Microbiology, Washington, DC.
24. Grbic-Galic, D. 1986. Anaerobic production and transformation of aromatic hydrocarbons and substituted phenols by ferulic acid-degrading BESA-inhibited methanogenic consortia. FEMS Microbiol. Ecol. 38:161-169.
25. Grbic-Galic, D. and T. M. Vogel. 1987. Transformation of toluene and benzene by mixed methanogenic cultures. Appl. Environ. Microbiol. 53:254-260.
26. Haag, F., M. Reinhard and P. L. McCarty. 1991. Degradation of toluene and p-xylene in anaerobic microcosms: Evidence for sulfate as terminal electron acceptor. Environ. Tox. Chem. 10:1379-1389.
27. Harmsen, H. J. M., H. M. P. Kengen, A. D. L. Akkermans and A. J. M. Stains. 1995. Phylogenetic analysis of two syntrophic propionate-oxidizing bacteria in enrichment cultures. System. Appl. Microbiol. 18:67-73.
28. Hungate, R. E. 1969. A roll tube method for cultivation of strict anaerobes, p. 117-132. In J. R. Norris and D. W. Ribbons (eds.), Methods in Microbiology, Academic press, New York.
29. Hutchins, S. R. 1991. Optimizing BTEX biodégradation under denitrifying conditions. Environ. Sei. Technol. 10:1437-1448.
30. Kirschner P. and E. C. Böttger. 1992. Letter to the editor: Microheterogeneity within rRNA of Mycobacterium gordonae. J. Clin. Microbiol. 30:1049-1050.
31. Kuhn, E. P., J. Zeyer, P. Eicherand and R. P. Schwarzenbach. 1988. Anaerobic degradation of alkylated benzenes in denitrifying laboratory aquifer columns. Appl. Environ. Microbiol. 54:490-496.
100
Characterization of a manganese-reducing culture
32. Langenhoff, A. A. M., D. L. Brouwers-Ceiler, J. H. L. Engelberting, J. J. Quist, J. G. P. M. Wolkenfelt, A. J. B. Zehnder and G. Schraa. 1997. Microbial reduction of manganese coupled to toluene oxidation. FEMS Microbiol. Ecol. 22:119-127.
33. Lovley, D. R. 1991. Dissimilatory Fe(III) and Mn(IV) reduction. Microbiol. Rev. 55:259-287.
34. Lovley, D. R., S. J. Giovannoni, D. C. White, J. E. Champine, E. Phillips, Y. A. Gorby and S. Goodwin. 1993. Geobacter-metallireducens gen. nov. sp. nov., a microorganism capable of coupling the complete oxidation of organic compounds to the reduction of iron and other metals. Arch. Microbiol. 159:336-344.
35. Lovley, D. R. and D. J. Lonergan. 1990. Anaerobic oxidation of toluene, phenol and p-cresol by the dissimilatory iron-reducing organism, GS-15. Appl. Environ. Microbiol. 56:1858-1864.
36. Major, D. W., C. I. Mayfiel and J. F. Barker. 1988. Biotransformation of benzene by denitrification in aquifer sand. Groundwater 29:8-14.
37. Manz, W., R. Amann, W. Ludwig, M. Wagner and K. H. Schleifer. 1992. Phylogenese oligodeoxynucleotide probes for the major subclasses of proteobacteria: Problems and solutions. System. Appl. Microbiol. 15:593-600.
38. Muyzer, G., E. C. de Waal and A. G. Uitterlinden. 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes encoding for 16S rRNA. Appl. Environ. Microbiol. 59:695-700.
39. Myers, C. R. and K. H. Nealson. 1988. Bacterial manganese reduction and growth with manganese oxide as the sole electron acceptor. Science 240:1319-1321.
40. Nealson, K. H. and C. R. Myers. 1992. Microbial reduction of manganese and iron -New approaches to carbon cycling. Appl. Environ. Microbiol. 58:439-443.
41. Rabus, R., R. Nordhaus, W. Ludwig and F. Widdel. 1993. Complete oxidation of toluene under strictly anoxic conditions by a new sulfate-reducing bacterium. Appl. Environ. Microbiol. 59:1444-1451.
42. Reinhold-Hurek, B., T. Hurek, M. Gellis, B. Hoste, M. Vancanneyt, K. Kersters and J. de Ley. 1993. Azoarcus gen.nov., nitrogen-fixing Proteobacteria associated with roots of Kallar grass (Leptochloa fusca (L.) Kunth), and description of two species, Azoarcus indigens sp.nov. and Azoarcus communis sp.nov. Int. J. Syst. Bacteriol. 43:574-584.
43. Rogall T., J. Walters, T. Flohr and E. C. Böttger. 1990. Towards a phylogeny and definition of species at the molecular level within the genus Mycobacterium. Int. J. Syst. Bacteriol. 40:323-330.
44. Sambrook, J., E. F. Fritsch and T. Maniatis. 1989. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.
45. Sanger, F., S. Nicklen and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sei. USA 74:5463-5467.
46. Schocher, R. J., B. Seyfried, F. Vazquez and J. Zeyer. 1991. Anaerobic degradation of toluene by pure cultures of denitrifying bacteria. Arch. Microbiol. 157:7-12.
47. Seyfried, B., G. Glod, R. Schocher, A. Tschech and J. Zeyer. 1994. Initial reactions in the anaerobic oxidation of toluene and m-xylene by denitrifying bacteria. Appl. Environ. Microbiol. 60:4047-4052.
48. Stahl, D. A. and R. I. Amann. 1991. Development and application of nucleic acid probes., p. 205-248. In E. Stackebrandt and M. Goodfellow (eds.), Nucleic Acid Techniques in Bacterial Systematics. John Wiley & Sons, Inc., New York.
101
Chapter 5
49. Stone, A. T. and J. J. Morgan. 1984. Reduction and dissolution of manganese(III) and manganese(IV) oxides by organics: 2. survey of the activity of organics. Environ. Sei. Technol. 18:617-624.
50. Vogel, T. M. and D. Grbic-Galic. 1986. Incorporation of oxygen from water into toluene and benzene during anaerobic fermentative transformation. Appl. Environ. Microbiol. 52:200-202.
51. Wilson, B. H., G. B. Smith and J. F. Rees. 1986. Biotransformations of selected alkylbenzenes and halogenated aliphatic hydrocarbons in methanogenic aquifer material: A microcosm study. Environ. Sei. Technol. 20:997-1002.
52. Zeyer, J., E. P. Kuhn and R. P. Schwarzenbach. 1986. Rapid microbial degradation of toluene and 1,3-dimethylbenzene in the absence of molecular oxygen. Appl. Environ. Microbiol. 52:944-947.
53. Zhou, J. Z., M. R. Fries, J. C. Cheesanford and J. M. Tiedje. 1995. Phylogenetic analyses of a new group of denitrifiers capable of anaerobic growth on toluene and description of Azoarcus tolulyticus sp. nov. Int. J. Syst. Bacteriol. 45:500-506.
102
Chapter 6
General Discussion
103
Chapter 6
In the last decades, a growing awareness of the health risks caused by the
presence of toxic compounds in the environment has initiated the development of
clean-up technologies. A number of technologies is in use for cleaning up contami
nated soils, such as excavation followed by safe disposal or combustion. These
conventional soil clean-up technologies require the replacement of the soil, disrupt
the landscape, are costly (in the case of disposal) and may transfer contaminants to
the air (in the case of combustion). For groundwater clean-up, pump-and-treat
systems are used that withdraw large volumes of water to flush the contaminants
from the aquifer solids. This technology is often inefficient and slow, and also
incapable of restoring a good groundwater quality in a reasonable time. The
hazards of these soil clean-up methods (e.g. transfer of contaminants to the air) and
the limitations of groundwater clean-up methods have led to the development of
bioremediation technologies.
Bioremediation is defined as a remedial measure that uses microorganisms to
mineralize or immobilize hazardous contaminants or to transform them to less
harmful compounds. Bioremediation can be divided into in situ bioremediation, in
which the contaminated soil is treated in place, and ex situ bioremediation, in
which the soil is excavated and treated either in an actively aerated bed (land-
farming) or in a slurry-phase bioreactor. The advantage of an in situ process is that
the contaminated soil does not need to be moved, and essentially remains undis
turbed during treatment. This may make in situ bioremediation cheaper and safer
than ex situ bioremediation.
In this chapter, principles of aerobic and anaerobic in situ bioremediation are
given. The anaerobic in situ bioremediation of aromatic hydrocarbon-contaminated
sites is emphasized and some prerequisites, limitations and drawbacks are dis
cussed. Finally, control and evaluation of in situ bioremediation projects are
discussed.
104
General discussion
In situ bioremediation
Whether in situ bioremediation is an appropriate clean-up technique for a
contaminated site depends on various factors. The presence of microorganisms,
capable of degrading the pollutant, must be demonstrated either in field experi
ments or in laboratory tests with site-specific samples. In the absence of suitable
microorganisms, microorganisms can be selected that are able to degrade the
contaminants and these microorganisms can then be inoculated in the contaminated
soil (43). The type of contaminant is important, e.g. low chlorinated and non-
chlorinated aromatic compounds and alkanes are known to be aerobically well
degradable. Much less is known about the degradation of the higher chlorinated
compounds and homocyclic aromatics under anaerobic conditions. Knowledge of
the degradation pathway in microorganisms gives insight whether a compound is
mineralized or transformed into harmless compounds, or that a more toxic com
pound is formed. Environmental characteristics of a site affect bioremediation as
well. A sufficient permeability of the soil is needed to transmit fluids, and a uni
formity of the subsurface is important to predict chemical transport and fate of the
contaminant, and to characterize the site (29). The site needs to have a steady
groundwater flow, so the contaminant reaches the microorganisms in the
subsurface. Additionally, the microorganisms require essential nutrients and elec
tron acceptors/donors for growth; these may or may not be sufficiently present in
the soil.
In situ bioremediation at a contaminated site can occur naturally when the
site contains all the necessary microorganisms, nutrients and electron
acceptors/donors. This selfpurification capacity is called intrinsic (in situ) bio
remediation. In contrast, engineered in situ bioremediation can be used at sites
where the selfpurification capacity is lacking or small. Environmental conditions
are then manipulated to create better conditions for biodégradation. The activity of
the microorganisms is increased by the addition of limiting nutrients and electron
acceptors. The addition of oxygen is widely applied, because most aromatic
contaminants are degraded by aerobic microorganisms. Another possibility is to
stimulate the use of naturally occurring electron acceptors, such as metal oxides.
The bioavailability of metal oxides in soil is often low but can be increased via the
105
Chapter 6
addition of chelating agents (25). Finally, hydrophobic compounds such as PAHs
are poorly soluble and adsorb strongly to soil particles. This low bioavailability
results in a slow transformation of the contaminants in the soil. Increasing the bio
availability of PAHs by the addition of surfactants resulted in a faster transform
ation in laboratory experiments (44). However, knowledge and experience for a
successful application of surfactants in the field, is still insufficient.
An engineered in situ bioremediation accelerates biodégradation rates in
comparison to an intrinsic in situ bioremediation. This then requires less time for
clean-up of a contaminated site. The shorter time to control and monitor the site,
may then reduce costs of bioremediation. Consequently, intrinsic in situ bio
remediation is a favourable option at those sites where biodégradation takes place
naturally and the clean-up time is less important.
Aerobic in situ bioremediation
Engineered in situ bioremediation at sites contaminated with aromatic
hydrocarbons is often based on the supply of oxygen, since most aromatic hydro
carbons can be degraded by aerobic microorganisms. Air, pure oxygen, or
hydrogen peroxide are injected into the soil, or oxygenated water is pumped to the
soil. The injection of air may be the simplest technique, but the injection of pure
oxygen or H202 increases the amount of dissolved oxygen that is added to the soil
from 8 mg/1 to 40 mg/1 and 100 mg/1, respectively (3). These higher concentrations
of oxygen may reduce the time period needed for bioremediation and decrease the
bioremediation costs, because less pumping is required. However, the supply of
pure oxygen can cause problems due to its potential explosion hazard, and is there
fore not widely used (3). Hydrogen peroxide is not hazardous, as it is rapidly
transformed into 02 and H20 by microorganisms or by naturally occurring inor
ganic compounds, e.g. iron oxides (30). H202 is a highly reactive compound and
its rapid decomposition can result in the production of oxygen above water
saturation. Consequently, oxygen will form bubbles and these bubbles decrease the
permeability of the soil (38). Small scale experiments have to clarify whether the
addition of H202 is feasible for a specific site. The success of H202 addition for the
106
General discussion
bioremediation of aromatic hydrocarbons has been demonstrated in several field
experiments (4, 19, 30).
The first aerobic in situ bioremediation of a site contaminated with aromatic
hydrocarbons was done at an oil pipeline spill in Pennsylvania in 1972 (29). Since
then, in situ bioremediation has become an accepted technology for the clean-up of
soils, contaminated with easily degradable petroleum products (27, 31, 36, 45). A
recent, successful large scale in situ bioremediation has been demonstrated at the
Exxon Valdez oil spill in Alaska in 1989 (31).
Sites contaminated with the gasoline compounds benzene, toluene, ethyl-
benzene, and xylenes (BTEX) are relatively easy to bioremediate under aerobic
conditions. These compounds have a relatively high solubility in water compared to
many other contaminants, and they can serve as carbon and energy source for
many different aerobic bacteria. Higher molecular weight compounds, such as
polycyclic aromatic hydrocarbons (PAHs), are much slower metabolized by
bacteria. This is partly due to their complex structure, low solubility, and strong
adsorption to soil. The use of white-rot fungi that degrade PAHs with extracellular
enzymes (such as lignin peroxidase and manganese peroxidase) may then be a valu
able alternative (40). These fungi need a primary growth substrate, such as
cellulose or glucose, for the co-oxidation of aromatic hydrocarbons. The products
of the co-oxidation are not further transformed by the fungi, and other microorgan
isms need to be present for a complete degradation of the contaminant. Thus, a
mixed microbial population is required to remediate PAH-contaminated sites (40).
So far, current aerobic in situ bioremediation techniques are considered
ineffective for the removal of most PAHs from contaminated soil within a reason
able time period (48), due to the low bioavailability of the PAHs. More success to
degrade PAHs with less than four aromatic rings has been achieved with ex situ
methods such as land farming (48) or the use of bioreactors (22, 37). Bioreactors
are expensive but effective, because optimal conditions are easier to maintain and a
good mixing of soil, microorganisms, nutrients and electron acceptor is possible.
The application of this method has not yet been studied extensively, and further
research is needed to optimize its efficiency and to learn more about the economics
of the process.
107
Chapter 6
Anaerobic in situ bioremediation
The use of engineered anaerobic in situ bioremediation at sites contaminated
with aromatic compounds is limited compared to aerobic in situ bioremediation.
The limited use of anaerobic bioremediation is partly due to our lack of knowledge
of the transformations of these compounds by anaerobic bacteria. Only in recent
years has it become clear that anaerobic bacteria degrade aromatic hydrocarbons
and that anaerobic transformations take place at contaminated sites (intrinsic
bioremediation). The stimulation of these transformations has not yet been studied
extensively and guidelines how to operate engineered anaerobic in situ bioremediat
ion do not yet exist. The use of anaerobic in situ bioremediation processes is
advantageous because the often difficult and costly supply of oxygen is not needed.
Alternative electron acceptors, such as carbon dioxide, sulfate, iron, manganese, or
nitrate have to be present at a contaminated site. Such extra additions might be
more economical than the supply of oxygen (48). Based on results from the
research described in this thesis and literature data, factors that influence anaerobic
in situ bioremediation are discussed in the following section.
Factors affecting anaerobic in situ bioremediation
Although various studies have been performed to gain information on poss
ible anaerobic transformation reactions of aromatic hydrocarbons (see Introduction)
little is known about the microorganisms. The anaerobic degradation of aromatic
compounds with a functional group, like phenol and cresol, has been demonstrated
in several laboratory experiments and successful field bioremediation processes
have been developed (20, 41). Knowledge on the degradation of non-oxygenated
aromatic hydrocarbons is emerging only since the last few years (15, 17, 34), and
almost nothing is known about the occurrence of anaerobic transformations at
contaminated sites. Only a few in situ bioremediation studies with BTEX as pollu
tants and nitrate as electron acceptor are in progress (20, 33, 41).
Microorganisms do not always degrade a compound directly upon exposure,
but often a lag-phase can be seen. During this lag-phase the compound seems to be
108
General discussion
inert. Several mechanisms have been proposed to explain this phenomenon, includ
ing enzyme induction, growth of a degrading population, and genetic changes
resulting in new metabolic pathways (23, 26). Adaptation may involve cooperative
or symbiotic relationships of microorganisms in the degradation of a compound,
and occurs not only within single microbial populations but also amongst diverse
microbial populations. Adaptation was demonstrated in a study with sediment from
San Diego Bay, California, USA. Naphthalene and phenanthrene were oxidized to
carbon dioxide in sediments that were heavily contaminated with PAHs (33 mg/kg
of sediment) within one month of incubation. In less contaminated sediments (4
mg/kg of sediment), mineralization had not started after 70 days of incubation (11).
Apparently, heavily contaminated sediments contained adapted bacteria that were
able to degrade the PAHs, whereas in the less contaminated sediments no adap
tation had occurred. The use of contaminated material as inoculum, in which the
microorganisms have been exposed to the pollutant for a long period of time, does
not automatically result in the degradation of the pollutant. We studied the possible
transformation of toluene, benzene, and naphthalene under different anaerobic
conditions in columns filled with sediment, contaminated with those compounds
(Chapter 2). The inoculum material contained aerobic and anaerobic microorgan
isms, with a history of exposure to these aromatics. We had expected that these
microorganisms had been adapted to the contaminants and to anaerobic conditions,
and that they could degrade them anaerobically. Immediate degradation was found
for toluene under all conditions tested, while naphthalene was only degraded in the
column amended with sulfate. After about 300 days, naphthalene also started to be
degraded in the columns amended with manganese and nitrate. In the time-course
of our experiments (350 to 500 days), microorganisms apparently have adapted to
naphthalene degradation. We never observed degradation of benzene in any of our
columns in the experimental period of 500 days, indicating that no microorganisms
were adapted to benzene degradation. Caldwell (10) found in a study with benzene-
contaminated sediment from various sites, both positive and negative results. Ben
zene degradation was demonstrated under methanogenic conditions with sediment
from a gasoline contaminated aquifer near Empire, Michigan, while no degradation
was found in sediment, originating from a landfill leachate impacted aquifer in
Norman, Oklahoma during 3 years of incubation. With the sediment from Empire,
109
Chapter 6
Michigan, and with sediment from a gasoline contaminated aquifer near Seal
Beach, California, degradation of benzene was also demonstrated under sulfate-
reducing conditions. No degradation was found with nitrate as electron acceptor
during 2 years of incubation of all of the above sediments (21). These experiments
demonstrate that microorganisms that degrade benzene in the absence of oxygen are
not ubiquitously present at contaminated sites. Before anaerobic in situ bioremed-
iation is chosen as a feasible technique, the presence of anaerobic benzene degra
ding microorganisms at that site must be demonstrated either in field experiments
or in laboratory tests.
Another prerequisite may be the presence of a primary growth substrate,
when the contaminant is degraded cometabolically. Since most aromatic hydrocar
bons can serve as sole carbon and energy source for bacteria, a primary substrate
may not be needed (Introduction). This was confirmed in the studies described in
chapter 4 and 5; our enrichment culture LET-13 was able to mineralize toluene
under manganese-reducing conditions without a primary growth substrate. Also
naphthalene was degraded without the addition of an other substrate in a sediment
column amended with sulfate (Chapter 2). Unfortunately, we were not able to
enrich for naphthalene degrading bacteria in batch experiments (Chapter 3). No en
richment was observed in the absence of a primary growth substrate, but the
addition of a primary growth substrate, such as acetate, lactate, or benzoate, did
not result in the degradation of naphthalene in batch cultures either. Aerobic fungi
are known to degrade aromatic hydrocarbons cometabolically (40). Such data do
not exist on anaerobic fungi.
The column studies that we performed on the biodégradation of specific
contaminants, took place under better conditions than can be expected in field situ
ations. The columns were continuously percolated with the contaminants. This
resulted in a saturation of the column material with the substrates, after which a
breakthrough of the aromatics was observed (Chapter 2 and 4). From this point on,
a certain concentration of contaminants remained in the aqueous phase, and should
have been available for microorganisms. Biodegradation rates in the field are often
much lower than found in laboratory-scale experiments. A limited bioavailability of
the contaminant may contribute to this finding. Bacterial substrate uptake occurs
mainly upon dissolution of the compound in the water phase (7). Most aromatic
110
General discussion
hydrocarbons, and especially the polycyclic ones, are poorly soluble in water and
may be present in so-called nonaqueous phase liquids (NAPLs). The degradation
rate of compounds present in a NAPL is much lower than when they are dissolved
in the aqueous phase, due to mass transfer limitations (1). Such a lower degrada
tion rate of naphthalene was demonstrated at a naphthalene contaminated site (16).
Aromatic hydrocarbons also tend to adsorb to soil particles, and desorption kinetics
will influence the degradation rate. In addition, hydrophobic aromatic pollutants
may form complexes with humic substances in the soil, which results in the forma
tion of irreversibly bound residues (6). Making the contaminant less susceptible for
microbial degradation. Finally, the contaminant can be present in micropores in the
soil, in which the microorganisms cannot penetrate. The rate of diffusion of the
compound towards the microorganisms will then strongly affect its rate of degrada
tion.
The bioavailability of pollutants decreases with the 'age' of pollution (18),
because of the chemical/physical interactions between the compounds and the
humic substances in the soil as previously described. As a result, the rate of degra
dation will decrease in time and residual concentrations may occur. These findings
suggest that bioremediation of a contaminated site might be more successful, when
the clean-up starts as soon as possible after the contamination has occurred.
Microbial growth and activity is dependent on characteristics like pH,
temperature, moisture and salinity. The temperature in the soil has a large effect on
the degradation rate. During bioremediation, changes in degradation rates can be
observed because of temperature changes in the soil during the seasons (1).
Furthermore, the temperature of the soil is often below the temperature optimum of
mesophilic bacteria and a low temperature of the soil is generally expected to have
a negative influence on the degradation rate. However, it has been demonstrated
that the degradation rate of toluene in a cold aquifer (5°C) was comparable with
the degradation rate at higher temperatures (20 °C) (9).
An important factor is the presence or delivery of the terminal electron
acceptor and nutrients (mainly nitrogen and phosphorous). In our study, the con
tinuous percolation of the columns with a balanced medium provided the microor
ganisms in the column with a constant supply of electron acceptor and nutrients.
However, under field conditions, the competition for electron acceptor and
111
Chapter 6
nutrients within the microbial population may limit the growth of the desired
microorganisms and may result in a slow contaminant removal. Another obstacle is
that electron acceptor and/or nutrients can be consumed by microorganisms, that
are not involved in the degradation of the contaminant, before they reach the
contaminated zone. A correct engineered delivery design should avoid this prob
lem. Additionally, electron acceptors can react with compounds in the soil to form
precipitates, e.g. metal sulfides. These precipitates can cause plugging of the soil,
or can already cause plugging in the injection wells (42).
The electron acceptors that are present or added to the soil determine which
types of microorganisms become dominant and consequently which degradation
pathways are possible. In many soils, different electron acceptors are heterogen-
eously distributed. The distribution of electron acceptors results in the presence of
various types of microorganisms in the soil that are heterogeneously distributed as
well. Theoretically, a sequence of redox-mediated reactions should occur when
more than one electron acceptor is available at a given site. The electron acceptor
that will provide the microorganisms with the largest energy for growth will be
used first (Introduction, Table 2). We did not observe this sequence in our experi
ments, because only one electron acceptor was added per column or batch, in stead
of a mixture of electron acceptors. However, we did observe a 6 times higher
degradation rate of toluene under manganese-reducing conditions than under
methanogenic conditions in batch experiments. This may be the result of the
difference in redox potential between the two electron acceptors. The use of a solid
electron acceptor like manganese or iron oxide may have an other advantage
besides its favourable redox potential. Upon being reduced, they can be reoxidized
and thereby returned to the sediments by precipitation, after which they can be
reused as electron acceptor. Since these manganese and iron cycles occur in many
sediments (28), they can in theory be used numerous times during bioremediation.
At low oxygen concentrations and in the presence of nitrate, it has been demon
strated that naphthalene is degraded with oxygenases as the first degrading enzymes
and nitrate as the ultimate electron acceptor (12, 46).
The importance of nutrient addition was demonstrated with our enrichment
culture LET-13 (Chapter 4). Sterile Rhine river sediment or its supernatant was
needed to maintain the toluene degrading activity of the culture in batches. We
112
General discussion
were not able to clarify which nutrients or trace elements were essential. Other
contaminant degrading organisms are also known for their need of a specific addi
tion. An anaerobic enrichment culture that dechlorinates PCBs needs the addition of
Rharitan river sediment or humic acids (5, 8).
The concentration of the contaminant is important for the microorganisms.
At high concentrations, toxic effects may occur. Toluene has been found to be
toxic at a concentration of 0.5 mM to the sulfate-reducing strain Tol2 (32), and at
1 mM to our manganese-reducing enrichment culture LET-13 (Chapter 5), and to
nitrate-reducing bacteria (2, 35). On the other hand, a low aqueous concentration
can be below the concentration that is needed for the induction of the necessary
enzymes.
The presence of mixtures of contaminants in the soil may influence the bio-
remediation rate. In laboratory-scale experiments, it was shown that in mixtures of
benzene, toluene, ethylbenzene, and xylenes, compounds were degraded sequen
tially (17). Toluene was the first to be degraded, followed by xylene and ethylben
zene, while benzene was found to be persistent. However, in incubations with ben
zene only, degradation of benzene did occur (13). Although we also used mixtures
of toluene, benzene and naphthalene in our column studies, we have never
observed this phenomenon (Chapter 2). Toluene was the first compound to be
degraded in all columns and omitting toluene did not result in the degradation of
the two other compounds. This suggests that benzene and naphthalene degrading
bacteria were not present. Degradation of naphthalene was also not observed in the
presence or absence of benzene in the nitrate-reducing column. At contaminated
sites, the contaminants are often present as mixtures. The degradability of a
compound, present in a mixture with other contaminants, might be different than
when the compounds are present as single contaminants.
Monitoring and evaluation of bioremediation
When all conditions and prerequisites for a successful in situ bioremediation
technique have been accomplished, the degradation processes need to be controlled
and evaluated to show and ensure that clean-up is taking place. Not all methods for
113
Chapter 6
demonstrating biodégradation in laboratory experiments can be used in field experi
ments (39) or are equally successful in laboratory and field experiments.
The use of 14C-labelled compounds is a common laboratory technique.
Measuring 14C02 provides usually the most reliable results, but is only usable when
the contaminant is completely mineralized. In our column studies, we could
demonstrate that [14C] naphthalene was mineralized by measuring the 14C02 produc
tion (Chapter 2). In field experiments, the capture of the produced 14C02 seems to
be impossible. In Denmark, an anaerobic continuous field injection experiment with
a radiolabelled compound has been performed. [14C]Benzene was injected in a
pollution plume, but no production of 14C02 could be measured (33). In the
Netherlands, governmental organizations would never allow this type of experi
ments with (volatile) radiolabelled compounds that are hazardous and difficult to
control.
Measuring the decrease in contaminant concentration gives an indication
whether the contaminant is degraded, but this is usually not reliable enough.
Artifacts, such as volatilization, off-site migration, adsorption to the soil, and other
abiotic losses, must be taken into account in these measurements. Knowledge of the
degradation pathway of a compound can be helpful. The pathway gives information
whether a compound is mineralized or transformed into less harmful or more toxic
compounds. Furthermore, the detection of intermediates can be used to monitor the
degradation of the contaminant. In a recent aerobic field experiment, the production
of l,2-dihydroxy-l,2-dihydronaphthalene, an intermediate in the aerobic degrada
tion of naphthalene, was used as evidence for a successful in situ bioremediation
(47).
Measuring a decrease in electron acceptor concentration does not necessarily
indicate that the contaminant is transformed. The added electron acceptor can be
used for the degradation of the contaminant, but other organic or inorganic carbon
compounds in the soil can also be oxidized with this electron acceptor. In addition,
it is difficult to measure a decrease in electron acceptor concentration, when solid
electron acceptors like iron and manganese oxide are used. Furthermore, the metals
may after reduction be reoxidized again. The possible cycling of electron acceptors
makes it difficult to use their decrease in concentration for the evaluation of
contaminant removal. The type of oxide formed after oxidation, determines its
114
General discussion
possible use as electron acceptor. A more amorphous form is reduced faster than a
more crystalline one, and consequently the rate of contaminant oxidation depends
on the type of metal oxide used. With amorphous metal oxides a higher degrada
tion rate can be achieved than with crystalline ones (24).
Demonstration of the growth of contaminant degrading bacteria on agar
plates will not be accurate either. Other organic material than the contaminant is
present at the polluted site, and may serve as growth substrate for bacteria that
grow on the plates. In addition, growth of bacteria on agar or impurities in the agar
is also possible (Chapter 3). A more conclusive method is the demonstration of
enzymes that are involved in the degradation of the compound. The presence and
number of genes, coding for these enzymes, can be demonstrated by extraction of
DNA from the site and the use of specific probes (14). For anaerobic degradation
however, little is known about the responsible enzymes, and more research is
needed before this method can be applied.
Knowledge about the success of degradation at field sites will often involve
uncertainties, because none of the methods described is alone reliable enough to
prove that bioremediation is occurring. For a good control, a combination of these
methods has to be used and the results need to be interpreted carefully. Only then
is it possible to evaluate whether an ongoing in situ bioremediation project is prog
ressing towards successful completion.
Concluding remarks
An effective in situ bioremediation depends on the presence of the appropri
ate microorganisms. Laboratory experiments with site-specific samples can be used
to demonstrate that degradation of a compound is possible at a particular site. One
should realize that the conditions in laboratory experiments will often differ from
those in the field, and that a decrease in contaminant concentration in the field has
to be shown to demonstrate that the bioremediation is successful.
The results from the manganese-reducing, toluene degrading bacterial culture
we enriched in this study, demonstrate that the bioremediation of toluene-contami
nated sites is in principle possible when manganese oxides are present. However,
115
Chapter 6
the required addition of complex compounds in laboratory experiments (e.g. sterile
Rhine river sediment), indicates that the enriched bacteria have a specific nutrition
need.
The naphthalene degrading activity that we observed in a sulfate-reducing
sediment column, could not be transferred to batches. This illustrates the diffi
culties one encounters when trying to isolate bacteria that anaerobically degrade
aromatic hydrocarbons.
The use of in situ bioremediation at a contaminated site must be based on
sufficient knowledge of the presence of the required microorganisms, the
contaminants, and the environmental conditions. At the moment, our knowledge on
microorganisms that can degrade aromatic hydrocarbons anaerobically and the
required conditions, is not sufficient to conclude that anaerobic in situ bioremed
iation of aromatic hydrocarbon contaminated sites can be successful (except for
toluene). Insight in the microbiology (e.g. responsible bacteria, involved enzymes,
enzyme regulation, degradation kinetics) is important to support the application of
such a microbial technique.
The few studies done at anaerobic, contaminated sites indicate that aromatic
hydrocarbons can be (partially) degraded anaerobically in nature, and that this
degradation may be significant. Additional laboratory and field studies must help to
establish the real potential of anaerobic microbial processes for the clean-up of
polluted sites.
REFERENCES
1. Alexander, M. 1994. Biodegradation and Bioremediation. Academic Press, San Diego. 2. Altenschmidt, U. and G. Fuchs. 1991. Anaerobic degradation of toluene in denitrifying
Pseudomonas sp.: indication for toluene methylhydroxylation and benzoyl-CoA as central aromatic intermediate. Arch. Microbiol. 156:152-158.
3. Alvarez-Cohen, L. 1993. Engineering challenges of implementing in situ bioremediation, p. 136-152. In National Research Council (eds.), In situ Bioremediation. When does it work, National Academy Press, Washington, D.C.
4. Anid, P. J., B. P. Ravest-Webster and T. M. Vogel. 1993. Effects of hydrogen peroxide on the biodégradation of PCBs in anaerobically dechlorinated river sediments. Biodegradation 4:241-248.
116
General discussion
5. Blake, C. K. and H. D. May. 1992. Anaerobic PCB-dechlorination in the absence of river sediment, p. 340. In Abstracts 92'"1 General Meeting ASM, American Society for Microbiology, Washington, D.C.
6. Bosma, T. N. P. 1994. Simulation of subsurface biotransformation. PhD-thesis Wageningen Agricultural University, The Netherlands.
7. Bouwer, E. J. and A. J. B. Zehnder. 1993. Bioremediation of organic compounds -putting microbial metabolism to work. Trends in Biotechnology 11:360-367.
8. Boyle, A. W., C. K. Blake, W. A. Price and H. D. May. 1993. Effects of polychlorinated biphenyl congener concentration and sediment supplementation on rates of methanogenesis and 2,3,6-trichlorobiphenyl dechlorination in an anaerobic enrichment. Appl. Environ. Microbiol. 59:3027-3031.
9. Bradley, P. M. and F. H. Chapelle. 1995. Rapid toluene mineralization by aquifer microorganisms at Adak, Alaska: implications for intrinsic bioremediation in cold environments. Environ. Sei. Technol. 29:2778-2781.
10. Caldwell, M. E. 1995. Personal communication. 11. Coates, J. D., R. T. Anderson and D. R. Lovley. 1996. Oxidation of polycyclic
aromatic hydrocarbons under sulfate-reducing conditions. Appl. Environ. Microbiol. 62:1099-1101.
12. Durant, N. D., C. A. A. Jonkers, L. P. Wilson and E. J. Bouwer. 1995. Enhanced biodégradation of naphthalene in MGP aquifer microcosms, p. 189-196. In R. E. Hinchee, J. T. Wilson and D. C. Downey (eds.), Intrinsic Bioremediation, Batelle Press, Columbus, Richland.
13. Edwards, E. A. and D. Grbic-Galic. 1992. Complete mineralization of benzene by aquifer microorganisms under strictly anaerobic conditions. Appl. Environ. Microbiol. 58:2663-2666.
14. Elsas, D. J. 1995. Extraction of microbial community DNA from soils, p. 1.3.3/1-1.3.3/11. In A. Akkermans, D. J. Elsas and F. de Bruijn (eds.), Molecular Microbial Ecology Manual.
15. Fuchs, G., M. E. S. Mohamed, U. Altenschmidt, J. Koch, A. Lack, R. Brackmann, C. Lochmeyer and B. Oswald. 1994. Biochemistry of anaerobic degradation of aromatic compounds, p. 513-553. In C. Ratledge (ed.), Biochemistry of Microbial Degradation, Kluwer Academic Publishers, Dordrecht.
16. Ghoshal, S., A. Ramaswami and R. G. Luthy. 1996. Biodegradation of naphthalene from coal tar and heptamethylnonane in mixed batchssytems. Environ. Sei. Technol. 30:1282-1291.
17. Grbic-Galic, D. 1990. Anaerobic microbial transformation of nonoxygenated aromatic and alicyclic compounds in soil, subsurface and freshwater sediments, p. 117-189. In J. M. Bollag and G. Stotzky (eds.). Soil Biochemistry and Microbiology, Marcel Dekker, Inc., New York.
18. Hatzinger, P. B. and M. Alexander. 1995. Effect of aging of chemicals in soil on their biodegradability and extractability. Environ. Sei. Technol. 29:537-545.
19. Hinchee, R. E., F. J. Brockinann and C. M. Vogel. 1995. Microbial Processes for Bioremediation. Batelle Press, Columbus, Richmond.
20. Hinchee, R. E., R. N. Miller and P. C. Johnson. 1995. In Situ Aeration: Air Sparging, Bioventing, and Related Bioremediation Processes, Batelle Press, Columbus, Richmond.
21 Kazunii, J., M. E. Caldwell, J. M. Suflita, D. R. Lovley and L. Y. Young. 1996. Anaerobic degradation of benzene in diverse anoxic environments. Environ. Sei. Technol. submitted.
117
Chapter 6
22. Kleijntjens, R. H. 1991. Biotechnological slurry process for the decontamination of excavated polluted soils. PhD-thesis Technical University Delft, The Netherlands.
23. Liu, S. and J. M. Suflita. 1993. Ecology and evolution of microbial populations for bioremediation. Trends in Biotechnology 11:344-352.
24. Lovley, D. R. 1991. Dissimilatory Fe(III) and Mn(IV) reduction. Microbiol. Rev. 55:259-287.
25. Lovley, D. R., J. C. Woodward and F. H. Chapelle. 1994. Stimulated anoxic biodégradation of aromatic hydrocarbons using Fe(III) ligands. Nature 370:128-131.
26. van der Meer, J. R. 1992. Molecular mechanisms of adaptation of soil bacteria to chlorinated benzenes. PhD-thesis Wageningen Agricultural University, The Netherlands.
27. Morgan, P. and R. J. Watkinson. 1989. Hydrocarbon degradation in soils and methods for soil biotreatment. Crit. Rev. Biotechnol. 8:303-333.
28. Nealson, K. H. and C. R. Myers. 1992. Microbial reduction of manganese and iron -New approaches to carbon cycling. Appl. Environ. Microbiol. 58:439-443.
29. National Research Council. 1993. In situ Bioremediation. When does it work. National Academy Press, Washington, D.C.
30. Pardieck, D. L., E. J. Bouwer and A. T. Stone. 1992. Hydrogen peroxide use to increase oxidant capacity for in situ bioremediation of contaminated soils and aquifers - A review. J. Contamin. Hydrol. 9:221-242.
31. Pritchard, P. H. and C. F. Costa. 1991. EPA's Alaska oil spill bioremediation project. Environ. Sei. Technol. 25:372-379.
32. Rabus, R., R. Nordhaus, W. Ludwig and F. Widdel. 1993. Complete oxidation of toluene under strictly anoxic conditions by a new sulfate-reducing bacterium. Appl. Environ. Microbiol. 59:1444-1451.
33. Rügge, K., P. L. Bjerg, H. Mosbaek and T. H. Christensen. 1995. Natural attenuation of xenobiotic compounds: anaerobic field injection experiment, p. 127-133. In R. E. Hinchee , J. T. Wilson and D. C. Downey (eds.), Intrinsic Bioremediation, Batelle Press, Columbus, Richland.
34. Schink, B., A. Brune and S. Schnell. 1992. Anaerobic degradation of aromatic compounds, p. 219-242. In G. Winkelmann (ed.), Microbial Degradation of Natural Products, VCH, Weinheim, New York, Basel, Cambridge.
35. Schocher, R. J., B. Seyfried, F. Vazquez and J. Zeyer. 1991. Anaerobic degradation of toluene by pure cultures of denitrifying bacteria. Arch. Microbiol. 157:7-12.
36. Sims, J. L., R. C. Sims and J. E. Matthews. 1990. Approach to bioremediation of contaminated soil. Hazard. Waste Hazard. Mater. 7:117-149.
37. Sims, R. C. 1990. Soil remediation techniques at uncontrolled hazardous waste sites. A critical review. Journal of the Air and Waste Management Association 40:704-732.
38. Spain, J. C , J. D. Milligan, D. C. Downey and J. K. Slaughter. 1989. Excessive bacterial decomposition of hydrogen peroxide during enhanced biodégradation. Ground Water 27:163-167.
39. Sturman, P. J., P. S. Stewart, A. B. Cunningham, E. J. Bouwer and J. H. Wolfram. 1995. Engineering scale-up of in situ bioremediation processes: a review. J. Contamin. Hydrol. 19:171-203.
40. Sutherland, J. B. 1992. Detoxification of polycyclic aromatic hydrocarbons by fungi. J. Ind. Microbiol. 9:53-62.
41. Sweed, H. G., P. B. Bedient and S. R. Hutchins. 1996. Surface application system for in situ ground-water bioremediation: site characterization and modeling. Ground Water 34:211-222.
42. TAUW and de Zon Brabant, The Netherlands. 1996. Personal communication.
118
General discussion
43. Vogel, T. M. 1996. Bioaugmentataion as a soil bioremediation approach. Current Opinion in Biotechnology 7:311-316.
44. Volkering, F., A. M. Breure, J. G. van Andel and W. H. Rulkens. 1995. Influence of nonionic surfactants on bioavailability and biodégradation of polycyclic aromatic hydrocarbons. Appl. Environ. Microbiol. 61:1699-1705.
45. Wilson, J. T. and C. H. Ward. 1987. Opportunities for bioreclamation of aquifers contaminated with petroleum hydrocarbons. Dev. Ind. microbiol. 27:109-116.
46. Wilson, L. P., N. D. Durant and E. J. Bouwer. 1995. Aromatic hydrocarbon transformation under mixed oxygen/nitrate electron acceptor conditions, p. 137-144. In R. E. Hinchee , J. T. Wilson and D. C. Downey (eds.), Microbial Processes for Bioremediation, Batelle Press, Columbus, Richland.
47. Wilson, M. S. and E. L. Madsen. 1996. Field extraction of a transient intermediary metabolite indicative of real time in situ naphthalene biodégradation. Environ. Sei. Technol. 30:2099-2103.
48. Wilson, S. C. and K. C. Jones. 1993. Bioremediation of soil contaminated with polynuclear aromatic hydrocarbons (PAHs) - a review. Environ. Poll. 81:229-249.
119
Summary
Aromatic hydrocarbons are widespread in nature, due to increasing industrial
activity, and often contribute to polluted soils, sediments, and groundwater. Most
of these compounds are toxic at relatively high concentrations, but some are
already carcinogenic at very low concentrations, e.g. benzene. A growing aware
ness of the health risks associated with contamination has directed research to the
removal or degradation of such compounds. The use of microorganisms to degrade
toxic compounds (bioremediation) is a relatively slow process compared to
traditional, chemical methods, but it is a natural process, mostly very specific and
low in costs. A review of the available information on the microbial degradation of
aromatic compounds is given in chapter 1. The anaerobic degradation is empha
sized, since in many polluted environments oxygen is limiting and anaerobic
processes will prevail. In the absence of oxygen, compounds like nitrate, metal-
ions (Fe3+ and Mn4+), sulfate, and carbondioxide, have taken over the function of
oxygen as a terminal electron acceptor. In addition, the first transformation
reactions differ from those in aerobic processes. Oxygenases are no longer
functioning and the degradation of oxygenated aromatic compounds, like benzoate
and phenol, is known to occur via e.g. reduction, dehydroxylation and
dehydrogenation of the aromatic ring. Information on the anaerobic degradation of
mono- and polycyclic aromatic hydrocarbons without functional groups, like
toluene, benzene, and naphthalene, is scarse. To gain more insight in the possibil
ities and limitations of the anaerobic degradation of these aromatic compounds,
their behaviour in anaerobic sediment columns was followed. Toluene, benzene,
and naphthalene were chosen as model compounds under methanogenic, sulfate-,
iron-, manganese-, and nitrate-reducing conditions (Chapter 2). Toluene was
transformed readily (within 1 to 2 months), while benzene was recalcitrant over the
test period of 375-525 days under all redox conditions tested. Naphthalene was
partly transformed in the column with nitrate or manganese as electron acceptor
present; the addition of benzoate had a positive effect on the degradation of
121
naphthalene in the column with nitrate. In the column with sulfate, the majority of
the added naphthalene disappeared. No effect on the degradation of naphthalene
was observed after adding and omitting an easier degradable substrate. [14C]naph
thalene was used to confirm the disappearance to be the result of degradation; two
third of the naphthalene was converted to C02.
Numerous attempts have been made for further enrichment of sulfate-
reducing, naphthalene degrading bacteria (Chapter 3). Unfortunately, the observed
degradation of naphthalene in a sediment column could not be obtained in batch
cultures, despite the large variety of tested enrichment conditions (different
naphthalene concentrations, inoculum size, medium composition, extra additions
etc.). A toxic effect of naphthalene on sulfate-reducing bacteria could not be found.
Toluene degradation in the columns was demonstrated under all redox
conditions tested. Chapter 4 describes the degradation of toluene in freshly started
sediment columns, to which either amorphous or highly crystalline manganese
oxide had been added. In batch experiments with material from these columns as
inoculum, the degradation of toluene to C02 and the formation of biomass under
manganese-reducing conditions was demonstrated. The oxidation of toluene was
found to be coupled to the reduction of Mn(IV), and the rate of oxidation was
found to be lower with the crystalline than with the amorphous manganese oxide.
Upon successive transfers of the enrichment cultures, the toluene degrading activity
would decrease in time. The activity could only be maintained in the presence of
sterilized Rhine river sediment or its supernatant. Without the sediment, but in the
presence of solids like teflon beads, glass beads, bentonite, vermiculite and
sterilized granular sludge, the toluene degrading activity completely disappeared
after 4 to 5 transfers. Furthermore, a direct contact between the bacteria and the
manganese oxide was found to be advantageous for a rapid toluene degradation.
The degradation rate could further be increased by adding organic ligands such as
oxalic acid or nitrilotriacetic acid (NTA).
The highly purified enrichment culture LET-13, which degrades toluene with
manganese oxide as electron acceptor, was obtained via repeated dilution series,
and is described and characterized in chapter 5. LET-13 was able to degrade a
variety of substituted monoaromatic compounds like (p-hydroxy) benzylalcohol, (p-
hydroxy) benzaldehyde, (/»-hydroxy) benzoate, cresol, and phenol. Benzene,
ethylbenzene, xylene and naphthalene were not degraded under the experimental
122
conditions used. The degradation of toluene occurred via hydroxylation of the
methyl group to benzoate, and a possible side reaction can lead to the formation of
cresol.
All organisms in the culture look similar; motile rods which are gram nega
tive, oxidase negative and catalase negative. The culture was partly identified with
phylogenetic analysis of cloned rDNA sequences. The phylogenetic analysis
showed that at least two major groups of bacteria are present. One group of
bacteria belongs to the Bactewides-Cytophaga group, and one group consists of
members of the ß-subclass of the Proteobacteria.
Finally, the results from this research are discussed in relation to their
relevance for soil bio remediation technologies.
123
Samenvatting
Aromatische koolwaterstoffen (zoals benzeen, ethylbenzeen, tolueen en
naftaleen) zijn schadelijke stoffen die in het milieu belanden als gevolg van
menselijke activiteiten. Ze vormen een belangrijke groep van verontreinigingen in
grond, grondwater en in (haven)slib. De meeste van deze vluchtige verbindingen
zijn pas toxisch, indien zij in een hoge concentratie voorkomen, maar enkele
verbindingen, zolas bijvoorbeeld benzeen, zijn in een lage concentratie al kanker
verwekkend. Efficiënte reinigingstechnieken zijn dan ook zeer gewenst.
Eén techniek is de afbraak door micro-organismen (bioremediatie). Ondanks
het feit dat bioremediatie een relatief langzaam proces is, heeft het toch voordelen
boven fysisch/chemische technieken. Het is een natuurlijk proces en tast de
eigenschappen van de te reinigen bodems, die niet hoeven te worden verwijderd,
nauwelijks aan. Een overzicht van het gedane onderzoek naar de microbiële afbraak
van aromaten staat beschreven in hoofdstuk 1. Het benadrukt voornamelijk
anaërobe afbraakprocessen, alhoewel het meeste onderzoek tot nu toe gericht is
geweest op aërobe omzettingsreacties. Bij aërobe omzettingen treedt moleculaire
zuurstof niet alleen op als elektronenacceptor, maar wordt het ook in de aromati
sche ring ingebouwd m.b.v. mono- en dioxygenäse enzymen. Veel is inmiddels
bekend over dit soort reacties en een groot aantal bacteriën, dat aromatische
koolwaterstoffen volledig kan afbreken, is geïsoleerd. Een probleem dat in veel
verontreinigingssituaties optreedt, is een gebrek aan zuurstof. Dit heeft tot gevolg
dat aërobe micro-organismen niet meer actief zijn en dat alleen anaërobe afbraak
kan plaatsvinden.
Anaërobe micro-organismen, waarbij zuurstof niet als elektronenacceptor
fungeert, gebruiken elektronenacceptoren zoals nitraat, sommige metalen (Fe3+,
Mn4+), sulfaat en kooldioxide. Tevens gebruiken zij andere enzymen dan oxyge
nases voor de eerste omzettingsreacties. Voor aromaten met een zuurstofhoudende
zijgroep (zoals benzoaat en fenol) zijn omzettingsreacties zoals reductie van de
aromatische ring, dehydroxylering en dehydrogenering bekend. Kennis over de
125
anaërobe omzettingsreacties van enkel- en meervoudige ringverbindingen zonder
functionele groepen is echter nog schaars.
In dit proefschrift staan experimenten beschreven, die zijn uitgevoerd om
meer inzicht te krijgen in de mogelijkheden en de limitaties van de anaërobe
afbraak van aromatische koolwaterstoffen. In hoofdstuk 2 staan experimenten met
anaërobe, continue doorstroomde sedimentkolommen beschreven. Tolueen, benzeen
en naftaleen zijn hierbij gekozen als modelstoffen en het gedrag van deze verbin
dingen in de kolommen onder vijf verschillende redoxcondities (methanogene,
sulfaat-, ijzer-, mangaan- en nitraatreducerende condities) is in de tijd gevolgd.
Tolueen werd relatief snel afgebroken (binnen 1 tot 2 maanden) onder alle
onderzochte condities. Benzeen werd gedurende het onderzoek in een periode van
375 tot 525 dagen in geen enkele van de vijf kolommen afgebroken. In de kolom
men met nitraat of mangaanoxide als elektronenacceptor werd naftaleen gedeeltelijk
afgebroken. De toevoeging van benzoaat in de kolom met nitraat kan hierbij een
positieve invloed hebben gehad. Onder sulfaatreducerende condities werd naftaleen
volledig afgebroken. De toevoeging van een makkelijker afbreekbare verbinding
had hierbij geen positief of negatief effect op de afbraak. Met radioactief naftaleen
is in een andere sedimentkolom aangetoond dat naftaleen voor ongeveer 60 % werd
omgezet naar C02.
Nadat de afbraak van naftaleen in een sulfaatreducerende kolom was
aangetoond, is materiaal van deze kolom gebruikt in batch-experimenten om
sulfaatreducerende, naftaleen afbrekende bacteriën op te hopen (Hoofdstuk 3). Om
onverklaarbare redenen is het echter niet gelukt om de afbraak van naftaleen ook in
batches te bewerkstelligen. Dit ondanks de grote variatie in de geteste condities
(verschillende concentraties naftaleen, verschillende hoeveelheden entmateriaal,
mediumsamenstelling, toevoegingen zoals extra kolommateriaal, Rijnsediment
enz.). Een eventueel effect van naftaleen op de groei van een aantal sulfaatreduce
rende bacteriën is getest bij verschillende naftaleen concentraties, maar de aanwe
zigheid van naftaleen bleek geen invloed te hebben op de groeisnelheid van deze
bacteriën.
Zoals in hoofdstuk 2 staat beschreven, was tolueen onder alle geteste
redoxcondities afbreekbaar. In hoofdstuk 4 worden vervolgexperimenten met
tolueen als substraat beschreven, waarbij alleen mangaanoxide als elektronen
acceptor is gebruikt. In nieuw opgestarte sedimentkolommen met kristallijn of
126
amorf mangaanoxide als elektronenacceptor, bleek er geen verschil in omzettings
snelheid van tolueen te zijn tussen de twee gebruikte mangaanoxiden. In batch-
experimenten met entmateriaal uit de kolom, bleek echter dat een meer amorfe
vorm van mangaanoxide als elektronenacceptor een snellere afbraak van tolueen gaf
dan een kristallijne vorm. In verdere experimenten met amorf mangaanoxide is de
afname van mangaanoxide (en de produktie van Mn2+) en de produktie van C02
aangetoond.
Na een aantal keren te hebben overgeënt, bleek de afbraak van tolueen
steeds langzamer te verlopen en uiteindelijk kwam deze na 4 à 5 generaties vrijwel
stil te liggen. De activiteit kon alleen worden herkregen door de toevoeging van
steriel Rijnsediment of het supernatant ervan. Andere toevoegingen zoals teflon- of
glasparels, bentoniet, vermiculiet of steriel korrelslib hadden geen van allen een
positieve invloed op de omzetting van tolueen. Verder is gebleken, dat een direct
contact tussen de bacteriën en het slecht oplosbare mangaanoxide de afbraak van
tolueen versnelde. Hetzelfde effect werd waargenomen als een chelerende verbin
ding, zoals oxaalzuur of NTA, aan het medium werd toegevoegd.
Na een groot aantal overentingen in vloeibaar medium is uiteindelijk de
ophopingscultuur LET-13 verkregen, waarvan eigenschappen en karakteristieken
staan beschreven in hoofdstuk 5. Een groot aantal aromatische verbindingen kan
dienst doen als koolstof- en energiebron voor LET-13, nl. (p-hydroxy) benzyl-
alcohol, (p-hydroxy) benzaldehyde, (p-hydroxy) benzoaat, cresol en fenol. Ben
zeen, ethylbenzeen, xyleen en naftaleen konden niet worden afgebroken. De
afbraakroute van tolueen is gedeeltelijk opgehelderd. Tolueen wordt afgebroken
door een methylhydroxylering via benzylalcohol en bezaldehyde naar benzoaat. De
ozetting tot cresol is ook aangetoond, maar dit is slechts een nevenreactie in LET-
13. De mangaanreducerende cultuur LET-13 bevat beweeglijke staafjes, van
ongeveer 1,5 /xm lengte, die gram-, oxidase- en katalase-negatief zijn. Met behulp
van moleculaire technieken is aangetoond dat LET-13 ten minste twee verschillende
groepen van bacteriën bevat. Eén van deze groepen bevat bacteriën die zijn in te
delen bij de Bacteroides-Cytophaga groep, en de andere groep bestaat uit bacteriën
die behoren bij de ß-subgroep van de Proteobacteriën.
In het laatste hoofdstuk van dit proefschrift worden de resultaten van dit
onderzoek gerelativeerd en bediscussieerd in het kader van een mogelijke toepas
sing voor bodemreinigingsprocessen.
127
Curriculum Vitae
Alette Langenhoff werd geboren op 14 september 1966. Na het behalen van
het VWO-diploma aan het Jacob Roelandslyceum in Boxtel, begon ze in 1984 met
de studie Levensmiddelentechnologie aan de Landbouwuniversiteit Wageningen.
Haar afstudeervakken waren Proceskunde en Industriële Microbiologie. Haar stages
heeft ze gevolgd bij achtereenvolgens het Instituut voor Biochemie en Biotech-
nolgie, Technische Universiteit Braunschweig, Duitsland en het CFTRI (Central
Food en Technology Research Institute) in Mysore, India. In augustus 1990 heeft
ze het doctoraalexamen behaald.
Na twee tijdelijke banen bij de secties Proceskunde en Industriële Microbio
logie van de vakgroep Levensmiddelentechnologie als resp. toegevoegd onder
zoeker en practicum assistent, is ze van februari 1991 tot januari 1996 aangesteld
geweest als assistent in opleiding (AIO) en toegevoegd onderzoeker bij de vakgroep
Microbiologie van de Landbouwuniversiteit Wageningen. Tijdens dit onderzoek is
ze werkzaam geweest aan de anaërobe afbraak van enkele aromatische verbin
dingen en de resultaten van dit onderzoek zijn beschreven in dit proefschrift.
Sinds 1 februari 1997 is zij werkzaam als onderzoeker bij het Department of
Chemical Engineering and Chemical Technology, Imperial College, Londen,
Engeland
129
List of Publications
Buitelaar, R.M., A.A.M. Langenhoff, R. Heidstra and J. Tramper. 1991.
Growth and thiofeneproduction by hairy root cultures of Tagetes patula in various
two-liquid-phase bioreactors. Enzyme Microbial Technology 13:487-494.
Groenewegen, P.E.J., P. Breeuwer, J.M.L.M. van Helvoort, A.A.M. Langenhoff, F.P. de Vries and J.A.M, de Bont. 1992. Novel degradative pathway of 4-
nitrobenzoate in Comamonas acidovorans NBA-10. Journal of General Microbiol
ogy. 138:1599-1605.
Langenhoff, A.A.M., A.J.B. Zehnder and G. Schraa. 1996. Anaerobic
transformation of toluene, benzene and naphthalene under various redox conditions
in sediment columns. Biodegradation 7:267-274.
Langenhoff, A.A.M., D.L. Brouwers-Ceiler, J.H.L. Engelberting, J.J. Quist, J.G.P.M. Wolkenfelt, A.J.B. Zehnder and G. Schraa. 1997. Microbial
reduction of manganese coupled to toluene oxidation. FEMS Microbiology Ecology
22:119-127.
Langenhoff, A.A.M., M. Briglia, I. Nijenhuis, N.C.G. Tan, A.J.B. Zehnder and G. Schraa. 1997. Characterization of a manganese-reducing, toluene degrad
ing enrichment culture. FEMS Microbiology Ecology submitted.
131
top related